ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast48g11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016655.1| Zea mays clone Contig488 mRNA sequence 466 e-128
2emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-l... 448 e-123
3gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial... 381 e-102
4dbj|AB026897.1| Triticum aestivum DNA, telomere sequence, isolat... 315 6e-83
5dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic D... 311 9e-82
6dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic D... 311 9e-82
7dbj|AK110001.1| Oryza sativa (japonica cultivar-group) cDNA clon... 311 9e-82
8dbj|AK063372.1| Oryza sativa (japonica cultivar-group) cDNA clon... 311 9e-82
9dbj|AK108972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 309 3e-81
10dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clon... 303 2e-79
11gb|AF375551.1| Oryza glaberrima clone 1-6 25S ribosomal RNA gene... 295 5e-77
12gb|AF375550.1| Oryza glaberrima clone 1-28 25S ribosomal RNA gen... 295 5e-77
13dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 5e-77
14dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 3e-75
15gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene 274 2e-70
16gb|AF363914.1| Oryza minuta clone 2-3 25S ribosomal RNA gene, pa... 254 2e-64
17gb|AF466388.1| Centrolepis strigosa 26S ribosomal RNA gene, part... 236 4e-59
18gb|AF466385.1| Kingia australis 26S ribosomal RNA gene, partial ... 236 4e-59
19gb|AF466384.1| Dasypogon bromeliifolius 26S ribosomal RNA gene, ... 236 4e-59
20gb|AF363898.1| Oryza malampuzhaensis clone 10-31 25S ribosomal R... 234 2e-58
21gb|AF363899.1| Oryza malampuzhaensis clone 10-8 25S ribosomal RN... 232 6e-58
22dbj|AK063660.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 6e-55
23dbj|AK061754.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 6e-55
24gb|AY079521.1| Calectasia cyanea 26S ribosomal RNA gene, partial... 220 2e-54
25gb|AF466387.1| Ecdeiocolea monostachya 26S ribosomal RNA gene, p... 216 4e-53
26gb|AF363895.1| Oryza ridleyi clone 8-16 25S ribosomal RNA gene, ... 214 2e-52
27gb|AF363894.1| Oryza ridleyi clone 8-15 25S ribosomal RNA gene, ... 214 2e-52
28gb|AF363890.1| Oryza longistaminata clone 4-4 25S ribosomal RNA ... 214 2e-52
29gb|AF363887.1| Oryza officinalis clone 9Nep-29 25S ribosomal RNA... 214 2e-52
30gb|AF363886.1| Oryza officinalis clone 9Nep-1 25S ribosomal RNA ... 214 2e-52
31gb|AF363885.1| Oryza officinalis clone 9Nep-9 25S ribosomal RNA ... 214 2e-52
32gb|AF363884.1| Oryza officinalis clone 9Nep-24 25S ribosomal RNA... 214 2e-52
33gb|AF363883.1| Oryza officinalis clone 9Nep-18 25S ribosomal RNA... 214 2e-52
34gb|AF363882.1| Oryza officinalis clone 9-14 25S ribosomal RNA ge... 214 2e-52
35gb|AF363881.1| Oryza officinalis clone 9-28 25S ribosomal RNA ge... 214 2e-52
36gb|AF363880.1| Oryza officinalis clone 9-12 25S ribosomal RNA ge... 214 2e-52
37gb|AF363918.1| Oryza officinalis clone 9-5 25S ribosomal RNA gen... 212 6e-52
38gb|AF363908.1| Oryza longistaminata clone 4-7 25S ribosomal RNA ... 212 6e-52
39dbj|AK105251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 6e-52
40gb|AF363872.1| Oryza nivara clone 15-34 25S ribosomal RNA gene, ... 208 9e-51
41gb|AF363871.1| Oryza australiensis clone 12-29 25S ribosomal RNA... 208 9e-51
42gb|AF363896.1| Oryza ridleyi clone 8-2 25S ribosomal RNA gene, p... 206 4e-50
43gb|AF363893.1| Oryza longistaminata clone 4-28 25S ribosomal RNA... 206 4e-50
44gb|AF363891.1| Oryza longistaminata clone 4-29 25S ribosomal RNA... 206 4e-50
45gb|AF363888.1| Oryza officinalis clone 9Nep-15 25S ribosomal RNA... 206 4e-50
46gb|AF466389.1| Anarthria humilis 26S ribosomal RNA gene, partial... 204 1e-49
47gb|AF363873.1| Oryza nivara clone 15-3 25S ribosomal RNA gene, p... 200 2e-48
48gb|AF363859.1| Oryza australiensis clone 12-23 25S ribosomal RNA... 200 2e-48
49gb|AF363857.1| Oryza nivara clone 15-4 25S ribosomal RNA gene, p... 200 2e-48
50gb|AF363892.1| Oryza granulata clone 16-3 25S ribosomal RNA gene... 198 9e-48
51gb|AF363889.1| Oryza officinalis clone 9Nep-5 25S ribosomal RNA ... 198 9e-48
52gb|AF363879.1| Oryza granulata clone 16-7 25S ribosomal RNA gene... 198 9e-48
53gb|AF363878.1| Oryza granulata clone 16-22 25S ribosomal RNA gen... 198 9e-48
54gb|AF363913.1| Oryza minuta clone 2-8 25S ribosomal RNA gene, pa... 196 4e-47
55gb|AF363912.1| Oryza minuta clone 2-12 25S ribosomal RNA gene, p... 196 4e-47
56gb|AF363910.1| Oryza minuta clone 2-25 25S ribosomal RNA gene, p... 196 4e-47
57gb|AF363920.1| Oryza latifolia clone 3-28 25S ribosomal RNA gene... 194 1e-46
58gb|AF363870.1| Oryza australiensis clone 12-1 25S ribosomal RNA ... 192 6e-46
59gb|AF363864.1| Oryza glaberrima clone 1-22 25S ribosomal RNA gen... 192 6e-46
60gb|AF363911.1| Oryza minuta clone 2-27 25S ribosomal RNA gene, p... 188 9e-45
61gb|AF363919.1| Oryza latifolia clone 3-10 25S ribosomal RNA gene... 186 3e-44
62dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 186 3e-44
63dbj|AP005527.3| Oryza sativa (japonica cultivar-group) genomic D... 186 3e-44
64gb|AF363923.1| Oryza latifolia clone 3-9 25S ribosomal RNA gene,... 184 1e-43
65gb|AF363921.1| Oryza latifolia clone 3-3 25S ribosomal RNA gene,... 184 1e-43
66gb|AF363876.1| Oryza glaberrima clone 1-29 25S ribosomal RNA gen... 184 1e-43
67gb|AF363875.1| Oryza punctata clone 5-27 25S ribosomal RNA gene,... 184 1e-43
68gb|AF363874.1| Oryza glaberrima clone 1-5 25S ribosomal RNA gene... 184 1e-43
69gb|AF363867.1| Oryza grandiglumis clone 14-7 25S ribosomal RNA g... 184 1e-43
70gb|AF363865.1| Oryza punctata clone 5-21 25S ribosomal RNA gene,... 184 1e-43
71gb|AF363863.1| Oryza punctata clone 5-13 25S ribosomal RNA gene,... 184 1e-43
72gb|AF363862.1| Oryza glaberrima clone 1-11 25S ribosomal RNA gen... 184 1e-43
73gb|AF363861.1| Oryza glaberrima clone 1-13 25S ribosomal RNA gen... 184 1e-43
74gb|AF363860.1| Oryza alta clone 11-31 25S ribosomal RNA gene, pa... 184 1e-43
75gb|AF363858.1| Oryza nivara clone 15-18 25S ribosomal RNA gene, ... 184 1e-43
76gb|AF363847.1| Oryza rufipogon clone 7-7 25S ribosomal RNA gene,... 184 1e-43
77gb|AF363846.1| Oryza rufipogon clone 7-18 25S ribosomal RNA gene... 184 1e-43
78gb|AF486829.1| Restio tetraphyllus 26S ribosomal RNA gene, parti... 182 5e-43
79gb|AF363904.1| Oryza rhizomatis clone 13-21 25S ribosomal RNA ge... 180 2e-42
80gb|AF363922.1| Oryza latifolia clone 3-5 25S ribosomal RNA gene,... 178 8e-42
81gb|AF363877.1| Oryza ridleyi clone 8-12 25S ribosomal RNA gene, ... 178 8e-42
82gb|BT016328.1| Zea mays clone Contig161 mRNA sequence 178 8e-42
83gb|AF363869.1| Oryza malampuzhaensis clone 10-49 25S ribosomal R... 176 3e-41
84gb|AF363868.1| Oryza rufipogon clone 7-9 25S ribosomal RNA gene,... 176 3e-41
85gb|AF363866.1| Oryza glaberrima clone 1-20 25S ribosomal RNA gen... 176 3e-41
86gb|AF363856.1| Oryza rufipogon clone 7-19 25S ribosomal RNA gene... 176 3e-41
87gb|AF363855.1| Oryza malampuzhaensis clone 10-55 25S ribosomal R... 176 3e-41
88gb|AF363854.1| Oryza grandiglumis clone 14-14 25S ribosomal RNA ... 176 3e-41
89gb|AF363853.1| Oryza malampuzhaensis clone 10-21 25S ribosomal R... 176 3e-41
90gb|AF363850.1| Oryza rufipogon clone 7-20 25S ribosomal RNA gene... 176 3e-41
91gb|AF363849.1| Oryza rufipogon clone 7-30 25S ribosomal RNA gene... 176 3e-41
92gb|AF363848.1| Oryza rufipogon clone 7-22 25S ribosomal RNA gene... 176 3e-41
93gb|AF363845.1| Oryza sativa subsp. indica clone IR36-16 25S ribo... 176 3e-41
94gb|AF363844.1| Oryza sativa subsp. indica clone IR36-2 25S ribos... 176 3e-41
95gb|AF363843.1| Oryza sativa subsp. indica clone IR36-10 25S ribo... 176 3e-41
96gb|AF363842.1| Oryza sativa subsp. indica clone IR36-13 25S ribo... 176 3e-41
97gb|AF363841.1| Oryza officinalis clone 9Nep-31 25S ribosomal RNA... 176 3e-41
98gb|AF363840.1| Oryza latifolia clone 6-79 25S ribosomal RNA gene... 176 3e-41
99gb|AF363839.1| Oryza grandiglumis clone 14-17 25S ribosomal RNA ... 176 3e-41
100gb|AF363838.1| Oryza latifolia clone 6-61 25S ribosomal RNA gene... 176 3e-41
101gb|AF363837.1| Oryza latifolia clone 6-27 25S ribosomal RNA gene... 176 3e-41
102gb|AF363836.1| Oryza sativa subsp. indica clone IR36-9 25S ribos... 176 3e-41
103gb|AF363835.1| Oryza latifolia clone 6-6 25S ribosomal RNA gene,... 176 3e-41
104gb|AF363852.1| Oryza grandiglumis clone 14-16 25S ribosomal RNA ... 170 2e-39
105gb|AF363851.1| Oryza grandiglumis clone 14-11 25S ribosomal RNA ... 170 2e-39
106gb|AF205520.1|AF205520 Juncus effusus 26S ribosomal RNA gene, pa... 170 2e-39
107gb|AF205518.1|AF205518 Rhynchospora latifolia 26S ribosomal RNA ... 168 8e-39
108gb|AF363909.1| Oryza longistaminata clone 4-2 25S ribosomal RNA ... 167 3e-38
109gb|AF363907.1| Oryza longistaminata clone 4-5 25S ribosomal RNA ... 167 3e-38
110gb|AF363906.1| Oryza rhizomatis clone 13-22 25S ribosomal RNA ge... 167 3e-38
111dbj|AK110180.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 3e-38
112gb|AF363902.1| Oryza officinalis clone 9-8 25S ribosomal RNA gen... 165 1e-37
113gb|AF363901.1| Oryza rhizomatis clone 13-14 25S ribosomal RNA ge... 165 1e-37
114gb|AF363917.1| Oryza australiensis clone 12-17 25S ribosomal RNA... 161 2e-36
115gb|AF363916.1| Oryza granulata clone 16-4 25S ribosomal RNA gene... 161 2e-36
116gb|AF363915.1| Oryza granulata clone 16-18 25S ribosomal RNA gen... 161 2e-36
117gb|AY079520.1| Typha domingensis 26S ribosomal RNA gene, partial... 155 1e-34
118gb|AF466386.1| Xyris laxifolia var. iridifolia 26S ribosomal RNA... 155 1e-34
119gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partia... 155 1e-34
120gb|AF290584.1|AF290584 Asphodeline lutea 26S ribosomal RNA gene,... 155 1e-34
121gb|AF290587.1|AF290587 Anigozanthos flavidus 26S ribosomal RNA g... 153 5e-34
122gb|AF205128.1|AF205128 Trillium gracilie 26S ribosomal RNA gene,... 153 5e-34
123gb|AF293852.1|AF293852 Smilax bona-nox internal transcribed spac... 151 2e-33
124gb|AF262003.1|AF262003 Sparattanthelium septentrionale 26S ribos... 151 2e-33
125gb|AF290588.1|AF290588 Trachycarpus fortunei 26S ribosomal RNA g... 147 3e-32
126gb|AF290585.1|AF290585 Hypoxis hirsuta 26S ribosomal RNA gene, p... 147 3e-32
127gb|AF203679.1|AF203679 Acorus calamus 26S ribosomal RNA gene, pa... 147 3e-32
128dbj|AK105535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 3e-32
129gb|AF205878.1|AF205878 Xerophyta retinervis 26S ribosomal RNA ge... 145 1e-31
130gb|AF203684.1|AF203684 Hypoxis hirsuta 26S ribosomal RNA gene, p... 145 1e-31
131gb|AF331971.1| Colchicum autumnale 26S ribosomal RNA gene, parti... 145 1e-31
132gb|AF205521.1|AF205521 Canna flaccida 26S ribosomal RNA gene, pa... 143 5e-31
133gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA ... 143 5e-31
134gb|U52604.1|JDU52604 Jeffersonia diphylla nuclear 26S ribosomal ... 143 5e-31
135gb|AY968422.1| Tetrameles nudiflora 26S ribosomal RNA gene, part... 141 2e-30
136gb|AF205517.1|AF205517 Pontederia cordata 26S ribosomal RNA gene... 141 2e-30
137gb|AF203678.1|AF203678 Arisaema triphyllum 26S ribosomal RNA gen... 141 2e-30
138gb|AF290586.1|AF290586 Alstroemeria pulchra 26S ribosomal RNA ge... 139 7e-30
139gb|AF205123.1|AF205123 Dioscorea macrostachya 26S ribosomal RNA ... 139 7e-30
140gb|AF203685.1|AF203685 Alophia drummondii 26S ribosomal RNA gene... 139 7e-30
141gb|AF203683.1|AF203683 Asparagus officinalis 26S ribosomal RNA g... 139 7e-30
142gb|AF331972.1| Musa x paradisiaca 26S ribosomal RNA gene, partia... 139 7e-30
143gb|AF205519.1|AF205519 Philydrum lanuginosum 26S ribosomal RNA g... 137 3e-29
144gb|AF205516.1|AF205516 Commelina virginica 26S ribosomal RNA gen... 137 3e-29
145gb|AY292915.1| Triglochin sp. YLQ-2003 26S ribosomal RNA gene, p... 135 1e-28
146gb|AY292901.1| Nuphar sp. YLQ-2003 26S ribosomal RNA gene, parti... 135 1e-28
147gb|DQ008660.1| Nuphar sp. Qiu M114 26S ribosomal RNA gene, parti... 135 1e-28
148gb|DQ008650.1| Triglochin maritimum 26S ribosomal RNA gene, part... 135 1e-28
149gb|AY968419.1| Octomeles sumatrana 26S ribosomal RNA gene, parti... 133 4e-28
150gb|U52629.1|CAU52629 Cimicifuga americana nuclear 26S ribosomal ... 133 4e-28
151gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial se... 131 2e-27
152gb|AF293855.1|AF293855 Mayaca fluviatilis internal transcribed s... 131 2e-27
153gb|AF205514.1|AF205514 Corsia sp. Neyland 1834 26S ribosomal RNA... 131 2e-27
154gb|AY686767.1| Boehmeria nivea voucher G. Weiblen 1214 (MIN) 26S... 129 7e-27
155gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete ... 129 7e-27
156gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, parti... 129 7e-27
157gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial s... 129 7e-27
158gb|AY095456.1| Ceratophyllum demersum 26S ribosomal RNA gene, pa... 129 7e-27
159gb|AY292904.1| Ceratophyllum demersum 26S ribosomal RNA gene, pa... 129 7e-27
160gb|AY954473.1| Aconitum racemulosum 26S ribosomal RNA gene, part... 129 7e-27
161gb|AF290583.1|AF290583 Anthericum ramosum 26S ribosomal RNA gene... 129 7e-27
162gb|AF205127.1|AF205127 Melanthium virginicum 26S ribosomal RNA g... 129 7e-27
163gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, part... 129 7e-27
164gb|AF297532.1|AF297532 Cornus florida 26S ribosomal RNA gene, pa... 129 7e-27
165gb|DQ008622.1| Ceratophyllum submersum 26S ribosomal RNA gene, p... 129 7e-27
166gb|AF479228.1| Ceratophyllum demersum 26S ribosomal RNA gene, co... 129 7e-27
167gb|U90699.1|CLU90699 Cunninghamia lanceolata 28S ribosomal RNA g... 129 7e-27
168gb|AF364029.1| Campynema linearis 26S large subunit ribosomal RN... 129 7e-27
169gb|U52626.1|CAU52626 Consolida ambigua nuclear 26S ribosomal RNA... 129 7e-27
170gb|AF363897.1| Oryza latifolia clone 6-80 25S ribosomal RNA gene... 127 3e-26
171gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, part... 127 3e-26
172gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, par... 127 3e-26
173gb|AY954469.1| Cimicifuga simplex 26S ribosomal RNA gene, partia... 127 3e-26
174gb|AY954467.1| Eranthis stellata 26S ribosomal RNA gene, partial... 127 3e-26
175gb|AF274655.1| Myriophyllum exalbescens 26S ribosomal RNA gene, ... 127 3e-26
176gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, part... 127 3e-26
177gb|AF131288.1| Souliea vaginata 26S ribosomal RNA gene, partial ... 127 3e-26
178gb|AF262005.1|AF262005 Caryodaphnopsis bilocellata 26S ribosomal... 127 3e-26
179gb|U52628.1|AAU52628 Actaea alba nuclear 26S ribosomal RNA gene,... 127 3e-26
180gb|AY686836.1| Bagassa guianensis voucher G. Weiblen 1677 (MIN) ... 125 1e-25
181gb|AY686806.1| Trophis racemosa voucher G. Weiblen 1400 (MIN) 26... 125 1e-25
182gb|AF468133.1| Begonia sp. Forrest 177 26S large subunit ribosom... 125 1e-25
183gb|AF531249.1| Encephalartos arenarius 26S ribosomal RNA gene, p... 125 1e-25
184gb|AY954478.1| Enemion raddeanum 26S ribosomal RNA gene, partial... 125 1e-25
185gb|AY056513.1| Taxus baccata 26S ribosomal RNA gene, partial seq... 125 1e-25
186gb|AY056505.1| Thujopsis dolabrata 26S ribosomal RNA gene, parti... 125 1e-25
187gb|AY056480.1| Bowenia serrulata 26S ribosomal RNA gene, partial... 125 1e-25
188gb|DQ008652.1| Orontium aquaticum 26S ribosomal RNA gene, partia... 125 1e-25
189gb|U90678.1|ELU90678 Encephalartos lebomboensis 28S ribosomal RN... 125 1e-25
190gb|U52609.1|EBU52609 Enemion biternatum nuclear 26S ribosomal RN... 125 1e-25
191gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete... 123 4e-25
192gb|AY079519.1| Eriocaulon decangulare 26S ribosomal RNA gene, pa... 123 4e-25
193gb|AY095452.1| Austrobaileya scandens 26S ribosomal RNA gene, pa... 123 4e-25
194gb|AY260033.1| Platycrater arguta 26S ribosomal RNA gene, comple... 123 4e-25
195gb|AY292914.1| Alisma sp. YLQ-2003 26S ribosomal RNA gene, parti... 123 4e-25
196gb|AY292886.1| Austrobaileya scandens 26S ribosomal RNA gene, pa... 123 4e-25
197gb|AY128173.1| Walsura tubulata 26S ribosomal RNA gene, partial ... 123 4e-25
198gb|AF205515.1|AF205515 Wodyetia bifurcata 26S ribosomal RNA gene... 123 4e-25
199gb|AF203682.1|AF203682 Manfreda virginica 26S ribosomal RNA gene... 123 4e-25
200gb|AF203680.1|AF203680 Sagittaria graminea 26S ribosomal RNA gen... 123 4e-25
201gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, ... 123 4e-25
202gb|AF297536.1|AF297536 Cornus officinalis 26S ribosomal RNA gene... 123 4e-25
203gb|AF297535.1|AF297535 Cornus mas 26S ribosomal RNA gene, partia... 123 4e-25
204gb|DQ008651.1| Alisma plantago-aquatica 26S ribosomal RNA gene, ... 123 4e-25
205gb|AF479116.1| Krameria ixine 26S ribosomal RNA gene, complete s... 123 4e-25
206gb|AY248757.1| Cornus eydeana 26S ribosomal RNA gene, partial se... 123 4e-25
207gb|AF363900.1| Oryza ridleyi clone 8-13 25S ribosomal RNA gene, ... 121 2e-24
208gb|AY423102.1| Loxostigma sp. RBGE 19962309 26S ribosomal RNA ge... 121 2e-24
209gb|AF468124.1| Begonia thomeana 26S large subunit ribosomal RNA ... 121 2e-24
210gb|AY095475.1| Ginkgo biloba 26S ribosomal RNA gene, partial seq... 121 2e-24
211gb|AY095473.1| Spathiphyllum wallisii 26S ribosomal RNA gene, pa... 121 2e-24
212gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, par... 121 2e-24
213gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complet... 121 2e-24
214gb|AY292913.1| Spathiphyllum sp. YLQ-2003 26S ribosomal RNA gene... 121 2e-24
215gb|AY292902.1| Brasenia schreberi 26S ribosomal RNA gene, partia... 121 2e-24
216gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, par... 121 2e-24
217gb|AF293854.1|AF293854 Crinum americanum internal transcribed sp... 121 2e-24
218gb|AF203681.1|AF203681 Limnobium spongia 26S ribosomal RNA gene,... 121 2e-24
219gb|AY034045.1| Sequoiadendron giganteum 28S ribosomal RNA gene, ... 121 2e-24
220gb|AY034044.1| Metasequoia glyptostroboides 28S ribosomal RNA ge... 121 2e-24
221gb|AY034043.1| Glyptostrobus pensilis 28S ribosomal RNA gene, pa... 121 2e-24
222gb|AY034042.1| Athrotaxis selaginoides 28S ribosomal RNA gene, p... 121 2e-24
223gb|AY034041.1| Athrotaxis laxifolia 28S ribosomal RNA gene, part... 121 2e-24
224gb|AY034040.1| Athrotaxis cupressoides 28S ribosomal RNA gene, p... 121 2e-24
225gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene... 121 2e-24
226gb|AF479140.1| Capparis sandwichiana 26S ribosomal RNA gene, com... 121 2e-24
227gb|U90703.1|CJU90703 Cryptomeria japonica 28S ribosomal RNA gene... 121 2e-24
228gb|U90702.1|TDU90702 Taxodium distichum 28S ribosomal RNA gene, ... 121 2e-24
229gb|U90701.1|SSU90701 Sequoia sempervirens 28S ribosomal RNA gene... 121 2e-24
230gb|U90700.1|TCU90700 Taiwania cryptomerioides 28S ribosomal RNA ... 121 2e-24
231gb|U90698.1|SVU90698 Sciadopitys verticillata 28S ribosomal RNA ... 121 2e-24
232gb|U90697.1|CHU90697 Cephalotaxus harringtonia 28S ribosomal RNA... 121 2e-24
233gb|AF146533.1|AF146533 Phacelia hirsuta 26S ribosomal RNA gene, ... 121 2e-24
234gb|U52627.1|DEU52627 Delphinium exaltatum nuclear 26S ribosomal ... 121 2e-24
235gb|AY423094.1| Rhynchoglossum hologlossum isolate DNA-CW13 26S r... 119 7e-24
236gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 119 7e-24
237gb|AY095474.1| Tacca chantieri 26S ribosomal RNA gene, partial s... 119 7e-24
238gb|AY095459.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 119 7e-24
239gb|AF222353.1| Paxistima canbyi 26S ribosomal RNA gene, partial ... 119 7e-24
240gb|AF222352.1| Paxistima myrsinites 26S ribosomal RNA gene, part... 119 7e-24
241gb|AY292895.1| Peperomia sp. YLQ-2003 26S ribosomal RNA gene, pa... 119 7e-24
242gb|AY292880.1| Galbulimima sp. YLQ-2003 26S ribosomal RNA gene, ... 119 7e-24
243gb|AY128176.1| Ruta graveolens 26S ribosomal RNA gene, partial s... 119 7e-24
244gb|AF224693.1| Rhizophora racemosa 26S ribosomal RNA gene, parti... 119 7e-24
245gb|AF224692.1| Rhizophora mangle 26S ribosomal RNA gene, partial... 119 7e-24
246gb|AY935808.1| Bauera rubioides isolate 18 26S ribosomal RNA gen... 119 7e-24
247gb|AF479123.1| Androstachys johnsonii 26S ribosomal RNA gene, pa... 119 7e-24
248gb|AF148279.1|AF148279 Mitchella repens 26S ribosomal RNA gene, ... 119 7e-24
249gb|U52635.1|NDU52635 Nigella damascena nuclear 26S ribosomal RNA... 119 7e-24
250gb|U52632.1|CPU52632 Caltha palustris nuclear 26S ribosomal RNA ... 119 7e-24
251gb|AY686858.1| Antiaris toxicaria voucher G. Weiblen 1115 (MIN) ... 117 3e-23
252gb|AY686855.1| Trophis involucrata voucher G. Weiblen 1405 (MIN)... 117 3e-23
253gb|AY686850.1| Streblus smithii voucher G. Weiblen 1172 (MIN) 26... 117 3e-23
254gb|AY686837.1| Prainea papuana voucher N. Zerega 61 (NY) 26S rib... 117 3e-23
255gb|AY686807.1| Clarisia ilicifolia voucher S. R. Lowrie 487 (GH)... 117 3e-23
256gb|AY686803.1| Morus nigra voucher G. Weiblen 1207 (MIN) 26S rib... 117 3e-23
257gb|AY686795.1| Artocarpus altilis voucher G. Weiblen 1104 (MIN) ... 117 3e-23
258gb|AY968405.1| Combretocarpus rotundatus 26S ribosomal RNA gene,... 117 3e-23
259gb|AY968403.1| Begonia oxyloba 26S ribosomal RNA gene, partial s... 117 3e-23
260gb|AF389274.1| Osyris lanceolata 26S ribosomal RNA gene, partial... 117 3e-23
261gb|AF468118.1| Begonia meyeri-johannis 26S large subunit ribosom... 117 3e-23
262gb|AY095468.1| Saururus cernuus 26S ribosomal RNA gene, partial ... 117 3e-23
263gb|AY292897.1| Saururus sp. YLQ-2003 26S ribosomal RNA gene, par... 117 3e-23
264gb|AY954481.1| Aquilegia ecalcarata 26S ribosomal RNA gene, part... 117 3e-23
265gb|AY954480.1| Thalictrum javanicum 26S ribosomal RNA gene, part... 117 3e-23
266gb|AY954479.1| Dichocarpum sutchuenense 26S ribosomal RNA gene, ... 117 3e-23
267gb|AY954471.1| Trollius laxus 26S ribosomal RNA gene, partial se... 117 3e-23
268gb|AY056509.1| Picea asperata 26S ribosomal RNA gene, partial se... 117 3e-23
269gb|AF274641.1| Chrysosplenium iowense 26S ribosomal RNA gene, co... 117 3e-23
270gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial seq... 117 3e-23
271gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial ... 117 3e-23
272gb|AF270476.1|AF270476 Kubitzkia mezii 26S ribosomal RNA gene, p... 117 3e-23
273gb|U90711.1|NNU90711 Nymphaea nouchali 28S ribosomal RNA gene, p... 117 3e-23
274gb|AF131285.1| Megaleranthis saniculifolia 26S ribosomal RNA gen... 117 3e-23
275dbj|AK109803.1| Oryza sativa (japonica cultivar-group) cDNA clon... 117 3e-23
276gb|U52624.1|TLU52624 Trollius laxus nuclear 26S ribosomal RNA ge... 117 3e-23
277gb|U52618.1|ATU52618 Anemone trifolia nuclear 26S ribosomal RNA ... 117 3e-23
278gb|U52615.1|TCU52615 Thalictrum cooleyi nuclear 26S ribosomal RN... 117 3e-23
279gb|U52614.1|TDU52614 Thalictrum dasycarpum nuclear 26S ribosomal... 117 3e-23
280gb|U52613.1|TRU52613 Thalictrum revolutum nuclear 26S ribosomal ... 117 3e-23
281gb|U52612.1|TCU52612 Thalictrum coriaceum nuclear 26S ribosomal ... 117 3e-23
282gb|U52611.1|TDU52611 Thalictrum dioicum nuclear 26S ribosomal RN... 117 3e-23
283gb|U52610.1|TTU52610 Thalictrum thalictroides nuclear 26S riboso... 117 3e-23
284gb|U52608.1|AEU52608 Aquilegia ecalcarata nuclear 26S ribosomal ... 117 3e-23
285gb|U52607.1|AVU52607 Aquilegia vulgaris nuclear 26S ribosomal RN... 117 3e-23
286emb|X83843.1|CD28SRRNA C.demersum 28S rRNA gene (partial) 117 3e-23
287emb|AJ271027.1|SGI271027 Sequoiadendron giganteum partial 25S rR... 117 3e-23
288gb|AY423078.1| Tetranema mexicanum isolate DNA-CW5 26S ribosomal... 115 1e-22
289gb|AY423077.1| Antirrhinum majus isolate DNA-CW4 26S ribosomal R... 115 1e-22
290gb|AY686805.1| Broussonetia papyrifera voucher G. Weiblen 1176 (... 115 1e-22
291gb|DQ287986.1| Abutilon theophrasti 26S ribosomal RNA gene, part... 115 1e-22
292gb|AF389263.1| Hypecoum imberbe 26S ribosomal RNA gene, partial ... 115 1e-22
293gb|AF389241.1| Nandina domestica 26S ribosomal RNA gene, partial... 115 1e-22
294gb|AF468134.1| Begonia lobata 26S large subunit ribosomal RNA ge... 115 1e-22
295gb|AF468132.1| Begonia luxurians 26S large subunit ribosomal RNA... 115 1e-22
296gb|AY095470.1| Trimenia moorei 26S ribosomal RNA gene, partial s... 115 1e-22
297gb|AF222402.1| Maytenus undata 26S ribosomal RNA gene, partial s... 115 1e-22
298gb|AF222401.1| Pterocelastrus tricuspidatus 26S ribosomal RNA ge... 115 1e-22
299gb|AF222400.1| Cassine schinoides 26S ribosomal RNA gene, partia... 115 1e-22
300gb|AF222398.1| Maurocenia frangula 26S ribosomal RNA gene, parti... 115 1e-22
301gb|AF222396.1| Gymnosporia polyacantha 26S ribosomal RNA gene, p... 115 1e-22
302gb|AF222395.1| Catha abbottii 26S ribosomal RNA gene, partial se... 115 1e-22
303gb|AF222394.1| Putterlickia verrucosa 26S ribosomal RNA gene, pa... 115 1e-22
304gb|AF222380.1| Mortonia greggii 26S ribosomal RNA gene, partial ... 115 1e-22
305gb|AF222379.1| Mortonia greggii 26S ribosomal RNA gene, partial ... 115 1e-22
306gb|AF222368.1| Tricerma texana 26S ribosomal RNA gene, partial s... 115 1e-22
307gb|AF222367.1| Peripterygia marginata 26S ribosomal RNA gene, pa... 115 1e-22
308gb|AF222363.1| Schaefferia stenophylla 26S ribosomal RNA gene, p... 115 1e-22
309gb|AF222358.1| Celastrus scandens 26S ribosomal RNA gene, partia... 115 1e-22
310gb|AF222357.1| Celastrus orbiculatus 26S ribosomal RNA gene, par... 115 1e-22
311gb|AF222356.1| Euonymus europaeus 26S ribosomal RNA gene, partia... 115 1e-22
312gb|AF222355.1| Euonymus alatus 26S ribosomal RNA gene, partial s... 115 1e-22
313gb|AF222354.1| Canotia holocantha 26S ribosomal RNA gene, partia... 115 1e-22
314gb|AF222351.1| Tripterygium regelii 26S ribosomal RNA gene, part... 115 1e-22
315gb|AF222347.1| Siphonodon celastrineus 26S ribosomal RNA gene, p... 115 1e-22
316gb|AF222346.1| Siphonodon australis 26S ribosomal RNA gene, part... 115 1e-22
317gb|AY128154.1| Chukrasia tabularis 26S ribosomal RNA gene, parti... 115 1e-22
318gb|AF374851.1| Saxifraga stellaris 26S ribosomal RNA gene, parti... 115 1e-22
319gb|AF374849.1| Saxifraga tolmiei 26S ribosomal RNA gene, partial... 115 1e-22
320gb|AF274665.1| Ribes aureum 26S ribosomal RNA gene, complete seq... 115 1e-22
321gb|AF205126.1|AF205126 Lilium michauxii 26S ribosomal RNA gene, ... 115 1e-22
322gb|AY935821.1| Rinorea pubiflora isolate 31 26S ribosomal RNA ge... 115 1e-22
323gb|AY935818.1| Larrea tridentata isolate 28 26S ribosomal RNA ge... 115 1e-22
324gb|AY935795.1| Empleuridium juniperinum isolate 5 26S ribosomal ... 115 1e-22
325gb|AF297537.1|AF297537 Cornus sessilis 26S ribosomal RNA gene, p... 115 1e-22
326gb|DQ008658.1| Schisandra sphenanthera 26S ribosomal RNA gene, p... 115 1e-22
327gb|DQ008657.1| Kadsura japonica 26S ribosomal RNA gene, partial ... 115 1e-22
328gb|DQ008640.1| Houttuynia cordata 26S ribosomal RNA gene, partia... 115 1e-22
329gb|AF479234.1| Thymelaea hirsuta 26S ribosomal RNA gene, complet... 115 1e-22
330gb|AF479214.1| Ribes speciosum 26S ribosomal RNA gene, complete ... 115 1e-22
331gb|AF479189.1| Donatia sp. Morgan 2142 26S ribosomal RNA gene, c... 115 1e-22
332gb|AF479156.1| Styrax japonicus 26S ribosomal RNA gene, complete... 115 1e-22
333gb|AF479141.1| Byblis gigantea 26S ribosomal RNA gene, complete ... 115 1e-22
334gb|AF479136.1| Durio zibethinus 26S ribosomal RNA gene, complete... 115 1e-22
335gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete ... 115 1e-22
336gb|AY177421.1| Bursera inaguensis 26S ribosomal RNA gene, comple... 115 1e-22
337gb|AF148274.1|AF148274 Heliotropium curassavicum 26S ribosomal R... 115 1e-22
338gb|AF148269.1|AF148269 Nemophila maculata 26S ribosomal RNA gene... 115 1e-22
339dbj|AK059583.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
340gb|AF036499.1|AF036499 Peltoboykinia tellimoides large subunit 2... 115 1e-22
341gb|AY423101.1| Cyrtandra apiculata isolate DNA-T90 26S ribosomal... 113 4e-22
342gb|AY423093.1| Gesneria humilis isolate DNA-SI.26 26S ribosomal ... 113 4e-22
343gb|AY423092.1| Sinningia schiffneri isolate DNA-S-1A 26S ribosom... 113 4e-22
344gb|AY423087.1| Napeanthus reitzii isolate DNA-SI.101 26S ribosom... 113 4e-22
345gb|AY423086.1| Besleria labiosa isolate DNA-G80 26S ribosomal RN... 113 4e-22
346gb|AY423085.1| Titanotrichum oldhamii isolate DNA-G37 26S riboso... 113 4e-22
347gb|AY423082.1| Peltanthera floribunda isolate DNA-CW9 26S riboso... 113 4e-22
348gb|AY968401.1| Anisophyllea corneri 26S ribosomal RNA gene, part... 113 4e-22
349gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, part... 113 4e-22
350gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial s... 113 4e-22
351gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RN... 113 4e-22
352gb|AY727930.1| Cornus sericea 26S ribosomal RNA gene, partial se... 113 4e-22
353gb|AF222393.1| Maytenus fournieri 26S ribosomal RNA gene, partia... 113 4e-22
354gb|AF222390.1| Denhamia obscura 26S ribosomal RNA gene, partial ... 113 4e-22
355gb|AF222389.1| Denhamia celastroides 26S ribosomal RNA gene, par... 113 4e-22
356gb|AY292906.1| Dicentra sp. YLQ-2003 26S ribosomal RNA gene, par... 113 4e-22
357gb|AY128170.1| Toona sp. Chase 664 26S ribosomal RNA gene, parti... 113 4e-22
358gb|AY056507.1| Cedrus libani 26S ribosomal RNA gene, partial seq... 113 4e-22
359gb|AY056500.1| Pinus mugo 26S ribosomal RNA gene, partial sequence 113 4e-22
360gb|AF274666.1| Saxifraga integrifolia 26S ribosomal RNA gene, co... 113 4e-22
361gb|AF205522.1|AF205522 Zingiber officinale 26S ribosomal RNA gen... 113 4e-22
362gb|AF205124.1|AF205124 Tacca chantieri 26S ribosomal RNA gene, p... 113 4e-22
363gb|AY935811.1| Crinodendron patagua isolate 21 26S ribosomal RNA... 113 4e-22
364gb|AF376132.1|AF376132 Platycladus orientalis 28S ribosomal RNA ... 113 4e-22
365gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete s... 113 4e-22
366gb|AF479175.1| Montinia caryophyllacea 26S ribosomal RNA gene, c... 113 4e-22
367gb|AF479144.1| Tropaeolum tricolor 26S ribosomal RNA gene, compl... 113 4e-22
368gb|AF479137.1| Sterculia apetala 26S ribosomal RNA gene, complet... 113 4e-22
369gb|AF479120.1| Medusagyne oppositifolia 26S ribosomal RNA gene, ... 113 4e-22
370gb|U90706.1|POU90706 Platycladus orientalis 28S ribosomal RNA ge... 113 4e-22
371gb|AY177420.1| Citrus aurantium 26S ribosomal RNA gene, complete... 113 4e-22
372emb|X05910.1|CLRRN26 Citrus limon cistron for 26S ribosomal RNA 113 4e-22
373gb|AF148280.1|AF148280 Asclepias viridis 26S ribosomal RNA gene,... 113 4e-22
374gb|AF148276.1|AF148276 Lobelia puberula 26S ribosomal RNA gene, ... 113 4e-22
375gb|U52636.1|HCU52636 Hydrastis canadensis nuclear 26S ribosomal ... 113 4e-22
376gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA ... 111 2e-21
377gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial ... 111 2e-21
378gb|AY727942.1| Acanthogilia gloriosa 26S ribosomal RNA gene, par... 111 2e-21
379gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, par... 111 2e-21
380gb|AF468138.1| Begonia incarnata 26S large subunit ribosomal RNA... 111 2e-21
381gb|AF468125.1| Begonia dewildei 26S large subunit ribosomal RNA ... 111 2e-21
382gb|AY095451.1| Asimina triloba 26S ribosomal RNA gene, partial s... 111 2e-21
383gb|AY095449.1| Amborella trichopoda 26S ribosomal RNA gene, part... 111 2e-21
384gb|AF222399.1| Cassine peragua 26S ribosomal RNA gene, partial s... 111 2e-21
385gb|AF222397.1| Catha edulis 26S ribosomal RNA gene, partial sequ... 111 2e-21
386gb|AF222388.1| Tripterococcus brunonis 26S ribosomal RNA gene, p... 111 2e-21
387gb|AF222387.1| Stackhousia monogyna 26S ribosomal RNA gene, part... 111 2e-21
388gb|AF222386.1| Dicarpellum pancheri 26S ribosomal RNA gene, part... 111 2e-21
389gb|AF222385.1| Dicarpellum baillonianum 26S ribosomal RNA gene, ... 111 2e-21
390gb|AF222365.1| Orthosphenia mexicana 26S ribosomal RNA gene, par... 111 2e-21
391gb|AF222364.1| Schaefferia frutescens 26S ribosomal RNA gene, pa... 111 2e-21
392gb|AF222349.1| Acanthothamnus aphyllus 26S ribosomal RNA gene, p... 111 2e-21
393gb|AY260030.1| Mentzelia decapetala 26S ribosomal RNA gene, comp... 111 2e-21
394gb|AY260013.1| Davidia involucrata 26S ribosomal RNA gene, compl... 111 2e-21
395gb|AY292887.1| Amborella trichopoda 26S ribosomal RNA gene, part... 111 2e-21
396gb|AY292881.1| Asimina sp. YLQ-2003 26S ribosomal RNA gene, part... 111 2e-21
397gb|AY128166.1| Munronia pinnata 26S ribosomal RNA gene, partial ... 111 2e-21
398emb|AJ969115.1| Citrus sinensis partial 26S rRNA gene, cultivate... 111 2e-21
399gb|AY954472.1| Adonis amurensis 26S ribosomal RNA gene, partial ... 111 2e-21
400gb|AY056510.1| Picea breweriana 26S ribosomal RNA gene, partial ... 111 2e-21
401gb|AY935815.1| Humiria balsamifera isolate 25 26S ribosomal RNA ... 111 2e-21
402gb|AF270483.1|AF270483 Lauraceae gen. sp. Vasquez 25230 26S ribo... 111 2e-21
403gb|AF270482.1|AF270482 Sextonia rubra 26S ribosomal RNA gene, pa... 111 2e-21
404gb|AF264140.1|AF264140 Sassafras albidum 26S ribosomal RNA gene,... 111 2e-21
405gb|AF479238.1| Amborella trichopoda 26S ribosomal RNA gene, comp... 111 2e-21
406gb|AF479160.1| Manilkara zapota 26S ribosomal RNA gene, complete... 111 2e-21
407gb|AF479135.1| Ochroma pyramidale 26S ribosomal RNA gene, comple... 111 2e-21
408gb|AF479134.1| Bombax ceiba 26S ribosomal RNA gene, complete seq... 111 2e-21
409gb|AF479117.1| Idesia polycarpa 26S ribosomal RNA gene, complete... 111 2e-21
410gb|AF262012.1|AF262012 Sextonia pubescens 26S ribosomal RNA gene... 111 2e-21
411gb|AF036492.1|AF036492 Plumbago auriculata large subunit 26S rib... 111 2e-21
412gb|AY755738.1| Ephedra pachyclada voucher (S) C-7844 26S ribosom... 109 6e-21
413gb|AY755737.1| Ephedra major voucher (S) 03-164 26S ribosomal RN... 109 6e-21
414gb|AY755735.1| Ephedra ciliata voucher (S) C-591 26S ribosomal R... 109 6e-21
415gb|AY755734.1| Ephedra foliata voucher (S) C-7808 26S ribosomal ... 109 6e-21
416gb|AY755731.1| Ephedra altissima voucher (S) C-7688 26S ribosoma... 109 6e-21
417gb|AY755730.1| Ephedra altissima voucher (S) C-628 26S ribosomal... 109 6e-21
418gb|AY755729.1| Ephedra aphylla voucher (S) C-7791 26S ribosomal ... 109 6e-21
419gb|AY755728.1| Ephedra equisetina voucher (S) C-465-2 26S riboso... 109 6e-21
420gb|AY755727.1| Ephedra distachya voucher (S) 03-684 26S ribosoma... 109 6e-21
421gb|AY755726.1| Ephedra tweediana voucher (UC) 66-0742 26S riboso... 109 6e-21
422gb|AY755725.1| Ephedra chilensis voucher (UC) 49-0542 26S riboso... 109 6e-21
423gb|AY755724.1| Ephedra likiangensis voucher (UC) 94-0389 26S rib... 109 6e-21
424gb|AY755723.1| Ephedra rupestris voucher (UC) 87-1368 26S riboso... 109 6e-21
425gb|AY755721.1| Ephedra procera voucher (Mo) 01903487 26S ribosom... 109 6e-21
426gb|AY755719.1| Ephedra distachya voucher (S) 04-481 26S ribosoma... 109 6e-21
427gb|AY755718.1| Ephedra gerardiana voucher (O) 74-460 26S ribosom... 109 6e-21
428gb|AY755716.1| Ephedra intermedia voucher (S) 04-483 26S ribosom... 109 6e-21
429gb|AY755714.1| Ephedra minuta voucher (S) 04-486 26S ribosomal R... 109 6e-21
430gb|AY755713.1| Ephedra minuta voucher (S) 04-485 26S ribosomal R... 109 6e-21
431gb|AY755712.1| Ephedra chilensis voucher (E) E00130260 26S ribos... 109 6e-21
432gb|AY755711.1| Ephedra gerardiana voucher (E) E00130259 26S ribo... 109 6e-21
433gb|AY755710.1| Ephedra fragilis voucher (E) E00130258 26S riboso... 109 6e-21
434gb|AY755709.1| Ephedra equisetina voucher (O) 90-536 26S ribosom... 109 6e-21
435gb|AY755707.1| Ephedra andina voucher (K) 10140 26S ribosomal RN... 109 6e-21
436gb|AY755706.1| Ephedra frustillata voucher (S) 04-482 26S riboso... 109 6e-21
437gb|AY755705.1| Ephedra equisetina voucher (S) 03-926 26S ribosom... 109 6e-21
438gb|AY686860.1| Sorocea briquetii voucher G. Weiblen 1457 (MIN) 2... 109 6e-21
439gb|AY686859.1| Helianthostylis sprucei voucher G. Weiblen 1523 (... 109 6e-21
440gb|AY686854.1| Dorstenia bahiensis voucher G. Weiblen 1101 (MIN)... 109 6e-21
441gb|AY686853.1| Pseudolmedia spuria voucher G. Weiblen 1427 (MIN)... 109 6e-21
442gb|AY686852.1| Batocarpus costaricensis voucher G. Weiblen 1463 ... 109 6e-21
443gb|AY686851.1| Clarisia biflora voucher W. Haber 11753 (F) 26S r... 109 6e-21
444gb|AY686849.1| Bleekrodea madagascariensis voucher S. Wohlhauser... 109 6e-21
445gb|AY686846.1| Brosimum lactescens voucher G. Weiblen 1513 (MIN)... 109 6e-21
446gb|AY686844.1| Perebea rubra voucher G. Weiblen 1685 (MIN) 26S r... 109 6e-21
447gb|AY686843.1| Perebea angustifolia voucher G. Weiblen 1403 (MIN... 109 6e-21
448gb|AY686842.1| Perebea humilis voucher G. Weiblen 1468 (MIN) 26S... 109 6e-21
449gb|AY686841.1| Naucleopsis naga voucher R. Aguillar 5025 (F) 26S... 109 6e-21
450gb|AY686839.1| Helicostylis tomentosa voucher G. Weiblen 1475 (M... 109 6e-21
451gb|AY686832.1| Brosimum utile voucher G. Weiblen 1180 (MIN) 26S ... 109 6e-21
452gb|AY686831.1| Streblus elongatus voucher N. Zerega 206 (NY) 26S... 109 6e-21
453gb|AY686827.1| Batocarpus amazonicus voucher G. Weiblen 1682 (MI... 109 6e-21
454gb|AY686826.1| Perebea longepedunculata voucher G. Weiblen 1477 ... 109 6e-21
455gb|AY686822.1| Trymatococcus oligandrus voucher G. Weiblen 1684 ... 109 6e-21
456gb|AY686821.1| Naucleopsis ternstroemiiflora voucher G. Weiblen ... 109 6e-21
457gb|AY686816.1| Helicostylis pedunculata voucher G. Weiblen 1680 ... 109 6e-21
458gb|AY686815.1| Sorocea bonplandii voucher G. Weiblen 1186 (MIN) ... 109 6e-21
459gb|AY686810.1| Dorstenia choconiana voucher G. Weiblen 1417 (MIN... 109 6e-21
460gb|AY686808.1| Pseudolmedia laevis voucher G. Weiblen 1502 (MIN)... 109 6e-21
461gb|AY686802.1| Milicia excelsa voucher L. Festo 990 (MO) 26S rib... 109 6e-21
462gb|AY686801.1| Maquira costaricana voucher G. Weiblen 1402 (MIN)... 109 6e-21
463gb|AY686797.1| Prainea limpato voucher N. Zerega 249 (NY) 26S ri... 109 6e-21
464gb|AY686792.1| Pseudolmedia macrophylla voucher G. Weiblen 1472 ... 109 6e-21
465gb|AY686791.1| Naucleopsis ulei voucher G. Weiblen 1509 (MIN) 26... 109 6e-21
466gb|AY686788.1| Trymatococcus amazonicus voucher G. Weiblen 1519 ... 109 6e-21
467gb|AY686786.1| Sorocea pubivena voucher R. L. Wilbur 70044 (F) 2... 109 6e-21
468gb|AY686785.1| Sorocea affinis voucher G. Weiblen 1437 (MIN) 26S... 109 6e-21
469gb|AY686784.1| Naucleopsis krukovii voucher G. Weiblen 1484 (MIN... 109 6e-21
470gb|AF389275.1| Viscum album 26S ribosomal RNA gene, partial sequ... 109 6e-21
471gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, parti... 109 6e-21
472gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 109 6e-21
473gb|AF389259.1| Nelumbo lutea 26S ribosomal RNA gene, partial seq... 109 6e-21
474gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partia... 109 6e-21
475gb|AF389240.1| Caulophyllum thalictroides 26S ribosomal RNA gene... 109 6e-21
476gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial ... 109 6e-21
477gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, parti... 109 6e-21
478gb|AY727935.1| Pentamerista neotropica 26S ribosomal RNA gene, p... 109 6e-21
479gb|AY727934.1| Tetramerista sp. JS-2005 26S ribosomal RNA gene, ... 109 6e-21
480gb|AY727932.1| Ilex repanda 26S ribosomal RNA gene, partial sequ... 109 6e-21
481gb|AY095461.1| Hedyosmum bonplandianum 26S ribosomal RNA gene, p... 109 6e-21
482gb|AF222423.1| Pristimera andina 26S ribosomal RNA gene, partial... 109 6e-21
483gb|AF222422.1| Pristimera celastroides 26S ribosomal RNA gene, p... 109 6e-21
484gb|AF222384.1| Quetzalia occidentalis 26S ribosomal RNA gene, pa... 109 6e-21
485gb|AF222371.1| Reinwardtia trigyna 26S ribosomal RNA gene, parti... 109 6e-21
486gb|AY292908.1| Nelumbo sp. YLQ-2003 26S ribosomal RNA gene, part... 109 6e-21
487gb|AY292889.1| Hedyosmum sp. YLQ-2003 26S ribosomal RNA gene, pa... 109 6e-21
488gb|AF374846.1| Bergenia cordifolia 26S ribosomal RNA gene, parti... 109 6e-21
489gb|AY954470.1| Helleborus thibetanus 26S ribosomal RNA gene, par... 109 6e-21
490gb|U52620.1|PSU52620 Pulsatilla sp. PSU 94983 nuclear 26S riboso... 109 6e-21
491gb|AY056493.1| Ephedra minuta 26S ribosomal RNA gene, partial se... 109 6e-21
492gb|AY056492.1| Ephedra intermedia 26S ribosomal RNA gene, partia... 109 6e-21
493gb|AY056490.1| Ephedra frustillata 26S ribosomal RNA gene, parti... 109 6e-21
494gb|AY056487.1| Ephedra monosperma 26S ribosomal RNA gene, partia... 109 6e-21
495gb|AC006837.16| Arabidopsis thaliana chromosome 2 BAC F23H14 gen... 109 6e-21
496gb|AF274650.1| Itea virginica 26S ribosomal RNA gene, complete s... 109 6e-21
497gb|AY935807.1| Anisophyllea fallax isolate 17 26S ribosomal RNA ... 109 6e-21
498gb|AF297534.1|AF297534 Cornus unalaschkensis 26S ribosomal RNA g... 109 6e-21
499gb|AF297531.1|AF297531 Cornus suecica 26S ribosomal RNA gene, pa... 109 6e-21
500gb|AF297530.1|AF297530 Cornus canadensis 26S ribosomal RNA gene,... 109 6e-21

>gb|BT016655.1| Zea mays clone Contig488 mRNA sequence
          Length = 1652

 Score =  466 bits (235), Expect = e-128
 Identities = 335/367 (91%), Gaps = 1/367 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
            ||||||||||||||||||||||||||||||||| ||||| |||| |||||||||||||||
Sbjct: 1212 cttgaaattgccgggagggaagcggatgggggctggcgacgcgcaccggccgtatgcgga 1271

                                                                        
Query: 61   acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
            ||||||| ||||||||||||| ||||||||||| |||||| ||||||| ||||| |||||
Sbjct: 1272 acggctcctgctggtccgccgatcggctcggggcgtggaccgttgtcgcccgcgccggcg 1331

                                                                        
Query: 121  gccaaagcccgggggccctaggtgcctccggttgccgtcgtcgacatggccggtacccgc 180
            |||||||||||||||||||||| ||| ||||  |||||||||| |  || ||||| ||||
Sbjct: 1332 gccaaagcccgggggccctaggcgcccccggcagccgtcgtcggcgcggacggtatccgc 1391

                                                                        
Query: 181  gcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccg 240
            |||||    |||| | |||||||||| |||||||||||||||||||| ||||||||||| 
Sbjct: 1392 gcgcctct-ggcgcgcccctcggggcgctgcgctgcaacggcctgcgagctccccatccc 1450

                                                                        
Query: 241  acccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaa 300
             ||||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 1451 ccccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttcagaaa 1510

                                                                        
Query: 301  cctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccga 360
            |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1511 cctgagatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccga 1570

                   
Query: 361  ccctgat 367
            |||||||
Sbjct: 1571 ccctgat 1577



to top

>emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-like sequence
          Length = 10658

 Score =  448 bits (226), Expect = e-123
 Identities = 335/369 (90%), Gaps = 3/369 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1    cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
            ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 1138 cttgaaattgccgggagggaagcggatgggggctggcgacgcgccccggccgtatgcgga 1197

                                                                        
Query: 61   acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
            ||||||| ||||||||||||| ||||||||||| |||||| ||||||| |||||  ||||
Sbjct: 1198 acggctcctgctggtccgccgatcggctcggggcgtggaccgttgtcgcccgcgctggcg 1257

                                                                        
Query: 121  gccaaagcccgggggccctaggtgcctccggttgccgtcgtcgacatggccggtacccgc 180
            |||||||||||||||||||||| ||| ||||  |||||||||| |  || ||||| ||||
Sbjct: 1258 gccaaagcccgggggccctaggcgcccccggcagccgtcgtcggcgcggacggtatccgc 1317

                                                                        
Query: 181  gcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccg 240
            |||||    ||||   |||||||||| || ||| ||||||||||||| ||||||||||||
Sbjct: 1318 gcgcctct-ggcgc--ccctcggggcgctacgccgcaacggcctgcgagctccccatccg 1374

                                                                        
Query: 241  acccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaa 300
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||  ||||
Sbjct: 1375 acccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttcagaaa 1434

                                                                        
Query: 301  cctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccga 360
            |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 1435 cctgagatgcgcaaggaagctgacgagcgggaggccctcacgagccgcaccgctggccga 1494

                     
Query: 361  ccctgatct 369
            |||||||||
Sbjct: 1495 ccctgatct 1503



to top

>gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial sequence
          Length = 3341

 Score =  381 bits (192), Expect = e-102
 Identities = 210/216 (97%)
 Strand = Plus / Plus

                                                                       
Query: 154 gccgtcgtcgacatggccggtacccgcgcgccgaaaggcgtgtccctcggggcactgcgc 213
           |||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 548 gccgtcgtcggcacggccggtacccgcgcgccgaaaggcgtgcccctcggggcactgcgc 607

                                                                       
Query: 214 tgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgac 273
           ||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 608 tgcaacgccctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgac 667

                                                                       
Query: 274 atgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggag 333
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 668 atgcgtgcgagtcgacgggttctgaaacctgggatgcgcaaggaagctgacgagcgggag 727

                                               
Query: 334 gccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||||||||||||||||||
Sbjct: 728 gccctcacgggccgcaccgctggccgaccctgatct 763



 Score =  170 bits (86), Expect = 2e-39
 Identities = 86/86 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 397 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 456

                                     
Query: 61  acggctcttgctggtccgccgctcgg 86
           ||||||||||||||||||||||||||
Sbjct: 457 acggctcttgctggtccgccgctcgg 482



to top

>dbj|AB026897.1| Triticum aestivum DNA, telomere sequence, isolate:deletion 1BS-8
          Length = 321

 Score =  315 bits (159), Expect = 6e-83
 Identities = 189/195 (96%), Gaps = 3/195 (1%)
 Strand = Plus / Minus

                                                                       
Query: 175 acccgcgcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccc 234
           ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||
Sbjct: 256 acccgcgcgccgaaaggtg-gtccctcggggcactgcgctgcaacggcctgcgggctccc 198

                                                                       
Query: 235 catccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggtt 294
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 197 catccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagtcgacgggtt 138

                                                                       
Query: 295 ttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgct 354
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 137 ctgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacggg-cgcaccg-t 80

                          
Query: 355 ggccgaccctgatct 369
           |||||||||||||||
Sbjct: 79  ggccgaccctgatct 65



to top

>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
             fosmid clone:OSJNOa109J19
          Length = 30481

 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                         
Query: 197   ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
             |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 29673 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 29732

                                                                         
Query: 257   ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 29733 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 29792

                                                                  
Query: 317   aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29793 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 29845



 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                         
Query: 197   ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
             |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 21745 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 21804

                                                                         
Query: 257   ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 21805 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 21864

                                                                  
Query: 317   aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21865 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 21917



 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                         
Query: 197   ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
             |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 13817 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 13876

                                                                         
Query: 257   ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 13877 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 13936

                                                                  
Query: 317   aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13937 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 13989



 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                        
Query: 197  ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
            |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 5889 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 5948

                                                                        
Query: 257  ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 5949 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 6008

                                                                 
Query: 317  aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
            |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6009 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 6061



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29480 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 29539

                                                                         
Query: 61    acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
             ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 29540 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 29599

                             
Query: 121   gccaaagcccgggggc 136
             ||||||||||||||||
Sbjct: 29600 gccaaagcccgggggc 29615



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21552 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 21611

                                                                         
Query: 61    acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
             ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 21612 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 21671

                             
Query: 121   gccaaagcccgggggc 136
             ||||||||||||||||
Sbjct: 21672 gccaaagcccgggggc 21687



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13624 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 13683

                                                                         
Query: 61    acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
             ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 13684 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 13743

                             
Query: 121   gccaaagcccgggggc 136
             ||||||||||||||||
Sbjct: 13744 gccaaagcccgggggc 13759



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                        
Query: 1    cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5696 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 5755

                                                                        
Query: 61   acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
            ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 5756 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 5815

                            
Query: 121  gccaaagcccgggggc 136
            ||||||||||||||||
Sbjct: 5816 gccaaagcccgggggc 5831



to top

>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0013K10
          Length = 129118

 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                         
Query: 197   ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
             |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 29401 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 29460

                                                                         
Query: 257   ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 29461 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 29520

                                                                  
Query: 317   aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29521 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 29573



 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                         
Query: 197   ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
             |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 21473 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 21532

                                                                         
Query: 257   ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 21533 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 21592

                                                                  
Query: 317   aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21593 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 21645



 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                         
Query: 197   ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
             |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 13545 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 13604

                                                                         
Query: 257   ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 13605 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 13664

                                                                  
Query: 317   aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13665 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 13717



 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                        
Query: 197  ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
            |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 5617 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 5676

                                                                        
Query: 257  ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 5677 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 5736

                                                                 
Query: 317  aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
            |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5737 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 5789



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29208 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 29267

                                                                         
Query: 61    acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
             ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 29268 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 29327

                             
Query: 121   gccaaagcccgggggc 136
             ||||||||||||||||
Sbjct: 29328 gccaaagcccgggggc 29343



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21280 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 21339

                                                                         
Query: 61    acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
             ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 21340 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 21399

                             
Query: 121   gccaaagcccgggggc 136
             ||||||||||||||||
Sbjct: 21400 gccaaagcccgggggc 21415



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                         
Query: 1     cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13352 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 13411

                                                                         
Query: 61    acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
             ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 13412 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 13471

                             
Query: 121   gccaaagcccgggggc 136
             ||||||||||||||||
Sbjct: 13472 gccaaagcccgggggc 13487



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                        
Query: 1    cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5424 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 5483

                                                                        
Query: 61   acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
            ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 5484 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 5543

                            
Query: 121  gccaaagcccgggggc 136
            ||||||||||||||||
Sbjct: 5544 gccaaagcccgggggc 5559



to top

>dbj|AK110001.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-F08, full
           insert sequence
          Length = 3069

 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 172 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgtaacac 231

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 232 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 291

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 292 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 344



 Score =  178 bits (90), Expect = 8e-42
 Identities = 108/114 (94%)
 Strand = Plus / Plus

                                                                       
Query: 23  cggatgggggccggcgatgcgccccggccgtatgcggaacggctcttgctggtccgccgc 82
           ||||||||||||||||||||||||||||||||||||||||||||   |||||||||||| 
Sbjct: 1   cggatgggggccggcgatgcgccccggccgtatgcggaacggcttcggctggtccgccga 60

                                                                 
Query: 83  tcggctcggggtgtggactgttgtcggccgcgtcggcggccaaagcccgggggc 136
           ||||||||||| |||||||||||||||||||| |||||||||||||||||||||
Sbjct: 61  tcggctcggggcgtggactgttgtcggccgcgccggcggccaaagcccgggggc 114



to top

>dbj|AK063372.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-E06, full
           insert sequence
          Length = 1529

 Score =  311 bits (157), Expect = 9e-82
 Identities = 169/173 (97%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 225 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 284

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 285 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 344

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 345 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 397



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32  cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 91

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 92  acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 151

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 152 gccaaagcccgggggc 167



to top

>dbj|AK108972.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-E02, full
           insert sequence
          Length = 1199

 Score =  309 bits (156), Expect = 3e-81
 Identities = 168/172 (97%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 554 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgtaacac 613

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 614 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 673

                                                               
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatc 368
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 674 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatc 725



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 420

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 421 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 480

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 481 gccaaagcccgggggc 496



to top

>dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G06, full
           insert sequence
          Length = 2893

 Score =  303 bits (153), Expect = 2e-79
 Identities = 168/173 (97%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 41  ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 100

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 101 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 160

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 161 aagctgacgagcgggaggccctcacgggccgcatcgctggccgaccctgatct 213



to top

>gb|AF375551.1| Oryza glaberrima clone 1-6 25S ribosomal RNA gene, partial sequence
          Length = 816

 Score =  295 bits (149), Expect = 5e-77
 Identities = 168/173 (97%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           ||||||||||  |||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 591 ccctcggggcggtgcgctgcaacggcctgcgggctccccatccgacccgtcttgaaacac 650

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 651 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 710

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 711 aagctgacgagcggga-gccctcacgggccgcaccgctggccgaccctgatct 762



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 457

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 458 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 517

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 518 gccaaagcccgggggc 533



to top

>gb|AF375550.1| Oryza glaberrima clone 1-28 25S ribosomal RNA gene, partial
           sequence
          Length = 816

 Score =  295 bits (149), Expect = 5e-77
 Identities = 168/173 (97%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           ||||||||||  |||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 591 ccctcggggcggtgcgctgcaacggcctgcgggctccccatccgacccgtcttgaaacac 650

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 651 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 710

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 711 aagctgacgagcggga-gccctcacgggccgcaccgctggccgaccctgatct 762



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 398 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 457

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 458 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 517

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 518 gccaaagcccgggggc 533



to top

>dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G04, full
           insert sequence
          Length = 3066

 Score =  295 bits (149), Expect = 5e-77
 Identities = 167/173 (96%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |||||| ||||||||||| |||| ||||||||||||||||||| |||||
Sbjct: 443 ccctcggggcgctgcgccgcaacggcctgtgggccccccatccgacccgtcttggaacac 502

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 503 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 562

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 563 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 615



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 250 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 309

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 310 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 369

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 370 gccaaagcccgggggc 385



to top

>dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-E11, full
           insert sequence
          Length = 1835

 Score =  289 bits (146), Expect = 3e-75
 Identities = 167/173 (96%), Gaps = 2/173 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |||||| ||||||||||||||||||||||||||||||||||   |||||
Sbjct: 503 ccctcggggcgctgcgccgcaacggcctgcgggctccccatccgacccgtcta--aacac 560

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 561 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 620

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 673



 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 310 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 369

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 370 acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 429

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 430 gccaaagcccgggggc 445



to top

>gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene
          Length = 3377

 Score =  274 bits (138), Expect = 2e-70
 Identities = 165/173 (95%), Gaps = 2/173 (1%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           ||||||||||   |||| |||||||||||||||||||||||||||||||||||| |||||
Sbjct: 594 ccctcggggcgtcgcgccgcaacggcctgcgggctccccatccgacccgtcttgaaacac 653

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 654 ggaccaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaagg 713

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||||||||||||  ||||||||||||||||||||||||||
Sbjct: 714 aagctgacgagcgggaggccctcac--gccgcaccgctggccgaccctgatct 764



 Score =  192 bits (97), Expect = 6e-46
 Identities = 127/136 (93%), Gaps = 2/136 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatgggggccggcgatgc--cccggccgtatgcgga 459

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||||| || ||||||||||| |||||||||||||||||||| |||||
Sbjct: 460 acggcttcggctggtccgtcgatcggctcggggcgtggactgttgtcggccgcgccggcg 519

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 520 gccaaagcccgggggc 535



to top

>gb|AF363914.1| Oryza minuta clone 2-3 25S ribosomal RNA gene, partial sequence
          Length = 944

 Score =  254 bits (128), Expect = 2e-64
 Identities = 168/180 (93%), Gaps = 1/180 (0%)
 Strand = Plus / Plus

                                                                       
Query: 191 gcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttg 250
           ||||| |||||||||| | |||| |||||||||||||||||||||||| |||||||||||
Sbjct: 568 gcgtgcccctcggggcgccgcgccgcaacggcctgcgggctccccatctgacccgtcttg 627

                                                                       
Query: 251 caacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacct-gggatg 309
            ||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||||||
Sbjct: 628 aaacacggaccaaggagtctgacatgtgtgcgagtcgacgggttctgaaacctagggatg 687

                                                                       
Query: 310 cgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||
Sbjct: 688 cgcaaggaagttgacgagcgggaggccctcgcgggccgcaccgctggctgaccctgatct 747



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 104/124 (83%)
 Strand = Plus / Plus

                                                                       
Query: 13  gggagggaagcggatgggggccggcgatgcgccccggccgtatgcggaacggctcttgct 72
           |||||| |||||||||||||| || |||| ||||  ||||||||||| ||  ||   |||
Sbjct: 395 gggaggaaagcggatgggggctggtgatgtgccctcgccgtatgcgggacaacttcagct 454

                                                                       
Query: 73  ggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggccaaagcccgg 132
           ||||||||  |||| |  ||| |||||| |||||||||| ||||||||||||||||||||
Sbjct: 455 ggtccgccaatcggattagggcgtggacagttgtcggccacgtcggcggccaaagcccgg 514

               
Query: 133 gggc 136
           ||||
Sbjct: 515 gggc 518



to top

>gb|AF466388.1| Centrolepis strigosa 26S ribosomal RNA gene, partial sequence
          Length = 974

 Score =  236 bits (119), Expect = 4e-59
 Identities = 173/191 (90%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcgcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatc 238
           |||||| | ||||||||||| |  || |||||||||||||| ||||||||||||||||||
Sbjct: 579 gcgcgctgcaaggcgtgtccttttggacactgcgctgcaacagcctgcgggctccccatc 638

                                                                       
Query: 239 cgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttga 298
           |||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |||
Sbjct: 639 cgacccgtcttgaaacacggaccaaggagtctgacatgcatgcgagtagacgggttctga 698

                                                                       
Query: 299 aacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggcc 358
           |||||||||||| |||||||||||| ||| |||||  ||| ||||| |||||||||||||
Sbjct: 699 aacctgggatgcacaaggaagctgatgagtgggagttcctaacgggacgcaccgctggcc 758

                      
Query: 359 gaccctgatct 369
           |||||||||||
Sbjct: 759 gaccctgatct 769



 Score =  157 bits (79), Expect = 3e-35
 Identities = 100/107 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||
Sbjct: 401 cttgaaattgccgggagggaagcggatggggaccggcgatgtgccccggtcgtatgcgga 460

                                                          
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtc 107
           ||||||  |||||||||||||||||||||| |||| |||||||||||
Sbjct: 461 acggcttatgctggtccgccgctcggctcgtggtgcggactgttgtc 507



to top

>gb|AF466385.1| Kingia australis 26S ribosomal RNA gene, partial sequence
          Length = 975

 Score =  236 bits (119), Expect = 4e-59
 Identities = 173/191 (90%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcgcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatc 238
           |||||| | ||||||||||| |  || |||||||||||||| ||||||||||||||||||
Sbjct: 580 gcgcgctgcaaggcgtgtccttttggacactgcgctgcaacagcctgcgggctccccatc 639

                                                                       
Query: 239 cgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttga 298
           |||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |||
Sbjct: 640 cgacccgtcttgaaacacggaccaaggagtctgacatgcatgcgagtagacgggttctga 699

                                                                       
Query: 299 aacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggcc 358
           |||||||||||| |||||||||||| ||| |||||  ||| ||||| |||||||||||||
Sbjct: 700 aacctgggatgcacaaggaagctgatgagtgggagttcctaacgggacgcaccgctggcc 759

                      
Query: 359 gaccctgatct 369
           |||||||||||
Sbjct: 760 gaccctgatct 770



 Score =  161 bits (81), Expect = 2e-36
 Identities = 102/109 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatggggaccggcgatgtgccccggtcgtatgcgga 461

                                                            
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcgg 109
           ||||||  |||||||||||||||||||||| |||| |||||||||||||
Sbjct: 462 acggcttatgctggtccgccgctcggctcgtggtgcggactgttgtcgg 510



to top

>gb|AF466384.1| Dasypogon bromeliifolius 26S ribosomal RNA gene, partial sequence
          Length = 981

 Score =  236 bits (119), Expect = 4e-59
 Identities = 173/191 (90%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcgcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatc 238
           |||||| | ||||||||||| |  || |||||||||||||| ||||||||||||||||||
Sbjct: 584 gcgcgctgcaaggcgtgtccttttggacactgcgctgcaacagcctgcgggctccccatc 643

                                                                       
Query: 239 cgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttga 298
           |||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |||
Sbjct: 644 cgacccgtcttgaaacacggaccaaggagtctgacatgcatgcgagtagacgggttctga 703

                                                                       
Query: 299 aacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggcc 358
           |||||||||||| |||||||||||| ||| |||||  ||| ||||| |||||||||||||
Sbjct: 704 aacctgggatgcacaaggaagctgatgagtgggagttcctaacgggacgcaccgctggcc 763

                      
Query: 359 gaccctgatct 369
           |||||||||||
Sbjct: 764 gaccctgatct 774



 Score =  161 bits (81), Expect = 2e-36
 Identities = 102/109 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatggggaccggcgatgtgccccggtcgtatgcgga 461

                                                            
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcgg 109
           ||||||  |||||||||||||||||||||| |||| |||||||||||||
Sbjct: 462 acggcttatgctggtccgccgctcggctcgtggtgcggactgttgtcgg 510



to top

>gb|AF363898.1| Oryza malampuzhaensis clone 10-31 25S ribosomal RNA gene, partial
           sequence
          Length = 958

 Score =  234 bits (118), Expect = 2e-58
 Identities = 157/170 (92%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||| ||||| |||| |||||||||||||| ||||||||||||||| |||||  ||||
Sbjct: 589 ccctcgaggcaccgcgccgcaacggcctgcggactccccatccgacccatcttgagacac 648

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
            |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 649 agaccaaggagtctgacatgcgtgcgagttgacgggttctgaaacctgggatgcgcaagg 708

                                                             
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctga 366
           |||||||||||||||| |||||| |||||||||| |||||||||||||||
Sbjct: 709 aagctgacgagcgggacgccctcgcgggccgcactgctggccgaccctga 758



 Score =  145 bits (73), Expect = 1e-31
 Identities = 121/137 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||| ||| ||||||||| ||||||||| ||||||||||||||||||||||| ||
Sbjct: 396 cttgaaattaccgagagggaagcagatgggggctggcgatgcgccccggccgtatgcaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           | ||||   |||||||| ||  ||||||||||| |||||||||||||||||| |||| ||
Sbjct: 456 atggcttcggctggtccaccaatcggctcggggcgtggactgttgtcggccgtgtcgacg 515

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 516 gccaaagctcgggggcc 532



to top

>gb|AF363899.1| Oryza malampuzhaensis clone 10-8 25S ribosomal RNA gene, partial
           sequence
          Length = 962

 Score =  232 bits (117), Expect = 6e-58
 Identities = 147/157 (93%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| |||||||||||||| ||||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 606 gcgccgcaacggcctgcggactccccatccgacccatcttgaaacacagaccaaggagtc 665

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 666 tgacatgcgtgcgagttgacgggttctgaaacctgggatgcgcaaggaagctgacgagcg 725

                                                
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctga 366
           ||| |||||| |||||||||| |||||||||||||||
Sbjct: 726 ggacgccctcgcgggccgcactgctggccgaccctga 762



 Score =  121 bits (61), Expect = 2e-24
 Identities = 118/137 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||| ||| ||||||||| ||||||||| ||||||||||||||||||||||| ||
Sbjct: 396 cttgaaattaccgagagggaagcagatgggggctggcgatgcgccccggccgtatgcaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           | ||||   ||||| || ||  ||||||||||| ||||||||||||  |||| |||| ||
Sbjct: 456 atggcttcggctgggccaccaatcggctcggggcgtggactgttgttcgccgtgtcgacg 515

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 516 gccaaagctcgggggcc 532



to top

>dbj|AK063660.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-C01, full
           insert sequence
          Length = 687

 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 63

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 64  acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 123

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 124 gccaaagcccgggggc 139



to top

>dbj|AK061754.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H12, full
           insert sequence
          Length = 1026

 Score =  222 bits (112), Expect = 6e-55
 Identities = 130/136 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 61

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||| ||||||||||| |||||||||||||||||||| |||||
Sbjct: 62  acggcttcggctggtccgccgatcggctcggggcgtggactgttgtcggccgcgccggcg 121

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 122 gccaaagcccgggggc 137



to top

>gb|AY079521.1| Calectasia cyanea 26S ribosomal RNA gene, partial sequence
          Length = 974

 Score =  220 bits (111), Expect = 2e-54
 Identities = 172/191 (90%), Gaps = 1/191 (0%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcgcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatc 238
           |||||| | ||||||||||| |  || |||||||||||||| ||||||||||||||||||
Sbjct: 580 gcgcgctgcaaggcgtgtccttttggacactgcgctgcaacagcctgcgggctccccatc 639

                                                                       
Query: 239 cgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttga 298
           |||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |||
Sbjct: 640 cgacccgtcttgaaacacggaccaaggagtctgacatgcatgcgagtagacgggttctga 699

                                                                       
Query: 299 aacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggcc 358
           |||||||||||| |||||||||||| ||| |||||  ||| ||||| ||| |||||||||
Sbjct: 700 aacctgggatgcacaaggaagctgatgagtgggagttcctaacgggacgc-ccgctggcc 758

                      
Query: 359 gaccctgatct 369
           |||||||||||
Sbjct: 759 gaccctgatct 769



 Score =  145 bits (73), Expect = 1e-31
 Identities = 100/109 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||| |||| |||| ||||||| ||||||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatggggaccggagatgtgccccggtcgtatgcgga 461

                                                            
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcgg 109
           ||||||  |||||||||||||||||||||| |||  |||||||||||||
Sbjct: 462 acggcttatgctggtccgccgctcggctcgtggtacggactgttgtcgg 510



to top

>gb|AF466387.1| Ecdeiocolea monostachya 26S ribosomal RNA gene, partial sequence
          Length = 979

 Score =  216 bits (109), Expect = 4e-53
 Identities = 148/161 (91%)
 Strand = Plus / Plus

                                                                       
Query: 209 tgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagt 268
           ||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||
Sbjct: 614 tgcgctgcaacagcctgcgggctccccatcccacccgtcttgaaacacggaccaaggagt 673

                                                                       
Query: 269 ctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagc 328
           ||||||||| ||||||| |||||||| ||||||||||||||| |||||||||||| ||| 
Sbjct: 674 ctgacatgcatgcgagtagacgggttctgaaacctgggatgcacaaggaagctgatgagt 733

                                                    
Query: 329 gggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||  ||| ||||| ||||||||||||||||||||||||
Sbjct: 734 gggagttcctaacgggacgcaccgctggccgaccctgatct 774



 Score =  161 bits (81), Expect = 2e-36
 Identities = 102/109 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatggggaccggcgatgtgccccggtcgtatgcgga 461

                                                            
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcgg 109
           ||||||  |||||||||||||||||||||| |||| |||||||||||||
Sbjct: 462 acggcttatgctggtccgccgctcggctcgtggtgcggactgttgtcgg 510



to top

>gb|AF363895.1| Oryza ridleyi clone 8-16 25S ribosomal RNA gene, partial sequence
          Length = 958

 Score =  214 bits (108), Expect = 2e-52
 Identities = 162/180 (90%)
 Strand = Plus / Plus

                                                                       
Query: 190 ggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtctt 249
           |||||| |||||| ||||||| |  ||||||||||||||||||||||||| |||||||||
Sbjct: 582 ggcgtgcccctcgaggcactgtgacgcaacggcctgcgggctccccatccaacccgtctt 641

                                                                       
Query: 250 gcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatg 309
           | |||||||||||||||||||||||||||||| |||||| | ||  | ||||||||||||
Sbjct: 642 gaaacacggaccaaggagtctgacatgcgtgcaagtcgatgagtcctaaaacctgggatg 701

                                                                       
Query: 310 cgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           | |||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||
Sbjct: 702 cacaaggaagctgacgagtgggaggccctcgcgggcagcaccgctagccgaccctgatct 761



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||| |||||||| |||||||  |||| |||||||||  ||  |||||||||
Sbjct: 396 cttgaaattgccaggagggaatcggatggtagccgacgatgcgccttggttgtatgcgga 455

                                                         
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgt 106
           ||||||   |||||||||||  | ||||| ||| ||||||||||||
Sbjct: 456 acggcttcggctggtccgccaattggctcagggcgtggactgttgt 501



to top

>gb|AF363894.1| Oryza ridleyi clone 8-15 25S ribosomal RNA gene, partial sequence
          Length = 958

 Score =  214 bits (108), Expect = 2e-52
 Identities = 162/180 (90%)
 Strand = Plus / Plus

                                                                       
Query: 190 ggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtctt 249
           |||||| |||||| ||||||| |  ||||||||||||||||||||||||| |||||||||
Sbjct: 582 ggcgtgcccctcgaggcactgtgacgcaacggcctgcgggctccccatccaacccgtctt 641

                                                                       
Query: 250 gcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatg 309
           | |||||||||||||||||||||||||||||| |||||| | ||  | ||||||||||||
Sbjct: 642 gaaacacggaccaaggagtctgacatgcgtgcaagtcgatgagtcctaaaacctgggatg 701

                                                                       
Query: 310 cgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           | |||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||
Sbjct: 702 cacaaggaagctgacgagtgggaggccctcgcgggcagcaccgctagccgaccctgatct 761



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||| |||||||| |||||||  |||| |||||||||  ||  |||||||||
Sbjct: 396 cttgaaattgccaggagggaatcggatggtagccgacgatgcgccttggttgtatgcgga 455

                                                         
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgt 106
           ||||||   |||||||||||  | ||||| ||| ||||||||||||
Sbjct: 456 acggcttcggctggtccgccaattggctcagggcgtggactgttgt 501



to top

>gb|AF363890.1| Oryza longistaminata clone 4-4 25S ribosomal RNA gene, partial
           sequence
          Length = 959

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 604 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 663

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 664 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 722

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 723 ggaggccctcatgggccgcatcgctggccaaccctgatct 762



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363887.1| Oryza officinalis clone 9Nep-29 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363886.1| Oryza officinalis clone 9Nep-1 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363885.1| Oryza officinalis clone 9Nep-9 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363884.1| Oryza officinalis clone 9Nep-24 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363883.1| Oryza officinalis clone 9Nep-18 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363882.1| Oryza officinalis clone 9-14 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363881.1| Oryza officinalis clone 9-28 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363880.1| Oryza officinalis clone 9-12 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  214 bits (108), Expect = 2e-52
 Identities = 148/160 (92%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363918.1| Oryza officinalis clone 9-5 25S ribosomal RNA gene, partial
           sequence
          Length = 906

 Score =  212 bits (107), Expect = 6e-52
 Identities = 147/159 (92%), Gaps = 1/159 (0%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| ||| |||||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 552 cgctgtaacagcctgcgggctccccatctgacccgtcttgaaacacggaccaaggagtct 611

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           |||||||||||||||||| ||||| |||||||| |||||| |||||||||||| ||||||
Sbjct: 612 gacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcgg 670

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||| |||||||| |||||||| ||||||||||
Sbjct: 671 gaggccctcatgggccgcatcgctggccaaccctgatct 709



 Score =  113 bits (57), Expect = 4e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
Sbjct: 345 cttgaaattgctgggagggaagcggatgggggccggcgatgcgccctggtcgtatgcgta 404

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| || ||| |
Sbjct: 405 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccacgccggtg 464

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 465 gccaaagctcgggggcc 481



to top

>gb|AF363908.1| Oryza longistaminata clone 4-7 25S ribosomal RNA gene, partial
           sequence
          Length = 944

 Score =  212 bits (107), Expect = 6e-52
 Identities = 147/159 (92%), Gaps = 1/159 (0%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| |||||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 590 cgctgtaacggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 649

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           |||||||||||||||||| ||||| |||||||| |||||| |||||||||||| ||||||
Sbjct: 650 gacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcgg 708

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||| |||||||| |||||||| ||||||||||
Sbjct: 709 gaggccctcatgggccgcatcgctggccaaccctgatct 747



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
Sbjct: 382 cttgaaattgctgggagggaagcggatgggggccggcgatgcgccctggtcgtatgcgta 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| |  ||| |
Sbjct: 442 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccactccggtg 501

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 502 gccaaagctcgggggcc 518



to top

>dbj|AK105251.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-C11, full
           insert sequence
          Length = 1965

 Score =  212 bits (107), Expect = 6e-52
 Identities = 110/111 (99%)
 Strand = Plus / Plus

                                                                       
Query: 259 accaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaa 318
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 1   accaaggagtctgacatgcgtgcgagtcgacgggttctgaaacctgggatgcgcaaggaa 60

                                                              
Query: 319 gctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  gctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 111



to top

>gb|AF363872.1| Oryza nivara clone 15-34 25S ribosomal RNA gene, partial sequence
          Length = 892

 Score =  208 bits (105), Expect = 9e-51
 Identities = 157/173 (90%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || |||||||| || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacgagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363871.1| Oryza australiensis clone 12-29 25S ribosomal RNA gene, partial
           sequence
          Length = 892

 Score =  208 bits (105), Expect = 9e-51
 Identities = 157/173 (90%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || |||||||| || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacgagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363896.1| Oryza ridleyi clone 8-2 25S ribosomal RNA gene, partial sequence
          Length = 957

 Score =  206 bits (104), Expect = 4e-50
 Identities = 161/180 (89%)
 Strand = Plus / Plus

                                                                       
Query: 190 ggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtctt 249
           |||||| |||| | ||||||| |  ||||||||||||||||||||||||| |||||||||
Sbjct: 581 ggcgtgccccttgaggcactgtgacgcaacggcctgcgggctccccatccaacccgtctt 640

                                                                       
Query: 250 gcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatg 309
           | |||||||||||||||||||||||||||||| |||||| | ||  | ||||||||||||
Sbjct: 641 gaaacacggaccaaggagtctgacatgcgtgcaagtcgatgagtcctaaaacctgggatg 700

                                                                       
Query: 310 cgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           | |||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||
Sbjct: 701 cacaaggaagctgacgagtgggaggccctcgcgggcagcaccgctagccgaccctgatct 760



 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 88/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||| |||||||| |||||||   ||| |||||||||  ||  |||||||||
Sbjct: 395 cttgaaattgccaggagggaatcggatggtacccgacgatgcgccttggttgtatgcgga 454

                                                         
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgt 106
           ||||||   |||||||||||  | ||||| ||| ||||||||||||
Sbjct: 455 acggcttcggctggtccgccaattggctcagggcgtggactgttgt 500



to top

>gb|AF363893.1| Oryza longistaminata clone 4-28 25S ribosomal RNA gene, partial
           sequence
          Length = 945

 Score =  206 bits (104), Expect = 4e-50
 Identities = 147/160 (91%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 590 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 649

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||| ||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 650 tgacatgcgagcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 708

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 709 ggaggccctcatgggccgcatcgctggccaaccctgatct 748



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 382 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 442 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 501

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 502 accaaagcacgggggc 517



to top

>gb|AF363891.1| Oryza longistaminata clone 4-29 25S ribosomal RNA gene, partial
           sequence
          Length = 959

 Score =  206 bits (104), Expect = 4e-50
 Identities = 147/160 (91%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 604 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 663

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 664 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 722

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| ||| |||| ||||||||||
Sbjct: 723 ggaggccctcatgggccgcatcgccggccaaccctgatct 762



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363888.1| Oryza officinalis clone 9Nep-15 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  206 bits (104), Expect = 4e-50
 Identities = 147/160 (91%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||| |||| |||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggccaaccccgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF466389.1| Anarthria humilis 26S ribosomal RNA gene, partial sequence
          Length = 973

 Score =  204 bits (103), Expect = 1e-49
 Identities = 171/191 (89%), Gaps = 2/191 (1%)
 Strand = Plus / Plus

                                                                       
Query: 179 gcgcgccgaaaggcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatc 238
           |||||| | ||||||||||| |  || |||||| ||||||| ||||||||||||||||||
Sbjct: 580 gcgcgctgcaaggcgtgtccttttggacactgc-ctgcaacagcctgcgggctccccatc 638

                                                                       
Query: 239 cgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttga 298
           |||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |||
Sbjct: 639 cgacccgtcttgaaacacggaccaaggagtctgacatgcatgcgagtagacgggttctga 698

                                                                       
Query: 299 aacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggcc 358
           |||||||||||| |||||||||||| ||| |||||  ||| ||||| ||| |||||||||
Sbjct: 699 aacctgggatgcacaaggaagctgatgagtgggagttcctaacgggacgc-ccgctggcc 757

                      
Query: 359 gaccctgatct 369
           |||||||||||
Sbjct: 758 gaccctgatct 768



 Score =  161 bits (81), Expect = 2e-36
 Identities = 102/109 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatggggaccggcgatgtgccccggtcgtatgcgga 461

                                                            
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcgg 109
           ||||||  |||||||||||||||||||||| |||| |||||||||||||
Sbjct: 462 acggcttatgctggtccgccgctcggctcgtggtgcggactgttgtcgg 510



to top

>gb|AF363873.1| Oryza nivara clone 15-3 25S ribosomal RNA gene, partial sequence
          Length = 889

 Score =  200 bits (101), Expect = 2e-48
 Identities = 156/173 (90%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363859.1| Oryza australiensis clone 12-23 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  200 bits (101), Expect = 2e-48
 Identities = 156/173 (90%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363857.1| Oryza nivara clone 15-4 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  200 bits (101), Expect = 2e-48
 Identities = 156/173 (90%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363892.1| Oryza granulata clone 16-3 25S ribosomal RNA gene, partial sequence
          Length = 956

 Score =  198 bits (100), Expect = 9e-48
 Identities = 147/160 (91%), Gaps = 2/160 (1%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||| ||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 gga-gccctcatgggccgcatcgctggccaaccctgatct 759



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363889.1| Oryza officinalis clone 9Nep-5 25S ribosomal RNA gene, partial
           sequence
          Length = 957

 Score =  198 bits (100), Expect = 9e-48
 Identities = 146/160 (91%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatctcgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| |||||||| |||||||  ||||||||||
Sbjct: 721 ggaggccctcatgggccgcatcgctggctaaccctgatct 760



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363879.1| Oryza granulata clone 16-7 25S ribosomal RNA gene, partial sequence
          Length = 956

 Score =  198 bits (100), Expect = 9e-48
 Identities = 147/160 (91%), Gaps = 2/160 (1%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||| ||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 gga-gccctcatgggccgcatcgctggccaaccctgatct 759



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363878.1| Oryza granulata clone 16-22 25S ribosomal RNA gene, partial
           sequence
          Length = 956

 Score =  198 bits (100), Expect = 9e-48
 Identities = 147/160 (91%), Gaps = 2/160 (1%)
 Strand = Plus / Plus

                                                                       
Query: 210 gcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtc 269
           |||| ||||| |||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 602 gcgccgcaacagcctgcgggctccccatccgacccatcttgaaacacggaccaaggagtc 661

                                                                       
Query: 270 tgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||||||| ||||| |||||||| |||||| |||||||||||| |||||
Sbjct: 662 tgacatgcgtgcgagtcgatgggttctgaaacctaggatgc-caaggaagctgatgagcg 720

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||| ||||||| |||||||| |||||||| ||||||||||
Sbjct: 721 gga-gccctcatgggccgcatcgctggccaaccctgatct 759



 Score =  135 bits (68), Expect = 1e-28
 Identities = 119/136 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| | ||
Sbjct: 396 cttgaaattgccgagagggaagcggatgggggccgacgatgcgccccggccgtatacaga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| ||||||| |||||||| |||||| || |||||||| | |||| 
Sbjct: 456 acggcttaggctggtctgccgctcagctcggggcgtggaccgtcgtcggccgtgccggca 515

                           
Query: 121 gccaaagcccgggggc 136
            ||||||| |||||||
Sbjct: 516 accaaagcacgggggc 531



to top

>gb|AF363913.1| Oryza minuta clone 2-8 25S ribosomal RNA gene, partial sequence
          Length = 903

 Score =  196 bits (99), Expect = 4e-47
 Identities = 144/159 (90%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||||| |||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 565 cgctgcagcggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 624

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           |||||||||||||||  ||||||| ||||||| |||||| | ||||||| ||||||||||
Sbjct: 625 gacatgcgtgcgagttaacgggttctgaaacccgggatgtggaaggaagttgacgagcgg 684

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| ||| ||||||||| |||||| ||||||||||
Sbjct: 685 gaggcccgcacaggccgcacccctggccaaccctgatct 723



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 112/134 (83%)
 Strand = Plus / Plus

                                                                       
Query: 3   tgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcggaac 62
           |||||||  ||||||| |||||||||||||| || |||| ||||  ||||||||||| ||
Sbjct: 362 tgaaattaacgggaggaaagcggatgggggctggtgatgtgccctcgccgtatgcgggac 421

                                                                       
Query: 63  ggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggc 122
             ||   |||||||||||  |||| |  ||| |||||| |||||||||| ||||||||||
Sbjct: 422 aacttcagctggtccgccaatcggattagggcgtggacagttgtcggccacgtcggcggc 481

                         
Query: 123 caaagcccgggggc 136
           ||||||||||||||
Sbjct: 482 caaagcccgggggc 495



to top

>gb|AF363912.1| Oryza minuta clone 2-12 25S ribosomal RNA gene, partial sequence
          Length = 904

 Score =  196 bits (99), Expect = 4e-47
 Identities = 144/159 (90%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||||| |||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 566 cgctgcagcggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 625

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           |||||||||||||||  ||||||| ||||||| |||||| | ||||||| ||||||||||
Sbjct: 626 gacatgcgtgcgagttaacgggttctgaaacccgggatgtggaaggaagttgacgagcgg 685

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| ||| ||||||||| |||||| ||||||||||
Sbjct: 686 gaggcccgcacaggccgcacccctggccaaccctgatct 724



 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 3   tgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcggaac 62
           |||||||  ||||||| |||||||||||||| || |||| |||| |||||||||||||||
Sbjct: 362 tgaaattaacgggaggaaagcggatgggggctggtgatgtgccctggccgtatgcggaac 421

                                                                       
Query: 63  ggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggc 122
             ||   |||||||||||  |||| |  ||| |||||| |||||||||| ||||||||||
Sbjct: 422 aacttcagctggtccgccaatcggattagggcgtggacagttgtcggccacgtcggcggc 481

                         
Query: 123 caaagcccgggggc 136
           ||||||||||||||
Sbjct: 482 caaagcccgggggc 495



to top

>gb|AF363910.1| Oryza minuta clone 2-25 25S ribosomal RNA gene, partial sequence
          Length = 904

 Score =  196 bits (99), Expect = 4e-47
 Identities = 144/159 (90%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||||| |||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 566 cgctgcagcggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 625

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           |||||||||||||||  ||||||| ||||||| |||||| | ||||||| ||||||||||
Sbjct: 626 gacatgcgtgcgagttaacgggttctgaaacccgggatgtggaaggaagttgacgagcgg 685

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| ||| ||||||||| |||||| ||||||||||
Sbjct: 686 gaggcccgcacaggccgcacccctggccaaccctgatct 724



 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 3   tgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcggaac 62
           |||||||  ||||||| |||||||||||||| || |||| |||| |||||||||||||||
Sbjct: 362 tgaaattaacgggaggaaagcggatgggggctggtgatgtgccctggccgtatgcggaac 421

                                                                       
Query: 63  ggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggc 122
             ||   |||||||||||  |||| |  ||| |||||| |||||||||| ||||||||||
Sbjct: 422 aacttcagctggtccgccaatcggattagggcgtggacagttgtcggccacgtcggcggc 481

                         
Query: 123 caaagcccgggggc 136
           ||||||||||||||
Sbjct: 482 caaagcccgggggc 495



to top

>gb|AF363920.1| Oryza latifolia clone 3-28 25S ribosomal RNA gene, partial sequence
          Length = 851

 Score =  194 bits (98), Expect = 1e-46
 Identities = 138/150 (92%), Gaps = 1/150 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||||||| |||||||||||||||||||| || | |||||||||||||||||||||||
Sbjct: 612 ggcctgcggg-tccccatccgacccgtcttgaaagatggaccaaggagtctgacatgcgt 670

                                                                       
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctc 339
           || |||||||||||| |||||| ||||||||||||||||||||||||| |||||||||  
Sbjct: 671 gcaagtcgacgggttctgaaacttgggatgcgcaaggaagctgacgagagggaggcccct 730

                                         
Query: 340 acgggccgcaccgctggccgaccctgatct 369
           ||||||  ||||||||||||||||||||||
Sbjct: 731 acgggctacaccgctggccgaccctgatct 760



 Score =  129 bits (65), Expect = 7e-27
 Identities = 120/137 (87%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||||||||
Sbjct: 397 cttgaaattgccgcgagggaagcagatgggggccggcgatgcgccctggccatatgcgga 456

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  || | |||||||| ||  |||||||| || ||||| |||||||||||||  |||||
Sbjct: 457 acaactttggctggtccaccaatcggctcgaggcgtggattgttgtcggccgc-ccggcg 515

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||||| |||||
Sbjct: 516 gccaaagcccgagggcc 532



to top

>gb|AF363870.1| Oryza australiensis clone 12-1 25S ribosomal RNA gene, partial
           sequence
          Length = 892

 Score =  192 bits (97), Expect = 6e-46
 Identities = 155/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| ||||||   |||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgagtcac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || |||||||| || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacgagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363864.1| Oryza glaberrima clone 1-22 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  192 bits (97), Expect = 6e-46
 Identities = 155/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363911.1| Oryza minuta clone 2-27 25S ribosomal RNA gene, partial sequence
          Length = 904

 Score =  188 bits (95), Expect = 9e-45
 Identities = 143/159 (89%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||||| |||||||||||||||||||| | ||||||||| ||||||||| |||||||||
Sbjct: 566 cgctgcagcggcctgcgggctccccatctggcccgtcttgaaacacggactaaggagtct 625

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           |||||||||||||||  ||||||| ||||||| |||||| | ||||||| ||||||||||
Sbjct: 626 gacatgcgtgcgagttaacgggttctgaaacccgggatgtggaaggaagttgacgagcgg 685

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| ||| ||||||||| |||||| ||||||||||
Sbjct: 686 gaggcccgcacaggccgcacccctggccaaccctgatct 724



 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 3   tgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcggaac 62
           |||||||  ||||||| |||||||||||||| || |||| |||| |||||||||||||||
Sbjct: 362 tgaaattaacgggaggaaagcggatgggggctggtgatgtgccctggccgtatgcggaac 421

                                                                       
Query: 63  ggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggc 122
             ||   |||||||||||  |||| |  ||| |||||| |||||||||| ||||||||||
Sbjct: 422 aacttcagctggtccgccaatcggattagggcgtggacagttgtcggccacgtcggcggc 481

                         
Query: 123 caaagcccgggggc 136
           ||||||||||||||
Sbjct: 482 caaagcccgggggc 495



to top

>gb|AF363919.1| Oryza latifolia clone 3-10 25S ribosomal RNA gene, partial sequence
          Length = 851

 Score =  186 bits (94), Expect = 3e-44
 Identities = 137/150 (91%), Gaps = 1/150 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||||||| |||||||||||||||||||| || | |||||||||||||||||||||||
Sbjct: 612 ggcctgcggg-tccccatccgacccgtcttgaaagatggaccaaggagtctgacatgcgt 670

                                                                       
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctc 339
           || |||||||||||| |||||| ||||||||||||||||||||||||| ||||||||   
Sbjct: 671 gcaagtcgacgggttctgaaacttgggatgcgcaaggaagctgacgagagggaggcctct 730

                                         
Query: 340 acgggccgcaccgctggccgaccctgatct 369
           ||||||  ||||||||||||||||||||||
Sbjct: 731 acgggctacaccgctggccgaccctgatct 760



 Score =  129 bits (65), Expect = 7e-27
 Identities = 120/137 (87%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||||||||
Sbjct: 397 cttgaaattgccgcgagggaagcagatgggggccggcgatgcgccctggccatatgcgga 456

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  || | |||||||| ||  |||||||| || ||||| |||||||||||||  |||||
Sbjct: 457 acaactttggctggtccaccaatcggctcgaggcgtggattgttgtcggccgc-ccggcg 515

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||||| |||||
Sbjct: 516 gccaaagcccgagggcc 532



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  186 bits (94), Expect = 3e-44
 Identities = 136/150 (90%)
 Strand = Plus / Plus

                                                                           
Query: 197     ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
               |||||||||||||||| ||||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 8377342 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgttttgaaacac 8377401

                                                                           
Query: 257     ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
               |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 8377402 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 8377461

                                             
Query: 317     aagctgacgagcgggaggccctcacgggcc 346
               || ||||| || || |||||||| ||||||
Sbjct: 8377462 aatctgacaagtggcaggccctcgcgggcc 8377491



 Score =  174 bits (88), Expect = 1e-40
 Identities = 124/136 (91%)
 Strand = Plus / Minus

                                                                           
Query: 234     ccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggt 293
               |||||||||||||||||  ||||||||||||||||||||||||| | |||||||| ||||
Sbjct: 8378252 ccatccgacccgtcttgagacacggaccaaggagtctgacatgcctacgagtcgatgggt 8378193

                                                                           
Query: 294     tttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgc 353
               | || ||||||||||||||||||||||||||||| | ||||||||| |||||||||||||
Sbjct: 8378192 tctggaacctgggatgcgcaaggaagctgacgagtgagaggccctcgcgggccgcaccgc 8378133

                               
Query: 354     tggccgaccctgatct 369
                |||||||||| ||||
Sbjct: 8378132 cggccgaccctaatct 8378117



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                           
Query: 1       cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
               |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 8377162 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 8377221

                                                                           
Query: 61      acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
               ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 8377222 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 8377281

                                
Query: 121     gccaaagcccgggggcc 137
               ||||||||| |||||||
Sbjct: 8377282 gccaaagcctgggggcc 8377298



to top

>dbj|AP005527.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0603C10
          Length = 187620

 Score =  186 bits (94), Expect = 3e-44
 Identities = 136/150 (90%)
 Strand = Plus / Plus

                                                                          
Query: 197    ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
              |||||||||||||||| ||||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 170847 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgttttgaaacac 170906

                                                                          
Query: 257    ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
              |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 170907 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 170966

                                            
Query: 317    aagctgacgagcgggaggccctcacgggcc 346
              || ||||| || || |||||||| ||||||
Sbjct: 170967 aatctgacaagtggcaggccctcgcgggcc 170996



 Score =  174 bits (88), Expect = 1e-40
 Identities = 124/136 (91%)
 Strand = Plus / Minus

                                                                          
Query: 234    ccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtcgacgggt 293
              |||||||||||||||||  ||||||||||||||||||||||||| | |||||||| ||||
Sbjct: 171757 ccatccgacccgtcttgagacacggaccaaggagtctgacatgcctacgagtcgatgggt 171698

                                                                          
Query: 294    tttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgc 353
              | || ||||||||||||||||||||||||||||| | ||||||||| |||||||||||||
Sbjct: 171697 tctggaacctgggatgcgcaaggaagctgacgagtgagaggccctcgcgggccgcaccgc 171638

                              
Query: 354    tggccgaccctgatct 369
               |||||||||| ||||
Sbjct: 171637 cggccgaccctaatct 171622



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                          
Query: 1      cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
              |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 170667 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 170726

                                                                          
Query: 61     acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
              ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 170727 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 170786

                               
Query: 121    gccaaagcccgggggcc 137
              ||||||||| |||||||
Sbjct: 170787 gccaaagcctgggggcc 170803



to top

>gb|AF363923.1| Oryza latifolia clone 3-9 25S ribosomal RNA gene, partial sequence
          Length = 849

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |  |||| ||| ||||||||| ||||||||||||||||||||| || | 
Sbjct: 587 ccctcggggcgccacgctacaatggcctgcgg-ctccccatccgacccgtcttgaaagat 645

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||| || |||||||||||| |||||| ||||||||||||||
Sbjct: 646 ggaccaaggagtctgacatgcgcgcaagtcgacgggttctgaaacttgggatgcgcaagg 705

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||| | |||||||||  |||||| |||||||||||||||| ||||||
Sbjct: 706 aagctgacgggagggaggcccctacgggctgcaccgctggccgaccatgatct 758



 Score =  129 bits (65), Expect = 7e-27
 Identities = 120/137 (87%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||||||||
Sbjct: 395 cttgaaattgccgcgagggaagcagatgggggccggcgatgcgccctggccatatgcgga 454

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  || | |||||||| ||  |||||||| || ||||| |||||||||||||  |||||
Sbjct: 455 acaactttggctggtccaccaatcggctcgaggcgtggattgttgtcggccgc-ccggcg 513

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||||| |||||
Sbjct: 514 gccaaagcccgagggcc 530



to top

>gb|AF363921.1| Oryza latifolia clone 3-3 25S ribosomal RNA gene, partial sequence
          Length = 851

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |  |||| ||| ||||||||| ||||||||||||||||||||| || | 
Sbjct: 589 ccctcggggcgccacgctacaatggcctgcgg-ctccccatccgacccgtcttgaaagat 647

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||| || |||||||||||| |||||| ||||||||||||||
Sbjct: 648 ggaccaaggagtctgacatgcgcgcaagtcgacgggttctgaaacttgggatgcgcaagg 707

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||| | |||||||||  |||||| |||||||||||||||| ||||||
Sbjct: 708 aagctgacgggagggaggcccctacgggctgcaccgctggccgaccatgatct 760



 Score =  127 bits (64), Expect = 3e-26
 Identities = 119/136 (87%), Gaps = 1/136 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||||||||
Sbjct: 397 cttgaaattgccgcgagggaagcagatgggggccggcgatgcgccctggccatatgcgga 456

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  || | |||||||| ||  |||||||| || ||||| |||||||||||||  |||||
Sbjct: 457 acaactttggctggtccaccaatcggctcgaggcgtggattgttgtcggccgc-ccggcg 515

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||| ||||
Sbjct: 516 gccaaagcccgagggc 531



to top

>gb|AF363876.1| Oryza glaberrima clone 1-29 25S ribosomal RNA gene, partial
           sequence
          Length = 941

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 575 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 634

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 635 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 694

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 695 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 746



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 395 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 454

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 455 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 514

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 515 gccaaagcctgggggcc 531



to top

>gb|AF363875.1| Oryza punctata clone 5-27 25S ribosomal RNA gene, partial sequence
          Length = 943

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 575 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 634

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 635 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 694

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 695 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 746



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 114/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 395 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 454

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| | |||||||||| ||| ||| |||||
Sbjct: 455 acggcttcggctggtctacgaattggctcggggcgcggactgttgttggctgcgccggcg 514

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 515 gccaaagcctgggggcc 531



to top

>gb|AF363874.1| Oryza glaberrima clone 1-5 25S ribosomal RNA gene, partial sequence
          Length = 943

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 575 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 634

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 635 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 694

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 695 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 746



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 395 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 454

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 455 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 514

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 515 gccaaagcctgggggcc 531



to top

>gb|AF363867.1| Oryza grandiglumis clone 14-7 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363865.1| Oryza punctata clone 5-21 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363863.1| Oryza punctata clone 5-13 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363862.1| Oryza glaberrima clone 1-11 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363861.1| Oryza glaberrima clone 1-13 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363860.1| Oryza alta clone 11-31 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363858.1| Oryza nivara clone 15-18 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| ||||||||||||||||||||||| |||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcaacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || ||  ||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggccggccctcgcgggccatacctctggccg-ccctgatct 695



to top

>gb|AF363847.1| Oryza rufipogon clone 7-7 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363846.1| Oryza rufipogon clone 7-18 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  184 bits (93), Expect = 1e-43
 Identities = 154/173 (89%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF486829.1| Restio tetraphyllus 26S ribosomal RNA gene, partial sequence
          Length = 955

 Score =  182 bits (92), Expect = 5e-43
 Identities = 119/128 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 402 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 461

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||||||||||||||||||| |||||| |||| |||||||| |||||
Sbjct: 462 acggcttgcgctggtccgccgctcggctcggggcgtggaccgttgccggccgcgccggcg 521

                   
Query: 121 gccaaagc 128
           ||||||||
Sbjct: 522 gccaaagc 529



 Score =  178 bits (90), Expect = 8e-42
 Identities = 111/118 (94%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 594 gcaacggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgaca 653

                                                                     
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           ||| ||||||||||||||   | ||||||||||||| |||||||||||||||||||||
Sbjct: 654 tgcatgcgagtcgacgggcgctaaaacctgggatgcacaaggaagctgacgagcggga 711



to top

>gb|AF363904.1| Oryza rhizomatis clone 13-21 25S ribosomal RNA gene, partial
           sequence
          Length = 944

 Score =  180 bits (91), Expect = 2e-42
 Identities = 142/159 (89%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| |||||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 589 cgctgtaacggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 648

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           ||||||||||||||   | | | | ||||||| |||||||||||||||| |||||||| |
Sbjct: 649 gacatgcgtgcgagataatgtgctctgaaacccgggatgcgcaaggaagttgacgagcag 708

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||| | ||||||||| |||||
Sbjct: 709 gaggccctcacgggccgcaccccaggccgaccccgatct 747



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| ||||||||||||||||||| |||||||||||||| || |||||||| |
Sbjct: 382 cttgaaattgctgggagggaagcggatggggcccggcgatgcgccctggtcgtatgcgta 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| || ||| |
Sbjct: 442 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccacgccggtg 501

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 502 gccaaagctcgggggcc 518



to top

>gb|AF363922.1| Oryza latifolia clone 3-5 25S ribosomal RNA gene, partial sequence
          Length = 851

 Score =  178 bits (90), Expect = 8e-42
 Identities = 148/166 (89%), Gaps = 1/166 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||| |  |||| ||| |||||||||| |||||||||||||||||||| || | 
Sbjct: 589 ccctcggggcgccacgctacaatggcctgcggg-tccccatccgacccgtcttgaaagat 647

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||||||||||||||||||| || |||||||||||| |||||| ||||||||||||||
Sbjct: 648 ggaccaaggagtctgacatgcgcgcaagtcgacgggttctgaaacttgggatgcgcaagg 707

                                                         
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgacc 362
           ||||||||| | |||||||||  |||||| ||||||||||||||||
Sbjct: 708 aagctgacgggagggaggcccctacgggctgcaccgctggccgacc 753



 Score =  129 bits (65), Expect = 7e-27
 Identities = 120/137 (87%), Gaps = 1/137 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||| ||||||||| |||||||||||||||||||||| |||| ||||||||
Sbjct: 397 cttgaaattgccgcgagggaagcagatgggggccggcgatgcgccctggccatatgcgga 456

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  || | |||||||| ||  |||||||| || ||||| |||||||||||||  |||||
Sbjct: 457 acaactttggctggtccaccaatcggctcgaggcgtggattgttgtcggccgc-ccggcg 515

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||||| |||||
Sbjct: 516 gccaaagcccgagggcc 532



to top

>gb|AF363877.1| Oryza ridleyi clone 8-12 25S ribosomal RNA gene, partial sequence
          Length = 958

 Score =  178 bits (90), Expect = 8e-42
 Identities = 144/162 (88%)
 Strand = Plus / Plus

                                                                       
Query: 208 ctgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggag 267
           |||||| |||||| |||| ||||||||||||| |||| ||||| |||| |||||||||| 
Sbjct: 600 ctgcgccgcaacgtcctgtgggctccccatccaacccatcttgaaacatggaccaaggaa 659

                                                                       
Query: 268 tctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgag 327
           ||||||||||||  ||||||| ||||| | ||||||||||||| ||||||||||||| ||
Sbjct: 660 tctgacatgcgtatgagtcgatgggttctaaaacctgggatgcacaaggaagctgacaag 719

                                                     
Query: 328 cgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           | |||||||||| |||||||||| ||||||||||||||||||
Sbjct: 720 caggaggccctcgcgggccgcactgctggccgaccctgatct 761



 Score =  107 bits (54), Expect = 3e-20
 Identities = 109/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||| ||||||||||||| |||||||| |||||||||||||||| ||||||||||
Sbjct: 396 cttgaaattaccgggagggaagcagatgggggtcggcgatgcgccccggtcgtatgcgga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||| ||  ||||||| |||  ||||| ||||| ||||||  ||| |
Sbjct: 456 acggcttcagctggtccaccaatcggctcagggcatggacagttgttggccgcaccggtg 515

                   
Query: 121 gccaaagc 128
           | ||||||
Sbjct: 516 gscaaagc 523



to top

>gb|BT016328.1| Zea mays clone Contig161 mRNA sequence
          Length = 1055

 Score =  178 bits (90), Expect = 8e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 268 tctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgag 327
           |||||||||||||||||||||||||||  |||||||| ||||||||||||||||||||||
Sbjct: 240 tctgacatgcgtgcgagtcgacgggttcagaaacctgagatgcgcaaggaagctgacgag 299

                                                     
Query: 328 cgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 cgggaggccctcacgggccgcaccgctggccgaccctgatct 341



to top

>gb|AF363869.1| Oryza malampuzhaensis clone 10-49 25S ribosomal RNA gene, partial
           sequence
          Length = 891

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||||||| ||||||||| ||| |||||||||||| ||| |||||| |||||
Sbjct: 525 cccttggggcactgcgttgcaacggcttgcaggctccccatccaacctgtcttgaaacac 584

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||| ||||||| || |||||||
Sbjct: 585 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgtaacctggaatacgcaagg 644

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 645 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 696



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 115/138 (83%), Gaps = 1/138 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccgg-cgatgcgccccggccgtatgcgg 59
           |||||||| |||||||| ||||  |||| ||||||  |||||||||| |||||||||| |
Sbjct: 344 cttgaaatcgccgggagagaagtagatgagggccgcacgatgcgccctggccgtatgcag 403

                                                                       
Query: 60  aacggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| ||||
Sbjct: 404 aacggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggc 463

                             
Query: 120 ggccaaagcccgggggcc 137
           |||||||||| |||||||
Sbjct: 464 ggccaaagcctgggggcc 481



to top

>gb|AF363868.1| Oryza rufipogon clone 7-9 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||||||| ||||||||| ||| |||||||||||| ||| |||||| |||||
Sbjct: 524 cccttggggcactgcgttgcaacggcttgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||| ||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgtaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363866.1| Oryza glaberrima clone 1-20 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| ||||||||||||| |||||||||||| |||  ||||| |||||
Sbjct: 524 ccctcggggcactgcgttgcaacggcctgcaggctccccatccaacctatcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||| ||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcatgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || |  |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtgcaaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||  ||||||| ||||| |||| |||||| |||||||||| |||||||||| ||
Sbjct: 344 cttgaaatctccgggagagaagcagatgagggccgacgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||||||| |||||||||||| ||| ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcggggcgtggactgttgttggctgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363856.1| Oryza rufipogon clone 7-19 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||||||| ||||||||| ||| |||||||||||| ||| |||||| |||||
Sbjct: 524 cccttggggcactgcgttgcaacggcttgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||| ||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgtaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363855.1| Oryza malampuzhaensis clone 10-55 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||||||| ||||||||| ||| |||||||||||| ||| |||||| |||||
Sbjct: 524 cccttggggcactgcgttgcaacggcttgcaggctccccatccaacctgtcttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||| ||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgtaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctgacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363854.1| Oryza grandiglumis clone 14-14 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagaggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363853.1| Oryza malampuzhaensis clone 10-21 25S ribosomal RNA gene, partial
           sequence
          Length = 889

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 523 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 582

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 583 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 642

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || ||||| || || |||| ||| ||||||  ||| ||||||| |||||||||
Sbjct: 643 aatctgacaagtggcaggcgctcgcgggccatacctctggccg-ccctgatct 694



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 343 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 402

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 403 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 462

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 463 gccaaagcctgggggcc 479



to top

>gb|AF363850.1| Oryza rufipogon clone 7-20 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 106/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                    
Query: 121 gccaaagcc 129
           |||||||||
Sbjct: 464 gccaaagcc 472



to top

>gb|AF363849.1| Oryza rufipogon clone 7-30 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 112/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| ||| |||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgcccggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363848.1| Oryza rufipogon clone 7-22 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 112/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| ||| |||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgcccggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363845.1| Oryza sativa subsp. indica clone IR36-16 25S ribosomal RNA gene,
           partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363844.1| Oryza sativa subsp. indica clone IR36-2 25S ribosomal RNA gene,
           partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363843.1| Oryza sativa subsp. indica clone IR36-10 25S ribosomal RNA gene,
           partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363842.1| Oryza sativa subsp. indica clone IR36-13 25S ribosomal RNA gene,
           partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363841.1| Oryza officinalis clone 9Nep-31 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363840.1| Oryza latifolia clone 6-79 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363839.1| Oryza grandiglumis clone 14-17 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363838.1| Oryza latifolia clone 6-61 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 112/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||| ||||| |||||||
Sbjct: 464 gccgaagcctgggggcc 480



to top

>gb|AF363837.1| Oryza latifolia clone 6-27 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363836.1| Oryza sativa subsp. indica clone IR36-9 25S ribosomal RNA gene,
           partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363835.1| Oryza latifolia clone 6-6 25S ribosomal RNA gene, partial sequence
          Length = 890

 Score =  176 bits (89), Expect = 3e-41
 Identities = 153/173 (88%), Gaps = 1/173 (0%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           || || || || || |||||||| ||||||  ||| ||||||| |||||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggccatacctctggccg-ccctgatct 695



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363852.1| Oryza grandiglumis clone 14-16 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  170 bits (86), Expect = 2e-39
 Identities = 134/150 (89%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                         
Query: 317 aagctgacgagcgggaggccctcacgggcc 346
           || || || || || |||||||| ||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggcc 673



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF363851.1| Oryza grandiglumis clone 14-11 25S ribosomal RNA gene, partial
           sequence
          Length = 890

 Score =  170 bits (86), Expect = 2e-39
 Identities = 134/150 (89%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||||||||||||||| | ||||||||||| |||||||||||| ||| || ||| |||||
Sbjct: 524 ccctcggggcactgcgttacaacggcctgcaggctccccatccaacctgttttgaaacac 583

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
           |||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 584 ggaccacggagtctgacatgcgtgcgagtcgacgggttttgaaacctggaatacgcaagg 643

                                         
Query: 317 aagctgacgagcgggaggccctcacgggcc 346
           || || || || || |||||||| ||||||
Sbjct: 644 aatctaacaagtggcaggccctcgcgggcc 673



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||| |||||||| ||||| |||| ||||||  ||||||||| |||||||||| ||
Sbjct: 344 cttgaaatcgccgggagagaagcagatgagggccgatgatgcgccctggccgtatgcaga 403

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   |||||||  |   | ||||| ||| |||||||||||| | | ||| |||||
Sbjct: 404 acggcttcggctggtctacgaattggctcagggcgtggactgttgttgactgcgccggcg 463

                            
Query: 121 gccaaagcccgggggcc 137
           ||||||||| |||||||
Sbjct: 464 gccaaagcctgggggcc 480



to top

>gb|AF205520.1|AF205520 Juncus effusus 26S ribosomal RNA gene, partial sequence
          Length = 968

 Score =  170 bits (86), Expect = 2e-39
 Identities = 110/118 (93%)
 Strand = Plus / Plus

                                                                       
Query: 214 tgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgac 273
           |||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 620 tgcatcggcctgtgggctccccatccgacccgtcttgaaacacggaccaaggagtctgac 679

                                                                     
Query: 274 atgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggg 331
           ||||||||||||||||||||   |||||| |||| |||||||||||||||||||||||
Sbjct: 680 atgcgtgcgagtcgacgggtgcggaaacccgggaggcgcaaggaagctgacgagcggg 737



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 48/49 (97%)
 Strand = Plus / Plus

                                                            
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 49
           ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgacccgg 447



 Score = 46.1 bits (23), Expect = 0.080
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 107 cggccgcgtcggcggccaaagcccggg 133
           |||||| ||||||||||||||||||||
Sbjct: 512 cggccgtgtcggcggccaaagcccggg 538



to top

>gb|AF205518.1|AF205518 Rhynchospora latifolia 26S ribosomal RNA gene, partial sequence
          Length = 965

 Score =  168 bits (85), Expect = 8e-39
 Identities = 106/113 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 622 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 681

                                                                
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggg 331
           |||||||||||||||    ||||| |||| |||||||||||||||||||||||
Sbjct: 682 tgcgagtcgacgggtgcgtaaacccgggaggcgcaaggaagctgacgagcggg 734



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                            
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 49
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 447



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 348 caccgctggccgaccctgatct 369
           ||||||||||||||||||||||
Sbjct: 739 caccgctggccgaccctgatct 760



to top

>gb|AF363909.1| Oryza longistaminata clone 4-2 25S ribosomal RNA gene, partial
           sequence
          Length = 960

 Score =  167 bits (84), Expect = 3e-38
 Identities = 142/160 (88%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| |||||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 604 cgctgtaacggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 663

                                                                       
Query: 271 gacatgcgtgcgagtcgacg-ggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||   | | | || ||||||| |||||||||||||||| |||||||| 
Sbjct: 664 gacatgcgtgcgagataatgtgcttctgaaacccgggatgcgcaaggaagttgacgagca 723

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| |||||||||||||| | ||||||||| |||||
Sbjct: 724 ggaggccttcacgggccgcaccccaggccgaccccgatct 763



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
Sbjct: 396 cttgaaattgctgggagggaagcggatgggggccggcgatgcgccctggtcgtatgcgta 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| |  ||| |
Sbjct: 456 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccactccggtg 515

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 516 gccaaagctcgggggcc 532



to top

>gb|AF363907.1| Oryza longistaminata clone 4-5 25S ribosomal RNA gene, partial
           sequence
          Length = 946

 Score =  167 bits (84), Expect = 3e-38
 Identities = 142/160 (88%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| |||||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 590 cgctgtaacggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 649

                                                                       
Query: 271 gacatgcgtgcgagtcgacg-ggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||   | | | || ||||||| |||||||||||||||| |||||||| 
Sbjct: 650 gacatgcgtgcgagataatgtgcttctgaaacccgggatgcgcaaggaagttgacgagca 709

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| |||||||||||||| | ||||||||| |||||
Sbjct: 710 ggaggccttcacgggccgcaccccaggccgaccccgatct 749



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
Sbjct: 382 cttgaaattgctgggagggaagcggatgggggccggcgatgcgccctggtcgtatgcgta 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| |  ||| |
Sbjct: 442 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccactccggtg 501

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 502 gccaaagctcgggggcc 518



to top

>gb|AF363906.1| Oryza rhizomatis clone 13-22 25S ribosomal RNA gene, partial
           sequence
          Length = 946

 Score =  167 bits (84), Expect = 3e-38
 Identities = 142/160 (88%), Gaps = 1/160 (0%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| |||||||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 590 cgctgtaacggcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 649

                                                                       
Query: 271 gacatgcgtgcgagtcgacg-ggttttgaaacctgggatgcgcaaggaagctgacgagcg 329
           ||||||||||||||   | | | || ||||||| |||||||||||||||| |||||||| 
Sbjct: 650 gacatgcgtgcgagataatgtgcttctgaaacccgggatgcgcaaggaagttgacgagca 709

                                                   
Query: 330 ggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||| |||||||||||||| | ||||||||| |||||
Sbjct: 710 ggaggccttcacgggccgcaccccaggccgaccccgatct 749



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| ||||||||||||||||||| |||||||||||||| || |||||||| |
Sbjct: 382 cttgaaattgctgggagggaagcggatggggcccggcgatgcgccctggtcgtatgcgta 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| || ||| |
Sbjct: 442 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccacgccggtg 501

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 502 gccaaagctcgggggcc 518



to top

>dbj|AK110180.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-H04, full
           insert sequence
          Length = 3016

 Score =  167 bits (84), Expect = 3e-38
 Identities = 99/104 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23  cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 82

                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgtt 104
           ||||||   |||||||||||| ||||||||||| ||||||||||
Sbjct: 83  acggcttcggctggtccgccgatcggctcggggcgtggactgtt 126



to top

>gb|AF363902.1| Oryza officinalis clone 9-8 25S ribosomal RNA gene, partial
           sequence
          Length = 944

 Score =  165 bits (83), Expect = 1e-37
 Identities = 140/159 (88%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| ||| |||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 589 cgctgtaacagcctgcgggctccccatctgacccgtcttgaaacacggactaaggagtct 648

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           ||||||||||||||   | | | | ||||||| |||||||| ||||||| |||||||| |
Sbjct: 649 gacatgcgtgcgagataatgtgctctgaaacccgggatgcgtaaggaagttgacgagcag 708

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||| | ||||||||| |||||
Sbjct: 709 gaggccctcacgggccgcaccccaggccgaccccgatct 747



 Score =  113 bits (57), Expect = 4e-22
 Identities = 117/137 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
Sbjct: 382 cttgaaattgctgggagggaagcggatgggggccggcgatgcgccctggtcgtatgcgta 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| || ||| |
Sbjct: 442 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccacgccggtg 501

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 502 gccaaagctcgggggcc 518



to top

>gb|AF363901.1| Oryza rhizomatis clone 13-14 25S ribosomal RNA gene, partial
           sequence
          Length = 944

 Score =  165 bits (83), Expect = 1e-37
 Identities = 140/159 (88%)
 Strand = Plus / Plus

                                                                       
Query: 211 cgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           ||||| ||| |||||||||||||||||| ||||||||||| ||||||||| |||||||||
Sbjct: 589 cgctgtaacagcctgcgggctccccatctgacccgtcttgtaacacggactaaggagtct 648

                                                                       
Query: 271 gacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgg 330
           ||||||||||||||   | | | | ||||||| |||||||| ||||||| |||||||| |
Sbjct: 649 gacatgcgtgcgagataatgtgctctgaaacccgggatgcgtaaggaagttgacgagcag 708

                                                  
Query: 331 gaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||| | ||||||||| |||||
Sbjct: 709 gaggccctcacgggccgcaccccaggccgaccccgatct 747



 Score =  105 bits (53), Expect = 1e-19
 Identities = 116/137 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| ||||||||||||||||||| |||||||||||||| || |||||||| |
Sbjct: 382 cttgaaattgctgggagggaagcggatggggcccggcgatgcgccctggtcgtatgcgta 441

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||  ||   |||||||||||  |  | || ||| ||||||||||||||||| || ||| |
Sbjct: 442 acaacttcggctggtccgccaatttgatcagggcgtggactgttgtcggccacgccggtg 501

                            
Query: 121 gccaaagcccgggggcc 137
           |||||||| ||||||||
Sbjct: 502 gccaaagctcgggggcc 518



to top

>gb|AF363917.1| Oryza australiensis clone 12-17 25S ribosomal RNA gene, partial
           sequence
          Length = 953

 Score =  161 bits (81), Expect = 2e-36
 Identities = 150/173 (86%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||| ||||  ||| ||||||  ||||||||||||||| ||||||| |||||
Sbjct: 584 cccttggggcaccgcgccacaatggcctgtaggctccccatccgactcgtcttgaaacac 643

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
            |||||||||||||||| |||||| ||| |||||||||||||||||| ||||||||||||
Sbjct: 644 agaccaaggagtctgacttgcgtgtgaggcgacgggttttgaaacctaggatgcgcaagg 703

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| ||||||||   | ||||| ||||||| || |||| ||||||
Sbjct: 704 aagctgacgagtgggaggcctcgatgggccacaccgcttgctgaccttgatct 756



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||| |||||||||| ||||||||||||| ||| ||||| ||| ||||||||
Sbjct: 393 cttgaaattgccaggagggaagcagatgggggccggcaatgtgccccagccttatgcgga 452

                 
Query: 61  acggct 66
           ||||||
Sbjct: 453 acggct 458



to top

>gb|AF363916.1| Oryza granulata clone 16-4 25S ribosomal RNA gene, partial sequence
          Length = 953

 Score =  161 bits (81), Expect = 2e-36
 Identities = 150/173 (86%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||| ||||  ||| ||||||  ||||||||||||||| ||||||| |||||
Sbjct: 584 cccttggggcaccgcgccacaatggcctgtaggctccccatccgactcgtcttgaaacac 643

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
            |||||||||||||||| |||||| ||| |||||||||||||||||| ||||||||||||
Sbjct: 644 agaccaaggagtctgacttgcgtgtgaggcgacgggttttgaaacctaggatgcgcaagg 703

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| ||||||||   | ||||| ||||||| || |||| ||||||
Sbjct: 704 aagctgacgagtgggaggcctcgatgggccacaccgcttgctgaccttgatct 756



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||| |||||||||| ||||||||||||| ||| ||||| ||| ||||||||
Sbjct: 393 cttgaaattgccaggagggaagcagatgggggccggcaatgtgccccagccttatgcgga 452

                 
Query: 61  acggct 66
           ||||||
Sbjct: 453 acggct 458



to top

>gb|AF363915.1| Oryza granulata clone 16-18 25S ribosomal RNA gene, partial
           sequence
          Length = 953

 Score =  161 bits (81), Expect = 2e-36
 Identities = 150/173 (86%)
 Strand = Plus / Plus

                                                                       
Query: 197 ccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacac 256
           |||| ||||||| ||||  ||| ||||||  ||||||||||||||| ||||||| |||||
Sbjct: 584 cccttggggcaccgcgccacaatggcctgtaggctccccatccgactcgtcttgaaacac 643

                                                                       
Query: 257 ggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgcgcaagg 316
            |||||||||||||||| |||||| ||| |||||||||||||||||| ||||||||||||
Sbjct: 644 agaccaaggagtctgacttgcgtgtgaggcgacgggttttgaaacctaggatgcgcaagg 703

                                                                
Query: 317 aagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||| ||||||||   | ||||| ||||||| || |||| ||||||
Sbjct: 704 aagctgacgagtgggaggcctcgatgggccacaccgcttgctgaccttgatct 756



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 60/66 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||| |||||||||| ||||||||||||| ||| ||||| ||| ||||||||
Sbjct: 393 cttgaaattgccaggagggaagcagatgggggccggcaatgtgccccagccttatgcgga 452

                 
Query: 61  acggct 66
           ||||||
Sbjct: 453 acggct 458



to top

>gb|AY079520.1| Typha domingensis 26S ribosomal RNA gene, partial sequence
          Length = 979

 Score =  155 bits (78), Expect = 1e-34
 Identities = 121/134 (90%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 458

                                                                       
Query: 61  acggctct-tgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           ||||||||  || |||||||| |||||||||||| | |||| ||||  ||||||||||||
Sbjct: 459 acggctctaagccggtccgccactcggctcggggcgcggaccgttgcgggccgcgtcggc 518

                         
Query: 120 ggccaaagcccggg 133
           |||| |||||||||
Sbjct: 519 ggcctaagcccggg 532



 Score =  147 bits (74), Expect = 3e-32
 Identities = 135/153 (88%), Gaps = 3/153 (1%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 623 cggcccgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 682

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           ||||||||||||||     ||||| || | ||||||||||||||||||||||||  ||| 
Sbjct: 683 tgcgagtcgacgggcgcgaaaacccggtaggcgcaaggaagctgacgagcgggaaccccc 742

                                            
Query: 339 c--acgggccgcaccgctggccgaccctgatct 369
              | ||||||| ||||||||||||||||||||
Sbjct: 743 tgtaggggccgc-ccgctggccgaccctgatct 774



to top

>gb|AF466386.1| Xyris laxifolia var. iridifolia 26S ribosomal RNA gene, partial
           sequence
          Length = 960

 Score =  155 bits (78), Expect = 1e-34
 Identities = 127/143 (88%), Gaps = 4/143 (2%)
 Strand = Plus / Plus

                                                                       
Query: 225 gcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgag 284
           |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 607 gcgggctccccacccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgag 666

                                                                       
Query: 285 tcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcac--- 341
           |||||||| | | ||||| |  | |||||||||||||||| ||||||| |||| |||   
Sbjct: 667 tcgacgggctctaaaacccgataggcgcaaggaagctgactagcgggaagcccccaccgg 726

                                  
Query: 342 -gggccgcaccgctggccgaccc 363
            ||||||||||||||||||||||
Sbjct: 727 ggggccgcaccgctggccgaccc 749



 Score =  133 bits (67), Expect = 4e-28
 Identities = 100/111 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||| ||||  ||||||||||||||
Sbjct: 398 cttgaaattgccgggagggaagcggatgggggccggcgacgcgcgtcggccgtatgcgga 457

                                                              
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggcc 111
           |||||||  || ||||||||||||||||||  | |||||| || |||||||
Sbjct: 458 acggctcgcgccggtccgccgctcggctcgtcgcgtggaccgtcgtcggcc 508



to top

>gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partial sequence
          Length = 3316

 Score =  155 bits (78), Expect = 1e-34
 Identities = 105/114 (92%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 610 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 669

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| ||||||||  ||||||| || | ||||||||||||||| | ||||||
Sbjct: 670 tgcgagccgacgggtgctgaaacccggaaggcgcaaggaagctgatgtgcggga 723



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 59/63 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||  ||||||| |||||||
Sbjct: 375 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtgccggccggatgcgga 434

              
Query: 61  acg 63
           |||
Sbjct: 435 acg 437



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 73  ggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggccaaagcc 129
           |||||||||||||||||||  || |||| ||||  ||||| | |||||||| |||||
Sbjct: 451 ggtccgccgctcggctcggcatgcggaccgttgcgggccgtgccggcggcccaagcc 507



to top

>gb|AF290584.1|AF290584 Asphodeline lutea 26S ribosomal RNA gene, partial sequence
          Length = 991

 Score =  155 bits (78), Expect = 1e-34
 Identities = 105/114 (92%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 635 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 694

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| ||||||||  ||||||| || | ||||||||||||||| | ||||||
Sbjct: 695 tgcgagccgacgggtgctgaaacccggaaggcgcaaggaagctgatgcgcggga 748



 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%), Gaps = 5/134 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcgccggccggatgcgga 458

                                                                       
Query: 61  acggctc-----ttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgt 115
           ||||| |       || ||||||||||||||||||| | | |||| ||||  ||||||| 
Sbjct: 459 acggcccggacagggccggtccgccgctcggctcggcgcgcggaccgttgcgggccgcgc 518

                         
Query: 116 cggcggccaaagcc 129
           |||||||| |||||
Sbjct: 519 cggcggcccaagcc 532



to top

>gb|AF290587.1|AF290587 Anigozanthos flavidus 26S ribosomal RNA gene, partial sequence
          Length = 982

 Score =  153 bits (77), Expect = 5e-34
 Identities = 129/145 (88%), Gaps = 1/145 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 626 cggccagcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 685

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||| ||||||||   |||||| || | ||||||||||||||||| ||||||| ||| 
Sbjct: 686 tgcgagccgacgggtgcggaaacccggaaggcgcaaggaagctgacgggcgggagccccc 745

                                    
Query: 339 c-acgggccgcaccgctggccgacc 362
           |  |||| |||||||| ||||||||
Sbjct: 746 ctgcggggcgcaccgccggccgacc 770



 Score =  137 bits (69), Expect = 3e-29
 Identities = 117/133 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggccggatgcgga 458

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           |||||    || ||||||||||||||||||||| |||||| | ||  ||||||  |||||
Sbjct: 459 acggcgagagccggtccgccgctcggctcggggcgtggaccgctgcgggccgctccggcg 518

                        
Query: 121 gccaaagcccggg 133
           ||| || ||||||
Sbjct: 519 gccgaaacccggg 531



to top

>gb|AF205128.1|AF205128 Trillium gracilie 26S ribosomal RNA gene, partial sequence
          Length = 985

 Score =  153 bits (77), Expect = 5e-34
 Identities = 104/113 (92%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 630 ggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgt 689

                                                                
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           ||||||| ||||||   ||||||||| | ||| ||||||||||||| ||||||
Sbjct: 690 gcgagtcaacgggtgaggaaacctggaaggcgtaaggaagctgacgggcggga 742



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 41/41 (100%)
 Strand = Plus / Plus

                                                    
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatg 41
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatg 439



to top

>gb|AF293852.1|AF293852 Smilax bona-nox internal transcribed spacer 2 and 26S large subunit
           ribosomal RNA gene, partial sequence
          Length = 948

 Score =  151 bits (76), Expect = 2e-33
 Identities = 115/128 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccggatgcgga 458

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||  |  || ||||||||||||||||||||| | |||| ||||  ||||||| |||||
Sbjct: 459 acggtgcgagccggtccgccgctcggctcggggcgcggaccgttgcgggccgcgccggcg 518

                   
Query: 121 gccaaagc 128
           ||| ||||
Sbjct: 519 gccgaagc 526



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||| |||||||||||||||||||||  |||| |||||||||||||||||||| |
Sbjct: 592 cggcctgcgagctccccatccgacccgtcttaaaacatggaccaaggagtctgacatgtg 651

                                                      
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagct 321
           |||||| ||| |||     |||||| ||| |||||||||||||
Sbjct: 652 tgcgagccgatgggcacgaaaacctaggaggcgcaaggaagct 694



to top

>gb|AF262003.1|AF262003 Sparattanthelium septentrionale 26S ribosomal RNA gene, partial
           sequence; chloroplast gene for chloroplast product
          Length = 582

 Score =  151 bits (76), Expect = 2e-33
 Identities = 119/132 (90%), Gaps = 1/132 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||
Sbjct: 343 cttgaaattgccgggagggaagcggatgggggccggcgatgcgcctcggtcggatgcgga 402

                                                                       
Query: 61  acgg-ctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||| |||  || ||||||||||||||||||||| | |||||||||  ||||||| ||||
Sbjct: 403 acggcctcaagccggtccgccgctcggctcggggcgcggactgttgcgggccgcggcggc 462

                       
Query: 120 ggccaaagcccg 131
           |||| |||||||
Sbjct: 463 ggcctaagcccg 474



to top

>gb|AF290588.1|AF290588 Trachycarpus fortunei 26S ribosomal RNA gene, partial sequence
          Length = 996

 Score =  147 bits (74), Expect = 3e-32
 Identities = 107/118 (90%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
Sbjct: 626 gcaacggcccgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgata 685

                                                                     
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           ||||||||||||||||||    |||||| || | ||||||||||||||||| ||||||
Sbjct: 686 tgcgtgcgagtcgacgggcgcggaaacccggaaggcgcaaggaagctgacgggcggga 743



 Score =  131 bits (66), Expect = 2e-27
 Identities = 118/134 (88%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcacctcggccggatgcgga 458

                                                                       
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||     || ||||||||||||||||||||| | |||| ||||  ||||||| ||||
Sbjct: 459 acggcggagagccggtccgccgctcggctcggggcgcggaccgttgcgggccgcgccggc 518

                         
Query: 120 ggccaaagcccggg 133
           |||| |||||||||
Sbjct: 519 ggccgaagcccggg 532



to top

>gb|AF290585.1|AF290585 Hypoxis hirsuta 26S ribosomal RNA gene, partial sequence
          Length = 977

 Score =  147 bits (74), Expect = 3e-32
 Identities = 104/114 (91%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 621 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 680

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| ||||||||   |||||| || | ||||||||||||||| | ||||||
Sbjct: 681 tgcgagccgacgggtgccgaaacccggaaggcgcaaggaagctgatgggcggga 734



 Score =  145 bits (73), Expect = 1e-31
 Identities = 118/133 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||| |||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgctccggccggatgtgga 458

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           |||||||  || ||||| ||||||||||||||| | |||| | ||  ||||||| |||||
Sbjct: 459 acggctcacgccggtccaccgctcggctcggggcgcggaccgatgcgggccgcgccggcg 518

                        
Query: 121 gccaaagcccggg 133
           |||||||||||||
Sbjct: 519 gccaaagcccggg 531



to top

>gb|AF203679.1|AF203679 Acorus calamus 26S ribosomal RNA gene, partial sequence
          Length = 987

 Score =  147 bits (74), Expect = 3e-32
 Identities = 95/102 (93%)
 Strand = Plus / Plus

                                                                       
Query: 223 ctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcg 282
           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 636 ctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcg 695

                                                     
Query: 283 agtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           |||| |||||| |  ||||| |||| ||||||||||||||||
Sbjct: 696 agtcaacgggtgtgcaaacccgggaggcgcaaggaagctgac 737



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 115/135 (85%), Gaps = 3/135 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| |||| || ||| |||||| |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggctggcggtgtgcctcggccggatgcgga 458

                                                                       
Query: 61  acggctctt--gctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcgg 118
           |||| | ||  || |||||||| |||||||||||||| ||||  |||  || |||| |||
Sbjct: 459 acgg-tgttgagccggtccgccactcggctcggggtgcggaccattgcgggtcgcgacgg 517

                          
Query: 119 cggccaaagcccggg 133
           || ||||||||||||
Sbjct: 518 cgaccaaagcccggg 532



to top

>dbj|AK105535.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-H02, full
           insert sequence
          Length = 1576

 Score =  147 bits (74), Expect = 3e-32
 Identities = 74/74 (100%)
 Strand = Plus / Plus

                                                                       
Query: 296 tgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctg 355
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   tgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcaccgctg 61

                         
Query: 356 gccgaccctgatct 369
           ||||||||||||||
Sbjct: 62  gccgaccctgatct 75



to top

>gb|AF205878.1|AF205878 Xerophyta retinervis 26S ribosomal RNA gene, partial sequence
          Length = 987

 Score =  145 bits (73), Expect = 1e-31
 Identities = 134/153 (87%), Gaps = 1/153 (0%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 630 acggccagcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgc 689

                                                                       
Query: 278 gtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga-ggcc 336
           ||||||| |||||||    |||||| || | ||||||||||||||||| ||||||   ||
Sbjct: 690 gtgcgagccgacgggcgcggaaacccggaaggcgcaaggaagctgacgggcgggatcccc 749

                                            
Query: 337 ctcacgggccgcaccgctggccgaccctgatct 369
           ||| ||||  ||||||| ||||||||| |||||
Sbjct: 750 ctcgcggggtgcaccgccggccgaccccgatct 782



 Score =  105 bits (53), Expect = 1e-19
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggctggatgcgga 458

                
Query: 61  acggc 65
           |||||
Sbjct: 459 acggc 463



to top

>gb|AF203684.1|AF203684 Hypoxis hirsuta 26S ribosomal RNA gene, partial sequence
          Length = 975

 Score =  145 bits (73), Expect = 1e-31
 Identities = 118/133 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||| |||
Sbjct: 396 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgctccggccggatgtgga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           |||||||  || ||||| ||||||||||||||| | |||| | ||  ||||||| |||||
Sbjct: 456 acggctcacgccggtccaccgctcggctcggggcgcggaccgatgcgggccgcgccggcg 515

                        
Query: 121 gccaaagcccggg 133
           |||||||||||||
Sbjct: 516 gccaaagcccggg 528



 Score =  115 bits (58), Expect = 1e-22
 Identities = 100/114 (87%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 619 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 678

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           | |    ||||||||   |||||| || | ||||||||||||||| | ||||||
Sbjct: 679 tccagcccgacgggtgccgaaacccggaaggcgcaaggaagctgatgggcggga 732



to top

>gb|AF331971.1| Colchicum autumnale 26S ribosomal RNA gene, partial sequence
          Length = 981

 Score =  145 bits (73), Expect = 1e-31
 Identities = 118/133 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccggatgcgga 458

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           |||||    || ||||||||||||||||||||| | |||| | ||  ||| ||| |||||
Sbjct: 459 acggcgagagccggtccgccgctcggctcggggcgcggaccgatgcgggctgcgccggcg 518

                        
Query: 121 gccaaagcccggg 133
           ||| |||||||||
Sbjct: 519 gcctaagcccggg 531



 Score =  133 bits (67), Expect = 4e-28
 Identities = 102/114 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||
Sbjct: 625 cggnctgcgggctccccacccgacccgtcttgaaacacggaccaaggagtctgacatgcg 684

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| ||||||||   |||||| || | ||||||||||||||| | ||||||
Sbjct: 685 tgcgagccgacgggtgcggaaacccggaaggcgcaaggaagctgatgggcggga 738



to top

>gb|AF205521.1|AF205521 Canna flaccida 26S ribosomal RNA gene, partial sequence
          Length = 982

 Score =  143 bits (72), Expect = 5e-31
 Identities = 133/152 (87%), Gaps = 1/152 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 626 cggccagcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 685

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggg-aggccc 337
            ||||||||||||||   |||||| || | ||||||||||||||| | ||||| |  |||
Sbjct: 686 cgcgagtcgacgggtgcggaaacccggaaggcgcaaggaagctgatgggcgggaaccccc 745

                                           
Query: 338 tcacgggccgcaccgctggccgaccctgatct 369
           ||  |||  ||||||| |||||||||||||||
Sbjct: 746 tcgaggggtgcaccgccggccgaccctgatct 777



 Score =  127 bits (64), Expect = 3e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||| || |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgtgccccggtcggatgcgga 458

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||||||||||||||||| ||||
Sbjct: 459 acggcgagagccggtccgccgctcggctcggggtgcggac 498



to top

>gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA gene, partial
           sequence
          Length = 3213

 Score =  143 bits (72), Expect = 5e-31
 Identities = 93/100 (93%)
 Strand = Plus / Plus

                                                                       
Query: 225 gcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgag 284
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 634 gcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgag 693

                                                   
Query: 285 tcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           || |||||| |  ||||| |||| ||||||||||||||||
Sbjct: 694 tcaacgggtgtgcaaacccgggaggcgcaaggaagctgac 733



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 113/134 (84%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| |||| || ||| |||||| |||||||
Sbjct: 396 cttgaaattgtcgggagggaagcggatgggggctggcggtgtgcctcggccggatgcgga 455

                                                                       
Query: 61  acggctct-tgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           ||||  ||  || |||||||| |||||||||||| | ||||  |||  || |||| ||||
Sbjct: 456 acggtgctgagccggtccgccactcggctcggggcgcggaccattgcgggtcgcgacggc 515

                         
Query: 120 ggccaaagcccggg 133
           | ||||||||||||
Sbjct: 516 gaccaaagcccggg 529



to top

>gb|U52604.1|JDU52604 Jeffersonia diphylla nuclear 26S ribosomal RNA gene, partial
           sequence
          Length = 1047

 Score =  143 bits (72), Expect = 5e-31
 Identities = 93/100 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||||||||  ||||||||||||| ||||||| ||||||
Sbjct: 387 acggctcttgtcggtccgccgctcgactcggggcgtggac 426



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 551 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 610

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 611 tgcgagtcaacggg 624



to top

>gb|AY968422.1| Tetrameles nudiflora 26S ribosomal RNA gene, partial sequence
          Length = 929

 Score =  141 bits (71), Expect = 2e-30
 Identities = 131/151 (86%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 611 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 670

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||||||||| |   ||||| | || ||||||||||||||||  ||||||  ||||
Sbjct: 671 tgcgagtcgacgggctagtaaacccgtgaggcgcaaggaagctgactggcgggatcccct 730

                                          
Query: 339 cacgggccgcaccgctggccgaccctgatct 369
           |  |||| ||||||| | |||||| ||||||
Sbjct: 731 cgtgggctgcaccgccgaccgaccttgatct 761



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||| |||| ||||| || ||| |||
Sbjct: 386 cttgaaattgtcgggagggaagcggatgggggccggcggtgcgtcccggtcggatgtgga 445

               
Query: 61  acgg 64
           ||||
Sbjct: 446 acgg 449



to top

>gb|AF205517.1|AF205517 Pontederia cordata 26S ribosomal RNA gene, partial sequence
          Length = 993

 Score =  141 bits (71), Expect = 2e-30
 Identities = 104/115 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||| |||| |||
Sbjct: 628 cggccagcgggctccccatccgacccgtcttgaaacacggaccaaggagtccgacacgcg 687

                                                                  
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggag 333
            ||||||||||||||   |||||| |||| ||||||||||||||||| |||||||
Sbjct: 688 cgcgagtcgacgggtgcggaaacccgggaggcgcaaggaagctgacgggcgggag 742



 Score =  109 bits (55), Expect = 6e-21
 Identities = 61/63 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcggcccggccggatgcgga 458

              
Query: 61  acg 63
           |||
Sbjct: 459 acg 461



to top

>gb|AF203678.1|AF203678 Arisaema triphyllum 26S ribosomal RNA gene, partial sequence
          Length = 985

 Score =  141 bits (71), Expect = 2e-30
 Identities = 98/107 (91%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 628 acggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgc 687

                                                          
Query: 278 gtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           ||||||||| ||||||   |||||| | || |||||||||| |||||
Sbjct: 688 gtgcgagtcaacgggtgcggaaacccgtgaggcgcaaggaaactgac 734



 Score =  119 bits (60), Expect = 7e-24
 Identities = 117/135 (86%), Gaps = 2/135 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 400 cttgaaattgtcgggagggaagcggatgggggccggcgatgcacctcggccggatgcgga 459

                                                                       
Query: 61  acggc--tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcgg 118
           |||||      || |||||||||||||||||||||||||||| || |  || || |||||
Sbjct: 460 acggcgacaaagccggtccgccgctcggctcggggtgtggaccgtcgcgggtcgtgtcgg 519

                          
Query: 119 cggccaaagcccggg 133
           ||||| |||||||||
Sbjct: 520 cggcctaagcccggg 534



to top

>gb|AF290586.1|AF290586 Alstroemeria pulchra 26S ribosomal RNA gene, partial sequence
          Length = 987

 Score =  139 bits (70), Expect = 7e-30
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||
Sbjct: 631 cggcctgcgggctccccacccgacccgtcttgaaacacggaccaaggagtctgacatgcg 690

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| |||||||    |||||| |||| ||||||||||||||| | ||||||
Sbjct: 691 tgcgagccgacgggcgcggaaacccgggaggcgcaaggaagctgatgggcggga 744



 Score =  111 bits (56), Expect = 2e-21
 Identities = 116/136 (85%), Gaps = 3/136 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||  |||||| || |||||||
Sbjct: 399 cttgaaattgncgggagggaagcggatgggggccggcgatgtnccccggtcggatgcgga 458

                                                                       
Query: 61  acggc---tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcg 117
           |||||    |  || ||||||||||||||||||||| | |||| | ||  ||||||| ||
Sbjct: 459 acggcccaacgggccggtccgccgctcggctcggggcgcggaccgatgcgggccgcggcg 518

                           
Query: 118 gcggccaaagcccggg 133
           |||||| |||||||||
Sbjct: 519 gcggccgaagcccggg 534



to top

>gb|AF205123.1|AF205123 Dioscorea macrostachya 26S ribosomal RNA gene, partial sequence
          Length = 991

 Score =  139 bits (70), Expect = 7e-30
 Identities = 119/134 (88%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccggatgcgga 458

                                                                       
Query: 61  acggctct-tgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||  |  || ||||||||||||||||||||  | |||| | ||  ||||||| ||||
Sbjct: 459 acggcgatgagccggtccgccgctcggctcgggccgcggaccgatgcgggccgcggcggc 518

                         
Query: 120 ggccaaagcccggg 133
           |||| |||||||||
Sbjct: 519 ggccgaagcccggg 532



 Score =  131 bits (66), Expect = 2e-27
 Identities = 102/114 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 634 cggcccgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 693

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| |||||||    |||||| || | ||||||||||||||| | ||||||
Sbjct: 694 tgcgagccgacgggcgcggaaacccggaaggcgcaaggaagctgaagggcggga 747



to top

>gb|AF203685.1|AF203685 Alophia drummondii 26S ribosomal RNA gene, partial sequence
          Length = 987

 Score =  139 bits (70), Expect = 7e-30
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 631 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 690

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| | |||||||   ||||| || | ||||||||||||||| | ||||||
Sbjct: 691 tgcgagccaacgggttcccaaacccggaaggcgcaaggaagctgatgggcggga 744



 Score =  133 bits (67), Expect = 4e-28
 Identities = 119/136 (87%), Gaps = 4/136 (2%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcgccggccggatgcgga 458

                                                                       
Query: 61  acggctctt----gctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtc 116
           ||||| |||    |||||||||||||||||||||| | | |||| ||||  ||| ||| |
Sbjct: 459 acggcccttaccggctggtccgccgctcggctcggcgcgcggaccgttgcgggctgcgcc 518

                           
Query: 117 ggcggccaaagcccgg 132
           ||||||| ||||||||
Sbjct: 519 ggcggcccaagcccgg 534



to top

>gb|AF203683.1|AF203683 Asparagus officinalis 26S ribosomal RNA gene, partial sequence
          Length = 992

 Score =  139 bits (70), Expect = 7e-30
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 636 cggcccgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 695

                                                                 
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||| | |||||  |||||||| || | ||||||||||||||| | ||||||
Sbjct: 696 tgcgagccaacgggcgttgaaacccggaaggcgcaaggaagctgatgtgcggga 749



 Score =  115 bits (58), Expect = 1e-22
 Identities = 119/140 (85%), Gaps = 7/140 (5%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgcgccggccggatgcgga 458

                                                                       
Query: 61  acggctctt-------gctggtccgccgctcggctcggggtgtggactgttgtcggccgc 113
           ||| | | |       ||||||||| |||||||||||| | |||||| ||||  ||||||
Sbjct: 459 acgaccccttacgggggctggtccgtcgctcggctcggtgcgtggaccgttgcgggccgc 518

                               
Query: 114 gtcggcggccaaagcccggg 133
             |||||||| |||||||||
Sbjct: 519 accggcggcctaagcccggg 538



to top

>gb|AF331972.1| Musa x paradisiaca 26S ribosomal RNA gene, partial sequence
          Length = 986

 Score =  139 bits (70), Expect = 7e-30
 Identities = 97/106 (91%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 637 gggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagtc 696

                                                         
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||||   |||||| || | || |||||||||||||| ||||||
Sbjct: 697 gacgggtgcggaaacccggaaggcacaaggaagctgacgggcggga 742



 Score =  111 bits (56), Expect = 2e-21
 Identities = 87/96 (90%), Gaps = 1/96 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||| || ||| || |||||||
Sbjct: 401 cttgaaattgccgggagggaagcggatgggggccggcgatgcacctcggtcggatgcgga 460

                                               
Query: 61  acggctct-tgctggtccgccgctcggctcggggtg 95
           |||||  |  || |||||||||||||||||||||||
Sbjct: 461 acggcggtcagccggtccgccgctcggctcggggtg 496



to top

>gb|AF205519.1|AF205519 Philydrum lanuginosum 26S ribosomal RNA gene, partial sequence
          Length = 975

 Score =  137 bits (69), Expect = 3e-29
 Identities = 133/153 (86%), Gaps = 1/153 (0%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 618 acggtctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgc 677

                                                                       
Query: 278 gtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggag-gcc 336
           |||||||||   ||||   |||||| |  | ||||||||||||||||| |||||||  ||
Sbjct: 678 gtgcgagtctttgggtgcggaaacccgcaaggcgcaaggaagctgacgggcgggagcccc 737

                                            
Query: 337 ctcacgggccgcaccgctggccgaccctgatct 369
           |||  ||| |||||||| ||||||||| |||||
Sbjct: 738 ctcgaggggcgcaccgccggccgaccccgatct 770



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                            
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 49
           |||||||||| ||||||||||||||||||||||||||||||||| ||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgctccgg 447



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 73  ggtccgccgctcggctcgggg 93
           |||||||||||||||||||||
Sbjct: 461 ggtccgccgctcggctcgggg 481



to top

>gb|AF205516.1|AF205516 Commelina virginica 26S ribosomal RNA gene, partial sequence
          Length = 983

 Score =  137 bits (69), Expect = 3e-29
 Identities = 87/93 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccggatgcgga 458

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 459 acggcgagagccggtccgccgctcggctcgggg 491



 Score =  117 bits (59), Expect = 3e-23
 Identities = 71/75 (94%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||| ||||||||| ||||||||||||||||||| |||||||
Sbjct: 627 cggccagcgggctccccatccggcccgtcttgaaacacggaccaaggagtcttacatgcg 686

                          
Query: 279 tgcgagtcgacgggt 293
           |||||||||||||||
Sbjct: 687 tgcgagtcgacgggt 701



to top

>gb|AY292915.1| Triglochin sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3322

 Score =  135 bits (68), Expect = 1e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 794 ggcctgcgggcttcccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgt 853

                                                       
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           ||||||||| |||| |||||||| |  | |||||| ||||||||
Sbjct: 854 gcgagtcgatgggtgttgaaacccgtaaggcgcaaagaagctga 897



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||| | ||| || | |||||
Sbjct: 568 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtctcggtcggaagcgga 627

               
Query: 61  acgg 64
           ||||
Sbjct: 628 acgg 631



to top

>gb|AY292901.1| Nuphar sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3568

 Score =  135 bits (68), Expect = 1e-28
 Identities = 93/100 (93%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 587 cttgaaattgccgggagggaagcggatgggggccggcgatgcgcctcggtcgtatgcgga 646

                                                   
Query: 61  acggctct-tgctggtccgccgctcggctcggggtgtgga 99
           ||||||||  || ||||||||| |||||||| ||||||||
Sbjct: 647 acggctctcagccggtccgccgatcggctcgaggtgtgga 686



 Score =  129 bits (65), Expect = 7e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
Sbjct: 816 cggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtg 875

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| |||||| | |||||| || | ||| |||||||||||
Sbjct: 876 tgcgagtcaacgggtgtggaaacccggaaggcgaaaggaagctga 920



to top

>gb|DQ008660.1| Nuphar sp. Qiu M114 26S ribosomal RNA gene, partial sequence
          Length = 2516

 Score =  135 bits (68), Expect = 1e-28
 Identities = 93/100 (93%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||
Sbjct: 376 cttgaaattgccgggagggaagcggatgggggccggcgatgcgcctcggtcgtatgcgga 435

                                                   
Query: 61  acggctct-tgctggtccgccgctcggctcggggtgtgga 99
           ||||||||  || ||||||||| |||||||| ||||||||
Sbjct: 436 acggctctcagccggtccgccgatcggctcgaggtgtgga 475



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 92/105 (87%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||| ||||| ||||| ||| |||||||||||||||||||||| || |
Sbjct: 605 cggcctgcgggctccc-atccggcccgttttgaaacacggaccaaggagtctgacttgtg 663

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| |||||| | |||||| || | ||| |||||||||||
Sbjct: 664 tgcgagtcaacgggtgtggaaacccggaaggcgaaaggaagctga 708



to top

>gb|DQ008650.1| Triglochin maritimum 26S ribosomal RNA gene, partial sequence
          Length = 3156

 Score =  135 bits (68), Expect = 1e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 549 ggcctgcgggcttcccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgt 608

                                                       
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           ||||||||| |||| |||||||| |  | |||||| ||||||||
Sbjct: 609 gcgagtcgatgggtgttgaaacccgtaaggcgcaaagaagctga 652



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||| | ||| || | |||||
Sbjct: 323 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtctcggtcggaagcgga 382

               
Query: 61  acgg 64
           ||||
Sbjct: 383 acgg 386



to top

>gb|AY968419.1| Octomeles sumatrana 26S ribosomal RNA gene, partial sequence
          Length = 936

 Score =  133 bits (67), Expect = 4e-28
 Identities = 130/151 (86%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 601 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 660

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||||||||| |   ||||| |  | ||||||||||||||||  ||||||  ||||
Sbjct: 661 tgcgagtcgacgggctagtaaacccgtaaggcgcaaggaagctgactggcgggatcccct 720

                                          
Query: 339 cacgggccgcaccgctggccgaccctgatct 369
           | ||||  ||||||| | |||||| ||||||
Sbjct: 721 cgcgggttgcaccgccgaccgaccttgatct 751



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||| |||| ||||| || ||| |||
Sbjct: 376 cttgaaattgtcgggagggaagcggatgggggccggcggtgcgtcccggtcggatgtgga 435

                
Query: 61  acggc 65
           |||||
Sbjct: 436 acggc 440



to top

>gb|U52629.1|CAU52629 Cimicifuga americana nuclear 26S ribosomal RNA gene, partial
           sequence
          Length = 1046

 Score =  133 bits (67), Expect = 4e-28
 Identities = 85/91 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| |||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgctccggtcggatgcgga 386

                                          
Query: 61  acggctcttgctggtccgccgctcggctcgg 91
           |||||| | ||||||||||||||||||||||
Sbjct: 387 acggctatagctggtccgccgctcggctcgg 417



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 62/67 (92%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||| ||||||||||||| || ||||||||| ||||||||||||||||||||||||| ||
Sbjct: 553 ggccagcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgt 612

                  
Query: 280 gcgagtc 286
           |||||||
Sbjct: 613 gcgagtc 619



to top

>gb|AY957453.1| Santalum album 26S ribosomal RNA gene, partial sequence
          Length = 3306

 Score =  131 bits (66), Expect = 2e-27
 Identities = 96/106 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 602 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 661

                                                         
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           |||||||| ||||||||  ||||||| || ||  ||||||||||||
Sbjct: 662 tgcgagtcaacgggtttgtaaacctgcgaggcataaggaagctgac 707



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 58/65 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| ||||||| ||| ||| || ||| |||
Sbjct: 375 cttgaaattgtcgggagggaagcggatgggggctggcgatgtgcctcggtcgcatgtgga 434

                
Query: 61  acggc 65
           |||||
Sbjct: 435 acggc 439



to top

>gb|AF293855.1|AF293855 Mayaca fluviatilis internal transcribed spacer 2 and 26S large
           subunit ribosomal RNA gene, partial sequence
          Length = 988

 Score =  131 bits (66), Expect = 2e-27
 Identities = 103/114 (90%), Gaps = 1/114 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||| ||||||||||||||||||||||||||||||| |  ||||| |||||||
Sbjct: 399 cttgaaattgctgggagggaagcggatgggggccggcgatgcgtcttggccggatgcgga 458

                                                                 
Query: 61  acggct-cttgctggtccgccgctcggctcggggtgtggactgttgtcggccgc 113
           |||||| ||||| ||||||||||||||||||||||| |||  ||||||| ||||
Sbjct: 459 acggctccttgccggtccgccgctcggctcggggtgcggatcgttgtcgcccgc 512



 Score =  115 bits (58), Expect = 1e-22
 Identities = 94/106 (88%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           |||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||||||
Sbjct: 639 gggctccccacccgacccgtcttgaaacacggaccaaggagtctgacgtgcgtgcgagtc 698

                                                         
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
            |||||    |||||| | || ||||||||||||||| ||||||||
Sbjct: 699 aacgggcgcagaaacccgagaggcgcaaggaagctgatgagcggga 744



to top

>gb|AF205514.1|AF205514 Corsia sp. Neyland 1834 26S ribosomal RNA gene, partial sequence
          Length = 1243

 Score =  131 bits (66), Expect = 2e-27
 Identities = 105/118 (88%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           ||||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||
Sbjct: 628 gcaacggccagcgggctccccacccgacccgtcttgaaacacggaccaaggagtctgaca 687

                                                                     
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           |||||||||| |||||||    |||||| || | ||||||||||||||| | ||||||
Sbjct: 688 tgcgtgcgagccgacgggcgcggaaacccggaaggcgcaaggaagctgatgggcggga 745



 Score =  125 bits (63), Expect = 1e-25
 Identities = 117/134 (87%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcncctcggccggatgcgga 458

                                                                       
Query: 61  acggctct-tgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||  |  || ||||||||||||||||||||| | |||| ||||  ||| ||  ||||
Sbjct: 459 acggcgatcagccggtccgccgctcggctcggggcgcggaccgttgcgggctgccccggc 518

                         
Query: 120 ggccaaagcccggg 133
           |||| |||||||||
Sbjct: 519 ggcccaagcccggg 532



to top

>gb|AY686767.1| Boehmeria nivea voucher G. Weiblen 1214 (MIN) 26S ribosomal RNA
           gene, partial sequence
          Length = 985

 Score =  129 bits (65), Expect = 7e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 510 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 569

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||| | ||||| | || |||||||||||||||
Sbjct: 570 tgcgagtcaacgggttatcaaacccgtgaggcgcaaggaagctga 614



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||| ||| ||| || |||||||
Sbjct: 283 cttgaaattgtcgggagggaagcggatgggggccggcgatgtgcctcggtcggatgcgga 342

            
Query: 61  a 61
           |
Sbjct: 343 a 343



to top

>gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score =  129 bits (65), Expect = 7e-27
 Identities = 98/109 (89%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 585 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 644

                                                            
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           || ||||||||| ||||| | | ||||| |  | |||||||||||||||
Sbjct: 645 tgtgtgcgagtcaacgggctatcaaacccgtaaggcgcaaggaagctga 693



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 109/134 (81%), Gaps = 1/134 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||| |||||| ||||||||||||| || || ||||| || ||| |||
Sbjct: 362 cttgaaattgtcgggaaggaagcagatgggggccggcaatncgtcccggtcggatgtgga 421

                                                                       
Query: 61  acgg-ctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           ||||  ||  || ||||||||| ||| ||||||| |||||  ||||  |   ||| ||||
Sbjct: 422 acggtgtcaagccggtccgccgatcgactcggggcgtggatcgttgcggattgcggcggc 481

                         
Query: 120 ggccaaagcccggg 133
           ||||||||||||||
Sbjct: 482 ggccaaagcccggg 495



to top

>gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, partial sequence
          Length = 3344

 Score =  129 bits (65), Expect = 7e-27
 Identities = 93/101 (92%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||| ||||| || |||||||
Sbjct: 382 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtcccggtcggatgcgga 441

                                                    
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggac 100
           ||||| ||| |||||||||||||||| ||||||| ||||||
Sbjct: 442 acggcttctagctggtccgccgctcgactcggggcgtggac 482



 Score =  103 bits (52), Expect = 4e-19
 Identities = 64/68 (94%)
 Strand = Plus / Plus

                                                                       
Query: 226 cgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagt 285
           |||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||
Sbjct: 621 cgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagt 680

                   
Query: 286 cgacgggt 293
           | ||||||
Sbjct: 681 caacgggt 688



to top

>gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score =  129 bits (65), Expect = 7e-27
 Identities = 87/93 (93%), Gaps = 1/93 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 381 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 440

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||| |||||||||||||| |||||||||||
Sbjct: 441 acggct-ttgctggtccgccgatcggctcgggg 472



 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 61/66 (92%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 612 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 671

                 
Query: 287 gacggg 292
            |||||
Sbjct: 672 aacggg 677



to top

>gb|AY095456.1| Ceratophyllum demersum 26S ribosomal RNA gene, partial sequence
          Length = 3305

 Score =  129 bits (65), Expect = 7e-27
 Identities = 96/105 (91%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 603 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 662

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||  ||||||| | |  |||||||||||||||
Sbjct: 663 tgcgagtcaacgggtgctgaaacccgag-ggcgcaaggaagctga 706



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||| |||| ||| || |||| ||
Sbjct: 375 cttgaaattgtcgggagggaagcggatgggggccggcgatccgcctcggacggatgcaga 434

               
Query: 61  acgg 64
           ||||
Sbjct: 435 acgg 438



to top

>gb|AY292904.1| Ceratophyllum demersum 26S ribosomal RNA gene, partial sequence
          Length = 3320

 Score =  129 bits (65), Expect = 7e-27
 Identities = 96/105 (91%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 603 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 662

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||  ||||||| | |  |||||||||||||||
Sbjct: 663 tgcgagtcaacgggtgctgaaacccgag-ggcgcaaggaagctga 706



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||| |||| ||| || |||| ||
Sbjct: 375 cttgaaattgtcgggagggaagcggatgggggccggcgatccgcctcggacggatgcaga 434

               
Query: 61  acgg 64
           ||||
Sbjct: 435 acgg 438



to top

>gb|AY954473.1| Aconitum racemulosum 26S ribosomal RNA gene, partial sequence
          Length = 1322

 Score =  129 bits (65), Expect = 7e-27
 Identities = 86/93 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 386

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    ||||||||||||||||||||||||
Sbjct: 387 acggcgaaagctggtccgccgctcggctcgggg 419



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619



to top

>gb|AF290583.1|AF290583 Anthericum ramosum 26S ribosomal RNA gene, partial sequence
          Length = 991

 Score =  129 bits (65), Expect = 7e-27
 Identities = 95/105 (90%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 635 cggccagcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 694

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||| |||||||  |  ||||| || | |||||||||||||||
Sbjct: 695 tgcgagccgacgggcgtgaaaacccggaaggcgcaaggaagctga 739



 Score =  119 bits (60), Expect = 7e-24
 Identities = 119/139 (85%), Gaps = 6/139 (4%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| |||||||||| ||||||| |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggctggcgatgcgcgccggccggatgcgga 458

                                                                       
Query: 61  acggctctt------gctggtccgccgctcggctcggggtgtggactgttgtcggccgcg 114
           ||||||| |      || ||||||||||||||||||| ||| |||| ||||  ||||| |
Sbjct: 459 acggctcctaacggggccggtccgccgctcggctcggcgtgcggaccgttgcgggccgtg 518

                              
Query: 115 tcggcggccaaagcccggg 133
             |||||||||||||||||
Sbjct: 519 ctggcggccaaagcccggg 537



to top

>gb|AF205127.1|AF205127 Melanthium virginicum 26S ribosomal RNA gene, partial sequence
          Length = 983

 Score =  129 bits (65), Expect = 7e-27
 Identities = 89/97 (91%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
Sbjct: 635 gggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagcc 694

                                                
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagctga 323
           || |||||| || |||||| | |||||||||||||||
Sbjct: 695 gatgggtttggatacctggaaggcgcaaggaagctga 731



 Score = 85.7 bits (43), Expect = 9e-14
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||| || ||||||| ||| |||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgtgctccggccggatgtgga 458

              
Query: 61  acg 63
           |||
Sbjct: 459 acg 461



to top

>gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score =  129 bits (65), Expect = 7e-27
 Identities = 98/109 (89%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 682

                                                            
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           || ||||||||| ||||| | | ||||| |  | |||||||||||||||
Sbjct: 683 tgtgtgcgagtcaacgggctatcaaacccgtaaggcgcaaggaagctga 731



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||| ||||| || ||| |||
Sbjct: 400 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtcccggtcggatgtgga 459

               
Query: 61  acgg 64
           ||||
Sbjct: 460 acgg 463



to top

>gb|AF297532.1|AF297532 Cornus florida 26S ribosomal RNA gene, partial sequence
          Length = 3347

 Score =  129 bits (65), Expect = 7e-27
 Identities = 98/109 (89%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 621 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 680

                                                            
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           || ||||||||| ||||| | | ||||| |  | |||||||||||||||
Sbjct: 681 tgtgtgcgagtcaacgggctatcaaacccgtaaggcgcaaggaagctga 729



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                            
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 49
           |||||||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtcccgg 447



to top

>gb|DQ008622.1| Ceratophyllum submersum 26S ribosomal RNA gene, partial sequence
          Length = 2911

 Score =  129 bits (65), Expect = 7e-27
 Identities = 96/105 (91%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 482 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 541

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||  ||||||| | |  |||||||||||||||
Sbjct: 542 tgcgagtcaacgggtgctgaaacccgag-ggcgcaaggaagctga 585



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||| |||| ||| || |||| ||
Sbjct: 254 cttgaaattgtcgggagggaagcggatgggggccggcgatccgcctcggacggatgcaga 313

               
Query: 61  acgg 64
           ||||
Sbjct: 314 acgg 317



to top

>gb|AF479228.1| Ceratophyllum demersum 26S ribosomal RNA gene, complete sequence
          Length = 3320

 Score =  129 bits (65), Expect = 7e-27
 Identities = 96/105 (91%), Gaps = 1/105 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 603 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 662

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||  ||||||| | |  |||||||||||||||
Sbjct: 663 tgcgagtcaacgggtgctgaaacccgag-ggcgcaaggaagctga 706



 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 58/64 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||| |||| ||| || |||| ||
Sbjct: 375 cttgaaattgtcgggagggaagcggatgggggccggcgatccgcctcggacggatgcaga 434

               
Query: 61  acgg 64
           ||||
Sbjct: 435 acgg 438



to top

>gb|U90699.1|CLU90699 Cunninghamia lanceolata 28S ribosomal RNA gene, partial sequence
          Length = 629

 Score =  129 bits (65), Expect = 7e-27
 Identities = 86/93 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 369 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 428

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           ||||| |  || |||||||||||||||||||||
Sbjct: 429 acggcgcgagccggtccgccgctcggctcgggg 461



to top

>gb|AF364029.1| Campynema linearis 26S large subunit ribosomal RNA gene, partial
           sequence
          Length = 984

 Score =  129 bits (65), Expect = 7e-27
 Identities = 98/109 (89%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||| || |||||||||||| ||||||||||||| |||||||||||||||||||||||
Sbjct: 625 gcaacgaccagcgggctccccacccgacccgtcttgaaacacggaccaaggagtctgaca 684

                                                            
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||||| ||||||||   |||||| || | |||||||||||||||
Sbjct: 685 tgcgtgcgagccgacgggtacggaaacccggaaggcgcaaggaagctga 733



 Score =  117 bits (59), Expect = 3e-23
 Identities = 83/91 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcgcgccggtcggatgcgga 458

                                          
Query: 61  acggctcttgctggtccgccgctcggctcgg 91
           |||||  |  | |||||||||||||||||||
Sbjct: 459 acggcgatgcccggtccgccgctcggctcgg 489



to top

>gb|U52626.1|CAU52626 Consolida ambigua nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1046

 Score =  129 bits (65), Expect = 7e-27
 Identities = 86/93 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 386

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    ||||||||||||||||||||||||
Sbjct: 387 acggcgagagctggtccgccgctcggctcgggg 419



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619



to top

>gb|AF363897.1| Oryza latifolia clone 6-80 25S ribosomal RNA gene, partial sequence
          Length = 958

 Score =  127 bits (64), Expect = 3e-26
 Identities = 118/136 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||| | |||||| ||||| ||||||||||||  |||||||||
Sbjct: 396 cttgaaattgccgggagggaatcagatgggagccggtgatgcgccccggttgtatgcgga 455

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   ||||||| |||  || ||||| |||||||||  ||||||||| || |||||
Sbjct: 456 acggcttcggctggtctgcccgtcagctcgaggtgtggaccattgtcggccacgccggcg 515

                           
Query: 121 gccaaagcccgggggc 136
           ||||||||||||||||
Sbjct: 516 gccaaagcccgggggc 531



 Score =  125 bits (63), Expect = 1e-25
 Identities = 150/179 (83%)
 Strand = Plus / Plus

                                                                       
Query: 191 gcgtgtccctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttg 250
           ||||| |||||||||| || ||  ||||| |||| ||||||||||||| ||||  | |||
Sbjct: 583 gcgtgcccctcggggcgctacgtcgcaacagcctacgggctccccatctgacctatgttg 642

                                                                       
Query: 251 caacacggaccaaggagtctgacatgcgtgcgagtcgacgggttttgaaacctgggatgc 310
            || | |||||| ||||||||||||||||| ||||||||||||  |  ||||||||||||
Sbjct: 643 aaagatggaccatggagtctgacatgcgtgtgagtcgacgggtcctagaacctgggatgc 702

                                                                      
Query: 311 gcaaggaagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
             ||||||||||| |||| ||||||||||  ||||||||| |||||| |||||| ||||
Sbjct: 703 ataaggaagctgatgagcaggaggccctcgtgggccgcactgctggctgaccctaatct 761



to top

>gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, partial sequence
          Length = 3330

 Score =  127 bits (64), Expect = 3e-26
 Identities = 92/100 (92%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||| |||||||||||||||| || ||| |||
Sbjct: 381 cttgaaattgtcgggagggaagcggatgggggtcggcgatgcgccccggtcggatgtgga 440

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 441 acggct-ttgctggtccgccgatcggctcggggcgtggac 479



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 604 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 663

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 664 tgcgagtcaacggg 677



to top

>gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score =  127 bits (64), Expect = 3e-26
 Identities = 131/152 (86%), Gaps = 1/152 (0%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
Sbjct: 607 cggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtg 666

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||| |||||   | ||||| |  | ||||||||||||||||  |||||| |||| 
Sbjct: 667 tgcgagtcaacgggcgattaaacccgtaaggcgcaaggaagctgactggcgggacgcccc 726

                                           
Query: 339 c-acgggccgcaccgctggccgaccctgatct 369
           |  ||||||||||||| | |||||| ||||||
Sbjct: 727 cggcgggccgcaccgccgaccgaccttgatct 758



 Score =  103 bits (52), Expect = 4e-19
 Identities = 88/100 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 382 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 441

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||| ||||||| ||||||
Sbjct: 442 acggcgagagccggtccgccgatcgactcggggcgtggac 481



to top

>gb|AY954469.1| Cimicifuga simplex 26S ribosomal RNA gene, partial sequence
          Length = 1322

 Score =  127 bits (64), Expect = 3e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||| || |||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgtgctccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||| | |||||||||||||||||||||| ||| ||||
Sbjct: 387 acggctatagctggtccgccgctcggctcggtgtgcggac 426



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619



to top

>gb|AY954467.1| Eranthis stellata 26S ribosomal RNA gene, partial sequence
          Length = 1322

 Score =  127 bits (64), Expect = 3e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||| || |||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgtgcaccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||| | |||||||||||||||||||||| ||| ||||
Sbjct: 387 acggctatagctggtccgccgctcggctcggtgtgcggac 426



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 62/67 (92%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619

                  
Query: 287 gacgggt 293
            ||||||
Sbjct: 620 aacgggt 626



to top

>gb|AF274655.1| Myriophyllum exalbescens 26S ribosomal RNA gene, complete sequence
          Length = 3358

 Score =  127 bits (64), Expect = 3e-26
 Identities = 92/100 (92%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||
Sbjct: 396 cttgaaattgtcgggagggaagcggatgggggctggcgatgcgccccggtcgtatgcgga 455

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||  |||||||||||||| ||| ||||||| ||||||
Sbjct: 456 acggc-attgctggtccgccgatcgactcggggcgtggac 494



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 621 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 680

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 681 tgcgagtcaacggg 694



to top

>gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, partial sequence
          Length = 3081

 Score =  127 bits (64), Expect = 3e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||||
Sbjct: 366 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtcccggccggatgcgga 425

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || |||| |||||||||||||||||||||||
Sbjct: 426 acggcaaaagccggtctgccgctcggctcggggtgtggac 465



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           |||||| | |||| ||| ||||| ||||||||| ||||||||||||||||||||||||||
Sbjct: 588 acggccggtgggccccctatccggcccgtcttgaaacacggaccaaggagtctgacatgc 647

                          
Query: 278 gtgcgagtcgacggg 292
           ||||||||| |||||
Sbjct: 648 gtgcgagtcaacggg 662



to top

>gb|AF131288.1| Souliea vaginata 26S ribosomal RNA gene, partial sequence
          Length = 987

 Score =  127 bits (64), Expect = 3e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||| || |||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgtgctccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||| | |||||||||||||||||||||| | ||||||
Sbjct: 387 acggctatagctggtccgccgctcggctcggtgcgtggac 426



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 551 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 610



to top

>gb|AF262005.1|AF262005 Caryodaphnopsis bilocellata 26S ribosomal RNA gene, partial
           sequence; chloroplast gene for chloroplast product
          Length = 584

 Score =  127 bits (64), Expect = 3e-26
 Identities = 116/132 (87%), Gaps = 1/132 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||| ||| || |||||||
Sbjct: 343 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcctcggtcggatgcgga 402

                                                                       
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           ||||| ||  || ||||||||||||||||||||| | |||| ||||  || |||| ||||
Sbjct: 403 acggcgtcgagccggtccgccgctcggctcggggcgcggaccgttgcgggtcgcggcggc 462

                       
Query: 120 ggccaaagcccg 131
           |||| |||||||
Sbjct: 463 ggcctaagcccg 474



to top

>gb|U52628.1|AAU52628 Actaea alba nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1046

 Score =  127 bits (64), Expect = 3e-26
 Identities = 91/100 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||| || |||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgtgctccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||| | |||||||||||||||||||||| ||| ||||
Sbjct: 387 acggctatagctggtccgccgctcggctcggtgtgcggac 426



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 62/67 (92%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||| ||||||||||||| || ||||||||| ||||||||||||||||||||||||| ||
Sbjct: 553 ggccagcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgt 612

                  
Query: 280 gcgagtc 286
           |||||||
Sbjct: 613 gcgagtc 619



to top

>gb|AY686836.1| Bagassa guianensis voucher G. Weiblen 1677 (MIN) 26S ribosomal RNA
           gene, partial sequence
          Length = 985

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
Sbjct: 509 cggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtg 568

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||| ||||||    ||||| |  | ||||||||||||||||  ||||||  ||||
Sbjct: 569 tgcgagtcaacgggtgagtaaacccgcaaggcgcaaggaagctgactggcgggatcccct 628

                                          
Query: 339 cacgggccgcaccgctggccgaccctgatct 369
           | ||||  ||||||| | |||||| ||||||
Sbjct: 629 cgcgggttgcaccgccgaccgaccttgatct 659



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 283 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 342

               
Query: 61  acgg 64
           ||||
Sbjct: 343 acgg 346



to top

>gb|AY686806.1| Trophis racemosa voucher G. Weiblen 1400 (MIN) 26S ribosomal RNA
           gene, partial sequence
          Length = 985

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
Sbjct: 509 cggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtg 568

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||| ||||||    ||||| |  | ||||||||||||||||  ||||||  ||||
Sbjct: 569 tgcgagtcaacgggtgaataaacccgtaaggcgcaaggaagctgactggcgggatcccct 628

                                          
Query: 339 cacgggccgcaccgctggccgaccctgatct 369
           | ||||  ||||||| | |||||| ||||||
Sbjct: 629 cgcgggttgcaccgccgaccgaccttgatct 659



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 283 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 342

               
Query: 61  acgg 64
           ||||
Sbjct: 343 acgg 346



to top

>gb|AF468133.1| Begonia sp. Forrest 177 26S large subunit ribosomal RNA gene,
           partial sequence
          Length = 548

 Score =  125 bits (63), Expect = 1e-25
 Identities = 129/151 (85%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 333 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 392

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||| |||||   | ||||| | || ||||||||||||||||  ||||||  ||||
Sbjct: 393 tgcgagtcaacgggccataaaacccgtgaggcgcaaggaagctgactggcgggatcccct 452

                                          
Query: 339 cacgggccgcaccgctggccgaccctgatct 369
           |  |||  ||||||| | |||||| ||||||
Sbjct: 453 cgagggttgcaccgccgaccgaccttgatct 483



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||| |||| ||||| || ||| |||
Sbjct: 108 cttgaaattgtcgggagggaagcggatgggggccggcggtgcgtcccggtcggatgtgga 167

                
Query: 61  acggc 65
           |||||
Sbjct: 168 acggc 172



to top

>gb|AF531249.1| Encephalartos arenarius 26S ribosomal RNA gene, partial sequence
          Length = 605

 Score =  125 bits (63), Expect = 1e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| |||||||||||| |||||| || |||||||
Sbjct: 335 cttgaaattgccgggagggaagcggatggaggccggcgatgcaccccggtcggatgcgga 394

                                              
Query: 61  acggctcttgctggtccgccgctcggctcggggtg 95
           ||| |  |||| |||||||||||||||||||||||
Sbjct: 395 acgacggttgccggtccgccgctcggctcggggtg 429



 Score = 40.1 bits (20), Expect = 4.9
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 224 tgcgggctccccatccgacccgtcttgcaacacggaccaa 263
           ||||||||  |||| || ||||||||| ||||||||||||
Sbjct: 566 tgcgggctttccattcggcccgtcttgaaacacggaccaa 605



to top

>gb|AY954478.1| Enemion raddeanum 26S ribosomal RNA gene, partial sequence
          Length = 1321

 Score =  125 bits (63), Expect = 1e-25
 Identities = 84/91 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcgccggccggatgcgga 386

                                          
Query: 61  acggctcttgctggtccgccgctcggctcgg 91
           |||||    ||||||||||||||||||||||
Sbjct: 387 acggcgagagctggtccgccgctcggctcgg 417



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 559 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 618

                                              
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagct 321
             |||||  | ||||| | || |||||||||||||
Sbjct: 619 agcgggtgattaaacccgtgaggcgcaaggaagct 653



to top

>gb|AY056513.1| Taxus baccata 26S ribosomal RNA gene, partial sequence
          Length = 1177

 Score =  125 bits (63), Expect = 1e-25
 Identities = 127/147 (86%), Gaps = 1/147 (0%)
 Strand = Plus / Plus

                                                                       
Query: 224 tgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcga 283
           ||||||||  ||||||||||||||||| ||||||||||||||||||| ||||| ||||||
Sbjct: 583 tgcgggctttccatccgacccgtcttgaaacacggaccaaggagtctaacatgtgtgcga 642

                                                                       
Query: 284 gtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctc-acg 342
           |||| ||||||| |||||| | || ||||||||||||||||  ||| ||| |||||  ||
Sbjct: 643 gtcggcgggtttggaaacccgcgaggcgcaaggaagctgactggcgagagcccctcttcg 702

                                      
Query: 343 ggccgcaccgctggccgaccctgatct 369
           ||  ||||||| | |||||||||||||
Sbjct: 703 gggtgcaccgccgaccgaccctgatct 729



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 81/93 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||| |||||||||||| |||||| || |||||||
Sbjct: 353 cttgaaattgtcgggagggaagcggatggaggccggcgatgctccccggtcggatgcgga 412

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           ||||     || |||||||| ||||||||||||
Sbjct: 413 acggtgtgagccggtccgccactcggctcgggg 445



to top

>gb|AY056505.1| Thujopsis dolabrata 26S ribosomal RNA gene, partial sequence
          Length = 1191

 Score =  125 bits (63), Expect = 1e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||| ||||| || |||||||
Sbjct: 366 cttgaaattgccgggagggaagcggatggaggccggcgatgcgtcccggtcggatgcgga 425

                                              
Query: 61  acggctcttgctggtccgccgctcggctcggggtg 95
           ||||| |  || |||||||||||||||||||||||
Sbjct: 426 acggcgcgagccggtccgccgctcggctcggggtg 460



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||| |||||||  ||||||||||||||||| ||||||||||||||||||| ||||| ||
Sbjct: 592 ggccagcgggctttccatccgacccgtcttgaaacacggaccaaggagtctaacatgtgt 651

                                                        
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           |||||| | ||||||  |||||| | || ||| ||||||||||||
Sbjct: 652 gcgagttggcgggttgggaaacccgcgaggcgaaaggaagctgac 696



to top

>gb|AY056480.1| Bowenia serrulata 26S ribosomal RNA gene, partial sequence
          Length = 1207

 Score =  125 bits (63), Expect = 1e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 379 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 438

                                              
Query: 61  acggctcttgctggtccgccgctcggctcggggtg 95
           ||| |  |||  |||||||||||||||||||||||
Sbjct: 439 acgacggttgtcggtccgccgctcggctcggggtg 473



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||| |||||||  ||||||||||||||||| ||||||||||||||||||| ||||| ||
Sbjct: 608 ggcccgcgggctttccatccgacccgtcttgaaacacggaccaaggagtctaacatgtgt 667

                          
Query: 280 gcgagtcgacgggtt 294
           |||||||| ||||||
Sbjct: 668 gcgagtcggcgggtt 682



to top

>gb|DQ008652.1| Orontium aquaticum 26S ribosomal RNA gene, partial sequence
          Length = 2131

 Score =  125 bits (63), Expect = 1e-25
 Identities = 72/75 (96%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           ||||| || |||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 294 acggcatgtgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgc 353

                          
Query: 278 gtgcgagtcgacggg 292
           |||||||||||||||
Sbjct: 354 gtgcgagtcgacggg 368



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| | |||||||||||||||| ||||||||||||||| ||| || |||||||
Sbjct: 67  cttgaaattgtcaggagggaagcggatggtggccggcgatgcgcctcggtcggatgcgga 126

              
Query: 61  acg 63
           |||
Sbjct: 127 acg 129



to top

>gb|U90678.1|ELU90678 Encephalartos lebomboensis 28S ribosomal RNA gene, partial sequence
          Length = 639

 Score =  125 bits (63), Expect = 1e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| |||||||||||| |||||| || |||||||
Sbjct: 357 cttgaaattgccgggagggaagcggatggaggccggcgatgcaccccggtcggatgcgga 416

                                              
Query: 61  acggctcttgctggtccgccgctcggctcggggtg 95
           ||| |  |||| |||||||||||||||||||||||
Sbjct: 417 acgacggttgccggtccgccgctcggctcggggtg 451



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                               
Query: 224 tgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacat 275
           ||||||||  |||| || ||||||||| ||||||||||||||||||| ||||
Sbjct: 588 tgcgggctttccattcggcccgtcttgaaacacggaccaaggagtctaacat 639



to top

>gb|U52609.1|EBU52609 Enemion biternatum nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1047

 Score =  125 bits (63), Expect = 1e-25
 Identities = 84/91 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcaccggccggatgcgga 386

                                          
Query: 61  acggctcttgctggtccgccgctcggctcgg 91
           |||||    ||||||||||||||||||||||
Sbjct: 387 acggcgagagctggtccgccgctcggctcgg 417



 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619

                                              
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagct 321
             |||||  | ||||| | || |||||||||||||
Sbjct: 620 agcgggtgattaaacccgtgaggcgcaaggaagct 654



to top

>gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score =  123 bits (62), Expect = 4e-25
 Identities = 74/78 (94%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 585 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 644

                             
Query: 275 tgcgtgcgagtcgacggg 292
           || ||||||||| |||||
Sbjct: 645 tgtgtgcgagtcaacggg 662



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||||||||||||||| || ||| |||
Sbjct: 362 cttgaaattgtcgggagggaagcgaatgggggccggcgatgcgccccggtcggatgtgga 421

               
Query: 61  acgg 64
           ||||
Sbjct: 422 acgg 425



to top

>gb|AY079519.1| Eriocaulon decangulare 26S ribosomal RNA gene, partial sequence
          Length = 976

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||
Sbjct: 617 ggcctgtgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgcgt 676

                         
Query: 280 gcgagtcgacgggt 293
           ||||||||||||||
Sbjct: 677 gcgagtcgacgggt 690



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||| ||||||||| |||||| ||| || ||| |||
Sbjct: 400 cttgaaattgccgggagggaagcggatgcgggccggcgttgcgccgcggtcggatgtgga 459

                
Query: 61  acggc 65
           |||||
Sbjct: 460 acggc 464



to top

>gb|AY095452.1| Austrobaileya scandens 26S ribosomal RNA gene, partial sequence
          Length = 2979

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 591 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 650

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 651 tgcgagtcaacggg 664



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||||||||||| ||| || |||||||
Sbjct: 361 cttgaaattgtcgggagggaagcgaatgggggccggcgatgcgcctcggtcggatgcgga 420

                
Query: 61  acggc 65
           |||||
Sbjct: 421 acggc 425



to top

>gb|AY260033.1| Platycrater arguta 26S ribosomal RNA gene, complete sequence
          Length = 3373

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||
Sbjct: 624 cggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgcg 683

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 684 tgcgagtcaacggg 697



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 86/100 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||| || ||| || ||| |||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcccctcggtcggatgtgga 458

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||| ||||||| ||||||
Sbjct: 459 acggcgagagccggtccgccgatcgactcggggcgtggac 498



to top

>gb|AY292914.1| Alisma sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3534

 Score =  123 bits (62), Expect = 4e-25
 Identities = 95/106 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 800 cggcctgtgggctcctcatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 859

                                                         
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           |||||||| ||||||   |||||| | || || |||||||||||||
Sbjct: 860 tgcgagtcaacgggtgcggaaacccgcgaggcacaaggaagctgac 905



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| |||| |||||  ||| || |||||||
Sbjct: 575 cttgaaattgtcgggagggaagcggatgggggctggcggtgcgcgtcggtcgaatgcgga 634

               
Query: 61  acgg 64
           ||||
Sbjct: 635 acgg 638



to top

>gb|AY292886.1| Austrobaileya scandens 26S ribosomal RNA gene, partial sequence
          Length = 2979

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 591 cggcctgcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 650

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 651 tgcgagtcaacggg 664



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||||||||||| ||| || |||||||
Sbjct: 361 cttgaaattgtcgggagggaagcgaatgggggccggcgatgcgcctcggtcggatgcgga 420

                
Query: 61  acggc 65
           |||||
Sbjct: 421 acggc 425



to top

>gb|AY128173.1| Walsura tubulata 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
Sbjct: 315 cggccggcgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgtg 374

                         
Query: 279 tgcgagtcgacggg 292
           ||||||||||||||
Sbjct: 375 tgcgagtcgacggg 388



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 82/93 (88%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||| ||||||||||| || ||| |||
Sbjct: 89  cttgaaattgtcgggagggaagcggatgggggccggctatgcgccccggtcggatgtgga 148

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || ||||||||| |||||||||||
Sbjct: 149 acggcgagagccggtccgccgatcggctcgggg 181



to top

>gb|AF205515.1|AF205515 Wodyetia bifurcata 26S ribosomal RNA gene, partial sequence
          Length = 995

 Score =  123 bits (62), Expect = 4e-25
 Identities = 65/66 (98%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 639 gggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagtc 698

                 
Query: 287 gacggg 292
           ||||||
Sbjct: 699 gacggg 704



 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 57/61 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||| || ||| || |||||||
Sbjct: 399 cttgaaattgccgggagggaagcggatgggggccggcgatgcacctcggtcggatgcgga 458

            
Query: 61  a 61
           |
Sbjct: 459 a 459



to top

>gb|AF203682.1|AF203682 Manfreda virginica 26S ribosomal RNA gene, partial sequence
          Length = 991

 Score =  123 bits (62), Expect = 4e-25
 Identities = 95/106 (89%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
Sbjct: 643 gggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagcc 702

                                                         
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagctgacgagcggga 332
           ||||||  |  ||||| || | ||||||||||||||| | ||||||
Sbjct: 703 gacgggcgtgaaaacccggaaggcgcaaggaagctgatgggcggga 748



 Score =  119 bits (60), Expect = 7e-24
 Identities = 119/139 (85%), Gaps = 6/139 (4%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcgccggccggatgcgga 458

                                                                       
Query: 61  acggctctt------gctggtccgccgctcggctcggggtgtggactgttgtcggccgcg 114
           ||||| |||      || ||||||||||||||||||| ||| |||| ||||   |||| |
Sbjct: 459 acggcccttcagggggccggtccgccgctcggctcggcgtgcggaccgttgcgagccgtg 518

                              
Query: 115 tcggcggccaaagcccggg 133
            |||||||| |||||||||
Sbjct: 519 ccggcggcccaagcccggg 537



to top

>gb|AF203680.1|AF203680 Sagittaria graminea 26S ribosomal RNA gene, partial sequence
          Length = 979

 Score =  123 bits (62), Expect = 4e-25
 Identities = 95/106 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 623 cggcctgtgggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 682

                                                         
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           ||| | || ||||||   |||||| | || ||||||||||||||||
Sbjct: 683 tgccaatcaacgggtgcggaaacccgtgaggcgcaaggaagctgac 728



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| |||| |||||  ||| || |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggctggcggtgcgcgtcggtcgaatgcgga 458

                                         
Query: 61  acggctcttgctggtccgccgctcggctcg 90
           ||||| |  ||||||||||  |||||||||
Sbjct: 459 acggcaccagctggtccgctactcggctcg 488



to top

>gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, partial sequence
          Length = 3361

 Score =  123 bits (62), Expect = 4e-25
 Identities = 74/78 (94%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 682

                             
Query: 275 tgcgtgcgagtcgacggg 292
           || ||||||||| |||||
Sbjct: 683 tgtgtgcgagtcaacggg 700



 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 61/66 (92%), Gaps = 1/66 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggcc-ggcgatgcgccccggccgtatgcgg 59
           |||||||||| ||||||||||||| ||||||||| ||||||||||||||| || ||||||
Sbjct: 399 cttgaaattgtcgggagggaagcgaatgggggcccggcgatgcgccccggtcggatgcgg 458

                 
Query: 60  aacggc 65
           ||||||
Sbjct: 459 aacggc 464



to top

>gb|AF297536.1|AF297536 Cornus officinalis 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score =  123 bits (62), Expect = 4e-25
 Identities = 74/78 (94%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 682

                             
Query: 275 tgcgtgcgagtcgacggg 292
           || ||||||||| |||||
Sbjct: 683 tgtgtgcgagtcaacggg 700



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||||||||||||||| || ||| |||
Sbjct: 400 cttgaaattgtcgggagggaagcgaatgggggccggcgatgcgccccggtcggatgtgga 459

               
Query: 61  acgg 64
           ||||
Sbjct: 460 acgg 463



to top

>gb|AF297535.1|AF297535 Cornus mas 26S ribosomal RNA gene, partial sequence
          Length = 3350

 Score =  123 bits (62), Expect = 4e-25
 Identities = 74/78 (94%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 623 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 682

                             
Query: 275 tgcgtgcgagtcgacggg 292
           || ||||||||| |||||
Sbjct: 683 tgtgtgcgagtcaacggg 700



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||||||||||||||| || ||| |||
Sbjct: 400 cttgaaattgtcgggagggaagcgaatgggggccggcgatgcgccccggtcggatgtgga 459

               
Query: 61  acgg 64
           ||||
Sbjct: 460 acgg 463



to top

>gb|DQ008651.1| Alisma plantago-aquatica 26S ribosomal RNA gene, partial sequence
          Length = 3024

 Score =  123 bits (62), Expect = 4e-25
 Identities = 95/106 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 463 cggcctgtgggctcctcatccgacccgtcttgaaacacggaccaaggagtctgacatgcg 522

                                                         
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           |||||||| ||||||   |||||| | || || |||||||||||||
Sbjct: 523 tgcgagtcaacgggtgcggaaacccgcgaggcacaaggaagctgac 568



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| |||| |||||  ||| || |||||||
Sbjct: 238 cttgaaattgtcgggagggaagcggatgggggctggcggtgcgcgtcggtcgaatgcgga 297

               
Query: 61  acgg 64
           ||||
Sbjct: 298 acgg 301



to top

>gb|AF479116.1| Krameria ixine 26S ribosomal RNA gene, complete sequence
          Length = 3368

 Score =  123 bits (62), Expect = 4e-25
 Identities = 71/74 (95%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 622 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 681

                         
Query: 279 tgcgagtcgacggg 292
           ||||||||||||||
Sbjct: 682 tgcgagtcgacggg 695



 Score =  113 bits (57), Expect = 4e-22
 Identities = 91/101 (90%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 395 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 454

                                                    
Query: 61  acggct-cttgctggtccgccgctcggctcggggtgtggac 100
           |||||  |  || ||||||||| ||||||||||||||||||
Sbjct: 455 acggccacaagccggtccgccgatcggctcggggtgtggac 495



to top

>gb|AY248757.1| Cornus eydeana 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score =  123 bits (62), Expect = 4e-25
 Identities = 74/78 (94%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 594 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 653

                             
Query: 275 tgcgtgcgagtcgacggg 292
           || ||||||||| |||||
Sbjct: 654 tgtgtgcgagtcaacggg 671



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 57/64 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||| || |||||||| || ||| |||
Sbjct: 371 cttgaaattgtcgggagggaagcgaatgggggccggcaattcgccccggtcggatgtgga 430

               
Query: 61  acgg 64
           ||||
Sbjct: 431 acgg 434



to top

>gb|AF363900.1| Oryza ridleyi clone 8-13 25S ribosomal RNA gene, partial sequence
          Length = 937

 Score =  121 bits (61), Expect = 2e-24
 Identities = 88/97 (90%)
 Strand = Plus / Plus

                                                                       
Query: 198 cctcggggcactgcgctgcaacggcctgcgggctccccatccgacccgtcttgcaacacg 257
           |||||||||||| ||  ||||||||||||||||| || ||| ||||||||||| ||||| 
Sbjct: 581 cctcggggcactacgtcgcaacggcctgcgggcttcctatctgacccgtcttgaaacaca 640

                                                
Query: 258 gaccaaggagtctgacatgcgtgcgagtcgacgggtt 294
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 641 gaccaagaagtctgacatgcgtgcgagtcgacgggtt 677



 Score =  107 bits (54), Expect = 3e-20
 Identities = 114/134 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||| || ||||||||||||||||||||| |||||||||  |||||| |||||| |||
Sbjct: 388 cttgaatttaccgggagggaagcggatggggcccggcgatgtaccccggtcgtatgtgga 447

                                                                       
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcg 120
           ||||||   | ||||  |||  | ||||||||| |||||| |||||||||| |||||| |
Sbjct: 448 acggcttcggttggtttgccaattggctcggggcgtggaccgttgtcggccacgtcggtg 507

                         
Query: 121 gccaaagcccgggg 134
           ||||||||||||||
Sbjct: 508 gccaaagcccgggg 521



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 312 caaggaagctgacgagcgggaggccctcacgggccgcaccgctggccgaccctgatct 369
           ||||||||||||||||||||||||||||  |||| |||||  ||||||||||||||||
Sbjct: 684 caaggaagctgacgagcgggaggccctcgtgggctgcaccattggccgaccctgatct 741



to top

>gb|AY423102.1| Loxostigma sp. RBGE 19962309 26S ribosomal RNA gene, partial
           sequence
          Length = 1191

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||| ||
Sbjct: 625 ggcctgtgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtgt 684

                                                        
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           ||||||| |||||   ||||||| | || ||||||||||||||||
Sbjct: 685 gcgagtcaacgggcgatgaaacccgtgaggcgcaaggaagctgac 729



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||| ||||||||||||||||| || ||| |||
Sbjct: 400 cttgaaattgtcgggagggaagcggatggggaccggcgatgcgccccggtcggatgtgga 459

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||     || ||||||||| ||| ||||||||||||||
Sbjct: 460 acggtgagagccggtccgccgatcgactcggggtgtggac 499



to top

>gb|AF468124.1| Begonia thomeana 26S large subunit ribosomal RNA gene, partial
           sequence
          Length = 551

 Score =  121 bits (61), Expect = 2e-24
 Identities = 128/151 (84%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||
Sbjct: 334 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgcg 393

                                                                       
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccct 338
           |||||||| |||||     ||||| | || |||||||||||||||   ||||||  ||||
Sbjct: 394 tgcgagtcaacgggccagcaaacccgtgaggcgcaaggaagctgastggcgggatcccct 453

                                          
Query: 339 cacgggccgcaccgctggccgaccctgatct 369
           | ||||  ||||||| | |||||| ||||||
Sbjct: 454 cgcgggttgcaccgccgaccgaccttgatct 484



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||| |||| ||||| || ||| |||
Sbjct: 110 cttgaaattgtcgggagggaagcggatgggggccggcggtgcggcccggtcggatgtgga 169

                
Query: 61  acggc 65
           |||||
Sbjct: 170 acggc 174



to top

>gb|AY095475.1| Ginkgo biloba 26S ribosomal RNA gene, partial sequence
          Length = 3309

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 374 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 433

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 434 acggcgtgagccggtccgccgctcggctcgggg 466



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||| |||||||  |||| |||||||||||| ||||||||||||||||||| ||||| ||
Sbjct: 597 ggccagcgggctttccattcgacccgtcttgaaacacggaccaaggagtctaacatgtgt 656

                                                        
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgac 324
           |||| ||| ||||||  |||||| | || ||||||||||||||||
Sbjct: 657 gcgaatcggcgggttgggaaacccgcgargcgcaaggaagctgac 701



to top

>gb|AY095473.1| Spathiphyllum wallisii 26S ribosomal RNA gene, partial sequence
          Length = 3313

 Score =  121 bits (61), Expect = 2e-24
 Identities = 79/85 (92%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           |||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||
Sbjct: 602 acggcctgcgggctcccctttcgacccgtcttgaaacacggaccaaggagtctgacatgc 661

                                    
Query: 278 gtgcgagtcgacgggttttgaaacc 302
           ||||||||| |||||| | ||||||
Sbjct: 662 gtgcgagtcaacgggtgtggaaacc 686



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 89/101 (88%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||  |||||||||||||||||||||||||||||| || ||| || |||||||
Sbjct: 375 cttgaaattgttgggagggaagcggatgggggccggcgatgcacctcggtcggatgcgga 434

                                                    
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggac 100
           ||||| ||  || |||||||| |||||||||||||| ||||
Sbjct: 435 acggcgtcgagccggtccgccactcggctcggggtgcggac 475



to top

>gb|AY095465.1| Nymphaea sp. MJZ-2002 26S ribosomal RNA gene, partial sequence
          Length = 3314

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
Sbjct: 607 cggccagcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtg 666

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| |||||| | |||||| || | |||||||||| ||||
Sbjct: 667 tgcgagtcaacgggtgtggaaacccggaaggcgcaaggaaactga 711



 Score =  117 bits (59), Expect = 3e-23
 Identities = 90/99 (90%), Gaps = 1/99 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||
Sbjct: 375 cttgaaattgccgggagggaagcggatgggggtcggcgatgcgcctcggtcgtatgcgga 434

                                                  
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtgg 98
           ||||| | | || |||||| |||||||||||||| ||||
Sbjct: 435 acggcttatggccggtccggcgctcggctcggggcgtgg 473



to top

>gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complete sequence
          Length = 3362

 Score =  121 bits (61), Expect = 2e-24
 Identities = 97/109 (88%)
 Strand = Plus / Plus

                                                                       
Query: 215 gcaacggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgaca 274
           |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 618 gcaacggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgaca 677

                                                            
Query: 275 tgcgtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           || |||| |||| ||||| | | ||||| |  | |||||||||||||||
Sbjct: 678 tgtgtgcaagtcaacgggctatcaaacccgtaaggcgcaaggaagctga 726



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 49
           |||||||||| |||||||||| ||||||||||||||||||||| |||||
Sbjct: 396 cttgaaattgtcgggagggaaacggatgggggccggcgatgcgtcccgg 444



to top

>gb|AY292913.1| Spathiphyllum sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3328

 Score =  121 bits (61), Expect = 2e-24
 Identities = 79/85 (92%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           |||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||
Sbjct: 602 acggcctgcgggctcccctttcgacccgtcttgaaacacggaccaaggagtctgacatgc 661

                                    
Query: 278 gtgcgagtcgacgggttttgaaacc 302
           ||||||||| |||||| | ||||||
Sbjct: 662 gtgcgagtcaacgggtgtggaaacc 686



 Score = 97.6 bits (49), Expect = 2e-17
 Identities = 89/101 (88%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||  |||||||||||||||||||||||||||||| || ||| || |||||||
Sbjct: 375 cttgaaattgttgggagggaagcggatgggggccggcgatgcacctcggtcggatgcgga 434

                                                    
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggac 100
           ||||| ||  || |||||||| |||||||||||||| ||||
Sbjct: 435 acggcgtcgagccggtccgccactcggctcggggtgcggac 475



to top

>gb|AY292902.1| Brasenia schreberi 26S ribosomal RNA gene, partial sequence
          Length = 2812

 Score =  121 bits (61), Expect = 2e-24
 Identities = 92/101 (91%), Gaps = 1/101 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||
Sbjct: 539 cttgaaattgccgggagggaagcggatgggggccggcgatgcgcctcggtcgaatgcgga 598

                                                    
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggac 100
           ||||| |   || ||||||||||||||||||||| ||||||
Sbjct: 599 acggcctaaggccggtccgccgctcggctcggggcgtggac 639



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           |||||||||||||||||||||| ||||||||| |||||||||||||||||||| || | |
Sbjct: 769 cggcctgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctggcaagtg 828

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||| |||||||  | |||||| || | ||| |||||||||||
Sbjct: 829 tgcgagccgacgggagtggaaacccggaaggcgaaaggaagctga 873



to top

>gb|AY292900.1| Nymphaea sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
Sbjct: 607 cggccagcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtg 666

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| |||||| | |||||| || | |||||||||| ||||
Sbjct: 667 tgcgagtcaacgggtgtggaaacccggaaggcgcaaggaaactga 711



 Score =  117 bits (59), Expect = 3e-23
 Identities = 90/99 (90%), Gaps = 1/99 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||
Sbjct: 375 cttgaaattgccgggagggaagcggatgggggtcggcgatgcgcctcggtcgtatgcgga 434

                                                  
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtgg 98
           ||||| | | || |||||| |||||||||||||| ||||
Sbjct: 435 acggcttatggccggtccggcgctcggctcggggcgtgg 473



to top

>gb|AF293854.1|AF293854 Crinum americanum internal transcribed spacer 2 and 26S large
           subunit ribosomal RNA gene, partial sequence
          Length = 991

 Score =  121 bits (61), Expect = 2e-24
 Identities = 88/97 (90%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
Sbjct: 643 gggctccccatccgacccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagcc 702

                                                
Query: 287 gacgggttttgaaacctgggatgcgcaaggaagctga 323
           ||||||     |||||||| | |||||||||||||||
Sbjct: 703 gacgggcgagaaaacctggaaggcgcaaggaagctga 739



 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                     
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgc 42
           |||||||||| |||||||||||||||||||||||||||||||
Sbjct: 400 cttgaaattgtcgggagggaagcggatgggggccggcgatgc 441



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 73  ggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggcggccaaagcccgg 132
           |||||||||||||||| || ||| |||| || |  ||||||||||| |||  ||||||||
Sbjct: 478 ggtccgccgctcggcttggcgtgcggaccgtcgcgggccgcgtcggaggcacaagcccgg 537

            
Query: 133 g 133
           |
Sbjct: 538 g 538



to top

>gb|AF203681.1|AF203681 Limnobium spongia 26S ribosomal RNA gene, partial sequence
          Length = 969

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||| | ||||||| || ||||||||| |||||||||||||||||||||||||||
Sbjct: 613 cggcctgcgagttccccattcggcccgtcttgaaacacggaccaaggagtctgacatgcg 672

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| | ||||||| |||||||  | |||||||||||||||
Sbjct: 673 tgcgagtcaatgggttttcaaacctgtaaggcgcaaggaagctga 717



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 87/100 (87%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| ||||||||| ||| | || |||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggctggcgatgcgtcccagtcggatgcgga 458

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||| |  ||| ||||||||||||| || |||| ||||||
Sbjct: 459 acggtttatgccggtccgccgctcgtcttggggcgtggac 498



to top

>gb|AY034045.1| Sequoiadendron giganteum 28S ribosomal RNA gene, partial sequence
          Length = 577

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 356 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 415

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 416 acggcgtgagccggtccgccgctcggctcgggg 448



to top

>gb|AY034044.1| Metasequoia glyptostroboides 28S ribosomal RNA gene, partial
           sequence
          Length = 601

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 350 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 409

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 410 acggcgtgagccggtccgccgctcggctcgggg 442



to top

>gb|AY034043.1| Glyptostrobus pensilis 28S ribosomal RNA gene, partial sequence
          Length = 602

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 350 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 409

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 410 acggcgtaagccggtccgccgctcggctcgggg 442



to top

>gb|AY034042.1| Athrotaxis selaginoides 28S ribosomal RNA gene, partial sequence
          Length = 583

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 356 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 415

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 416 acggcgagagccggtccgccgctcggctcgggg 448



to top

>gb|AY034041.1| Athrotaxis laxifolia 28S ribosomal RNA gene, partial sequence
          Length = 579

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 352 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 411

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 412 acggcgagagccggtccgccgctcggctcgggg 444



to top

>gb|AY034040.1| Athrotaxis cupressoides 28S ribosomal RNA gene, partial sequence
          Length = 587

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 360 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 419

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 420 acggcgagagccggtccgccgctcggctcgggg 452



to top

>gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene, partial sequence
          Length = 2775

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||| |||||||||||||||||||||||| || |||||||
Sbjct: 393 cttgaaattgtcgggagggaagcgaatgggggccggcgatgcgccccggtcggatgcgga 452

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||||  || ||||||||| |||||||||||
Sbjct: 453 acggctcgcgccggtccgccgatcggctcgggg 485



 Score =  107 bits (54), Expect = 3e-20
 Identities = 127/150 (84%), Gaps = 1/150 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||| |||||| ||||||||| ||||||||| ||||||||||||||||||||||||| ||
Sbjct: 621 ggccagcgggcaccccatccggcccgtcttgaaacacggaccaaggagtctgacatgtgt 680

                                                                       
Query: 280 gcgagtcgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctc 339
           ||||||| |||||     ||||| | || ||||||||||||||||  |||||| |||| |
Sbjct: 681 gcgagtcaacgggcgagcaaacccgtgaggcgcaaggaagctgactggcggga-gccccc 739

                                         
Query: 340 acgggccgcaccgctggccgaccctgatct 369
             |||||||||||| | ||||||| |||||
Sbjct: 740 cggggccgcaccgccgaccgacccggatct 769



to top

>gb|AF479140.1| Capparis sandwichiana 26S ribosomal RNA gene, complete sequence
          Length = 3361

 Score =  121 bits (61), Expect = 2e-24
 Identities = 94/105 (89%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||||||
Sbjct: 603 cggcccgcgggctccccatccggcccgtcttgaaacacggaccaaggagtctgacatgcg 662

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| |||||     ||||| |||| |||||||||||||||
Sbjct: 663 tgcgagtcaacgggcgagtaaacccgggaggcgcaaggaagctga 707



 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 47/49 (95%)
 Strand = Plus / Plus

                                                            
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccgg 49
           |||||||||| |||||||||||||||||||||||||||||||| |||||
Sbjct: 376 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtcccgg 424



to top

>gb|U90703.1|CJU90703 Cryptomeria japonica 28S ribosomal RNA gene, partial sequence
          Length = 648

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 369 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 428

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 429 acggcgtcagccggtccgccgctcggctcgggg 461



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           |||| |||||||  ||||||||||||||||| |||||||||||||||||||
Sbjct: 596 ggccagcgggctttccatccgacccgtcttgaaacacggaccaaggagtct 646



to top

>gb|U90702.1|TDU90702 Taxodium distichum 28S ribosomal RNA gene, partial sequence
          Length = 648

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 369 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 428

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 429 acggcgtaagccggtccgccgctcggctcgggg 461



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           |||| |||||||  ||||||||||||||||| |||||||||||||||||||
Sbjct: 596 ggccagcgggctttccatccgacccgtcttgaaacacggaccaaggagtct 646



to top

>gb|U90701.1|SSU90701 Sequoia sempervirens 28S ribosomal RNA gene, partial sequence
          Length = 636

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 357 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 416

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 417 acggcgtgagccggtccgccgctcggctcgggg 449



 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                              
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           |||| |||||||  ||||||||||||||||| |||||||||||||||||||
Sbjct: 582 ggccagcgggctttccatccgacccgtcttgaaacacggaccaaggagtct 632



to top

>gb|U90700.1|TCU90700 Taiwania cryptomerioides 28S ribosomal RNA gene, partial sequence
          Length = 643

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 373 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 432

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 433 acggcgtgagccggtccgccgctcggctcgggg 465



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaagga 266
           |||| |||||||  |||| |||||||||||| |||||||||||||||
Sbjct: 596 ggccagcgggctttccattcgacccgtcttgaaacacggaccaagga 642



to top

>gb|U90698.1|SVU90698 Sciadopitys verticillata 28S ribosomal RNA gene, partial sequence
          Length = 644

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||  |||||||||||||||||| || |||||||
Sbjct: 373 cttgaaattgccgggagggaagcggatggatgccggcgatgcgccccggtcggatgcgga 432

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           ||||| |  || |||||||||||||||||||||
Sbjct: 433 acggcgcaagccggtccgccgctcggctcgggg 465



 Score = 44.1 bits (22), Expect = 0.31
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 225 gcgggctccccatccgacccgtcttgcaacacggacca 262
           |||||||  |||| |||||||||||| |||||||||||
Sbjct: 602 gcgggctttccattcgacccgtcttgaaacacggacca 639



to top

>gb|U90697.1|CHU90697 Cephalotaxus harringtonia 28S ribosomal RNA gene, partial sequence
          Length = 637

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||
Sbjct: 358 cttgaaattgccgggagggaagcggatggaggccggcgatgcgccccggtcggatgcgga 417

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    || |||||||||||||||||||||
Sbjct: 418 acggcgtgagccggtccgccgctcggctcgggg 450



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                              
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtct 270
           |||| |||||||  |||| |||||||||||| |||||||||||||||||||
Sbjct: 584 ggccagcgggctttccattcgacccgtcttgaaacacggaccaaggagtct 634



to top

>gb|AF146533.1|AF146533 Phacelia hirsuta 26S ribosomal RNA gene, partial sequence
          Length = 972

 Score =  121 bits (61), Expect = 2e-24
 Identities = 92/100 (92%), Gaps = 3/100 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 399 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcgtatgcgga 458

                                                   
Query: 61  acggctctt--gctggtccgccgctcggctcggggtgtgg 98
           ||||| |||   | ||||||||| ||||||||||||||||
Sbjct: 459 acggc-cttaaaccggtccgccgatcggctcggggtgtgg 497



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||| ||
Sbjct: 626 ggcctgtgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtgt 685

                         
Query: 280 gcgagtcgacgggt 293
           ||||||| ||||||
Sbjct: 686 gcgagtcaacgggt 699



to top

>gb|U52627.1|DEU52627 Delphinium exaltatum nuclear 26S ribosomal RNA gene, partial
           sequence
          Length = 1045

 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||| ||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcctcggtcggatgcgga 386

                                            
Query: 61  acggctcttgctggtccgccgctcggctcgggg 93
           |||||    ||||||||||||||||||||||||
Sbjct: 387 acggcgagagctggtccgccgctcggctcgggg 419



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619



to top

>gb|AY423094.1| Rhynchoglossum hologlossum isolate DNA-CW13 26S ribosomal RNA gene,
           partial sequence
          Length = 1190

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||
Sbjct: 401 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgtcccggtcgtatgcgga 460

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||| ||||||||||||||
Sbjct: 461 acggcgagagccggtccgccgatcgactcggggtgtggac 500



 Score =  105 bits (53), Expect = 1e-19
 Identities = 65/69 (94%)
 Strand = Plus / Plus

                                                                       
Query: 224 tgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcga 283
           |||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||
Sbjct: 628 tgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtgtgcga 687

                    
Query: 284 gtcgacggg 292
           ||| |||||
Sbjct: 688 gtcaacggg 696



to top

>gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score =  119 bits (60), Expect = 7e-24
 Identities = 118/136 (86%), Gaps = 1/136 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 382 cttgaaattgtcgggagggaagcggatgggggctggcgatgcgcctcggccggatgcgga 441

                                                                       
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||  |  ||||||| |||||||||||||||||| |||| ||||  || || | ||||
Sbjct: 442 acggcgacgagctggtctgccgctcggctcggggtgcggaccgttgcgggtcgtggcggc 501

                           
Query: 120 ggccaaagcccggggg 135
           |||  |||||||||||
Sbjct: 502 ggcttaagcccggggg 517



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| |||| |||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 612 cggcctgtgggccccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 671

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||   |||||| |  | |||||||||||||||
Sbjct: 672 tgcgagtcaacgggtgcggaaacccgcaaggcgcaaggaagctga 716



to top

>gb|AY095474.1| Tacca chantieri 26S ribosomal RNA gene, partial sequence
          Length = 2858

 Score =  119 bits (60), Expect = 7e-24
 Identities = 123/144 (85%)
 Strand = Plus / Plus

                                                                       
Query: 226 cgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagt 285
           ||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||| 
Sbjct: 620 cgggccccccatccggcccgtcttgaaacacggaccaaggagtctgacatgcgtgcgagc 679

                                                                       
Query: 286 cgacgggttttgaaacctgggatgcgcaaggaagctgacgagcgggaggccctcacgggc 345
           |||||||  | |||||| || | ||||||| || |||||| | ||||  |||||| ||| 
Sbjct: 680 cgacgggcgtggaaacccggaaggcgcaagtaaactgacgcgtgggatcccctcatgggg 739

                                   
Query: 346 cgcaccgctggccgaccctgatct 369
            ||||||| |||||||| ||||||
Sbjct: 740 tgcaccgcgggccgaccttgatct 763



 Score =  113 bits (57), Expect = 4e-22
 Identities = 63/65 (96%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||
Sbjct: 375 cttgaaattgccgggagggaagcggatgggggccggcgatgcgctccggccgaatgcgga 434

                
Query: 61  acggc 65
           |||||
Sbjct: 435 acggc 439



to top

>gb|AY095459.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence
          Length = 3315

 Score =  119 bits (60), Expect = 7e-24
 Identities = 118/136 (86%), Gaps = 1/136 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 377 cttgaaattgtcgggagggaagcggatgggggctggcgatgcgcctcggccggatgcgga 436

                                                                       
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||  |  ||||||| |||||||||||||||||| |||| ||||  || || | ||||
Sbjct: 437 acggcgacgagctggtctgccgctcggctcggggtgcggaccgttgcgggtcgtggcggc 496

                           
Query: 120 ggccaaagcccggggg 135
           |||  |||||||||||
Sbjct: 497 ggcttaagcccggggg 512



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| |||| |||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 606 cggcctgtgggccccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 665

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||   |||||| |  | |||||||||||||||
Sbjct: 666 tgcgagtcaacgggtgcggaaacccgcaaggcgcaaggaagctga 710



to top

>gb|AF222353.1| Paxistima canbyi 26S ribosomal RNA gene, partial sequence
          Length = 931

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 378 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 437

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||||||||||||||||||
Sbjct: 438 acggcgagagccggtccgccgatcggctcggggtgtggac 477



 Score =  115 bits (58), Expect = 1e-22
 Identities = 70/74 (94%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 603 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 662

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 663 tgcgagtcaacggg 676



to top

>gb|AF222352.1| Paxistima myrsinites 26S ribosomal RNA gene, partial sequence
          Length = 909

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 358 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 417

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||||||||||||||||||
Sbjct: 418 acggcgagagccggtccgccgatcggctcggggtgtggac 457



 Score =  115 bits (58), Expect = 1e-22
 Identities = 70/74 (94%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 583 cggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 642

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 643 tgcgagtcaacggg 656



to top

>gb|AY292895.1| Peperomia sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3494

 Score =  119 bits (60), Expect = 7e-24
 Identities = 91/100 (91%), Gaps = 1/100 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||| |||||||||||||||| || |||||||
Sbjct: 528 cttgaaattgtcgggagggaagcggatgggggtcggcgatgcgccccggtcggatgcgga 587

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||||| |||||||| |||  ||||||||||| ||||||
Sbjct: 588 acggctc-tgctggtctgccaatcggctcggggcgtggac 626



 Score =  115 bits (58), Expect = 1e-22
 Identities = 94/106 (88%)
 Strand = Plus / Plus

                                                                       
Query: 218 acggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgc 277
           |||||||| || |||||||| |||||||||||| ||||||||||||||||||||||||| 
Sbjct: 751 acggcctgtggactccccattcgacccgtcttgaaacacggaccaaggagtctgacatgt 810

                                                         
Query: 278 gtgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           ||||||||| |||||| || ||||| |  | |||||||||||||||
Sbjct: 811 gtgcgagtcaacgggtgttcaaacccgtaaggcgcaaggaagctga 856



to top

>gb|AY292880.1| Galbulimima sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score =  119 bits (60), Expect = 7e-24
 Identities = 118/136 (86%), Gaps = 1/136 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 377 cttgaaattgtcgggagggaagcggatgggggctggcgatgcgcctcggccggatgcgga 436

                                                                       
Query: 61  acggc-tcttgctggtccgccgctcggctcggggtgtggactgttgtcggccgcgtcggc 119
           |||||  |  ||||||| |||||||||||||||||| |||| ||||  || || | ||||
Sbjct: 437 acggcgacgagctggtctgccgctcggctcggggtgcggaccgttgcgggtcgtggcggc 496

                           
Query: 120 ggccaaagcccggggg 135
           |||  |||||||||||
Sbjct: 497 ggcttaagcccggggg 512



 Score =  105 bits (53), Expect = 1e-19
 Identities = 92/105 (87%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| |||| |||||| |||||||||||| ||||||||||||||||||||||||| |
Sbjct: 606 cggcctgtgggccccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtg 665

                                                        
Query: 279 tgcgagtcgacgggttttgaaacctgggatgcgcaaggaagctga 323
           |||||||| ||||||   |||||| |  | |||||||||||||||
Sbjct: 666 tgcgagtcaacgggtgcggaaacccgcaaggcgcaaggaagctga 710



to top

>gb|AY128176.1| Ruta graveolens 26S ribosomal RNA gene, partial sequence
          Length = 872

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 89  cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 148

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||||||||||||| ||||
Sbjct: 149 acggcgagagccggtccgccgatcggctcggggtgcggac 188



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 68/74 (91%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||| ||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 314 cggcctgtgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 373

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 374 tgcgagtcaacggg 387



to top

>gb|AF224693.1| Rhizophora racemosa 26S ribosomal RNA gene, partial sequence
          Length = 441

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||| ||| || |||||||
Sbjct: 82  cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcctcggtcggatgcgga 141

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||| |  || ||||||||| ||||||||||| ||||||
Sbjct: 142 acggcgcgagccggtccgccgatcggctcggggcgtggac 181



 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 68/74 (91%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||| ||||| ||||||||||||||||||||||||| |
Sbjct: 307 cggcctgcgggctccccattcggcccctcttgaaacacggaccaaggagtctgacatgtg 366

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 367 tgcgagtcaacggg 380



to top

>gb|AF224692.1| Rhizophora mangle 26S ribosomal RNA gene, partial sequence
          Length = 441

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||| ||| || |||||||
Sbjct: 82  cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcctcggtcggatgcgga 141

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||| |  || ||||||||| ||||||||||| ||||||
Sbjct: 142 acggcgcgagccggtccgccgatcggctcggggcgtggac 181



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 307 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 366

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 367 tgcgagtcaacggg 380



to top

>gb|AY935808.1| Bauera rubioides isolate 18 26S ribosomal RNA gene, partial
           sequence
          Length = 906

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 373 cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 432

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||||   || ||||||||| ||| ||||||| ||||||
Sbjct: 433 acggcttcggccggtccgccgatcgactcggggcgtggac 472



 Score =  111 bits (56), Expect = 2e-21
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 599 cggcctgcgggctccccattcgrcccgtcttgaaacacggaccaaggagtctgacatgtg 658

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 659 tgcgagtcaacggg 672



to top

>gb|AF479123.1| Androstachys johnsonii 26S ribosomal RNA gene, partial sequence
          Length = 2881

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||
Sbjct: 379 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgcgga 438

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    || ||||||||| ||||||||||| ||||||
Sbjct: 439 acggcgagagccggtccgccgatcggctcggggcgtggac 478



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Plus

                                                                       
Query: 219 cggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcg 278
           ||||||||||||||||||| || ||||||||| ||||||||||||||||||||||||| |
Sbjct: 604 cggcctgcgggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtg 663

                         
Query: 279 tgcgagtcgacggg 292
           |||||||| |||||
Sbjct: 664 tgcgagtcaacggg 677



to top

>gb|AF148279.1|AF148279 Mitchella repens 26S ribosomal RNA gene, partial sequence
          Length = 943

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| |||||||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 363 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgccccggtcggatgtgga 422

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           ||||||   || ||||||||| ||||||||||| ||||||
Sbjct: 423 acggctagcgccggtccgccgatcggctcggggcgtggac 462



 Score =  105 bits (53), Expect = 1e-19
 Identities = 62/65 (95%)
 Strand = Plus / Plus

                                                                       
Query: 220 ggcctgcgggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgt 279
           |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||
Sbjct: 589 ggcctgcgggctccccattcgacccgtcttgaaacacggaccaaggagtctgacatgtgt 648

                
Query: 280 gcgag 284
           |||||
Sbjct: 649 gcgag 653



to top

>gb|U52635.1|NDU52635 Nigella damascena nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1047

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||| |||||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcaccccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    |||||||||||||||||||||| ||| ||||
Sbjct: 387 acggcgaaagctggtccgccgctcggctcggtgtgcggac 426



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 560 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 619



to top

>gb|U52632.1|CPU52632 Caltha palustris nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1044

 Score =  119 bits (60), Expect = 7e-24
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                       
Query: 1   cttgaaattgccgggagggaagcggatgggggccggcgatgcgccccggccgtatgcgga 60
           |||||||||| ||||||||||||||||||||||||||||||||| |||| || |||||||
Sbjct: 327 cttgaaattgtcgggagggaagcggatgggggccggcgatgcgcaccggtcggatgcgga 386

                                                   
Query: 61  acggctcttgctggtccgccgctcggctcggggtgtggac 100
           |||||    |||||||||||||||||||||| | ||||||
Sbjct: 387 acggcgagagctggtccgccgctcggctcggtgcgtggac 426



 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 56/60 (93%)
 Strand = Plus / Plus

                                                                       
Query: 227 gggctccccatccgacccgtcttgcaacacggaccaaggagtctgacatgcgtgcgagtc 286
           ||||||||||| || ||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 559 gggctccccattcggcccgtcttgaaacacggaccaaggagtctgacatgtgtgcgagtc 618


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,602,592
Number of Sequences: 3902068
Number of extensions: 1602592
Number of successful extensions: 54982
Number of sequences better than 10.0: 20795
Number of HSP's better than 10.0 without gapping: 20710
Number of HSP's successfully gapped in prelim test: 85
Number of HSP's that attempted gapping in prelim test: 29773
Number of HSP's gapped (non-prelim): 24591
length of query: 369
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 347
effective length of database: 17,147,199,772
effective search space: 5950078320884
effective search space used: 5950078320884
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top