>emb|AL135778.9| Human DNA sequence from clone RP1-119C5 on chromosome 6 Contains the 5'
end of the BMP6 gene for bone morphogenetic protein 6 and
a CpG island, complete sequence
Length = 152786
Score = 42.1 bits (21), Expect = 1.5
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 136 ttgcaagctggaagagaaagt 156
|||||||||||||||||||||
Sbjct: 48628 ttgcaagctggaagagaaagt 48608
>emb|AL596090.11| Mouse DNA sequence from clone RP23-135F6 on chromosome 11 Contains the
5' end of the gene for the likely ortholog of H. sapiens
target of myb1-like 2 (chicken) (TOM1L2) (A730055F12Rik),
a glyceraldehyde-3-phosphate dehydrogenase (Gapd)
pseudogene, the gene for a novel Leucine Rich Repeat
domain-containing protein (4930449E07Rik), the Atpaf2 gene
for ATP synthase mitochondrial F1 complex assembly factor
2, the gene for a novel protein (4933439F18Rik), an acid
phosphatase 1 soluble (Acp1) pseudogene, a ribosomal
protein S4, X-linked (Rps4x) pseudogene, the Drg2 gene for
developmentally regulated GTP binding protein 2, the 5'
end of the Myo15 gene for myosin XV and four CpG islands,
complete sequence
Length = 207440
Score = 42.1 bits (21), Expect = 1.5
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 272 ggagcaaaaaagcaacagtct 292
|||||||||||||||||||||
Sbjct: 85209 ggagcaaaaaagcaacagtct 85229
>emb|AL591430.8| Mouse DNA sequence from clone RP23-41B20 on chromosome 2 Contains the
5' end of the Cdh22 gene for cadherin 22, the Ovcov1 gene
for ovarian cancer overexpressed 1, the Elmo2 gene for
engulfment and cell motility 2, ced-12 homolog (C.
elegans), the 3' end of a putative novel zinc finger
protein and three CpG islands, complete sequence
Length = 144243
Score = 40.1 bits (20), Expect = 6.1
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 172 tgttgctgcttgccataagaggct 195
|||||||||||||| |||||||||
Sbjct: 22579 tgttgctgcttgccctaagaggct 22556
>dbj|AP001960.2| Homo sapiens genomic DNA, chromosome 4q22-q24, clone:2064I15, complete
sequence
Length = 140730
Score = 40.1 bits (20), Expect = 6.1
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 124 tttttctagatcttgcaagc 143
||||||||||||||||||||
Sbjct: 125475 tttttctagatcttgcaagc 125494
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,651,503
Number of Sequences: 3902068
Number of extensions: 4651503
Number of successful extensions: 194729
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 194515
Number of HSP's gapped (non-prelim): 214
length of query: 450
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 428
effective length of database: 17,147,199,772
effective search space: 7339001502416
effective search space used: 7339001502416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)