ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast48b01 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_545387.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC488265), mRNA Length = 714 Score = 65.9 bits (33), Expect = 3e-08 Identities = 45/49 (91%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 401 ccatgtctggtcgcggcaagggcgggaaggggctgggcaagggcggcgc 449
>ref|XM_849188.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611513), mRNA Length = 450 Score = 61.9 bits (31), Expect = 4e-07 Identities = 43/47 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 139 atgtctggtcgcggcaagggcgggaaggggctgggcaagggcggcgc 185
>ref|XM_849161.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611490), mRNA Length = 312 Score = 61.9 bits (31), Expect = 4e-07 Identities = 43/47 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 1 atgtctggtcgcggcaagggcgggaaggggctgggcaagggcggcgc 47
>ref|XM_848746.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611106), mRNA Length = 312 Score = 61.9 bits (31), Expect = 4e-07 Identities = 43/47 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 1 atgtctggtcgcggcaagggcgggaaggggctgggcaagggcggcgc 47
>ref|XM_545382.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC488260), mRNA Length = 312 Score = 61.9 bits (31), Expect = 4e-07 Identities = 43/47 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 1 atgtctggtcgcggcaagggcgggaaggggctgggcaagggcggcgc 47
>ref|XM_545396.2| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC488274), mRNA Length = 366 Score = 60.0 bits (30), Expect = 2e-06 Identities = 42/46 (91%) Strand = Plus / Plus Query: 85 tgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 65 tgtctggtcgcggcaagggcgggaaggggctgggcaagggcggcgc 110
>ref|XM_467181.1| Oryza sativa (japonica cultivar-group), mRNA Length = 312 Score = 58.0 bits (29), Expect = 7e-06 Identities = 38/41 (92%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaaggg 124 |||||||| |||||||||||||| ||||||||||| ||||| Sbjct: 1 atgtctgggcgcggcaagggaggcaaggggctgggcaaggg 41
>gb|BT009488.1| Triticum aestivum clone wr1.pk0058.g3:fis, full insert mRNA sequence Length = 1768 Score = 58.0 bits (29), Expect = 7e-06 Identities = 44/49 (89%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||||||||| |||||||| || ||||| ||||| Sbjct: 1287 ccatgtccggccgcggcaagggaggcaaggggctcggcaagggcggcgc 1335
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 58.0 bits (29), Expect = 7e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaaggg 124 |||||||| |||||||||||||| ||||||||||| ||||| Sbjct: 28013140 atgtctgggcgcggcaagggaggcaaggggctgggcaaggg 28013100 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 26686003 aagctcgccggagggagaa 26686021
>dbj|AP004255.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1212_A08 Length = 119304 Score = 58.0 bits (29), Expect = 7e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaaggg 124 |||||||| |||||||||||||| ||||||||||| ||||| Sbjct: 56802 atgtctgggcgcggcaagggaggcaaggggctgggcaaggg 56762
>dbj|AP004071.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1717_A09 Length = 203132 Score = 58.0 bits (29), Expect = 7e-06 Identities = 38/41 (92%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaaggg 124 |||||||| |||||||||||||| ||||||||||| ||||| Sbjct: 2787 atgtctgggcgcggcaagggaggcaaggggctgggcaaggg 2747
>emb|X79715.1|LTMRHISH4 L.temulentum mRNA for histone H4 Length = 616 Score = 58.0 bits (29), Expect = 7e-06 Identities = 44/49 (89%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||||||||| |||||||| || ||||| ||||| Sbjct: 48 ccatgtcgggccgcggcaagggaggaaaggggctcggcaagggcggcgc 96
>ref|NM_197569.1| Oryza sativa (japonica cultivar-group) histone H4 (OSJNBb0064P21.1), mRNA Length = 372 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 60 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 107
>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1 (LOC417953), mRNA Length = 2271 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| |||||||| ||||| Sbjct: 333 catgtctggcagaggcaagggcgggaaggggctcggtaagggcggcgc 380
>gb|AC096782.6| Oryza sativa chromosome 10 BAC OSJNBa0025B05 genomic sequence, complete sequence Length = 14849 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 3952 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 3999
>gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 genomic sequence, complete sequence Length = 142114 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 5946 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 5899
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 20500656 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 20500609
>dbj|AK119699.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-D04, full insert sequence Length = 544 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 74 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 121
>dbj|AK059098.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-C07, full insert sequence Length = 531 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 70 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 117
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 56.0 bits (28), Expect = 3e-05 Identities = 43/48 (89%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||| ||||| ||||||||||| ||||||||||| ||||| ||||| Sbjct: 20511928 catgtcgggccgtggcaagggaggcaaggggctgggcaagggaggcgc 20511881
>ref|NM_185758.1| Oryza sativa (japonica cultivar-group), mRNA Length = 312 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||| |||||||||||||| ||||| ||||| ||||| Sbjct: 1 atgtctgggcgcgggaagggagggaagggcctgggcaagggaggcgc 47
>ref|XM_473659.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 312 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || |||||||||||||| ||||||||||| ||||| ||||| Sbjct: 1 atgtcggggcgcggcaagggaggcaaggggctgggcaagggcggcgc 47
>gb|BT018251.1| Zea mays clone EL01N0563H01.c mRNA sequence Length = 594 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| || ||||||||||| ||||| ||||| Sbjct: 44 atgtctgggcgcggcaagggcggcaaggggctgggcaagggcggcgc 90
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||||||| ||||| || ||||| || |||||||||||||| Sbjct: 173076 atgtctggccgcggtaagggcggaaagggtctaggtaagggtggcgc 173030
>ref|NM_003539.3| Homo sapiens histone 1, H4d (HIST1H4D), mRNA Length = 367 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||||||| ||||| || ||||| || |||||||||||||| Sbjct: 1 atgtctggccgcggtaagggcggaaagggtctaggtaagggtggcgc 47
>ref|XM_848792.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611148), mRNA Length = 312 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| | |||||||| |||||||||||||| ||||| ||||| Sbjct: 1 atgtctggcagaggcaagggcgggaaggggctgggcaagggcggcgc 47
>gb|AY128657.1| Homo sapiens clone HIST1H4D histone H4 gene, complete cds Length = 930 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||||||| ||||| || ||||| || |||||||||||||| Sbjct: 311 atgtctggccgcggtaagggcggaaagggtctaggtaagggtggcgc 357
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||||||| ||||| || ||||| || |||||||||||||| Sbjct: 95457 atgtctggccgcggtaagggcggaaagggtctaggtaagggtggcgc 95411
>emb|X60482.1|HSH4BHIS H.sapiens H4/b gene for H4 histone Length = 814 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||||||| ||||| || ||||| || |||||||||||||| Sbjct: 257 atgtctggccgcggtaagggcggaaagggtctaggtaagggtggcgc 303
>emb|AL662987.3|OSJN00188 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0088A01, complete sequence Length = 186325 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || |||||||||||||| ||||||||||| ||||| ||||| Sbjct: 135690 atgtcggggcgcggcaagggaggcaaggggctgggcaagggcggcgc 135644
>gb|AY263810.1| Eucalyptus globulus histone H4 mRNA, complete cds Length = 451 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| ||||||||||||||||| |||||||| || ||||| ||||| Sbjct: 1 atgtcgggccgcggcaagggaggcaaggggcttggcaagggcggcgc 47
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || |||||||||||||| ||||||||||| ||||| ||||| Sbjct: 29462674 atgtcggggcgcggcaagggaggcaaggggctgggcaagggcggcgc 29462628
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||| |||||||||||||| ||||| ||||| ||||| Sbjct: 21773710 atgtctgggcgcgggaagggagggaagggcctgggcaagggaggcgc 21773756
>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0534A03 Length = 153170 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||| |||||||||||||| ||||| ||||| ||||| Sbjct: 90893 atgtctgggcgcgggaagggagggaagggcctgggcaagggaggcgc 90939
>dbj|AK059019.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-B02, full insert sequence Length = 594 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || |||||||||||||| ||||||||||| ||||| ||||| Sbjct: 77 atgtcggggcgcggcaagggaggcaaggggctgggcaagggcggcgc 123
>gb|AY105603.1| Zea mays PCO094685 mRNA sequence Length = 731 Score = 54.0 bits (27), Expect = 1e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| || ||||||||||| ||||| ||||| Sbjct: 81 atgtctgggcgcggcaagggcggcaaggggctgggcaagggcggcgc 127
>ref|XM_608100.2| PREDICTED: Bos taurus similar to germinal histone H4 gene (LOC529647), mRNA Length = 951 Score = 52.0 bits (26), Expect = 4e-04 Identities = 44/50 (88%) Strand = Plus / Plus Query: 81 accatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||||| ||||||||||| |||||||| || || || |||||||| Sbjct: 637 accatgtctggacgcggcaagggcgggaagggccttggaaaaggtggcgc 686
>emb|AJ249813.1|MAL249813 Mortierella alpina histone H3.2 and H4.2 genes for histone H3 and for histone H4 Length = 1860 Score = 52.0 bits (26), Expect = 4e-04 Identities = 29/30 (96%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||||||||| ||||| Sbjct: 1288 catgtctggccgcggcaagggaggaaaggg 1317
>ref|XM_849156.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611486), mRNA Length = 444 Score = 52.0 bits (26), Expect = 4e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||||| |||||||||||||| ||||| ||||| Sbjct: 142 cgcggcaagggcgggaaggggctgggcaagggcggcgc 179
>gb|M13377.1|MZEH4C7 Maize (Zea mays) histone H4 gene (H4C7), complete cds Length = 868 Score = 52.0 bits (26), Expect = 4e-04 Identities = 44/50 (88%) Strand = Plus / Plus Query: 81 accatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| || ||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 347 accatgtcggggcgcggaaagggcgggaaggggctgggcaagggcggcgc 396
>gb|M36659.1|MZEH4A Corn histone H4 (H4C13) gene, complete cds Length = 949 Score = 52.0 bits (26), Expect = 4e-04 Identities = 44/50 (88%) Strand = Plus / Plus Query: 81 accatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| || ||||| ||||| |||||||||||||| ||||| ||||| Sbjct: 335 accatgtcggggcgcggaaagggcgggaaggggctgggaaagggcggcgc 384
>gb|AC108500.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1280_A04, complete sequence Length = 88553 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 4571 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 4523
>gb|AC121361.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0009E21, complete sequence Length = 153214 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 113257 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 113305
>gb|AC108503.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1387_F08, complete sequence Length = 141535 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 67508 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 67556
>gb|AC108876.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1525_A02, complete sequence Length = 93826 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 87083 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 87035
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||||||||| ||||| || || ||||| ||||| Sbjct: 1060551 ccatgtcgggccgcggcaagggaggcaagggtcttggcaagggcggcgc 1060599
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 22758058 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 22758106 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Minus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 22592033 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 22591985
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||||||||| ||||| || || ||||| ||||| Sbjct: 1060549 ccatgtcgggccgcggcaagggaggcaagggtcttggcaagggcggcgc 1060597
>gb|AC118980.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1263H11, complete sequence Length = 126827 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||||||||| ||||| || || ||||| ||||| Sbjct: 80766 ccatgtcgggccgcggcaagggaggcaagggtcttggcaagggcggcgc 80814
>dbj|AK119240.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-120-A04, full insert sequence Length = 672 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 89 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 137
>dbj|AK105816.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C11, full insert sequence Length = 588 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 103 ccatgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 151
>dbj|AK058741.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G08, full insert sequence Length = 526 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| ||||||||||||||||| ||||| || || ||||| ||||| Sbjct: 66 ccatgtcgggccgcggcaagggaggcaagggtcttggcaagggcggcgc 114
>gb|M12277.1|WHTH4091 Wheat histone H4 TH091 gene, complete cds Length = 727 Score = 50.1 bits (25), Expect = 0.002 Identities = 43/49 (87%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| |||| |||||| || ||||||||||| ||||| ||||| Sbjct: 251 ccatgtctgggcgcgacaagggcggcaaggggctgggcaagggcggcgc 299
>ref|XM_425458.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC427884), mRNA Length = 516 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 204 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 251
>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945), mRNA Length = 972 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 889 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 842
>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4 Length = 1504 Score = 48.1 bits (24), Expect = 0.006 Identities = 39/44 (88%) Strand = Plus / Minus Query: 81 accatgtctggccgcggcaagggagggaaggggctgggtaaggg 124 ||||||||||| ||||||||||| || ||||| ||||| ||||| Sbjct: 386 accatgtctggacgcggcaagggtggcaagggcctgggcaaggg 343
>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene Length = 8384 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 6665 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 6618 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 787 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 834
>ref|XM_341530.2| PREDICTED: Rattus norvegicus histone 1, H2bm (predicted) (Hist1h2bm_predicted), mRNA Length = 1023 Score = 48.1 bits (24), Expect = 0.006 Identities = 33/36 (91%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctggg 118 |||||||||||| |||||||| |||||||| ||||| Sbjct: 702 catgtctggccgaggcaagggcgggaagggtctggg 737
>gb|U37576.1|GGU37576 Gallus gallus histone H4-VIII gene, complete cds Length = 1481 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 363 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 410
>gb|U37575.1|GGU37575 Gallus gallus histones H4-VI, H2B-VII and H4-VII genes, complete cds Length = 2297 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 2000 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 1953 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 200 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 247
>gb|M74534.1|CHKHIST4B Chicken histone H4 protein gene, complete cds Length = 661 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 160 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 207
>gb|M74533.1|CHKHIST4A Chicken histone H4 protein gene, complete cds Length = 630 Score = 48.1 bits (24), Expect = 0.006 Identities = 42/48 (87%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 143 catgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 190
>ref|XM_475394.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 1 atgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 47
>ref|XM_475383.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 1 atgtcggggcgcggcaagggaggcaaggggctcggcaagggcggcgc 47
>ref|NM_187563.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| ||||||||||||||||| ||||| || || ||||| ||||| Sbjct: 1 atgtcgggccgcggcaagggaggcaagggtcttggcaagggcggcgc 47
>gb|BT017776.1| Zea mays clone EL01N0503B03.c mRNA sequence Length = 622 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| || ||||| ||||| ||||| ||||| Sbjct: 71 atgtctgggcgcggcaagggcggcaagggtctgggcaagggcggcgc 117
>ref|XM_425463.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC427889), mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 1 atgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 47
>ref|XM_416192.1| PREDICTED: Gallus gallus similar to germinal histone H4 gene (LOC417952), mRNA Length = 1374 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 1 atgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 47
>ref|XM_849000.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611344), mRNA Length = 456 Score = 46.1 bits (23), Expect = 0.025 Identities = 32/35 (91%) Strand = Plus / Plus Query: 96 ggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| ||||| ||||| Sbjct: 157 ggcaagggcgggaaggggctgggcaagggcggcgc 191
>ref|XM_848870.1| PREDICTED: Canis familiaris similar to germinal histone H4 gene (LOC611231), mRNA Length = 1428 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| |||||||| || || ||||| ||||| Sbjct: 1117 atgtctggtcgcggcaagggcgggaagggactaggcaagggcggcgc 1163
>gb|BC066250.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79353 IMAGE:7002105), complete cds Length = 365 Score = 46.1 bits (23), Expect = 0.025 Identities = 32/35 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctggg 118 ||||||||||||||||| ||||| ||||| ||||| Sbjct: 1 atgtctggccgcggcaaaggaggtaagggcctggg 35
>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes Length = 4717 Score = 46.1 bits (23), Expect = 0.025 Identities = 44/51 (86%) Strand = Plus / Minus Query: 80 caccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| ||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 4603 caccatgtccggcagaggcaagggcgggaaggggctcggcaaggggggcgc 4553 Score = 46.1 bits (23), Expect = 0.025 Identities = 44/51 (86%) Strand = Plus / Plus Query: 80 caccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| ||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 115 caccatgtccggcagaggcaagggcgggaaggggctcggcaaggggggcgc 165
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| || || ||||| || |||||||| Sbjct: 131357 atgtctggtcgcggcaagggaggaaaaggcctgggcaaaggtggcgc 131311
>dbj|AK133404.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4933413O14 product:histone 1, H4b, full insert sequence Length = 1459 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| || || ||||| || |||||||| Sbjct: 260 atgtctggtcgcggcaagggaggaaaaggcctgggcaaaggtggcgc 214
>ref|NM_178193.1| Mus musculus histone 1, H4b (Hist1h4b), mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| || || ||||| || |||||||| Sbjct: 1 atgtctggtcgcggcaagggaggaaaaggcctgggcaaaggtggcgc 47
>dbj|AK016178.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930558J22 product:histone 4 protein, full insert sequence Length = 1100 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| || || ||||| || |||||||| Sbjct: 282 atgtctggtcgcggcaagggaggaaaaggcctgggcaaaggtggcgc 236
>gb|BC067497.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79354 IMAGE:7002106), complete cds Length = 365 Score = 46.1 bits (23), Expect = 0.025 Identities = 32/35 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctggg 118 ||||||||||||||||| ||||| ||||| ||||| Sbjct: 1 atgtctggccgcggcaaaggaggtaagggcctggg 35
>gb|AY158964.1| Mus musculus histone protein Hist1h4b gene, complete cds Length = 1186 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| || || ||||| || |||||||| Sbjct: 809 atgtctggtcgcggcaagggaggaaaaggcctgggcaaaggtggcgc 763
>gb|AY104535.1| Zea mays PCO094675 mRNA sequence Length = 995 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Minus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || ||||||||||| || ||||||||||| ||||| ||||| Sbjct: 946 atgtcggggcgcggcaagggcggcaaggggctgggcaagggcggcgc 900
>gb|BC067496.1| Homo sapiens histone 1, H4i, mRNA (cDNA clone MGC:79352 IMAGE:7002103), complete cds Length = 364 Score = 46.1 bits (23), Expect = 0.025 Identities = 32/35 (91%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctggg 118 ||||||||||||||||| ||||| ||||| ||||| Sbjct: 1 atgtctggccgcggcaaaggaggtaagggcctggg 35
>ref|NM_001037845.1| Gallus gallus germinal histone H4 gene (LOC417946), mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 1 atgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 47
>ref|NM_001037843.1| Gallus gallus similar to germinal histone H4 gene (LOC417950), mRNA Length = 312 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||| | |||||||| ||||||||||| || ||||| ||||| Sbjct: 1 atgtctggcagaggcaagggcgggaaggggctcggcaagggcggcgc 47
>emb|X13236.1|MMHIS453 Mouse histone H4 gene Length = 1678 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| |||||||||||||| || || ||||| || |||||||| Sbjct: 660 atgtctggtcgcggcaagggaggaaaaggcctgggcaaaggtggcgc 706
>gb|M13370.1|MZEH4C14 Maize (Zea mays) histone H4 gene (H4C14), complete cds Length = 1135 Score = 46.1 bits (23), Expect = 0.025 Identities = 41/47 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||| ||||||||||| || ||||| ||||| ||||| ||||| Sbjct: 472 atgtctgggcgcggcaagggcggcaagggtctgggcaagggcggcgc 518
>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507), mRNA Length = 846 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 525 catgtctggccgcggcaaaggcgggaaggg 554
>gb|BC062345.1| Homo sapiens cDNA clone IMAGE:6597408 Length = 392 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 19 catgtctggccgcggcaaaggcgggaaggg 48
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 70328 catgtctggccgcggcaaaggcgggaaggg 70299 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 62924 catgtctggccgcggcaaaggcgggaaggg 62953
>gb|AC118206.11| Mus musculus chromosome 3, clone RP24-159J16, complete sequence Length = 255036 Score = 44.1 bits (22), Expect = 0.099 Identities = 22/22 (100%) Strand = Plus / Minus Query: 100 agggagggaaggggctgggtaa 121 |||||||||||||||||||||| Sbjct: 189711 agggagggaaggggctgggtaa 189690
>gb|AY128664.1| Homo sapiens clone HIST1H4K histone H4 gene, complete cds Length = 930 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 310 catgtctggccgcggcaaaggcgggaaggg 339
>gb|AY128663.1| Homo sapiens clone HIST1H4J histone H4 gene, complete cds Length = 930 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 311 catgtctggccgcggcaaaggcgggaaggg 340
>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2 Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs, STSs, GSSs and three CpG islands, complete sequence Length = 24706 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Minus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 19875 catgtctggccgcggcaaaggcgggaaggg 19846 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 12471 catgtctggccgcggcaaaggcgggaaggg 12500
>emb|X60484.1|HSH4EHIS H.sapiens H4/e gene for H4 histone Length = 859 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 310 catgtctggccgcggcaaaggcgggaaggg 339
>emb|X60483.1|HSH4DHIS H.sapiens H4/d gene for H4 histone Length = 1528 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 611 catgtctggccgcggcaaaggcgggaaggg 640
>dbj|AB179406.1| Macaca fascicularis testis cDNA clone: QtsA-19327, similar to human histone 1, H4j (HIST1H4J), mRNA, RefSeq: NM_021968.3 Length = 2002 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 85 catgtctggccgcggcaaaggcgggaaggg 114
>gb|BC017361.2| Homo sapiens cDNA clone MGC:29783 IMAGE:4647914, complete cds Length = 416 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 19 catgtctggccgcggcaaaggcgggaaggg 48
>emb|X00091.1|HSHISH4 Human histone H4 gene Length = 709 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 120 catgtctggccgcggcaaaggcgggaaggg 149
>gb|AF086564.1|HUMZE16D01 Homo sapiens full length insert cDNA clone ZE16D01 Length = 382 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 17 catgtctggccgcggcaaaggcgggaaggg 46
>gb|AC132149.4| Mus musculus BAC clone RP23-10H23 from 3, complete sequence Length = 217329 Score = 44.1 bits (22), Expect = 0.099 Identities = 22/22 (100%) Strand = Plus / Plus Query: 100 agggagggaaggggctgggtaa 121 |||||||||||||||||||||| Sbjct: 191158 agggagggaaggggctgggtaa 191179
>gb|J00188.1|HUMHIS4A1 human histone gene h4a Length = 213 Score = 44.1 bits (22), Expect = 0.099 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggg 112 |||||||||||||||||| || |||||||| Sbjct: 118 catgtctggccgcggcaaaggcgggaaggg 147
>ref|NM_021968.3| Homo sapiens histone 1, H4j (HIST1H4J), mRNA Length = 356 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggg 112 ||||||||||||||||| || |||||||| Sbjct: 1 atgtctggccgcggcaaaggcgggaaggg 29
>ref|NM_003541.2| Homo sapiens histone 1, H4k (HIST1H4K), mRNA Length = 354 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggg 112 ||||||||||||||||| || |||||||| Sbjct: 1 atgtctggccgcggcaaaggcgggaaggg 29
>emb|AJ249812.1|MAL249812 Mortierella alpina H3.1 and H4.1 genes for histone H3 and histone H4 Length = 1630 Score = 42.1 bits (21), Expect = 0.39 Identities = 39/45 (86%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtgg 127 ||||||||||||||| || ||||| ||||| || || |||||||| Sbjct: 1089 catgtctggccgcggtaaaggaggaaagggtctcggaaagggtgg 1133
>emb|BX065181.1|CNS09MGH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 323 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaagg 111 ||||||||||||||| |||||||| |||| Sbjct: 128 catgtctggccgcggaaagggaggcaagg 156
>emb|BX063677.1|CNS09LAP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 337 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaagg 111 ||||||||||||||| |||||||| |||| Sbjct: 129 catgtctggccgcggaaagggaggcaagg 157
>emb|BX063164.1|CNS09KWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 924 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaagg 111 ||||||||||||||| |||||||| |||| Sbjct: 122 catgtctggccgcggaaagggaggcaagg 150
>emb|BX061529.1|CNS09JN1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 967 Score = 42.1 bits (21), Expect = 0.39 Identities = 30/33 (90%) Strand = Plus / Plus Query: 92 ccgcggcaagggagggaaggggctgggtaaggg 124 ||||||||||||||| ||||| ||||| ||||| Sbjct: 62 ccgcggcaagggaggcaagggactgggaaaggg 94
>emb|BX020393.1|CNS08NWD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30AB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 327 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaagg 111 ||||||||||||||| |||||||| |||| Sbjct: 117 catgtctggccgcggaaagggaggcaagg 145
>emb|X84376.1|ZMHIS4DNA Z.mays histone H4 gene Length = 1029 Score = 42.1 bits (21), Expect = 0.39 Identities = 36/41 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaaggg 124 |||||||| ||||||||||| || ||||| ||||| ||||| Sbjct: 335 atgtctgggcgcggcaagggcggcaagggtctgggaaaggg 375
>gb|U64845.1| Caenorhabditis elegans cosmid F45F2, complete sequence Length = 29552 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 78 accaccatgtctggccgcggcaagggagg 106 |||||||||||||| ||||| |||||||| Sbjct: 22353 accaccatgtctggacgcggaaagggagg 22381
>gb|AC110002.2| Homo sapiens chromosome 5 clone RP11-125A13, complete sequence Length = 168708 Score = 42.1 bits (21), Expect = 0.39 Identities = 24/25 (96%) Strand = Plus / Plus Query: 103 gagggaaggggctgggtaagggtgg 127 |||||||| |||||||||||||||| Sbjct: 78903 gagggaagaggctgggtaagggtgg 78927
>gb|AC008547.6| Homo sapiens chromosome 5 clone CTC-502M5, complete sequence Length = 114005 Score = 42.1 bits (21), Expect = 0.39 Identities = 24/25 (96%) Strand = Plus / Minus Query: 103 gagggaaggggctgggtaagggtgg 127 |||||||| |||||||||||||||| Sbjct: 44300 gagggaagaggctgggtaagggtgg 44276
>gb|AF038387.1|AF038387 Capsicum annuum histone H4 mRNA, complete cds Length = 483 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggg 112 |||||||||||||| |||||||| ||||| Sbjct: 22 atgtctggccgcggaaagggaggcaaggg 50
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggg 112 ||||| || |||||||||||||||||||| Sbjct: 15861410 atgtcggggcgcggcaagggagggaaggg 15861438
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 0.39 Identities = 42/49 (85%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || ||||||||||| || |||||||| || ||||| ||||| Sbjct: 35833880 ccatgtcggggcgcggcaagggcggcaaggggctcggcaagggcggcgc 35833928 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 21520725 aagctcgccggagggagaa 21520743
>dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0506B12 Length = 170759 Score = 42.1 bits (21), Expect = 0.39 Identities = 42/49 (85%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || ||||||||||| || |||||||| || ||||| ||||| Sbjct: 98338 ccatgtcggggcgcggcaagggcggcaaggggctcggcaagggcggcgc 98386
>dbj|AP005551.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1081_G10 Length = 107955 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggg 112 ||||| || |||||||||||||||||||| Sbjct: 24536 atgtcggggcgcggcaagggagggaaggg 24564
>emb|X00043.1|TAHI01 Wheat histone H4 gene Length = 1200 Score = 42.1 bits (21), Expect = 0.39 Identities = 42/49 (85%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || |||||||||||||| ||||| || || ||||| ||||| Sbjct: 734 ccatgtccgggcgcggcaagggaggcaagggcctaggcaagggcggcgc 782
>emb|Y18575.1|FTR18575 Flaveria trinervia mRNA for histone H4, clone FtHH4 Length = 490 Score = 42.1 bits (21), Expect = 0.39 Identities = 36/41 (87%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaaggg 124 ||||||||||| || ||||| || ||||||||||| ||||| Sbjct: 56 atgtctggccgtggtaagggcggaaaggggctggggaaggg 96
>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 (ENSANGG00000000004), mRNA Length = 630 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaagg 111 ||||||||||||||| |||||||| |||| Sbjct: 114 catgtctggccgcggaaagggaggcaagg 142
>dbj|AK058686.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-A10, full insert sequence Length = 469 Score = 42.1 bits (21), Expect = 0.39 Identities = 27/29 (93%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggg 112 ||||| || |||||||||||||||||||| Sbjct: 51 atgtcggggcgcggcaagggagggaaggg 79
>dbj|AK058436.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-F07, full insert sequence Length = 1449 Score = 42.1 bits (21), Expect = 0.39 Identities = 42/49 (85%) Strand = Plus / Plus Query: 82 ccatgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||| || ||||||||||| || |||||||| || ||||| ||||| Sbjct: 845 ccatgtcggggcgcggcaagggcggcaaggggctcggcaagggcggcgc 893
>gb|J00866.1|CHKH43D8 Chicken histone H4 gene, clone pch3dr8 Length = 675 Score = 42.1 bits (21), Expect = 0.39 Identities = 30/33 (90%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggct 115 |||||||||| | |||||||| ||||||||||| Sbjct: 270 catgtctggcagaggcaagggcgggaaggggct 302
>gb|DQ213262.1| Taeniopygia guttata clone 0061P0011F09 histone 1 H4h-like mRNA, complete sequence Length = 874 Score = 40.1 bits (20), Expect = 1.5 Identities = 41/48 (85%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||||||||||| |||||||| || || ||||| || ||||| ||||| Sbjct: 39 catgtctggccggggcaagggcggcaaagggctcggcaagggcggcgc 86
>gb|AC115940.11| Mus musculus chromosome 5, clone RP24-553D12, complete sequence Length = 189685 Score = 40.1 bits (20), Expect = 1.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 caagggagggaaggggctgg 117 |||||||||||||||||||| Sbjct: 32960 caagggagggaaggggctgg 32979
>gb|AC127275.4| Mus musculus BAC clone RP24-207I8 from chromosome 5, complete sequence Length = 180919 Score = 40.1 bits (20), Expect = 1.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 caagggagggaaggggctgg 117 |||||||||||||||||||| Sbjct: 107894 caagggagggaaggggctgg 107913
>emb|AL049794.16|HSDJ777L9 Human DNA sequence from clone RP4-777L9 on chromosome 20 Contains the 5' end of the C20orf23 gene for a novel protein similar to KIF1 type and other kinesin-like proteins, the RPLP0P1 gene for ribosomal protein large P0 pseudogene 1 and a CpG island, complete sequence Length = 119696 Score = 40.1 bits (20), Expect = 1.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 97 gcaagggagggaaggggctg 116 |||||||||||||||||||| Sbjct: 78888 gcaagggagggaaggggctg 78869
>emb|BX069194.1|CNS09PJY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 370 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 119 cgcggcaagggaggcaagggactgggaaaggg 150
>emb|BX066857.1|CNS09NR1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 824 cgcggcaagggaggcaagggactgggaaaggg 793
>emb|BX066856.1|CNS09NR0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BC05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 113 cgcggcaagggaggcaagggactgggaaaggg 144
>emb|BX061530.1|CNS09JN2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 788 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 755 cgcggcaagggaggcaagggactgggaaaggg 724
>emb|BX061455.1|CNS09JKZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 988 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 872 cgcggcaagggaggcaagggactgggaaaggg 841
>emb|BX061454.1|CNS09JKY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BB08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1017 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 107 cgcggcaagggaggcaagggactgggaaaggg 138
>emb|BX060419.1|CNS09IS7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 94 cgcggcaagggaggcaagggactgggaaaggg 125
>emb|BX057868.1|CNS09GTC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 906 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 819 cgcggcaagggaggcaagggactgggaaaggg 788
>emb|BX057867.1|CNS09GTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 961 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 118 cgcggcaagggaggcaagggactgggaaaggg 149
>emb|BX053210.1|CNS09D7Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 763 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 99 cgcggcaagggaggcaagggactgggaaaggg 130
>emb|BX053174.1|CNS09D6Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 626 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 107 cgcggcaagggaggcaagggactgggaaaggg 138
>emb|BX053099.1|CNS09D4V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC30CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 434 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 52 cgcggcaagggaggcaagggactgggaaaggg 83
>emb|BX048034.1|CNS09986 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC22DF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 857 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 87 cgcggcaagggaggcaagggactgggaaaggg 118
>gb|AC069528.10| Homo sapiens 3 BAC RP11-329N15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 163163 Score = 40.1 bits (20), Expect = 1.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 74 gtcaaccaccatgtctggcc 93 |||||||||||||||||||| Sbjct: 132644 gtcaaccaccatgtctggcc 132663
>emb|BX047204.1|CNS098L4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 554 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 435 cgcggcaagggaggcaagggactgggaaaggg 404
>emb|BX047203.1|CNS098L3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21BB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 36 cgcggcaagggaggcaagggactgggaaaggg 67
>emb|BX047092.1|CNS098I0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC21AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 900 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 98 cgcggcaagggaggcaagggactgggaaaggg 129
>emb|BX043672.1|CNS095V0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC16BG04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 369 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 219 cgcggcaagggaggcaagggactgggaaaggg 188
>emb|BX039314.1|CNS092HY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC1AD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 820 cgcggcaagggaggcaagggactgggaaaggg 789
>emb|BX039313.1|CNS092HX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC1AD09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 114 cgcggcaagggaggcaagggactgggaaaggg 145
>emb|BX037780.1|CNS091BC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 622 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 532 cgcggcaagggaggcaagggactgggaaaggg 501
>emb|BX037779.1|CNS091BB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 604 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 126 cgcggcaagggaggcaagggactgggaaaggg 157
>emb|BX036322.1|CNS0906U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8AE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 107 cgcggcaagggaggcaagggactgggaaaggg 138
>emb|BX032922.1|CNS08XKE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Minus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 831 cgcggcaagggaggcaagggactgggaaaggg 800
>emb|BX032921.1|CNS08XKD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 982 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 109 cgcggcaagggaggcaagggactgggaaaggg 140
>emb|BX020583.1|CNS08O1N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30BC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 394 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 28 cgcggcaagggaggcaagggactgggaaaggg 59
>emb|BX009114.1|CNS08F72 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA14DD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 965 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 89 cgcggcaagggaggcaagggactgggaaaggg 120
>emb|X98017.1|TVH43 T.vaginalis DNA for histone H4-3 Length = 791 Score = 40.1 bits (20), Expect = 1.5 Identities = 38/44 (86%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtgg 127 |||||||||||||| || || || ||||| || ||||||||||| Sbjct: 135 atgtctggccgcggtaaaggtggtaagggtcttggtaagggtgg 178
>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 (ENSANGG00000013551), partial mRNA Length = 375 Score = 40.1 bits (20), Expect = 1.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaagg 111 |||||||||||||| |||||||| |||| Sbjct: 1 atgtctggccgcggaaagggaggcaagg 28
>ref|XM_311439.2| Anopheles gambiae str. PEST ENSANGP00000018626 (ENSANGG00000016137), partial mRNA Length = 312 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 10 cgcggcaagggaggcaagggactgggaaaggg 41
>ref|XM_306825.2| Anopheles gambiae str. PEST ENSANGP00000000125 (ENSANGG00000000123), partial mRNA Length = 312 Score = 40.1 bits (20), Expect = 1.5 Identities = 29/32 (90%) Strand = Plus / Plus Query: 93 cgcggcaagggagggaaggggctgggtaaggg 124 |||||||||||||| ||||| ||||| ||||| Sbjct: 10 cgcggcaagggaggcaagggactgggaaaggg 41
>emb|AL662804.18| Mouse DNA sequence from clone RP23-341C5 on chromosome 11, complete sequence Length = 223438 Score = 40.1 bits (20), Expect = 1.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 aagggagggaaggggctggg 118 |||||||||||||||||||| Sbjct: 126921 aagggagggaaggggctggg 126902
>gb|AC123673.7| Mus musculus chromosome 1, clone RP23-258D13, complete sequence Length = 191401 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 100 agggagggaaggggctggg 118 ||||||||||||||||||| Sbjct: 106503 agggagggaaggggctggg 106521
>gb|AY648850.1| Homo sapiens histone H4/o gene, complete cds Length = 930 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 108 aaggggctgggtaagggtggcgc 130 ||||||||||||||||| ||||| Sbjct: 335 aaggggctgggtaagggaggcgc 357
>ref|XM_520759.1| PREDICTED: Pan troglodytes similar to germinal histone H4 gene (LOC465305), mRNA Length = 1195 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 108 aaggggctgggtaagggtggcgc 130 ||||||||||||||||| ||||| Sbjct: 172 aaggggctgggtaagggaggcgc 194
>ref|XM_467147.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1532 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 138 aagctcgccggagggagaa 120
>ref|NM_190485.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 312 Score = 38.2 bits (19), Expect = 6.1 Identities = 40/47 (85%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||| || ||||||||||| || |||||||| || ||||| ||||| Sbjct: 1 atgtcggggcgcggcaagggcggcaaggggctcggcaagggcggcgc 47
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 43 acagaacccaagctcgccg 61 ||||||||||||||||||| Sbjct: 670250 acagaacccaagctcgccg 670232
>gb|AC024696.1| Caenorhabditis elegans cosmid F07B7, complete sequence Length = 40246 Score = 38.2 bits (19), Expect = 6.1 Identities = 25/27 (92%) Strand = Plus / Plus Query: 80 caccatgtctggccgcggcaagggagg 106 |||||||||||| ||||| |||||||| Sbjct: 18965 caccatgtctggacgcggaaagggagg 18991 Score = 38.2 bits (19), Expect = 6.1 Identities = 25/27 (92%) Strand = Plus / Minus Query: 80 caccatgtctggccgcggcaagggagg 106 |||||||||||| ||||| |||||||| Sbjct: 15474 caccatgtctggacgcggaaagggagg 15448
>ref|XM_369778.1| Magnaporthe grisea 70-15 hypothetical protein (MG06293.4) partial mRNA Length = 312 Score = 38.2 bits (19), Expect = 6.1 Identities = 37/43 (86%) Strand = Plus / Plus Query: 88 ctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 |||| ||||| |||||||| ||||| || || ||||||||||| Sbjct: 5 ctggacgcggaaagggaggaaagggtcttggaaagggtggcgc 47
>ref|XM_610233.2| PREDICTED: Bos taurus similar to Histone H2AFX (Histone H2A.X) (H2a/x) (LOC531733), mRNA Length = 1724 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 83 catgtctggccgcggcaag 101 ||||||||||||||||||| Sbjct: 489 catgtctggccgcggcaag 507
>gb|U64843.2| Caenorhabditis elegans cosmid K06C4, complete sequence Length = 43177 Score = 38.2 bits (19), Expect = 6.1 Identities = 25/27 (92%) Strand = Plus / Plus Query: 80 caccatgtctggccgcggcaagggagg 106 |||||||||||| ||||| |||||||| Sbjct: 16621 caccatgtctggacgcggaaagggagg 16647 Score = 38.2 bits (19), Expect = 6.1 Identities = 25/27 (92%) Strand = Plus / Minus Query: 80 caccatgtctggccgcggcaagggagg 106 |||||||||||| ||||| |||||||| Sbjct: 13130 caccatgtctggacgcggaaagggagg 13104
>ref|XM_843027.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0423) partial mRNA Length = 2526 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 43 acagaacccaagctcgccg 61 ||||||||||||||||||| Sbjct: 1653 acagaacccaagctcgccg 1635
>emb|CR339054.14| Zebrafish DNA sequence from clone DKEY-151M22 in linkage group 23, complete sequence Length = 184755 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 29 aacagcacacacccacaga 47 ||||||||||||||||||| Sbjct: 178726 aacagcacacacccacaga 178744
>gb|AC127236.3| Mus musculus BAC clone RP24-351L1 from chromosome 18, complete sequence Length = 188946 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 31 cagcacacacccacagaac 49 ||||||||||||||||||| Sbjct: 161003 cagcacacacccacagaac 160985
>gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome 6, complete sequence Length = 154613 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 103 gagggaaggggctgggtaa 121 ||||||||||||||||||| Sbjct: 57596 gagggaaggggctgggtaa 57578
>gb|AY128653.1| Homo sapiens clone HIST4H4 histone H4 gene, complete cds Length = 930 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 108 aaggggctgggtaagggtggcgc 130 ||||||||||||||||| ||||| Sbjct: 335 aaggggctgggtaagggaggcgc 357
>gb|AC083946.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-132J21, complete sequence Length = 200910 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 103 gagggaaggggctgggtaa 121 ||||||||||||||||||| Sbjct: 147161 gagggaaggggctgggtaa 147143
>gb|AC091762.27| Mus musculus strain C57BL/6J clone rp23-151n4 map 2, complete sequence Length = 204734 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 100 agggagggaaggggctggg 118 ||||||||||||||||||| Sbjct: 70251 agggagggaaggggctggg 70269
>gb|AC027449.6| Homo sapiens chromosome 18, clone RP11-535A5, complete sequence Length = 149660 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 99 aagggagggaaggggctgg 117 ||||||||||||||||||| Sbjct: 117801 aagggagggaaggggctgg 117783
>gb|AF454824.1| Enterococcus faecalis pathogenicity island, complete sequence Length = 153571 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 23 cgccgcaacagcacacacc 41 ||||||||||||||||||| Sbjct: 42448 cgccgcaacagcacacacc 42430
>gb|AC182390.3| Pan troglodytes BAC clone CH251-614D4 from chromosome 17, complete sequence Length = 197192 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 77 aaccaccatgtctggccgc 95 ||||||||||||||||||| Sbjct: 60218 aaccaccatgtctggccgc 60200
>dbj|AB226301.1| Aspergillus oryzae cDNA, contig sequence: AoEST3163 Length = 782 Score = 38.2 bits (19), Expect = 6.1 Identities = 40/47 (85%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||||| || ||||| || ||||| || || ||||||||||| Sbjct: 95 atgtctggccgtggaaagggtggaaagggtctcggaaagggtggcgc 141
>gb|AF361948.1| Eimeria tenella histone 4 (H4) gene, complete cds Length = 2086 Score = 38.2 bits (19), Expect = 6.1 Identities = 40/47 (85%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||||| || || ||||| |||||| |||| ||||| ||||| Sbjct: 756 atgtctggccgaggaaaaggaggaaaggggttgggaaagggaggcgc 802
>gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rosewell Park Cancer Institute Human Bac Library) complete sequence Length = 104926 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 108 aaggggctgggtaagggtggcgc 130 ||||||||||||||||| ||||| Sbjct: 20114 aaggggctgggtaagggaggcgc 20136
>ref|NM_175054.2| Homo sapiens histone 4, H4 (HIST4H4), mRNA Length = 412 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 108 aaggggctgggtaagggtggcgc 130 ||||||||||||||||| ||||| Sbjct: 72 aaggggctgggtaagggaggcgc 94
>gb|AY032999.1| Enterococcus faecalis putative pathogenicity island, partial sequence Length = 30711 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 23 cgccgcaacagcacacacc 41 ||||||||||||||||||| Sbjct: 6034 cgccgcaacagcacacacc 6016
>ref|NM_074631.2| Caenorhabditis elegans HIStone family member (his-3) (his-3) mRNA, complete cds Length = 398 Score = 38.2 bits (19), Expect = 6.1 Identities = 25/27 (92%) Strand = Plus / Plus Query: 80 caccatgtctggccgcggcaagggagg 106 |||||||||||| ||||| |||||||| Sbjct: 11 caccatgtctggacgcggaaagggagg 37
>gb|AC131157.4| Homo sapiens 12 BAC RP11-70F11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 180907 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 101 gggagggaaggggctgggtaagg 123 |||||||||||||||||| |||| Sbjct: 67450 gggagggaaggggctgggaaagg 67472
>ref|XM_225382.1| PREDICTED: Rattus norvegicus histone 1, H4m (predicted) (Hist1h4m_predicted), mRNA Length = 312 Score = 38.2 bits (19), Expect = 6.1 Identities = 31/35 (88%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctggg 118 ||||||||||| || ||||| |||||||| ||||| Sbjct: 1 atgtctggccgaggtaagggcgggaagggtctggg 35
>gb|AC132812.9| Homo sapiens chromosome 17, clone RP13-104F24, complete sequence Length = 161139 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 77 aaccaccatgtctggccgc 95 ||||||||||||||||||| Sbjct: 72509 aaccaccatgtctggccgc 72527
>dbj|AP005072.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0708H12 Length = 162381 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 48033 aagctcgccggagggagaa 48051
>dbj|AP003342.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0049O23 Length = 121038 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 14264 aagctcgccggagggagaa 14282
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 120164 aagctcgccggagggagaa 120182
>emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right terminal inverted repeat Length = 243019 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 20 caccgccgcaacagcacacaccc 42 ||||||||||||||| ||||||| Sbjct: 189228 caccgccgcaacagcgcacaccc 189250
>dbj|AK066526.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013073N06, full insert sequence Length = 1533 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 aagctcgccggagggagaa 70 ||||||||||||||||||| Sbjct: 138 aagctcgccggagggagaa 120
>gb|BC020884.1| Homo sapiens histone 4, H4, mRNA (cDNA clone MGC:24116 IMAGE:4619662), complete cds Length = 1951 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 108 aaggggctgggtaagggtggcgc 130 ||||||||||||||||| ||||| Sbjct: 72 aaggggctgggtaagggaggcgc 94
>emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left terminal inverted repeat Length = 273746 Score = 38.2 bits (19), Expect = 6.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 20 caccgccgcaacagcacacaccc 42 ||||||||||||||| ||||||| Sbjct: 189228 caccgccgcaacagcgcacaccc 189250
>gb|AE016830.1| Enterococcus faecalis V583, complete genome Length = 3218031 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 23 cgccgcaacagcacacacc 41 ||||||||||||||||||| Sbjct: 484736 cgccgcaacagcacacacc 484718
>emb|Z93388.1|CET10C6 Caenorhabditis elegans Cosmid T10C6, complete sequence Length = 33451 Score = 38.2 bits (19), Expect = 6.1 Identities = 25/27 (92%) Strand = Plus / Plus Query: 80 caccatgtctggccgcggcaagggagg 106 |||||||||||| ||||| |||||||| Sbjct: 28884 caccatgtctggacgcggaaagggagg 28910
>gb|AC127585.3| Mus musculus BAC clone RP24-141G21 from 15, complete sequence Length = 145858 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 102 ggagggaaggggctgggta 120 ||||||||||||||||||| Sbjct: 102495 ggagggaaggggctgggta 102513
>gb|L37110.1|AD1CLYL Plasmid pAD1 (from Enterococcus faecalis) cylLl, cylLs, cylM, clyB, cylA genes, complete cds Length = 7500 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 23 cgccgcaacagcacacacc 41 ||||||||||||||||||| Sbjct: 723 cgccgcaacagcacacacc 705
>emb|AL845266.2| Mouse DNA sequence from clone RP23-449M10 on chromosome 2, complete sequence Length = 171836 Score = 38.2 bits (19), Expect = 6.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 100 agggagggaaggggctggg 118 ||||||||||||||||||| Sbjct: 153874 agggagggaaggggctggg 153856
>dbj|AB033943.1| Aspergillus oryzae mRNA for histone H4, complete cds Length = 552 Score = 38.2 bits (19), Expect = 6.1 Identities = 40/47 (85%) Strand = Plus / Plus Query: 84 atgtctggccgcggcaagggagggaaggggctgggtaagggtggcgc 130 ||||||||||| || ||||| || ||||| || || ||||||||||| Sbjct: 41 atgtctggccgtggaaagggtggaaagggtctcggaaagggtggcgc 87 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,117,414 Number of Sequences: 3902068 Number of extensions: 1117414 Number of successful extensions: 110627 Number of sequences better than 10.0: 200 Number of HSP's better than 10.0 without gapping: 201 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 109944 Number of HSP's gapped (non-prelim): 683 length of query: 130 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 109 effective length of database: 17,151,101,840 effective search space: 1869470100560 effective search space used: 1869470100560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
