ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast47d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_425335.1| PREDICTED: Gallus gallus similar to AI448887 pr... 46 0.086
2gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxyl... 44 0.34
3gb|AC132412.2| Mus musculus BAC clone RP23-355N5 from chromosome... 44 0.34
4emb|AL357552.25| Human DNA sequence from clone RP4-633I8 on chro... 44 0.34
5dbj|AK047167.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 44 0.34
6gb|AC128664.3| Mus musculus BAC clone RP24-328H10 from 6, comple... 44 0.34
7gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome 42 1.3
8gb|AC135420.4| Oryza sativa (japonica cultivar-group) chromosome... 40 5.3
9gb|AC113998.5| Mus musculus BAC clone RP23-137C20 from 13, compl... 40 5.3
10gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 5.3
11gb|AC171007.3| Gallus gallus BAC clone CH261-166I11 from chromos... 40 5.3
12gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulga... 40 5.3
13dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
14gb|AC051619.7|AC051619 Homo sapiens chromosome 15 clone CTD-2651... 40 5.3
15gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 5.3
16gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding p... 40 5.3
17gb|AE015451.1| Pseudomonas putida KT2440 complete genome 40 5.3
18gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosom... 40 5.3

>ref|XM_425335.1| PREDICTED: Gallus gallus similar to AI448887 protein (LOC427762),
           partial mRNA
          Length = 1653

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 112 ccagccgcccccgtcggtcgtca 134
           |||||||||||||||||||||||
Sbjct: 660 ccagccgcccccgtcggtcgtca 638



to top

>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and
              SNF2P genes, complete cds; nucellin pseudogene, complete
              sequence; putative transposase, phosphatidylinositol
              phosphatidylcholine transfer protein sec14 cytosolic-like
              protein, and phytochrome P450-like protein genes, complete
              cds; and unknown genes
          Length = 438828

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 368    agcaacaaggatcggagagttgattt 393
              ||||| ||||||||||||||||||||
Sbjct: 196426 agcaagaaggatcggagagttgattt 196451



to top

>gb|AC132412.2| Mus musculus BAC clone RP23-355N5 from chromosome 6, complete sequence
          Length = 171747

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 173    gccaggtaggttctctaccatc 194
              ||||||||||||||||||||||
Sbjct: 141606 gccaggtaggttctctaccatc 141627



to top

>emb|AL357552.25| Human DNA sequence from clone RP4-633I8 on chromosome 1p36.21-36.32
              Contains the 5' end of the RERE gene for arginine-glutamic
              acid dipeptide (RE) repeats (FLJ38775), two ribosomal
              protein L7 (RPL7) pseudogenes, a ribosomal protein L27
              (RPL27) pseudogene, a novel gene and a CpG island, complete
              sequence
          Length = 143969

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 338    cagtcctgcagcagcagggcag 359
              ||||||||||||||||||||||
Sbjct: 125541 cagtcctgcagcagcagggcag 125520



to top

>dbj|AK047167.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930030P05 product:hypothetical
           Arginine-rich region containing protein, full insert
           sequence
          Length = 1757

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 173 gccaggtaggttctctaccatc 194
           ||||||||||||||||||||||
Sbjct: 968 gccaggtaggttctctaccatc 947



to top

>gb|AC128664.3| Mus musculus BAC clone RP24-328H10 from 6, complete sequence
          Length = 147041

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 173   gccaggtaggttctctaccatc 194
             ||||||||||||||||||||||
Sbjct: 17045 gccaggtaggttctctaccatc 17066



to top

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 236     gcttgctggcgcatgagcgga 256
               |||||||||||||||||||||
Sbjct: 3138450 gcttgctggcgcatgagcgga 3138470



to top

>gb|AC135420.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0060G17, complete sequence
          Length = 174949

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   cgcgccgtcgtgctgccggc 230
             ||||||||||||||||||||
Sbjct: 76259 cgcgccgtcgtgctgccggc 76278



to top

>gb|AC113998.5| Mus musculus BAC clone RP23-137C20 from 13, complete sequence
          Length = 194221

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 349   cagcagggcagcacagaagagcaa 372
             |||||||||||||| |||||||||
Sbjct: 43704 cagcagggcagcactgaagagcaa 43681



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 198     gcggccgcggcaccgcgccg 217
               ||||||||||||||||||||
Sbjct: 1236828 gcggccgcggcaccgcgccg 1236847



to top

>gb|AC171007.3| Gallus gallus BAC clone CH261-166I11 from chromosome ul, complete
             sequence
          Length = 223327

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 343   ctgcagcagcagggcagcac 362
             ||||||||||||||||||||
Sbjct: 68464 ctgcagcagcagggcagcac 68445



to top

>gb|S68728.1| LHC Ib-21=light-harvesting complex I [Hordeum vulgare=barley,
           Prato, mRNA Chloroplast, 878 nt]
          Length = 878

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 137 tcgcggagcagcagcgcacc 156
           ||||||||||||||||||||
Sbjct: 380 tcgcggagcagcagcgcacc 399



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 211     cgcgccgtcgtgctgccggc 230
               ||||||||||||||||||||
Sbjct: 7986668 cgcgccgtcgtgctgccggc 7986687



to top

>gb|AC051619.7|AC051619 Homo sapiens chromosome 15 clone CTD-2651B20 map 15q21.1, complete
             sequence
          Length = 213999

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   cctccaactacgaggctcca 294
             ||||||||||||||||||||
Sbjct: 16561 cctccaactacgaggctcca 16580



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 202     ccgcggcaccgcgccgtcgtgctgccgg 229
               |||||||||||||||| || ||||||||
Sbjct: 2482048 ccgcggcaccgcgccgacgagctgccgg 2482075



to top

>gb|AF218305.1|AF218305 Hordeum vulgare chlorophyll a/b binding protein precursor (lhca1)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 784

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 137 tcgcggagcagcagcgcacc 156
           ||||||||||||||||||||
Sbjct: 498 tcgcggagcagcagcgcacc 517



to top

>gb|AE015451.1| Pseudomonas putida KT2440 complete genome
          Length = 6181863

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 339     agtcctgcagcagcagggca 358
               ||||||||||||||||||||
Sbjct: 1706984 agtcctgcagcagcagggca 1706965



to top

>gb|AC168881.3| Mus musculus BAC clone RP23-170A19 from chromosome 13, complete
             sequence
          Length = 212206

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 349   cagcagggcagcacagaagagcaa 372
             |||||||||||||| |||||||||
Sbjct: 95431 cagcagggcagcactgaagagcaa 95454


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,304,985
Number of Sequences: 3902068
Number of extensions: 2304985
Number of successful extensions: 47035
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46607
Number of HSP's gapped (non-prelim): 428
length of query: 397
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 375
effective length of database: 17,147,199,772
effective search space: 6430199914500
effective search space used: 6430199914500
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top