ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast47b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_475118.1| Oryza sativa (japonica cultivar-group), predic... 123 5e-25
2dbj|AK104747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
3dbj|AK104602.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
4dbj|AK072091.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
5dbj|AK060107.1| Oryza sativa (japonica cultivar-group) cDNA clon... 123 5e-25
6dbj|AK065490.1| Oryza sativa (japonica cultivar-group) cDNA clon... 103 5e-19
7ref|XM_477564.1| Oryza sativa (japonica cultivar-group), mRNA 64 4e-07
8ref|XM_506268.1| PREDICTED Oryza sativa (japonica cultivar-group... 64 4e-07
9dbj|AK099295.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
10dbj|AK071844.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
11gb|AC135929.2| Oryza sativa (japonica cultivar-group) chromosome... 60 7e-06
12gb|AC134348.2| Oryza sativa (japonica cultivar-group) chromosome... 60 7e-06
13dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 60 7e-06
14gb|AC115928.10| Mus musculus chromosome 18, clone RP24-530D22, c... 58 3e-05
15gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosom... 58 3e-05
16gb|AC153499.7| Mus musculus 10 BAC RP23-478J15 (Roswell Park Can... 58 3e-05
17gb|AC010344.6| Homo sapiens chromosome 5 clone CTD-2017I7, compl... 58 3e-05
18gb|AC154669.2| Mus musculus BAC clone RP24-289P23 from 14, compl... 58 3e-05
19gb|AC116137.19| Mus musculus chromosome 19, clone RP23-122L1, co... 58 3e-05
20gb|AC154690.3| Mus musculus BAC clone RP24-331B7 from chromosome... 58 3e-05
21gb|AC113302.13| Mus musculus chromosome 5, clone RP23-431M7, com... 56 1e-04
22gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, c... 56 1e-04
23gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's ... 56 1e-04
24gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 ma... 56 1e-04
25gb|AC024028.10| Homo sapiens BAC clone RP11-151M24 from 7, compl... 56 1e-04
26gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosom... 56 1e-04
27gb|AC112258.4| Mus musculus BAC clone RP23-169M10 from 8, comple... 56 1e-04
28gb|AC163902.2| Mus musculus BAC clone RP23-479B18 from chromosom... 56 1e-04
29gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 m... 56 1e-04
30ref|XM_625679.1| Cryptosporidium parvum Iowa II hypothetical pro... 56 1e-04
31gb|AC116104.7| Mus musculus chromosome 5, clone RP23-18K20, comp... 56 1e-04
32emb|CT025871.10| Mouse DNA sequence from clone RP24-324L15 on ch... 56 1e-04
33gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, comple... 56 1e-04
34emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chro... 56 1e-04
35gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, co... 54 4e-04
36gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, com... 54 4e-04
37gb|AC021382.6|AC021382 Homo sapiens, clone RP11-26N15, complete ... 54 4e-04
38gb|AC101764.11| Mus musculus chromosome 3, clone RP24-471B15, co... 54 4e-04
39emb|AL683880.7| Mouse DNA sequence from clone RP23-124M9 on chro... 54 4e-04
40gb|AC098597.2| Homo sapiens BAC clone RP11-521C6 from 4, complet... 54 4e-04
41gb|AC115834.8| Mus musculus chromosome 3, clone RP24-159L1, comp... 52 0.002
42ref|XM_482878.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
43ref|XM_480435.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.002
44gb|AC126125.6| Rattus norvegicus 14 BAC CH230-25F8 (Children's H... 52 0.002
45gb|AC115290.5| Mus musculus BAC clone RP23-65M10 from chromosome... 52 0.002
46gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosom... 52 0.002
47gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete... 52 0.002
48emb|AL669846.11| Mouse DNA sequence from clone RP23-298L23 on ch... 52 0.002
49gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome... 52 0.002
50gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome... 52 0.002
51dbj|AK042647.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 52 0.002
52dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
53dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
54gb|AC154626.2| Mus musculus BAC clone RP23-311B8 from chromosome... 52 0.002
55gb|AC154681.2| Mus musculus BAC clone RP24-314G22 from chromosom... 52 0.002
56dbj|AP004693.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
57dbj|AP004568.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
58dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
59dbj|AP004656.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.002
60dbj|AK120496.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
61dbj|AK105577.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
62gb|AC154266.2| Mus musculus BAC clone RP24-321J24 from 13, compl... 52 0.002
63gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 52 0.002
64emb|AL935317.10| Zebrafish DNA sequence from clone CH211-199I10,... 52 0.002
65gb|AC173482.1| Mus musculus BAC clone RP23-383F20 from chromosom... 52 0.002
66emb|AL713906.3|CNS07YQ6 Oryza sativa chromosome 12, . BAC OJ1587... 52 0.002
67gb|AC132611.3| Mus musculus BAC clone RP23-375I21 from 17, compl... 52 0.002
68gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, co... 50 0.006
69gb|AC153729.1| Mus musculus BAC RP23-88C11 (Roswell Park Cancer... 50 0.006
70ref|NM_016374.4| Homo sapiens AT rich interactive domain 4B (RBP... 50 0.006
71gb|AC151736.6| Mus musculus BAC clone RP23-9L16 from chromosome ... 50 0.006
72gb|AC158954.17| Mus musculus chromosome 15, clone RP23-213P14, c... 50 0.006
73gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, com... 50 0.006
74gb|AC161212.9| Mus musculus chromosome 3, clone RP24-267M11, com... 50 0.006
75ref|XM_514285.1| PREDICTED: Pan troglodytes similar to AT rich i... 50 0.006
76ref|NM_022621.1| Rattus norvegicus nucleolin-related protein (No... 50 0.006
77gb|AC170163.1| Homo sapiens chromosome 1 clone WI2-3014I21, comp... 50 0.006
78gb|AC118932.7| Mus musculus chromosome 5, clone RP24-147H20, com... 50 0.006
79ref|NM_001012324.1| Mus musculus extracellular matrix protein 2,... 50 0.006
80gb|AC115789.9| Mus musculus chromosome 18, clone RP23-398N2, com... 50 0.006
81gb|AC158791.4| Mus musculus chromosome 1, clone RP23-247C6, comp... 50 0.006
82gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com... 50 0.006
83gb|U65590.1|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1R... 50 0.006
84gb|AY228561.1| Perdix perdix clone LEI30 microsatellite sequence 50 0.006
85gb|AC107760.9| Mus musculus chromosome 15, clone RP23-189K4, com... 50 0.006
86gb|AC121095.16| Mus musculus chromosome 14, clone RP24-324H17, c... 50 0.006
87gb|AC102757.6| Mus musculus chromosome 5, clone RP24-196M24, com... 50 0.006
88gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome... 50 0.006
89gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosom... 50 0.006
90gb|AC138595.10| Mus musculus chromosome 1, clone RP24-286D13, co... 50 0.006
91gb|AC115793.14| Mus musculus chromosome 9, clone RP23-400G18, co... 50 0.006
92gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, co... 50 0.006
93gb|AC115033.9| Mus musculus chromosome 15, clone RP24-269A7, com... 50 0.006
94gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's... 50 0.006
95gb|AC095688.7| Rattus norvegicus 2 BAC CH230-9C20 (Children's Ho... 50 0.006
96gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, co... 50 0.006
97gb|AC161409.11| Mus musculus chromosome 7, clone RP23-292B24, co... 50 0.006
98gb|AC102745.10| Mus musculus chromosome 17, clone RP24-371L2, co... 50 0.006
99gb|AC125233.4| Mus musculus BAC clone RP23-9D24 from chromosome ... 50 0.006
100gb|AC116595.4| Mus musculus BAC clone RP24-127G9 from chromosome... 50 0.006
101ref|XM_958850.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
102ref|XM_581028.2| PREDICTED: Bos taurus similar to cyclin I, tran... 50 0.006
103ref|XM_873106.1| PREDICTED: Bos taurus similar to cyclin I, tran... 50 0.006
104ref|XM_864393.1| PREDICTED: Bos taurus similar to cyclin I, tran... 50 0.006
105ref|XM_872917.1| PREDICTED: Bos taurus similar to cyclin I, tran... 50 0.006
106gb|AC121499.9| Mus musculus chromosome 9, clone RP23-269E5, comp... 50 0.006
107ref|XM_329974.1| Neurospora crassa OR74A hypothetical protein (N... 50 0.006
108gb|AC110168.11| Mus musculus chromosome 17, clone RP23-312F5, co... 50 0.006
109ref|XM_717782.1| Candida albicans SC5314 hypothetical protein (C... 50 0.006
110ref|XM_717636.1| Candida albicans SC5314 hypothetical protein (C... 50 0.006
111gb|AC140460.3| Mus musculus BAC clone RP24-151D4 from chromosome... 50 0.006
112gb|AC124717.3| Mus musculus BAC clone RP24-147K15 from chromosom... 50 0.006
113gb|BC065151.1| Mus musculus cDNA sequence BC065151, mRNA (cDNA c... 50 0.006
114gb|BC061127.1| Mus musculus cDNA sequence BC061127, mRNA (cDNA c... 50 0.006
115gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome... 50 0.006
116gb|AC122487.3| Mus musculus BAC clone RP24-381E21 from chromosom... 50 0.006
117gb|AC131185.4| Mus musculus BAC clone RP23-402H1 from chromosome... 50 0.006
118gb|AC157928.4| Mus musculus chromosome 5, clone RP24-119I9, comp... 50 0.006
119gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com... 50 0.006
120gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosom... 50 0.006
121gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome ... 50 0.006
122gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome... 50 0.006
123gb|AC007096.3| Homo sapiens BAC clone RP11-306F13 from 7, comple... 50 0.006
124gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, co... 50 0.006
125gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, comp... 50 0.006
126gb|AC131112.3| Mus musculus BAC clone RP24-136L4 from chromosome... 50 0.006
127gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosom... 50 0.006
128ref|XM_856550.1| PREDICTED: Canis familiaris similar to nucleoli... 50 0.006
129ref|XM_856520.1| PREDICTED: Canis familiaris similar to nucleoli... 50 0.006
130ref|XM_856489.1| PREDICTED: Canis familiaris similar to nucleoli... 50 0.006
131ref|XM_856460.1| PREDICTED: Canis familiaris similar to nucleoli... 50 0.006
132ref|XM_845384.1| PREDICTED: Canis familiaris similar to nucleoli... 50 0.006
133gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 50 0.006
134emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chro... 50 0.006
135gb|AC132302.3| Mus musculus BAC clone RP24-279N5 from chromosome... 50 0.006
136gb|AC117239.4| Mus musculus BAC clone RP24-117K6 from chromosome... 50 0.006
137gb|AC130541.4| Mus musculus BAC clone RP24-124P9 from chromosome... 50 0.006
138gb|AC132100.3| Mus musculus BAC clone RP24-294D10 from chromosom... 50 0.006
139gb|AC132268.3| Mus musculus BAC clone RP24-399H6 from chromosome... 50 0.006
140gb|AC130549.4| Mus musculus BAC clone RP24-456I3 from chromosome... 50 0.006
141gb|AC116557.30| Mus musculus strain C57BL/6J clone rp23-239f10 m... 50 0.006
142gb|AC122288.4| Mus musculus BAC clone RP23-254F4 from chromosome... 50 0.006
143gb|AC125381.4| Mus musculus BAC clone RP23-250N10 from chromosom... 50 0.006
144gb|AC125484.4| Mus musculus BAC clone RP23-127L14 from chromosom... 50 0.006
145gb|BC051413.1| Mus musculus calcium channel, voltage-dependent, ... 50 0.006
146gb|BC043482.1| Mus musculus calcium channel, voltage-dependent, ... 50 0.006
147gb|AC125108.3| Mus musculus BAC clone RP24-226A8 from chromosome... 50 0.006
148gb|AC127678.9| Mus musculus BAC clone RP24-233M12 from chromosom... 50 0.006
149gb|AC124382.4| Mus musculus BAC clone RP24-409N22 from chromosom... 50 0.006
150gb|AC126430.3| Mus musculus BAC clone RP24-406F17 from chromosom... 50 0.006
151gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosom... 50 0.006
152gb|AC122456.4| Mus musculus BAC clone RP24-265M23 from chromosom... 50 0.006
153gb|AC121914.3| Mus musculus BAC clone RP24-186A10 from chromosom... 50 0.006
154gb|AC122837.4| Mus musculus BAC clone RP23-189N3 from 16, comple... 50 0.006
155gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, comple... 50 0.006
156gb|AC126273.3| Mus musculus BAC clone RP23-99P15 from 7, complet... 50 0.006
157gb|AC122295.4| Mus musculus BAC clone RP23-263E3 from 13, comple... 50 0.006
158gb|AC125191.4| Mus musculus BAC clone RP23-262C22 from 16, compl... 50 0.006
159gb|AC124545.4| Mus musculus BAC clone RP23-272D9 from 7, complet... 50 0.006
160gb|AC122196.2| Mus musculus BAC clone RP23-50P5 from 5, complete... 50 0.006
161gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, compl... 50 0.006
162gb|AC121886.2| Mus musculus BAC clone RP24-141K3 from 18, comple... 50 0.006
163gb|AC121950.2| Mus musculus BAC clone RP24-216M19 from 6, comple... 50 0.006
164emb|CR730287.2|CNS0GQFO Tetraodon nigroviridis full-length cDNA 50 0.006
165emb|CR725274.2|CNS0GMKG Tetraodon nigroviridis full-length cDNA 50 0.006
166gb|AC110240.8| Mus musculus chromosome 3, clone RP23-113O9, comp... 50 0.006
167gb|AC004745.2| Homo sapiens BAC clone CTA-281B9 from 7, complete... 50 0.006
168gb|AC113292.6| Mus musculus chromosome 15, clone RP23-418M3, com... 50 0.006
169gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, comp... 50 0.006
170ref|XM_661336.1| Cryptosporidium hominis TU502 hypothetical prot... 50 0.006
171gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome... 50 0.006
172gb|AC109240.30| Mus musculus chromosome 1, clone RP23-445I23, co... 50 0.006
173gb|AC116718.21| Mus musculus chromosome 5, clone RP23-203O7, com... 50 0.006
174gb|AC160978.4| Mus musculus BAC clone RP23-426B17 from chromosom... 50 0.006
175gb|AC162689.3| Mus musculus chromosome 5, clone RP23-396K22, com... 50 0.006
176gb|BC089559.1| Mus musculus extracellular matrix protein 2, fema... 50 0.006
177gb|AC144799.3| Mus musculus chromosome 18 clone RP24-299J7, comp... 50 0.006
178gb|AC157809.4| Mus musculus chromosome 1, clone RP24-375B12, com... 50 0.006
179gb|AC161037.3| Mus musculus chromosome 7, clone RP24-255H18, com... 50 0.006
180gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Ho... 50 0.006
181emb|AL671862.6| Human DNA sequence from clone RP11-810H18 on chr... 50 0.006
182gb|BC017800.1| Homo sapiens AT rich interactive domain 4B (RBP1-... 50 0.006
183emb|AL450363.12| Human DNA sequence from clone RP11-469M2 on chr... 50 0.006
184ref|XM_785026.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.006
185emb|AL391417.7| Human DNA sequence from clone RP11-15J23 on chro... 50 0.006
186emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on ch... 50 0.006
187emb|AL356503.18| Human DNA sequence from clone RP13-159A24 on ch... 50 0.006
188emb|AL353093.18| Human DNA sequence from clone RP11-224P11 on ch... 50 0.006
189gb|AC128353.6| Rattus norvegicus 13 BAC CH230-148A5 (Children's ... 50 0.006
190gb|AC095390.9| Rattus norvegicus 12 BAC CH230-7C24 (Children's H... 50 0.006
191emb|AL139009.14| Human DNA sequence from clone RP5-976H8 on chro... 50 0.006
192emb|AL138919.12| Human DNA sequence from clone RP3-492L20 on chr... 50 0.006
193emb|AL133274.8| Human DNA sequence from clone RP13-94P8 on chrom... 50 0.006
194emb|AL133418.4| Human DNA sequence from clone RP5-835G14 on chro... 50 0.006
195gb|AC158565.2| Mus musculus chromosome 15, clone RP24-354O12, co... 50 0.006
196gb|AC159978.4| Mus musculus chromosome 15, clone RP24-173F4, com... 50 0.006
197gb|AC162857.5| Mus musculus chromosome 15, clone RP23-333C11, co... 50 0.006
198gb|AC128768.4| Rattus norvegicus 1 BAC CH230-445L3 (Children's H... 50 0.006
199ref|XM_788157.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 50 0.006
200ref|XM_793630.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.006
201ref|XM_794037.1| PREDICTED: Strongylocentrotus purpuratus simila... 50 0.006
202gb|AC164638.4| Mus musculus BAC clone RP23-198N12 from chromosom... 50 0.006
203gb|AC158238.2| Mus musculus BAC clone RP23-106F10 from chromosom... 50 0.006
204ref|NM_001016610.1| Xenopus tropicalis WD repeat domain 42A (wdr... 50 0.006
205ref|NM_020815.1| Homo sapiens protocadherin 10 (PCDH10), transcr... 50 0.006
206ref|NM_032961.1| Homo sapiens protocadherin 10 (PCDH10), transcr... 50 0.006
207emb|AL645637.18| Mouse DNA sequence from clone RP23-388B5 on chr... 50 0.006
208emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chr... 50 0.006
209emb|AL591065.17| Mouse DNA sequence from clone RP23-199H17 on ch... 50 0.006
210emb|AJ579852.2|MMU579852 Mus musculus mRNA for L-type dihydropyr... 50 0.006
211gb|AC156610.10| Mus musculus chromosome 7, clone RP23-331C4, com... 50 0.006
212emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chr... 50 0.006
213emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on ch... 50 0.006
214gb|AC151908.8| Mus musculus BAC clone RP23-109A22 from chromosom... 50 0.006
215emb|AL646042.14| Mouse DNA sequence from clone RP23-70A15 on chr... 50 0.006
216gb|AC155255.3| Mus musculus BAC clone RP24-143P3 from chromosome... 50 0.006
217gb|AC109488.3| Homo sapiens chromosome 5 clone RP11-57H15, compl... 50 0.006
218gb|AC156615.7| Mus musculus chromosome 3, clone RP23-1B20, compl... 50 0.006
219emb|AL671983.18| Mouse DNA sequence from clone RP23-232B3 on chr... 50 0.006
220gb|AE014181.1| Mus musculus piebald deletion region section 9 of... 50 0.006
221ref|NM_133249.1| Mus musculus peroxisome proliferative activated... 50 0.006
222dbj|AK097262.1| Homo sapiens cDNA FLJ39943 fis, clone SPLEN2023118 50 0.006
223dbj|AK092601.1| Homo sapiens cDNA FLJ35282 fis, clone PROST2007328 50 0.006
224gb|AC034299.8| Homo sapiens chromosome 18, clone RP11-500P9, com... 50 0.006
225gb|AC023789.8| Mus musculus chromosome 4 clone RP23-43A16, compl... 50 0.006
226gb|AC019026.12| Mus musculus chromosome 6 clone RP23-188E5 strai... 50 0.006
227dbj|AB051897.1| Mus musculus Scya6, Scya9, Scya16-ps, Scya5 gene... 50 0.006
228gb|AC164572.4| Mus musculus 6 BAC RP24-89J17 (Roswell Park Cance... 50 0.006
229gb|AC112640.3| Homo sapiens 3 BAC RP11-817M15 (Roswell Park Canc... 50 0.006
230gb|AC091923.3| Homo sapiens chromosome 5 clone RP11-268H4, compl... 50 0.006
231dbj|AK134746.1| Mus musculus adult male medulla oblongata cDNA, ... 50 0.006
232dbj|AK132894.1| Mus musculus adult male testis cDNA, RIKEN full-... 50 0.006
233ref|XM_943852.1| PREDICTED: Homo sapiens similar to mariner tran... 50 0.006
234ref|XM_497010.2| PREDICTED: Homo sapiens similar to mariner tran... 50 0.006
235gb|AC099670.2| Homo sapiens chromosome 1 clone RP11-84O12, compl... 50 0.006
236gb|AF312994.1|AF312994 Mus musculus chromosome 1 clone MML, comp... 50 0.006
237gb|AC016670.7| Homo sapiens BAC clone RP11-11K6 from 2, complete... 50 0.006
238dbj|AK163501.1| Mus musculus adult male corpora quadrigemina cDN... 50 0.006
239gb|AF453324.1|AF453324 Mus musculus PPAR gamma coactivator-1beta... 50 0.006
240gb|AC160655.2| Pan troglodytes BAC clone CH251-26F13 from chromo... 50 0.006
241gb|AC175205.2| Sporobolomyces roseus clone JGIBAIF-5L1, complete... 50 0.006
242gb|AF332093.1|AF332093 White spot syndrome virus, complete genome 50 0.006
243ref|XM_678008.1| PREDICTED: Danio rerio similar to START domain ... 50 0.006
244ref|XM_679095.1| PREDICTED: Danio rerio similar to vacuolar prot... 50 0.006
245gb|AC157791.6| Mus musculus chromosome 3, clone RP24-176D22, com... 50 0.006
246gb|AY220790.1| Homo sapiens SIN3A-associated protein 180 mRNA, c... 50 0.006
247gb|AC133096.3| Mus musculus BAC clone RP23-271C13 from chromosom... 50 0.006
248gb|AC158394.2| Mus musculus BAC clone RP23-406A1 from chromosome... 50 0.006
249gb|AC153132.4| Mus musculus BAC clone RP24-362N19 from chromosom... 50 0.006
250gb|AC154751.2| Mus musculus BAC clone RP24-399L21 from chromosom... 50 0.006
251gb|AC154773.2| Mus musculus BAC clone RP24-448I5 from chromosome... 50 0.006
252gb|AC005327.1|AC005327 Homo sapiens chromosome 19, cosmid F21185... 50 0.006
253dbj|AK028464.1| Mus musculus 0 day neonate skin cDNA, RIKEN full... 50 0.006
254gb|AF162137.2|AF162137 Mus musculus WNT-2 gene, partial cds; put... 50 0.006
255dbj|AK040995.1| Mus musculus adult male aorta and vein cDNA, RIK... 50 0.006
256dbj|AK038812.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 50 0.006
257gb|AC148707.1| Macaca mulatta Major Histocompatibility Complex B... 50 0.006
258gb|AC148679.1| Macaca mulatta Major Histocompatibility Complex B... 50 0.006
259gb|AC148666.1| Macaca mulatta Major Histocompatibility Complex B... 50 0.006
260dbj|AK041537.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 50 0.006
261gb|AC017067.4|AC017067 Homo sapiens BAC clone RP11-370B11 from 9... 50 0.006
262gb|AC158627.6| Mus musculus 10 BAC RP23-451N6 (Roswell Park Canc... 50 0.006
263gb|AC153969.12| Mus musculus 10 BAC RP24-86H7 (Roswell Park Canc... 50 0.006
264gb|AC116732.10| Mus musculus chromosome 3, clone RP23-347F4, com... 50 0.006
265gb|AY013874.1| Homo sapiens protocadherin 10 (PCDH10) mRNA, comp... 50 0.006
266dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
267gb|AC079412.5| Homo sapiens chromosome 16 clone CTD-2302M15, com... 50 0.006
268dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
269gb|AC007374.6|AC007374 Homo sapiens chromosome 14 clone RP11-325... 50 0.006
270gb|AC007491.7| Homo sapiens chromosome 16 clone RP11-182C10, com... 50 0.006
271dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 50 0.006
272dbj|AB210032.1| Homo sapiens mRNA for ARID4B variant protein, pa... 50 0.006
273gb|AC105383.3| Homo sapiens BAC clone RP11-9G1 from 4, complete ... 50 0.006
274dbj|BA000027.2| Oryzias latipes DNA, MHC Class I Region 50 0.006
275gb|AY211296.1| Eleutherodactylus megacephalus FMNH257714 cellula... 50 0.006
276gb|AC164979.2| Mus musculus BAC clone RP23-244J23 from chromosom... 50 0.006
277gb|AC158510.2| Mus musculus BAC clone RP24-236E11 from chromosom... 50 0.006
278gb|AF369029.2| White spot syndrome virus, complete genome 50 0.006
279gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome ... 50 0.006
280gb|AC153661.4| Mus musculus BAC clone RP23-152L5 from chromosome... 50 0.006
281gb|AC102408.10| Mus musculus chromosome 15, clone RP24-351C14, c... 50 0.006
282gb|AC016724.11| Homo sapiens BAC clone RP11-339F22 from 2, compl... 50 0.006
283gb|BC090986.1| Mus musculus protamine 3, mRNA (cDNA clone MGC:10... 50 0.006
284gb|AC090023.20| Homo sapiens 12 BAC RP11-221N13 (Roswell Park Ca... 50 0.006
285gb|AC024704.9| Homo sapiens BAC clone RP11-97J14 from 2, complet... 50 0.006
286gb|AC079248.5| Homo sapiens BAC clone RP11-24J11 from 2, complet... 50 0.006
287gb|AY196903.1| Homo sapiens interleukin 1 receptor antagonist (I... 50 0.006
288gb|AC068947.17| Mus Musculus Strain C57BL6/J Chromosome 3 BAC, R... 50 0.006
289gb|AC117695.15| Mus musculus chromosome 1, clone RP23-450I19, co... 50 0.006
290dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
291emb|BX293562.5| Zebrafish DNA sequence from clone DKEYP-5F12 in ... 50 0.006
292emb|BX005248.13| Zebrafish DNA sequence from clone CH211-155H12 ... 50 0.006
293gb|AC155910.6| Mus musculus 10 BAC RP24-492P8 (Roswell Park Canc... 50 0.006
294gb|AC153944.3| Mus musculus 10 BAC RP24-292A13 (Roswell Park Can... 50 0.006
295dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
296dbj|AP005426.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
297dbj|AP005830.4| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
298emb|AL928568.17| Mouse DNA sequence from clone RP23-396N8 on chr... 50 0.006
299gb|BC049598.1| Mus musculus cDNA sequence BC061127, mRNA (cDNA c... 50 0.006
300emb|BX470181.7| Zebrafish DNA sequence from clone CH211-91P22 in... 50 0.006
301emb|BX647492.1|HSM807638 Homo sapiens mRNA; cDNA DKFZp686I02128 ... 50 0.006
302dbj|AP005544.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.006
303emb|X83976.1|GGAMC1 G.gallus repetitive DNA (ID:Ggamc1) 50 0.006
304gb|AC117735.8| Mus musculus chromosome 5, clone RP24-132L16, com... 50 0.006
305gb|AC157091.6| Mus musculus 6 BAC RP24-359O2 (Roswell Park Cance... 50 0.006
306gb|AF227899.1|AF227899 Homo sapiens breast carcinoma-associated ... 50 0.006
307gb|AF440570.1| Shrimp white spot syndrome virus, complete genome 50 0.006
308dbj|AK065475.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.006
309gb|AC122236.5| Mus musculus BAC clone RP23-141I22 from 8, comple... 50 0.006
310emb|AL929229.6| Zebrafish DNA sequence from clone CH211-1E14 in ... 50 0.006
311emb|CT806423.2| Pan troglodytes chromosome X clone CH251-25B01 m... 50 0.006
312gb|AC110565.7| Mus musculus chromosome 5, clone RP23-297N19, com... 50 0.006
313gb|AC153555.5| Mus musculus 10 BAC RP23-193J20 (Roswell Park Can... 50 0.006
314gb|AF151373.1|AF151373 Rattus norvegicus nucleolin-related prote... 50 0.006
315gb|AY103664.1| Zea mays PCO086923 mRNA sequence 50 0.006
316gb|AC154040.7| Mus musculus 10 BAC RP23-348E15 (Roswell Park Can... 50 0.006
317tpe|BN000002.1|HSA000002 TPA: TPA_exp: Homo sapiens complete int... 50 0.006
318emb|CT025857.10| Mouse DNA sequence from clone RP24-315F22 on ch... 50 0.006
319emb|AL135818.3|CNS01DVH Human chromosome 14 DNA sequence BAC C-2... 50 0.006
320emb|CT027602.9| Mouse DNA sequence from clone RP24-359G24 on chr... 50 0.006
321emb|AL117190.6|CNS01DRF Human chromosome 14 DNA sequence BAC R-1... 50 0.006
322emb|CR760529.1| Xenopus tropicalis finished cDNA, clone TEgg075a15 50 0.006
323emb|AL121784.5|CNS01DSH Human chromosome 14 DNA sequence BAC R-3... 50 0.006
324emb|AL773539.18| Mouse DNA sequence from clone RP23-9F18 on chro... 50 0.006
325gb|AC099713.5| Mus musculus chromosome 15, clone RP23-447B6, com... 50 0.006
326gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, co... 50 0.006
327gb|AC110171.29| Mus musculus chromosome 12, clone RP23-400A5, co... 50 0.006
328dbj|D37888.1|CYIMYC2 Cyprinus carpio gene for c-Myc, complete cds 50 0.006
329emb|AL928621.16| Mouse DNA sequence from clone RP23-401G6 on chr... 50 0.006
330gb|AC174448.2| Mus musculus BAC clone RP23-204P24 from chromosom... 50 0.006
331gb|AC123681.12| Mus musculus chromosome 15, clone RP23-287O20, c... 50 0.006
332gb|AC117775.8| Mus musculus chromosome 16, clone RP24-535F23, co... 50 0.006
333emb|CT033780.10| Mouse DNA sequence from clone RP24-329E14 on ch... 50 0.006
334emb|AL928781.4|CNS08CCB Oryza sativa chromosome 12, . BAC OSJNBa... 50 0.006
335gb|AC003042.1|AC003042 Homo sapiens chromosome 17, clone HCIT75G... 50 0.006
336emb|AL732537.4|CNS08C9C Oryza sativa chromosome 12, . BAC OSJNBa... 50 0.006
337gb|AC139158.3| Mus musculus BAC clone RP24-77I7 from 8, complete... 50 0.006
338emb|AL845489.10| Mouse DNA sequence from clone RP23-300E5 on chr... 50 0.006
339gb|AC154274.1| Mus musculus BAC clone RP24-298J16 from 17, compl... 50 0.006
340gb|AC127255.4| Mus musculus BAC clone RP24-291I7 from 5, complet... 50 0.006
341gb|AC132587.5| Mus musculus BAC clone RP24-372N16 from 12, compl... 50 0.006
342gb|AC134827.4| Mus musculus BAC clone RP24-470E5 from 5, complet... 50 0.006
343gb|AC147989.4| Mus musculus BAC clone RP24-468I14 from 18, compl... 50 0.006
344gb|AC132228.3| Mus musculus BAC clone RP24-480G11 from 6, comple... 50 0.006
345gb|AC004562.1|AC004562 Homo sapiens chromosome 17, clone hRPC.34... 50 0.006
346ref|NM_013638.1| Mus musculus protamine 3 (Prm3), mRNA 50 0.006
347gb|AC131733.3| Mus musculus BAC clone RP23-98C9 from 8, complete... 50 0.006
348gb|AC140213.2| Mus musculus BAC clone RP23-270L5 from 7, complet... 50 0.006
349gb|AC150684.2| Mus musculus BAC clone RP23-268G6 from 7, complet... 50 0.006
350gb|AC129777.4| Mus musculus BAC clone RP23-281H23 from 8, comple... 50 0.006
351gb|AC127693.4| Mus musculus BAC clone RP23-135G19 from 17, compl... 50 0.006
352gb|AC131687.4| Mus musculus BAC clone RP23-379C1 from 14, comple... 50 0.006
353gb|AC125067.4| Mus musculus BAC clone RP23-431C5 from 12, comple... 50 0.006
354gb|AC125532.3| Mus musculus BAC clone RP23-447C2 from 10, comple... 50 0.006
355gb|AC131737.3| Mus musculus BAC clone RP23-106E9 from 7, complet... 50 0.006
356emb|AL928989.9| Mouse DNA sequence from clone RP24-125C11 on chr... 50 0.006
357emb|AL772342.12| Mouse DNA sequence from clone RP23-105D19 on ch... 50 0.006
358emb|AL929466.8| Mouse DNA sequence from clone RP23-431F3 on chro... 50 0.006
359emb|AL805982.10| Mouse DNA sequence from clone RP23-119K17 on ch... 50 0.006
360gb|AC150685.2| Mus musculus BAC clone RP23-239C12 from 19, compl... 50 0.006
361emb|CT010583.8| Mouse DNA sequence from clone RP23-203B24 on chr... 50 0.006
362emb|CT010462.5| Mouse DNA sequence from clone RP23-321N21 on chr... 50 0.006
363gb|AY495827.1| Oryctolagus cuniculus clone 179L1 kappa 1 light c... 50 0.006
364gb|AC154540.2| Mus musculus BAC clone RP23-452G1 from chromosome... 50 0.006
365gb|AC155326.8| Mus musculus 6 BAC RP24-72P18 (Roswell Park Cance... 50 0.006
366gb|AC153540.4| Mus musculus 10 BAC RP23-356N9 (Roswell Park Canc... 50 0.006
367emb|AL805906.7| Mouse DNA sequence from clone RP23-113J20 on chr... 50 0.006
368emb|AL732633.6| Mouse DNA sequence from clone RP23-320E20 on chr... 50 0.006
369emb|AL928698.3| Mouse DNA sequence from clone RP23-183D18 on chr... 50 0.006
370emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chr... 50 0.006
371emb|AL354805.23| Mouse DNA sequence from clone RP21-544J17 on ch... 50 0.006
372emb|AL672267.10| Mouse DNA sequence from clone RP23-377K9 on chr... 50 0.006
373emb|AL672278.12| Mouse DNA sequence from clone RP23-465H23 on ch... 50 0.006
374emb|AL596123.32| Mouse DNA sequence from clone RP23-94N18 on chr... 50 0.006
375emb|AL691505.12| Mouse DNA sequence from clone RP23-82B19 on chr... 50 0.006
376emb|AL663067.14| Mouse DNA sequence from clone RP23-23G3 on chro... 50 0.006
377emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chro... 50 0.006
378emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chr... 50 0.006
379emb|AL928993.7| Mouse DNA sequence from clone RP23-74A1 on chrom... 50 0.006
380emb|AL772185.10| Mouse DNA sequence from clone RP23-103G12 on ch... 50 0.006
381emb|Z47352.1|MMPRMGNS M.musculus PRM1, PRM2, PRM3 and TNP1 genes 50 0.006
382emb|AL928593.4| Mouse DNA sequence from clone RP23-100E9 on chro... 50 0.006
383gb|AC121107.19| Mus musculus chromosome 1, clone RP24-240P15, co... 50 0.006
384emb|AL513351.26| Mouse DNA sequence from clone RP23-122P5 on chr... 50 0.006
385emb|AL513346.17| Mouse DNA sequence from clone RP23-170L10 on ch... 50 0.006
386emb|AL731822.31| Mouse DNA sequence from clone RP23-105H6 on chr... 50 0.006
387emb|AL732526.8| Mouse DNA sequence from clone RP23-338O4 on chro... 50 0.006
388emb|AL732448.6| Mouse DNA sequence from clone RP23-116F12 on chr... 50 0.006
389gb|AC165249.2| Mus musculus BAC clone RP24-157P13 from chromosom... 50 0.006
390dbj|AB037821.1| Homo sapiens mRNA for KIAA1400 protein, partial cds 50 0.006
391dbj|AB030181.1| Homo sapiens mRNA for RBP1-like protein, complet... 50 0.006
392dbj|AB065931.1| Homo sapiens gene for seven transmembrane helix ... 50 0.006
393emb|AL732603.3| Mouse DNA sequence from clone RP23-154H8 on chro... 50 0.006
394emb|AL672231.7| Mouse DNA sequence from clone RP23-54C14 on chro... 50 0.006
395emb|AL732426.6| Mouse DNA sequence from clone RP23-132J17 on chr... 50 0.006
396gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, co... 48 0.025
397gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, com... 48 0.025
398gb|AC114608.5| Mus musculus chromosome 8, clone RP23-418L5, comp... 48 0.025
399gb|AC109251.9| Mus musculus chromosome 1, clone RP23-350B3, comp... 48 0.025
400gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cance... 48 0.025
401gb|AC110510.6| Mus musculus chromosome 1, clone RP24-503F14, com... 48 0.025
402gb|AC116759.13| Mus musculus chromosome 18, clone RP23-383E12, c... 48 0.025
403gb|AC124810.14| Mus musculus chromosome 15, clone RP23-163N4, co... 48 0.025
404gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, com... 48 0.025
405gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, co... 48 0.025
406gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, com... 48 0.025
407gb|AC116696.20| Mus musculus chromosome 3, clone RP24-425N23, co... 48 0.025
408gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, co... 48 0.025
409gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, c... 48 0.025
410gb|AC118200.8| Mus musculus chromosome 5, clone RP23-330E5, comp... 48 0.025
411gb|AC161230.10| Mus musculus chromosome 1, clone RP24-160I3, com... 48 0.025
412ref|NM_120531.2| Arabidopsis thaliana phosphatidate cytidylyltra... 48 0.025
413gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, co... 48 0.025
414gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, com... 48 0.025
415gb|AC152947.1| Mus musculus 10 BAC RP23-12H20 (Roswell Park Canc... 48 0.025
416gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, co... 48 0.025
417gb|AC161271.2| Mus musculus BAC clone RP23-59D8 from chromosome ... 48 0.025
418gb|AC140431.4| Mus musculus BAC clone RP24-172K3 from chromosome... 48 0.025
419gb|AC161810.10| Mus musculus chromosome 3, clone RP24-363L5, com... 48 0.025
420gb|AC146980.9| Mus musculus chromosome 3, clone RP24-97N14, comp... 48 0.025
421gb|AC137127.11| Mus musculus chromosome 9, clone RP24-264F17, co... 48 0.025
422gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, com... 48 0.025
423gb|AC163390.2| Mus musculus chromosome 1, clone RP24-300C19, com... 48 0.025
424gb|AC101706.9| Mus musculus chromosome 15, clone RP23-256L18, co... 48 0.025
425gb|AC138367.14| Mus musculus chromosome 8, clone RP23-296G24, co... 48 0.025
426gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, c... 48 0.025
427gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome ... 48 0.025
428gb|AC161120.5| Mus musculus BAC clone RP23-84A2 from chromosome ... 48 0.025
429gb|AC154375.2| Mus musculus BAC clone RP23-69H21 from chromosome... 48 0.025
430gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, co... 48 0.025
431gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, co... 48 0.025
432gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, co... 48 0.025
433gb|AC111028.10| Mus musculus chromosome 8, clone RP23-221P20, co... 48 0.025
434gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, com... 48 0.025
435gb|AC102219.11| Mus musculus chromosome 15, clone RP24-96K14, co... 48 0.025
436gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, comp... 48 0.025
437ref|XM_640447.1| Dictyostelium discoideum hypothetical protein (... 48 0.025
438gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, co... 48 0.025
439gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, com... 48 0.025
440ref|XM_635604.1| Dictyostelium discoideum hypothetical protein (... 48 0.025
441ref|XM_635272.1| Dictyostelium discoideum hypothetical protein (... 48 0.025
442gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5... 48 0.025
443gb|AC151846.3| Mus musculus BAC clone RP23-13B8 from chromosome ... 48 0.025
444gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosom... 48 0.025
445gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosom... 48 0.025
446gb|AC159318.4| Mus musculus BAC clone RP23-76M13 from chromosome... 48 0.025
447gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome ... 48 0.025
448gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome... 48 0.025
449gb|AC159286.3| Mus musculus BAC clone RP23-314E22 from chromosom... 48 0.025
450gb|AC169984.2| Mus musculus BAC clone RP23-450I9 from chromosome... 48 0.025
451gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosom... 48 0.025
452gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosom... 48 0.025
453gb|AC155304.4| Mus musculus BAC clone RP24-212I6 from chromosome... 48 0.025
454gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome... 48 0.025
455gb|AC163660.4| Mus musculus BAC clone RP23-283J16 from chromosom... 48 0.025
456gb|AC154204.2| Mus musculus BAC clone RP24-393D5 from chromosome... 48 0.025
457gb|AC162799.4| Mus musculus BAC clone RP24-392E13 from chromosom... 48 0.025
458gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosom... 48 0.025
459gb|AC165948.2| Mus musculus BAC clone RP24-430M9 from chromosome... 48 0.025
460gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, co... 48 0.025
461gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, com... 48 0.025
462gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Can... 48 0.025
463gb|AC154039.17| Mus musculus 10 BAC RP23-282M20 (Roswell Park Ca... 48 0.025
464gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, com... 48 0.025
465gb|AC166972.8| Mus musculus chromosome 3, clone RP24-330F18, com... 48 0.025
466ref|XM_483507.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.025
467ref|XM_507598.1| PREDICTED Oryza sativa (japonica cultivar-group... 48 0.025
468ref|XM_507306.1| PREDICTED Oryza sativa (japonica cultivar-group... 48 0.025
469ref|XM_474931.1| Oryza sativa (japonica cultivar-group), predic... 48 0.025
470ref|XM_470590.1| Oryza sativa (japonica cultivar-group), predic... 48 0.025
471ref|XM_465895.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.025
472gb|AC163020.9| Mus musculus chromosome 7, clone RP23-36L11, comp... 48 0.025
473ref|NM_184850.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.025
474ref|NM_197690.1| Oryza sativa (japonica cultivar-group) putative... 48 0.025
475gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosom... 48 0.025
476gb|AC159891.2| Mus musculus BAC clone RP23-394E10 from chromosom... 48 0.025
477gb|AC115898.22| Mus musculus chromosome 7, clone RP24-444C13, co... 48 0.025
478gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome... 48 0.025
479gb|AC167138.6| Mus musculus chromosome 15, clone RP24-358O3, com... 48 0.025
480gb|AC166984.7| Mus musculus chromosome 15, clone RP24-359A11, co... 48 0.025
481gb|AC100043.9| Mus musculus chromosome 3, clone RP23-32D13, comp... 48 0.025
482gb|AC104932.22| Mus musculus chromosome 3, clone RP24-337A16, co... 48 0.025
483gb|AC166332.7| Mus musculus chromosome 1, clone RP24-266F18, com... 48 0.025
484gb|AC131065.16| Mus musculus chromosome 18, clone RP23-21J21, co... 48 0.025
485gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, com... 48 0.025
486gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, comp... 48 0.025
487gb|AC133489.32| Mus musculus strain C57BL/6J clone rp23-74a5, co... 48 0.025
488gb|AC167331.3| Mus musculus chromosome 1, clone RP23-301L19, com... 48 0.025
489gb|AC113325.7| Mus musculus chromosome 1, clone RP23-453H23, com... 48 0.025
490gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosom... 48 0.025
491gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Can... 48 0.025
492gb|AC123882.6| Mus musculus chromosome 1, clone RP23-447L15, com... 48 0.025
493gb|AC102490.7| Mus musculus chromosome 1, clone RP24-512M8, comp... 48 0.025
494gb|AC113444.9| Mus musculus chromosome 15, clone RP23-268C9, com... 48 0.025
495gb|AC123744.8| Mus musculus chromosome 7, clone RP24-120F8, comp... 48 0.025
496gb|AC121116.7| Mus musculus chromosome 8, clone RP23-267D22, com... 48 0.025
497gb|AC166150.2| Mus musculus chromosome 1, clone RP23-321N22, com... 48 0.025
498gb|AC113177.16| Mus musculus chromosome 15, clone RP23-447G7, co... 48 0.025
499gb|AC116895.12| Mus musculus chromosome 8, clone RP24-531C8, com... 48 0.025
500gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, com... 48 0.025

>ref|XM_475118.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 867

 Score =  123 bits (62), Expect = 5e-25
 Identities = 140/166 (84%)
 Strand = Plus / Plus

                                                                       
Query: 281 aagccattcaatttcctccagatcctctgcgagggcgtcatagccggaggcaccgccggg 340
           ||||| ||||| ||||||||||| || || |||||||||||||| || |||||||| || 
Sbjct: 25  aagcccttcaacttcctccagattctgtgtgagggcgtcatagctggtggcaccgcgggt 84

                                                                       
Query: 341 gtcgtggtggagacggcgctctaccccatcgacaccatcaagaccaggcttcaggctgct 400
           || |||||||| || || || ||||| || || || || || ||||||||||||||||||
Sbjct: 85  gtggtggtggaaacagctctgtacccgattgatacgataaaaaccaggcttcaggctgct 144

                                                         
Query: 401 cgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
           || |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 145 cggggaggaagtcaaattcaatggaaaggattgtattctggattag 190



to top

>dbj|AK104747.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-E09, full
           insert sequence
          Length = 1168

 Score =  123 bits (62), Expect = 5e-25
 Identities = 140/166 (84%)
 Strand = Plus / Plus

                                                                       
Query: 281 aagccattcaatttcctccagatcctctgcgagggcgtcatagccggaggcaccgccggg 340
           ||||| ||||| ||||||||||| || || |||||||||||||| || |||||||| || 
Sbjct: 131 aagcccttcaacttcctccagattctgtgtgagggcgtcatagctggtggcaccgcgggt 190

                                                                       
Query: 341 gtcgtggtggagacggcgctctaccccatcgacaccatcaagaccaggcttcaggctgct 400
           || |||||||| || || || ||||| || || || || || ||||||||||||||||||
Sbjct: 191 gtggtggtggaaacagctctgtacccgattgatacgataaaaaccaggcttcaggctgct 250

                                                         
Query: 401 cgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
           || |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 251 cggggaggaagtcaaattcaatggaaaggattgtattctggattag 296



to top

>dbj|AK104602.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-G08, full
           insert sequence
          Length = 1168

 Score =  123 bits (62), Expect = 5e-25
 Identities = 140/166 (84%)
 Strand = Plus / Plus

                                                                       
Query: 281 aagccattcaatttcctccagatcctctgcgagggcgtcatagccggaggcaccgccggg 340
           ||||| ||||| ||||||||||| || || |||||||||||||| || |||||||| || 
Sbjct: 131 aagcccttcaacttcctccagattctgtgtgagggcgtcatagctggtggcaccgcgggt 190

                                                                       
Query: 341 gtcgtggtggagacggcgctctaccccatcgacaccatcaagaccaggcttcaggctgct 400
           || |||||||| || || || ||||| || || || || || ||||||||||||||||||
Sbjct: 191 gtggtggtggaaacagctctgtacccgattgatacgataaaaaccaggcttcaggctgct 250

                                                         
Query: 401 cgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
           || |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 251 cggggaggaagtcaaattcaatggaaaggattgtattctggattag 296



to top

>dbj|AK072091.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116F02, full
           insert sequence
          Length = 2069

 Score =  123 bits (62), Expect = 5e-25
 Identities = 140/166 (84%)
 Strand = Plus / Plus

                                                                       
Query: 281 aagccattcaatttcctccagatcctctgcgagggcgtcatagccggaggcaccgccggg 340
           ||||| ||||| ||||||||||| || || |||||||||||||| || |||||||| || 
Sbjct: 110 aagcccttcaacttcctccagattctgtgtgagggcgtcatagctggtggcaccgcgggt 169

                                                                       
Query: 341 gtcgtggtggagacggcgctctaccccatcgacaccatcaagaccaggcttcaggctgct 400
           || |||||||| || || || ||||| || || || || || ||||||||||||||||||
Sbjct: 170 gtggtggtggaaacagctctgtacccgattgatacgataaaaaccaggcttcaggctgct 229

                                                         
Query: 401 cgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
           || |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 230 cggggaggaagtcaaattcaatggaaaggattgtattctggattag 275



to top

>dbj|AK060107.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C07, full
           insert sequence
          Length = 1283

 Score =  123 bits (62), Expect = 5e-25
 Identities = 140/166 (84%)
 Strand = Plus / Plus

                                                                       
Query: 281 aagccattcaatttcctccagatcctctgcgagggcgtcatagccggaggcaccgccggg 340
           ||||| ||||| ||||||||||| || || |||||||||||||| || |||||||| || 
Sbjct: 134 aagcccttcaacttcctccagattctgtgtgagggcgtcatagctggtggcaccgcgggt 193

                                                                       
Query: 341 gtcgtggtggagacggcgctctaccccatcgacaccatcaagaccaggcttcaggctgct 400
           || |||||||| || || || ||||| || || || || || ||||||||||||||||||
Sbjct: 194 gtggtggtggaaacagctctgtacccgattgatacgataaaaaccaggcttcaggctgct 253

                                                         
Query: 401 cgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
           || |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 254 cggggaggaagtcaaattcaatggaaaggattgtattctggattag 299



to top

>dbj|AK065490.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023H18, full
           insert sequence
          Length = 1527

 Score =  103 bits (52), Expect = 5e-19
 Identities = 115/136 (84%)
 Strand = Plus / Plus

                                                                       
Query: 311 gagggcgtcatagccggaggcaccgccggggtcgtggtggagacggcgctctaccccatc 370
           |||||||||||||| || |||||||| || || |||||||| || || || ||||| || 
Sbjct: 219 gagggcgtcatagctggtggcaccgcgggtgtggtggtggaaacagctctgtacccgatt 278

                                                                       
Query: 371 gacaccatcaagaccaggcttcaggctgctcgagctggaagtcaaattcaatggaaaggc 430
           || || || || |||||||||||||||||||| |  ||||||||||||||||||||||| 
Sbjct: 279 gatacgataaaaaccaggcttcaggctgctcggggaggaagtcaaattcaatggaaagga 338

                           
Query: 431 ctgtattccggattag 446
            ||||||| |||||||
Sbjct: 339 ttgtattctggattag 354



to top

>ref|XM_477564.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1226

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 383 accaggcttcaggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccgga 442
           |||||||||||||||||   || ||||||| ||||||||||||||||| ||||| | || 
Sbjct: 256 accaggcttcaggctgcgaaaggtggaagtaaaattcaatggaaaggcttgtatgctggg 315

                   
Query: 443 ttaggtgg 450
           ||||||||
Sbjct: 316 ttaggtgg 323



to top

>ref|XM_506268.1| PREDICTED Oryza sativa (japonica cultivar-group), B1120F06.101 mRNA
          Length = 1291

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 383 accaggcttcaggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccgga 442
           |||||||||||||||||   || ||||||| ||||||||||||||||| ||||| | || 
Sbjct: 264 accaggcttcaggctgcgaaaggtggaagtaaaattcaatggaaaggcttgtatgctggg 323

                   
Query: 443 ttaggtgg 450
           ||||||||
Sbjct: 324 ttaggtgg 331



to top

>dbj|AK099295.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023137D03, full
           insert sequence
          Length = 1226

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 383 accaggcttcaggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccgga 442
           |||||||||||||||||   || ||||||| ||||||||||||||||| ||||| | || 
Sbjct: 256 accaggcttcaggctgcgaaaggtggaagtaaaattcaatggaaaggcttgtatgctggg 315

                   
Query: 443 ttaggtgg 450
           ||||||||
Sbjct: 316 ttaggtgg 323



to top

>dbj|AK071844.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023115D04, full
           insert sequence
          Length = 1292

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Plus

                                                                       
Query: 383 accaggcttcaggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccgga 442
           |||||||||||||||||   || ||||||| ||||||||||||||||| ||||| | || 
Sbjct: 264 accaggcttcaggctgcgaaaggtggaagtaaaattcaatggaaaggcttgtatgctggg 323

                   
Query: 443 ttaggtgg 450
           ||||||||
Sbjct: 324 ttaggtgg 331



to top

>gb|AC135929.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0692D12,
             complete sequence
          Length = 164064

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                   
Query: 393   aggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
             |||||||||| |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 79209 aggctgctcggggaggaagtcaaattcaatggaaaggattgtattctggattag 79156



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                         
Query: 311   gagggcgtcatagccggaggcaccgccggggtcgtggtggagacggcgctctaccccatc 370
             |||||||||||||| || |||||||| || || |||||||| || || || ||||| || 
Sbjct: 79988 gagggcgtcatagctggtggcaccgcgggtgtggtggtggaaacagctctgtacccgatt 79929

                                      
Query: 371   gacaccatcaagaccaggcttcagg 395
             || || || || |||||||||||||
Sbjct: 79928 gatacgataaaaaccaggcttcagg 79904



to top

>gb|AC134348.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0530H10,
              complete sequence
          Length = 148373

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                    
Query: 393    aggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
              |||||||||| |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 128441 aggctgctcggggaggaagtcaaattcaatggaaaggattgtattctggattag 128388



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                          
Query: 311    gagggcgtcatagccggaggcaccgccggggtcgtggtggagacggcgctctaccccatc 370
              |||||||||||||| || |||||||| || || |||||||| || || || ||||| || 
Sbjct: 129220 gagggcgtcatagctggtggcaccgcgggtgtggtggtggaaacagctctgtacccgatt 129161

                                       
Query: 371    gacaccatcaagaccaggcttcagg 395
              || || || || |||||||||||||
Sbjct: 129160 gatacgataaaaaccaggcttcagg 129136



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                      
Query: 393      aggctgctcgagctggaagtcaaattcaatggaaaggcctgtattccggattag 446
                |||||||||| |  |||||||||||||||||||||||  ||||||| |||||||
Sbjct: 17135074 aggctgctcggggaggaagtcaaattcaatggaaaggattgtattctggattag 17135021



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 70/85 (82%)
 Strand = Plus / Minus

                                                                            
Query: 311      gagggcgtcatagccggaggcaccgccggggtcgtggtggagacggcgctctaccccatc 370
                |||||||||||||| || |||||||| || || |||||||| || || || ||||| || 
Sbjct: 17135853 gagggcgtcatagctggtggcaccgcgggtgtggtggtggaaacagctctgtacccgatt 17135794

                                         
Query: 371      gacaccatcaagaccaggcttcagg 395
                || || || || |||||||||||||
Sbjct: 17135793 gatacgataaaaaccaggcttcagg 17135769



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||||
Sbjct: 14034379 tcttcttcttcttcctcctcctcc 14034356



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 41       ttctcttcttcttcttcctcctcctcc 67
                ||||||||||||||||| |||||||||
Sbjct: 21309361 ttctcttcttcttcttcgtcctcctcc 21309335



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 45      cttcttcttcttcctcctcctcc 67
               |||||||||||||||||||||||
Sbjct: 4973538 cttcttcttcttcctcctcctcc 4973516



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 45      cttcttcttcttcctcctcctcc 67
               |||||||||||||||||||||||
Sbjct: 2326695 cttcttcttcttcctcctcctcc 2326673



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 45     cttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||
Sbjct: 858509 cttcttcttcttcctcctcctcc 858531



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 44     tcttcttcttcttcctcctcctc 66
              |||||||||||||||||||||||
Sbjct: 770933 tcttcttcttcttcctcctcctc 770955



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 47      tcttcttcttcctcctcctccc 68
               ||||||||||||||||||||||
Sbjct: 4290602 tcttcttcttcctcctcctccc 4290623



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 46      ttcttcttcttcctcctcctcc 67
               ||||||||||||||||||||||
Sbjct: 2975898 ttcttcttcttcctcctcctcc 2975877



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 42     tctcttcttcttcttcctcctc 63
              ||||||||||||||||||||||
Sbjct: 769913 tctcttcttcttcttcctcctc 769934



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 47       tcttcttcttcctcctcctcc 67
                |||||||||||||||||||||
Sbjct: 24557771 tcttcttcttcctcctcctcc 24557751



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                |||||||||||||| |||||||||
Sbjct: 14034382 tcttcttcttcttcttcctcctcc 14034359



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 44      tcttcttcttcttcctcctc 63
               ||||||||||||||||||||
Sbjct: 6739661 tcttcttcttcttcctcctc 6739680



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 44      tcttcttcttcttcctcctcctcc 67
               ||||||||||| ||||||||||||
Sbjct: 4973536 tcttcttcttcctcctcctcctcc 4973513



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 48      cttcttcttcctcctcctcc 67
               ||||||||||||||||||||
Sbjct: 4240579 cttcttcttcctcctcctcc 4240598



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      tcttcttcttcctcctcctc 66
               ||||||||||||||||||||
Sbjct: 1812942 tcttcttcttcctcctcctc 1812923



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      tcttcttcttcctcctcctc 66
               ||||||||||||||||||||
Sbjct: 1429615 tcttcttcttcctcctcctc 1429596



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 858511 tcttcttcttcctcctcctcctcc 858534



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 770930 tcttcttcttcttcttcctcctcc 770953



to top

>gb|AC115928.10| Mus musculus chromosome 18, clone RP24-530D22, complete sequence
          Length = 182777

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 38    cccttctcttcttcttcttcctcctcctc 66
             |||||||||||||||||||||||||||||
Sbjct: 88475 cccttctcttcttcttcttcctcctcctc 88447



to top

>gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosome 10, complete
             sequence
          Length = 179668

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||||||
Sbjct: 12398 ccttctcttcttcttcttcctcctcctcc 12370



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 12390 tcttcttcttcctcctcctcctcc 12367



to top

>gb|AC153499.7| Mus musculus 10 BAC RP23-478J15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207222

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||||||
Sbjct: 169269 ccttctcttcttcttcttcctcctcctcc 169241



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 169261 tcttcttcttcctcctcctcctcc 169238



to top

>gb|AC010344.6| Homo sapiens chromosome 5 clone CTD-2017I7, complete sequence
          Length = 64467

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 40    cttctcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||||||
Sbjct: 33074 cttctcttcttcttcttcctcctcctccc 33046



to top

>gb|AC154669.2| Mus musculus BAC clone RP24-289P23 from 14, complete sequence
          Length = 149684

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||||||
Sbjct: 42375 ccttctcttcttcttcttcctcctcctcc 42347



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 42367 tcttcttcttcctcctcctcctcc 42344



to top

>gb|AC116137.19| Mus musculus chromosome 19, clone RP23-122L1, complete sequence
          Length = 170307

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||||||
Sbjct: 76309 ccttctcttcttcttcttcctcctcctcc 76281



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 76301 tcttcttcttcctcctcctcctcc 76278



to top

>gb|AC154690.3| Mus musculus BAC clone RP24-331B7 from chromosome 14, complete
            sequence
          Length = 181879

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                         
Query: 39   ccttctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||||||
Sbjct: 2856 ccttctcttcttcttcttcctcctcctcc 2884



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2864 tcttcttcttcctcctcctcctcc 2887



to top

>gb|AC113302.13| Mus musculus chromosome 5, clone RP23-431M7, complete sequence
          Length = 201427

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 39     ccttctcttcttcttcttcctcctcctc 66
              ||||||||||||||||||||||||||||
Sbjct: 171310 ccttctcttcttcttcttcctcctcctc 171283



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||| |||||||||||||||
Sbjct: 54850 tcttcttcctcttcctcctcctcc 54873



to top

>gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, complete sequence
          Length = 208483

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 39    ccttctcttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||||||||
Sbjct: 92848 ccttctcttcttcttcttcctcctcctc 92821



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 59795 tcttcttcttcttcctcctcctcc 59772



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 40    cttctcttcttcttcttcctcctcctc 66
             |||||||||||| ||||||||||||||
Sbjct: 92757 cttctcttcttcctcttcctcctcctc 92731



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             ||||||||||| |||||||||||||
Sbjct: 59792 tcttcttcttcctcctcctcctccc 59768



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 59798 tcttcttcttcttcttcctcctcc 59775



to top

>gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 194127

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 39    ccttctcttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||||||||
Sbjct: 52805 ccttctcttcttcttcttcctcctcctc 52778



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             |||||||||||| |||||||||||||
Sbjct: 52709 ctcttcttcttcctcctcctcctccc 52684



to top

>gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 map 3, complete sequence
          Length = 191014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 38     cccttctcttcttcttcttcctcctcct 65
              ||||||||||||||||||||||||||||
Sbjct: 123601 cccttctcttcttcttcttcctcctcct 123574



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 38     cccttctcttcttcttcttcct 59
              ||||||||||||||||||||||
Sbjct: 123650 cccttctcttcttcttcttcct 123629



to top

>gb|AC024028.10| Homo sapiens BAC clone RP11-151M24 from 7, complete sequence
          Length = 176278

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||||||
Sbjct: 80705 cttctcttcttcttcttcctcctcctcc 80732



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||| ||||||
Sbjct: 80764 ctcttcttcttcttcctcttcctcc 80788



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    cccttctcttcttcttcttc 57
             ||||||||||||||||||||
Sbjct: 96820 cccttctcttcttcttcttc 96801



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||| |||||||||||||||
Sbjct: 80771 tcttcttcctcttcctcctcctcc 80794



to top

>gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosome 3, complete sequence
          Length = 210014

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                          
Query: 38     cccttctcttcttcttcttcctcctcct 65
              ||||||||||||||||||||||||||||
Sbjct: 151968 cccttctcttcttcttcttcctcctcct 151941



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 38     cccttctcttcttcttcttcct 59
              ||||||||||||||||||||||
Sbjct: 152017 cccttctcttcttcttcttcct 151996



to top

>gb|AC112258.4| Mus musculus BAC clone RP23-169M10 from 8, complete sequence
          Length = 203519

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                          
Query: 40     cttctcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||||||
Sbjct: 189569 cttctcttcttcttcttcctcctcctcc 189596



to top

>gb|AC163902.2| Mus musculus BAC clone RP23-479B18 from chromosome 17, complete
             sequence
          Length = 190411

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             ||||||||||||||||||||||||||||
Sbjct: 38251 cccttctcttcttcttcttcctcctcct 38278



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             ||||||||||||||||||||||||||||
Sbjct: 38188 cccttctcttcttcttcttcctcctcct 38215



to top

>gb|AC079441.37| Mus musculus strain C57BL/6J clone rp23-349b16 map 17, complete
             sequence
          Length = 223005

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             ||||||||||||||||||||||||||||
Sbjct: 44919 cccttctcttcttcttcttcctcctcct 44892



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             ||||||||||||||||||||||||||||
Sbjct: 44856 cccttctcttcttcttcttcctcctcct 44829



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 43     ctcttcttcttcttcctcctc 63
              |||||||||||||||||||||
Sbjct: 194839 ctcttcttcttcttcctcctc 194819



to top

>ref|XM_625679.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd4_770),
            partial mRNA
          Length = 4320

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                        
Query: 44   tcttcttcttcttcctcctcctcccaaa 71
            ||||||||||||||||||||||||||||
Sbjct: 1142 tcttcttcttcttcctcctcctcccaaa 1115



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            ||||||||||||||| |||||||||
Sbjct: 1146 ctcttcttcttcttcttcctcctcc 1122



to top

>gb|AC116104.7| Mus musculus chromosome 5, clone RP23-18K20, complete sequence
          Length = 210459

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 39    ccttctcttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||||||||
Sbjct: 14604 ccttctcttcttcttcttcctcctcctc 14577



to top

>emb|CT025871.10| Mouse DNA sequence from clone RP24-324L15 on chromosome 17, complete
             sequence
          Length = 154761

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             ||||||||||||||||||||||||||||
Sbjct: 77047 cccttctcttcttcttcttcctcctcct 77074



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             ||||||||||||||||||||||||||||
Sbjct: 76984 cccttctcttcttcttcttcctcctcct 77011



to top

>gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, complete sequence
          Length = 233117

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||||||
Sbjct: 17739 cttctcttcttcttcttcctcctcctcc 17766



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||| || ||||||||||||||||||
Sbjct: 31977 ccttctcctcatcttcttcctcctcctcc 31949



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 39    ccttctcttcttcttcttcctcctcctc 66
             ||||||| |||||||| |||||||||||
Sbjct: 32007 ccttctcctcttcttcctcctcctcctc 31980



to top

>emb|AL929132.9| Mouse DNA sequence from clone RP23-346G8 on chromosome 2, complete
             sequence
          Length = 129438

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 28/28 (100%)
 Strand = Plus / Minus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||||||
Sbjct: 30318 cttctcttcttcttcttcctcctcctcc 30291



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 30288 ctcttcttcttcttcctcctcctcc 30264



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||| ||||||
Sbjct: 30198 cttctcttcttcttcttcctcttcctcc 30171



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 40    cttctcttcttcttcttcctcctcctc 66
             ||||| |||||||||||||||||||||
Sbjct: 30400 cttcttttcttcttcttcctcctcctc 30374



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             |||||||||||||||  |||||||||||
Sbjct: 30356 cttctcttcttcttccccctcctcctcc 30329



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 30311 tcttcttcttcctcctcctcctcc 30288



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 30284 tcttcttcttcctcctcctcctcc 30261



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||| |||||||||||||||||||
Sbjct: 30237 tctttttcttcttcctcctcctcc 30214



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||| |||||||||||||||
Sbjct: 30188 tcttcttcctcttcctcctcctcc 30165



to top

>gb|AC120390.12| Mus musculus chromosome 9, clone RP24-308L17, complete sequence
          Length = 138507

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 39    ccttctcttcttcttcttcctcctcct 65
             |||||||||||||||||||||||||||
Sbjct: 47938 ccttctcttcttcttcttcctcctcct 47964



to top

>gb|AC068408.9| Homo sapiens chromosome 18, clone RP11-612A1, complete sequence
          Length = 183583

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 41     ttctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||||
Sbjct: 135755 ttctcttcttcttcttcctcctcctcc 135729



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 135749 tcttcttcttcctcctcctcctcc 135726



to top

>gb|AC021382.6|AC021382 Homo sapiens, clone RP11-26N15, complete sequence
          Length = 189806

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                         
Query: 41     ttctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||||
Sbjct: 146854 ttctcttcttcttcttcctcctcctcc 146880



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 146860 tcttcttcttcctcctcctcctcc 146883



to top

>gb|AC101764.11| Mus musculus chromosome 3, clone RP24-471B15, complete sequence
          Length = 151388

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 42    tctcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||||
Sbjct: 35758 tctcttcttcttcttcctcctcctccc 35732



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 41     ttctcttcttcttcttcctcctcctcc 67
              ||||||||||| |||||||||||||||
Sbjct: 150879 ttctcttcttcctcttcctcctcctcc 150853



to top

>emb|AL683880.7| Mouse DNA sequence from clone RP23-124M9 on chromosome 4, complete
            sequence
          Length = 210306

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 43   ctcttcttcttcttcctcctcctccca 69
            |||||||||||||||||||||||||||
Sbjct: 7265 ctcttcttcttcttcctcctcctccca 7291



to top

>gb|AC098597.2| Homo sapiens BAC clone RP11-521C6 from 4, complete sequence
          Length = 177846

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                             
Query: 38     cccttctcttcttcttcttcctcctcctccc 68
              ||||| |||||||||||||||||||||||||
Sbjct: 130886 cccttttcttcttcttcttcctcctcctccc 130916



to top

>gb|AC115834.8| Mus musculus chromosome 3, clone RP24-159L1, complete sequence
          Length = 175998

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             ||||||||||||||||||||||||||
Sbjct: 63172 ctcttcttcttcttcctcctcctccc 63147



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 40     cttctcttcttcttcttcctcctcctcc 67
              |||||| ||||| |||||||||||||||
Sbjct: 103458 cttctcctcttcctcttcctcctcctcc 103485



to top

>ref|XM_482878.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1399

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 43  ctcttcttcttcttcctcctcctccc 68
           ||||||||||||||||||||||||||
Sbjct: 161 ctcttcttcttcttcctcctcctccc 186



to top

>ref|XM_480435.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3294

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 44 tcttcttcttcttcctcctcctccca 69
          ||||||||||||||||||||||||||
Sbjct: 68 tcttcttcttcttcctcctcctccca 93



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 44 tcttcttcttcttcctcctcctcc 67
          |||||||||||||| |||||||||
Sbjct: 65 tcttcttcttcttcttcctcctcc 88



to top

>gb|AC126125.6| Rattus norvegicus 14 BAC CH230-25F8 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 223844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 39     ccttctcttcttcttcttcctcctcctccc 68
              ||||||||||||| ||||||||||||||||
Sbjct: 175414 ccttctcttcttcctcttcctcctcctccc 175385



to top

>gb|AC115290.5| Mus musculus BAC clone RP23-65M10 from chromosome 10, complete sequence
          Length = 245623

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 43     ctcttcttcttcttcctcctcctcccaaat 72
              ||||||||| ||||||||||||||||||||
Sbjct: 233689 ctcttcttcctcttcctcctcctcccaaat 233718



to top

>gb|AC132395.3| Mus musculus BAC clone RP23-391F17 from chromosome 18, complete
             sequence
          Length = 212786

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 42    tctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||||
Sbjct: 21341 tctcttcttcttcttcctcctcctcc 21366



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             ||||||||||| |||||||||||||
Sbjct: 21346 tcttcttcttcctcctcctcctccc 21370



to top

>gb|AC122925.3| Mus musculus BAC clone RP23-9O19 from 1, complete sequence
          Length = 256751

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 38     cccttctcttcttcttcttcctcctcctcc 67
              |||| |||||||||||||||||||||||||
Sbjct: 185543 ccctcctcttcttcttcttcctcctcctcc 185572



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 185664 tcttcttcttcttcctcctcctcc 185687



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||||||||| |||||||||
Sbjct: 185660 ctcttcttcttcttcttcctcctcc 185684



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 185637 tcttcttcttcctcctcctcc 185657



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||| ||||||||||||
Sbjct: 185636 ctcttcttcttcctcctcctcctcc 185660



to top

>emb|AL669846.11| Mouse DNA sequence from clone RP23-298L23 on chromosome 11 Contains the
              Srfcp-pending gene for SRF co-factor protein, a novel gene
              (A730013G04) and a CpG island, complete sequence
          Length = 128747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 43     ctcttcttcttcttcctcctcctccc 68
              ||||||||||||||||||||||||||
Sbjct: 109585 ctcttcttcttcttcctcctcctccc 109610



to top

>gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome 17, complete sequence
          Length = 223528

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             ||||||||||||||||||||||||||
Sbjct: 25829 ctcttcttcttcttcctcctcctccc 25854



to top

>gb|AC153650.4| Mus musculus BAC clone RP24-93I18 from chromosome 1, complete sequence
          Length = 199753

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 38    cccttctcttcttcttcttcctcctcctcc 67
             |||| |||||||||||||||||||||||||
Sbjct: 87114 ccctcctcttcttcttcttcctcctcctcc 87143



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 87235 tcttcttcttcttcctcctcctcc 87258



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 41     ttctcttcttcttcttcctcctcctc 66
              |||||||||||||| |||||||||||
Sbjct: 165955 ttctcttcttcttcctcctcctcctc 165980



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 165958 tcttcttcttcctcctcctcc 165978



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||||||||| |||||||||
Sbjct: 87231 ctcttcttcttcttcttcctcctcc 87255



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 87208 tcttcttcttcctcctcctcc 87228



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||| ||||||||||||
Sbjct: 87207 ctcttcttcttcctcctcctcctcc 87231



to top

>dbj|AK042647.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730013G04
           product:unclassifiable, full insert sequence
          Length = 3190

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 43  ctcttcttcttcttcctcctcctccc 68
           ||||||||||||||||||||||||||
Sbjct: 990 ctcttcttcttcttcctcctcctccc 965



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                         
Query: 42      tctcttcttcttcttcctcctcctcc 67
               ||||||||||||||||||||||||||
Sbjct: 3185876 tctcttcttcttcttcctcctcctcc 3185851



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 43       ctcttcttcttcttcctcctcctcc 67
                |||||||||||||||||||||||||
Sbjct: 25556081 ctcttcttcttcttcctcctcctcc 25556057



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||||
Sbjct: 18995916 tcttcttcttcttcctcctcctcc 18995939



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||||
Sbjct: 18627193 tcttcttcttcttcctcctcctcc 18627216



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 47       tcttcttcttcctcctcctccc 68
                ||||||||||||||||||||||
Sbjct: 10006675 tcttcttcttcctcctcctccc 10006696



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 44       tcttcttcttcttcctcctcctccc 68
                ||||||||||| |||||||||||||
Sbjct: 25556077 tcttcttcttcctcctcctcctccc 25556053



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 47       tcttcttcttcctcctcctcc 67
                |||||||||||||||||||||
Sbjct: 23865868 tcttcttcttcctcctcctcc 23865848



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 45       cttcttcttcttcctcctcc 64
                ||||||||||||||||||||
Sbjct: 23082547 cttcttcttcttcctcctcc 23082528



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||| ||||||||||||
Sbjct: 18627196 tcttcttcttcctcctcctcctcc 18627219



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                |||||||||||||| |||||||||
Sbjct: 18627190 tcttcttcttcttcttcctcctcc 18627213



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 44      tcttcttcttcttcctcctc 63
               ||||||||||||||||||||
Sbjct: 3200718 tcttcttcttcttcctcctc 3200699



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 42      tctcttcttcttcttcctcc 61
               ||||||||||||||||||||
Sbjct: 2468729 tctcttcttcttcttcctcc 2468710



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                          
Query: 43       ctcttcttcttcttcctcctcctccc 68
                ||||||||||||||||||||||||||
Sbjct: 23078439 ctcttcttcttcttcctcctcctccc 23078464



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                         
Query: 44      tcttcttcttcttcctcctcctccca 69
               ||||||||||||||||||||||||||
Sbjct: 5102991 tcttcttcttcttcctcctcctccca 5103016



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                         
Query: 43       ctcttcttcttcttcctcctcctcc 67
                |||||||||||||||||||||||||
Sbjct: 28062309 ctcttcttcttcttcctcctcctcc 28062333



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||||
Sbjct: 28052684 tcttcttcttcttcctcctcctcc 28052707



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 38       cccttctcttcttcttcttcctcctcct 65
                |||| |||||||||||||||||||||||
Sbjct: 26594127 ccctcctcttcttcttcttcctcctcct 26594154



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 44      tcttcttcttcttcctcctcctc 66
               |||||||||||||||||||||||
Sbjct: 4288143 tcttcttcttcttcctcctcctc 4288165



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 43       ctcttcttcttcttcctcctcc 64
                ||||||||||||||||||||||
Sbjct: 23457049 ctcttcttcttcttcctcctcc 23457070



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 46       ttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||
Sbjct: 23347084 ttcttcttcttcctcctcctcc 23347063



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 47       tcttcttcttcctcctcctcc 67
                |||||||||||||||||||||
Sbjct: 27326316 tcttcttcttcctcctcctcc 27326296



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 44       tcttcttcttcttcctcctcc 64
                |||||||||||||||||||||
Sbjct: 19420269 tcttcttcttcttcctcctcc 19420289



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 44       tcttcttcttcttcctcctcc 64
                |||||||||||||||||||||
Sbjct: 10517820 tcttcttcttcttcctcctcc 10517800



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 46      ttcttcttcttcctcctcctc 66
               |||||||||||||||||||||
Sbjct: 2962102 ttcttcttcttcctcctcctc 2962122



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 44     tcttcttcttcttcctcctcc 64
              |||||||||||||||||||||
Sbjct: 312673 tcttcttcttcttcctcctcc 312693



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 44     tcttcttcttcttcctcctcc 64
              |||||||||||||||||||||
Sbjct: 244991 tcttcttcttcttcctcctcc 245011



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 6        caatccaatctaatccaatccgcc 29
                |||||||||| |||||||||||||
Sbjct: 27964499 caatccaatccaatccaatccgcc 27964522



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 47       tcttcttcttcctcctcctc 66
                ||||||||||||||||||||
Sbjct: 21699854 tcttcttcttcctcctcctc 21699835



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 44       tcttcttcttcttcctcctc 63
                ||||||||||||||||||||
Sbjct: 21113497 tcttcttcttcttcctcctc 21113478



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 95       ttccctcctctcctctcagc 114
                ||||||||||||||||||||
Sbjct: 11535318 ttccctcctctcctctcagc 11535337



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                |||||||||||||| |||||||||
Sbjct: 10517823 tcttcttcttcttcttcctcctcc 10517800



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 44      tcttcttcttcttcctcctcctcc 67
               |||||||||||||| |||||||||
Sbjct: 9764934 tcttcttcttcttcgtcctcctcc 9764911



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 44      tcttcttcttcttcctcctcctcc 67
               ||||||||||| ||||||||||||
Sbjct: 9764931 tcttcttcttcgtcctcctcctcc 9764908



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 90      cccccttccctcctctcctc 109
               ||||||||||||||||||||
Sbjct: 5581438 cccccttccctcctctcctc 5581419



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 44      tcttcttcttcttcctcctcctcc 67
               |||||||||||||| |||||||||
Sbjct: 5102988 tcttcttcttcttcttcctcctcc 5103011



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 244988 tcttcttcttcttcttcctcctcc 245011



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     cttcttcttcctcctcctcc 67
              ||||||||||||||||||||
Sbjct: 178689 cttcttcttcctcctcctcc 178670



to top

>gb|AC154626.2| Mus musculus BAC clone RP23-311B8 from chromosome 14, complete sequence
          Length = 194638

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 38    cccttctcttcttcttcttcctcctcctcc 67
             |||| |||||||||||||||||||||||||
Sbjct: 27498 ccctcctcttcttcttcttcctcctcctcc 27527



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    tcttcttcttcctcctcctc 66
             ||||||||||||||||||||
Sbjct: 27724 tcttcttcttcctcctcctc 27743



to top

>gb|AC154681.2| Mus musculus BAC clone RP24-314G22 from chromosome 14, complete
             sequence
          Length = 193716

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                           
Query: 38    cccttctcttcttcttcttcctcctcctcc 67
             |||| |||||||||||||||||||||||||
Sbjct: 16940 ccctcctcttcttcttcttcctcctcctcc 16911



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    tcttcttcttcctcctcctc 66
             ||||||||||||||||||||
Sbjct: 16714 tcttcttcttcctcctcctc 16695



to top

>dbj|AP004693.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0461F06
          Length = 147891

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                      
Query: 43   ctcttcttcttcttcctcctcctccc 68
            ||||||||||||||||||||||||||
Sbjct: 1538 ctcttcttcttcttcctcctcctccc 1563



to top

>dbj|AP004568.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0547A06
          Length = 150922

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 44     tcttcttcttcttcctcctcctccca 69
              ||||||||||||||||||||||||||
Sbjct: 140548 tcttcttcttcttcctcctcctccca 140573



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 140545 tcttcttcttcttcttcctcctcc 140568



to top

>dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0470B03
          Length = 163371

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 43     ctcttcttcttcttcctcctcctccc 68
              ||||||||||||||||||||||||||
Sbjct: 138167 ctcttcttcttcttcctcctcctccc 138192



to top

>dbj|AP004656.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0020B10
          Length = 136175

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 44    tcttcttcttcttcctcctcctccca 69
             ||||||||||||||||||||||||||
Sbjct: 52755 tcttcttcttcttcctcctcctccca 52780



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 52752 tcttcttcttcttcttcctcctcc 52775



to top

>dbj|AK120496.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013120I03,
          full insert sequence
          Length = 3280

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                    
Query: 44 tcttcttcttcttcctcctcctccca 69
          ||||||||||||||||||||||||||
Sbjct: 68 tcttcttcttcttcctcctcctccca 93



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 44 tcttcttcttcttcctcctcctcc 67
          |||||||||||||| |||||||||
Sbjct: 65 tcttcttcttcttcttcctcctcc 88



to top

>dbj|AK105577.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-128-D12, full
           insert sequence
          Length = 1396

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 43  ctcttcttcttcttcctcctcctccc 68
           ||||||||||||||||||||||||||
Sbjct: 161 ctcttcttcttcttcctcctcctccc 186



to top

>gb|AC154266.2| Mus musculus BAC clone RP24-321J24 from 13, complete sequence
          Length = 183555

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             ||||||||||||||||||||||||||
Sbjct: 75798 ctcttcttcttcttcctcctcctccc 75773



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                         
Query: 42      tctcttcttcttcttcctcctcctcc 67
               ||||||||||||||||||||||||||
Sbjct: 3185821 tctcttcttcttcttcctcctcctcc 3185796



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                         
Query: 43       ctcttcttcttcttcctcctcctcc 67
                |||||||||||||||||||||||||
Sbjct: 25484257 ctcttcttcttcttcctcctcctcc 25484233



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||||
Sbjct: 18922143 tcttcttcttcttcctcctcctcc 18922166



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||||||||||||||||
Sbjct: 18553419 tcttcttcttcttcctcctcctcc 18553442



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 47       tcttcttcttcctcctcctccc 68
                ||||||||||||||||||||||
Sbjct: 10006560 tcttcttcttcctcctcctccc 10006581



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 44       tcttcttcttcttcctcctcctccc 68
                ||||||||||| |||||||||||||
Sbjct: 25484253 tcttcttcttcctcctcctcctccc 25484229



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 47       tcttcttcttcctcctcctcc 67
                |||||||||||||||||||||
Sbjct: 23794073 tcttcttcttcctcctcctcc 23794053



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 45       cttcttcttcttcctcctcc 64
                ||||||||||||||||||||
Sbjct: 23010738 cttcttcttcttcctcctcc 23010719



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                ||||||||||| ||||||||||||
Sbjct: 18553422 tcttcttcttcctcctcctcctcc 18553445



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 44       tcttcttcttcttcctcctcctcc 67
                |||||||||||||| |||||||||
Sbjct: 18553416 tcttcttcttcttcttcctcctcc 18553439



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 44      tcttcttcttcttcctcctc 63
               ||||||||||||||||||||
Sbjct: 3200663 tcttcttcttcttcctcctc 3200644



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 42      tctcttcttcttcttcctcc 61
               ||||||||||||||||||||
Sbjct: 2468673 tctcttcttcttcttcctcc 2468654



to top

>emb|AL935317.10| Zebrafish DNA sequence from clone CH211-199I10, complete sequence
          Length = 200098

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 38    cccttctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||| ||||||||||
Sbjct: 55776 cccttctcttcttcttctttctcctcctcc 55805



to top

>gb|AC173482.1| Mus musculus BAC clone RP23-383F20 from chromosome 14, complete sequence
          Length = 216037

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                        
Query: 43     ctcttcttcttcttcctcctcctccc 68
              ||||||||||||||||||||||||||
Sbjct: 141253 ctcttcttcttcttcctcctcctccc 141228



to top

>emb|AL713906.3|CNS07YQ6 Oryza sativa chromosome 12, . BAC OJ1587_D05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 90756

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 42    tctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||||
Sbjct: 31788 tctcttcttcttcttcctcctcctcc 31813



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    tcttcttcttcttcctcctc 63
             ||||||||||||||||||||
Sbjct: 16946 tcttcttcttcttcctcctc 16965



to top

>gb|AC132611.3| Mus musculus BAC clone RP23-375I21 from 17, complete sequence
          Length = 96871

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             ||||||||||||||||||||||||||
Sbjct: 20810 ctcttcttcttcttcctcctcctccc 20835



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 20871 tcttcttcttcctcctcctcc 20891



to top

>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence
          Length = 214638

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 18440 ctcttcttcttcttcctcctcctcc 18416



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 18329 ctcttcttcttcttcctcctcctcc 18305



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 18241 tcttcttcttcttcctcctcctcc 18218



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 38    cccttctcttcttcttcttcctcctcctcc 67
             |||| |||||||||||| ||||||||||||
Sbjct: 23661 ccctcctcttcttcttcctcctcctcctcc 23632



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||| ||||||||||
Sbjct: 18475 tcttcttcttctttctcctcctcc 18452



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||| ||||||||||
Sbjct: 18364 tcttcttcttctttctcctcctcc 18341



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 18244 tcttcttcttcttcttcctcctcc 18221



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 18238 tcttcttcttcctcctcctcctcc 18215



to top

>gb|AC153729.1| Mus musculus  BAC RP23-88C11 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 250801

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 31333 ctcttcttcttcttcctcctcctcc 31309



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 44    tcttcttcttcttcctcctcc 64
             |||||||||||||||||||||
Sbjct: 34253 tcttcttcttcttcctcctcc 34273



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||| ||||||||||
Sbjct: 34250 tcttcttcttcttcttcctcctccc 34274



to top

>ref|NM_016374.4| Homo sapiens AT rich interactive domain 4B (RBP1- like) (ARID4B),
            transcript variant 1, mRNA
          Length = 6065

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2125 ctcttcttcttcttcctcctcctcc 2101



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2121 tcttcttcttcctcctcctcctcc 2098



to top

>gb|AC151736.6| Mus musculus BAC clone RP23-9L16 from chromosome 8, complete sequence
          Length = 239812

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||||||||| ||||||||||||||||||
Sbjct: 62639 ccttctcttcctcttcttcctcctcctcc 62611



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             |||||| |||||||||||||||||||
Sbjct: 62802 ctcttcctcttcttcctcctcctccc 62777



to top

>gb|AC158954.17| Mus musculus chromosome 15, clone RP23-213P14, complete sequence
          Length = 188940

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 40     cttctcttcttcttcttcctcctcctccc 68
              ||||||||||||||| |||||||||||||
Sbjct: 154857 cttctcttcttcttcctcctcctcctccc 154829



to top

>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence
          Length = 190857

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 55288 ctcttcttcttcttcctcctcctcc 55264



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||| ||||||
Sbjct: 55258 ctcttcttcttcttcctcttcctcc 55234



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 55284 tcttcttcttcctcctcctcctcc 55261



to top

>gb|AC161212.9| Mus musculus chromosome 3, clone RP24-267M11, complete sequence
          Length = 147921

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||||||||| ||||||||||||
Sbjct: 118996 ccttctcttcttcttcctcctcctcctcc 118968



to top

>ref|XM_514285.1| PREDICTED: Pan troglodytes similar to AT rich interactive domain 4B
            (RBP1- like) isoform 1; Rb-binding protein homolog;
            retinoblastoma-binding protein 1-like 1; RBP1-like
            protein; retinoblastoma binding protein 1-like 1; breast
            carcinoma-associated antigen BCAA; breast cance...
            (LOC457835), mRNA
          Length = 3117

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1350 ctcttcttcttcttcctcctcctcc 1326



to top

>ref|NM_022621.1| Rattus norvegicus nucleolin-related protein (Norp), mRNA
          Length = 2148

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 822 ctcttcttcttcttcctcctcctcc 798



to top

>gb|AC170163.1| Homo sapiens chromosome 1 clone WI2-3014I21, complete sequence
          Length = 40554

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 7170 ctcttcttcttcttcctcctcctcc 7194



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 43   ctcttcttcttcttcctcctcctc 66
            ||||||||||||||||||||||||
Sbjct: 7209 ctcttcttcttcttcctcctcctc 7232



to top

>gb|AC118932.7| Mus musculus chromosome 5, clone RP24-147H20, complete sequence
          Length = 168156

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 138126 ctcttcttcttcttcctcctcctcc 138150



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||| ||||||||||| |||||||||
Sbjct: 138119 ccttctcctcttcttcttcttcctcctcc 138147



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 138130 tcttcttcttcctcctcctcctcc 138153



to top

>ref|NM_001012324.1| Mus musculus extracellular matrix protein 2, female organ and
            adipocyte specific (Ecm2), mRNA
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1011 ctcttcttcttcttcctcctcctcc 987



to top

>gb|AC115789.9| Mus musculus chromosome 18, clone RP23-398N2, complete sequence
          Length = 206108

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 42     tctcttcttcttcttcctcctcctc 66
              |||||||||||||||||||||||||
Sbjct: 126695 tctcttcttcttcttcctcctcctc 126671



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||||||||||||||||
Sbjct: 4550 tcttcttcttcttcctcctcctcc 4527



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            |||||||||||||| |||||||||
Sbjct: 4553 tcttcttcttcttcttcctcctcc 4530



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 4547 tcttcttcttcctcctcctcctcc 4524



to top

>gb|AC158791.4| Mus musculus chromosome 1, clone RP23-247C6, complete sequence
          Length = 218755

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 64826 ctcttcttcttcttcctcctcctcc 64850



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 64830 tcttcttcttcctcctcctcctcc 64853



to top

>gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, complete sequence
          Length = 215514

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 38     cccttctcttcttcttcttcctcctcctc 66
              |||||||||||||| ||||||||||||||
Sbjct: 134169 cccttctcttcttcctcttcctcctcctc 134141



to top

>gb|U65590.1|HSU65590 Homo sapiens IL-1 receptor antagonist IL-1Ra (IL-1RN) gene,
             alternatively spliced forms, complete cds
          Length = 33414

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 19231 ctcttcttcttcttcctcctcctcc 19255



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 38    cccttctcttcttcttcttcctcctcct 65
             |||||||| |||||||||||||||||||
Sbjct: 19169 cccttctcctcttcttcttcctcctcct 19196



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 19235 tcttcttcttcctcctcctcctcc 19258



to top

>gb|AY228561.1| Perdix perdix clone LEI30 microsatellite sequence
          Length = 212

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                   
Query: 43 ctcttcttcttcttcctcctcctcc 67
          |||||||||||||||||||||||||
Sbjct: 85 ctcttcttcttcttcctcctcctcc 61



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 44  tcttcttcttcttcctcctc 63
           ||||||||||||||||||||
Sbjct: 117 tcttcttcttcttcctcctc 98



to top

>gb|AC107760.9| Mus musculus chromosome 15, clone RP23-189K4, complete sequence
          Length = 178900

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 38    cccttctcttcttcttcttcctcctcctc 66
             ||||||||||||||||| |||||||||||
Sbjct: 47855 cccttctcttcttcttcctcctcctcctc 47827



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 47849 tcttcttcttcctcctcctcc 47829



to top

>gb|AC121095.16| Mus musculus chromosome 14, clone RP24-324H17, complete sequence
          Length = 142953

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 42346 tcttcttcttcttcctcctcctccc 42370



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 42343 tcttcttcttcttcttcctcctcc 42366



to top

>gb|AC102757.6| Mus musculus chromosome 5, clone RP24-196M24, complete sequence
          Length = 179876

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 3905 ctcttcttcttcttcctcctcctcc 3929



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 43   ctcttcttcttcttcctcctc 63
            |||||||||||||||||||||
Sbjct: 3887 ctcttcttcttcttcctcctc 3907



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 3909 tcttcttcttcctcctcctcctcc 3932



to top

>gb|AC154523.2| Mus musculus BAC clone RP24-65H12 from chromosome 13, complete sequence
          Length = 196410

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 132018 ctcttcttcttcttcctcctcctcc 131994



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 132014 tcttcttcttcctcctcctcctcc 131991



to top

>gb|AC154528.2| Mus musculus BAC clone RP23-460I18 from chromosome 14, complete sequence
          Length = 207430

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 40     cttctcttcttcttcttcctcctcctccc 68
              |||| ||||||||||||||||||||||||
Sbjct: 144866 cttcccttcttcttcttcctcctcctccc 144894



to top

>gb|AC138595.10| Mus musculus chromosome 1, clone RP24-286D13, complete sequence
          Length = 172490

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 46495 ctcttcttcttcttcctcctcctcc 46519



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||| |||||||||||||||
Sbjct: 48131 ctcttcttcctcttcctcctcctcc 48107



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||| ||||||||||||||||||
Sbjct: 60329 tcttcctcttcttcctcctcctcc 60306



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 46499 tcttcttcttcctcctcctcctcc 46522



to top

>gb|AC115793.14| Mus musculus chromosome 9, clone RP23-400G18, complete sequence
          Length = 199109

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||| ||||||||||||||||||
Sbjct: 105096 ccttctcttcctcttcttcctcctcctcc 105068



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 190684 tcttcttcttcttcctcctcctcc 190661



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 190687 tcttcttcttcttcttcctcctcc 190664



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 190681 tcttcttcttcctcctcctcctcc 190658



to top

>gb|AC123658.9| Mus musculus chromosome 15, clone RP23-192C13, complete sequence
          Length = 211158

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||||||||| |||||||||||||||
Sbjct: 13303 ccttctcttcttcctcttcctcctcctcc 13275



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 13202 tcttcttcttcttcctcctcctcc 13179



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||| |||||||
Sbjct: 12987 ctcttcttcttcttccttctcctcc 12963



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 13205 tcttcttcttcttcttcctcctcc 13182



to top

>gb|AC115033.9| Mus musculus chromosome 15, clone RP24-269A7, complete sequence
          Length = 147113

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 87473 ctcttcttcttcttcctcctcctcc 87497



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||| ||||||||||||||||||
Sbjct: 87438 tcttcctcttcttcctcctcctcc 87461



to top

>gb|AC128859.4| Rattus norvegicus 10 BAC CH230-436I22 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 156078

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 99771 ctcttcttcttcttcctcctcctcc 99795



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 39     ccttctcttcttcttcttcctcctcctc 66
              ||||||||| ||||||||||||||||||
Sbjct: 101744 ccttctctttttcttcttcctcctcctc 101771



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 102061 tcttcttcttcctcctcctcc 102081



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 40     cttctcttcttcttcttcctcctcctcc 67
              ||||| ||||||||||||||| ||||||
Sbjct: 102838 cttcttttcttcttcttcctcttcctcc 102865



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||| |||||||||||||||||||
Sbjct: 102580 tcttattcttcttcctcctcctcc 102603



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     cttcttcttcctcctcctcc 67
              ||||||||||||||||||||
Sbjct: 101852 cttcttcttcctcctcctcc 101871



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 40     cttctcttcttcttcttcctcctcctcc 67
              ||||| ||||||||||||||| ||||||
Sbjct: 101132 cttcttttcttcttcttcctcttcctcc 101159



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     cttcttcttcctcctcctcc 67
              ||||||||||||||||||||
Sbjct: 100927 cttcttcttcctcctcctcc 100946



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 40     cttctcttcttcttcttcctcctcctcc 67
              ||||| ||||||||||||||| ||||||
Sbjct: 100587 cttcttttcttcttcttcctcttcctcc 100614



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 99775 tcttcttcttcctcctcctcctcc 99798



to top

>gb|AC095688.7| Rattus norvegicus 2 BAC CH230-9C20 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 176590

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 39     ccttctcttcttcttcttcctcctc 63
              |||||||||||||||||||||||||
Sbjct: 171339 ccttctcttcttcttcttcctcctc 171315



to top

>gb|AC132833.10| Mus musculus chromosome 15, clone RP24-498G7, complete sequence
          Length = 154206

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 34760 ctcttcttcttcttcctcctcctcc 34784



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||||
Sbjct: 34820 ctcttcttcttcttcctcctcctc 34843



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 34973 ctctttttcttcttcctcctcctcc 34997



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 34940 ctctttttcttcttcctcctcctcc 34964



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 34790 ctctttttcttcttcctcctcctcc 34814



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 34697 ctctttttcttcttcctcctcctcc 34721



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             ||||| ||||||||||||||||||
Sbjct: 34847 ctctttttcttcttcctcctcctc 34870



to top

>gb|AC161409.11| Mus musculus chromosome 7, clone RP23-292B24, complete sequence
          Length = 185365

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 144438 ctcttcttcttcttcctcctcctcc 144462



to top

>gb|AC102745.10| Mus musculus chromosome 17, clone RP24-371L2, complete sequence
          Length = 189211

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||| ||||||||||||||||||||||||
Sbjct: 42841 ccttatcttcttcttcttcctcctcctcc 42813



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||||| |||||||
Sbjct: 135342 tcttcttcttcttccttctcctcc 135319



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 42833 tcttcttcttcctcctcctcctcc 42810



to top

>gb|AC125233.4| Mus musculus BAC clone RP23-9D24 from chromosome 5, complete sequence
          Length = 212792

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 5350 ctcttcttcttcttcctcctcctcc 5326



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 5346 tcttcttcttcctcctcctcctcc 5323



to top

>gb|AC116595.4| Mus musculus BAC clone RP24-127G9 from chromosome 18, complete sequence
          Length = 158788

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 135859 ctcttcttcttcttcctcctcctcc 135835



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 135855 tcttcttcttcctcctcctcctcc 135832



to top

>ref|XM_958850.1| Neurospora crassa OR74A hypothetical protein (NCU02787.1) partial
            mRNA
          Length = 3525

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 44   tcttcttcttcttcctcctcctccc 68
            |||||||||||||||||||||||||
Sbjct: 3109 tcttcttcttcttcctcctcctccc 3133



to top

>ref|XM_581028.2| PREDICTED: Bos taurus similar to cyclin I, transcript variant 3
           (LOC504847), mRNA
          Length = 2525

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 39  ccttctcttcttcttcttcctcctcctcc 67
           ||||||| |||||||||||||||||||||
Sbjct: 114 ccttctcctcttcttcttcctcctcctcc 86



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||| ||||||||||||
Sbjct: 107 ctcttcttcttcctcctcctcctcc 83



to top

>ref|XM_873106.1| PREDICTED: Bos taurus similar to cyclin I, transcript variant 6
           (LOC504847), mRNA
          Length = 2580

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 39  ccttctcttcttcttcttcctcctcctcc 67
           ||||||| |||||||||||||||||||||
Sbjct: 112 ccttctcctcttcttcttcctcctcctcc 84



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||| ||||||||||||
Sbjct: 105 ctcttcttcttcctcctcctcctcc 81



to top

>ref|XM_864393.1| PREDICTED: Bos taurus similar to cyclin I, transcript variant 4
           (LOC504847), mRNA
          Length = 3088

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 39  ccttctcttcttcttcttcctcctcctcc 67
           ||||||| |||||||||||||||||||||
Sbjct: 548 ccttctcctcttcttcttcctcctcctcc 520



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||| ||||||||||||
Sbjct: 541 ctcttcttcttcctcctcctcctcc 517



to top

>ref|XM_872917.1| PREDICTED: Bos taurus similar to cyclin I, transcript variant 5
           (LOC504847), mRNA
          Length = 1970

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 39  ccttctcttcttcttcttcctcctcctcc 67
           ||||||| |||||||||||||||||||||
Sbjct: 548 ccttctcctcttcttcttcctcctcctcc 520



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||| ||||||||||||
Sbjct: 541 ctcttcttcttcctcctcctcctcc 517



to top

>gb|AC121499.9| Mus musculus chromosome 9, clone RP23-269E5, complete sequence
          Length = 212061

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||| |||||||||||||||||||||
Sbjct: 83172 ccttctcctcttcttcttcctcctcctcc 83144



to top

>ref|XM_329974.1| Neurospora crassa OR74A hypothetical protein (NCU02787.1) partial
            mRNA
          Length = 3525

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 44   tcttcttcttcttcctcctcctccc 68
            |||||||||||||||||||||||||
Sbjct: 3109 tcttcttcttcttcctcctcctccc 3133



to top

>gb|AC110168.11| Mus musculus chromosome 17, clone RP23-312F5, complete sequence
          Length = 177747

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 134701 ctcttcttcttcttcctcctcctcc 134725



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 45    cttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||
Sbjct: 81719 cttcttcttcttcctcctcctc 81740



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 134705 tcttcttcttcctcctcctcctcc 134728



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||| |||||||||||||||
Sbjct: 134657 tcttcttcctcttcctcctcctcc 134680



to top

>ref|XM_717782.1| Candida albicans SC5314 hypothetical protein (CaO19_12128), mRNA
          Length = 2391

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2046 ctcttcttcttcttcctcctcctcc 2022



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2042 tcttcttcttcctcctcctcctcc 2019



to top

>ref|XM_717636.1| Candida albicans SC5314 hypothetical protein (CaO19_4658), mRNA
          Length = 2391

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2046 ctcttcttcttcttcctcctcctcc 2022



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2042 tcttcttcttcctcctcctcctcc 2019



to top

>gb|AC140460.3| Mus musculus BAC clone RP24-151D4 from chromosome 9, complete sequence
          Length = 196545

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 96088 ctcttcttcttcttcctcctcctcc 96112



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 96122 tcttcttcttcttcctcctcctcc 96145



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||| |||||||| ||||||||||||
Sbjct: 96153 ccttctcctcttcttcctcctcctcctcc 96181



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||||||||| |||||||||
Sbjct: 96118 ctcttcttcttcttcttcctcctcc 96142



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 96092 tcttcttcttcctcctcctcctcc 96115



to top

>gb|AC124717.3| Mus musculus BAC clone RP24-147K15 from chromosome 18, complete sequence
          Length = 204165

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||||||||| ||||||||||||
Sbjct: 157593 ccttctcttcttcttcctcctcctcctcc 157621



to top

>gb|BC065151.1| Mus musculus cDNA sequence BC065151, mRNA (cDNA clone
           IMAGE:5708030), partial cds
          Length = 2336

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 881 ctcttcttcttcttcctcctcctcc 857



to top

>gb|BC061127.1| Mus musculus cDNA sequence BC061127, mRNA (cDNA clone
           IMAGE:6771130), with apparent retained intron
          Length = 582

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 213 ctcttcttcttcttcctcctcctcc 189



to top

>gb|AC125192.3| Mus musculus BAC clone RP23-266B4 from chromosome 8, complete sequence
          Length = 199459

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||| |||||||||||||||||||||
Sbjct: 187928 ccttctcctcttcttcttcctcctcctcc 187900



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||| ||||||||||||
Sbjct: 187921 ctcttcttcttcctcctcctcctcc 187897



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    tcttcttcttcctcctcctc 66
             ||||||||||||||||||||
Sbjct: 13653 tcttcttcttcctcctcctc 13672



to top

>gb|AC122487.3| Mus musculus BAC clone RP24-381E21 from chromosome 17, complete
             sequence
          Length = 149666

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 37984 ctcttcttcttcttcctcctcctcc 38008



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 37988 tcttcttcttcctcctcctcctcc 38011



to top

>gb|AC131185.4| Mus musculus BAC clone RP23-402H1 from chromosome 19, complete sequence
          Length = 208584

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 162749 ctcttcttcttcttcctcctcctcc 162725



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 40   cttctcttcttcttcttcctcctcctcc 67
            |||||||||||| ||||| |||||||||
Sbjct: 4944 cttctcttcttcctcttcttcctcctcc 4917



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||| ||||||||||||||||||
Sbjct: 4937 tcttcctcttcttcctcctcctcc 4914



to top

>gb|AC157928.4| Mus musculus chromosome 5, clone RP24-119I9, complete sequence
          Length = 157594

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 36933 ctcttcttcttcttcctcctcctcc 36957



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||| ||||||||||| |||||||||
Sbjct: 36926 ccttctcctcttcttcttcttcctcctcc 36954



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 36937 tcttcttcttcctcctcctcctcc 36960



to top

>gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, complete sequence
          Length = 149463

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 38   cccttctcttcttcttcttcctcctcctc 66
            |||||||||||||| ||||||||||||||
Sbjct: 9363 cccttctcttcttcctcttcctcctcctc 9335



to top

>gb|AC122282.5| Mus musculus BAC clone RP23-240B12 from chromosome 5, complete sequence
          Length = 227388

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 214811 ctcttcttcttcttcctcctcctcc 214835



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 214131 tcttcttcttcttcctcctcctcc 214154



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 214965 tcttcttcttcctcctcctcc 214985



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 214896 tcttcttcttcctcctcctcc 214916



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 214728 tcttcttcttcctcctcctcc 214748



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||||||||| |||||||||
Sbjct: 214127 ctcttcttcttcttcttcctcctcc 214151



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||||||||| |||||||||||
Sbjct: 214964 ctcttcttcttcctcctcctcctc 214987



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||||||||| |||||||||||
Sbjct: 214895 ctcttcttcttcctcctcctcctc 214918



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||||||||| |||||||||||
Sbjct: 214727 ctcttcttcttcctcctcctcctc 214750



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 214134 tcttcttcttcctcctcctcctcc 214157



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     cttcttcttcctcctcctcc 67
              ||||||||||||||||||||
Sbjct: 214021 cttcttcttcctcctcctcc 214040



to top

>gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome 6, complete sequence
          Length = 264135

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 153089 ctcttcttcttcttcctcctcctcc 153113



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 153028 tcttcttcttcttcctcctcctcc 153051



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 153031 tcttcttcttcctcctcctcctcc 153054



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 153025 tcttcttcttcttcttcctcctcc 153048



to top

>gb|AC122397.2| Mus musculus BAC clone RP24-90D21 from chromosome 15, complete sequence
          Length = 181742

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 25241 ctcttcttcttcttcctcctcctcc 25217



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 45    cttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||
Sbjct: 25306 cttcttcttcttcctcctcctcc 25284



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 57306 tcttcttcttcctcctcctcc 57286



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             |||||||||||| |||||||||||
Sbjct: 57307 ctcttcttcttcctcctcctcctc 57284



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 25304 tcttcttcttcctcctcctcctcc 25281



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    cttcttcttcctcctcctcc 67
             ||||||||||||||||||||
Sbjct: 25281 cttcttcttcctcctcctcc 25262



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 25237 tcttcttcttcctcctcctcctcc 25214



to top

>gb|AC007096.3| Homo sapiens BAC clone RP11-306F13 from 7, complete sequence
          Length = 35036

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 5531 ctcttcttcttcttcctcctcctcc 5555



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 44   tcttcttcttcttcctcctcctccc 68
            ||||||||||| |||||||||||||
Sbjct: 5535 tcttcttcttcctcctcctcctccc 5559



to top

>gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, complete sequence
          Length = 212183

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||||||||| |||||||||||||||
Sbjct: 163882 ccttctcttcttcctcttcctcctcctcc 163854



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 163781 tcttcttcttcttcctcctcctcc 163758



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||||||||||| |||||||
Sbjct: 163566 ctcttcttcttcttccttctcctcc 163542



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 163784 tcttcttcttcttcttcctcctcc 163761



to top

>gb|AC114676.7| Mus musculus chromosome 5, clone RP24-211H1, complete sequence
          Length = 153903

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 99512 ctcttcttcttcttcctcctcctcc 99488



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 100192 tcttcttcttcttcctcctcctcc 100169



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||||||||| |||||||||
Sbjct: 100196 ctcttcttcttcttcttcctcctcc 100172



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 99595 tcttcttcttcctcctcctcc 99575



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 99427 tcttcttcttcctcctcctcc 99407



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 99358 tcttcttcttcctcctcctcc 99338



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     cttcttcttcctcctcctcc 67
              ||||||||||||||||||||
Sbjct: 100302 cttcttcttcctcctcctcc 100283



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 100189 tcttcttcttcctcctcctcctcc 100166



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             |||||||||||| |||||||||||
Sbjct: 99596 ctcttcttcttcctcctcctcctc 99573



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             |||||||||||| |||||||||||
Sbjct: 99428 ctcttcttcttcctcctcctcctc 99405



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             |||||||||||| |||||||||||
Sbjct: 99359 ctcttcttcttcctcctcctcctc 99336



to top

>gb|AC131112.3| Mus musculus BAC clone RP24-136L4 from chromosome 7, complete sequence
          Length = 172989

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 162770 ctcttcttcttcttcctcctcctcc 162746



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||| ||||||||||| |||||||||
Sbjct: 162777 ccttctcctcttcttcttcttcctcctcc 162749



to top

>gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosome 16, complete
             sequence
          Length = 196519

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 88229 ctcttcttcttcttcctcctcctcc 88205



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             ||||||||||| |||||||||||||
Sbjct: 88225 tcttcttcttcctcctcctcctccc 88201



to top

>ref|XM_856550.1| PREDICTED: Canis familiaris similar to nucleolin-related protein,
            transcript variant 5 (LOC608445), mRNA
          Length = 3018

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1344 ctcttcttcttcttcctcctcctcc 1320



to top

>ref|XM_856520.1| PREDICTED: Canis familiaris similar to nucleolin-related protein,
            transcript variant 4 (LOC608445), mRNA
          Length = 3006

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1344 ctcttcttcttcttcctcctcctcc 1320



to top

>ref|XM_856489.1| PREDICTED: Canis familiaris similar to nucleolin-related protein,
            transcript variant 3 (LOC608445), mRNA
          Length = 2868

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1344 ctcttcttcttcttcctcctcctcc 1320



to top

>ref|XM_856460.1| PREDICTED: Canis familiaris similar to nucleolin-related protein,
            transcript variant 2 (LOC608445), mRNA
          Length = 2831

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1344 ctcttcttcttcttcctcctcctcc 1320



to top

>ref|XM_845384.1| PREDICTED: Canis familiaris similar to nucleolin-related protein,
            transcript variant 1 (LOC608445), mRNA
          Length = 3075

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1344 ctcttcttcttcttcctcctcctcc 1320



to top

>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 189551 ctcttcttcttcttcctcctcctcc 189527



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||  ||||||||||||||||||
Sbjct: 113647 ccttctctttctcttcttcctcctcctcc 113675



to top

>emb|CT009713.8| Mouse DNA sequence from clone RP23-151C6 on chromosome 13, complete
              sequence
          Length = 217752

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 160466 ctcttcttcttcttcctcctcctcc 160490



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 217675 tcttcttcttcctcctcctcc 217695



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||| ||||||||||||
Sbjct: 217674 ctcttcttcttcctcctcctcctcc 217698



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     tcttcttcttcctcctcctc 66
              ||||||||||||||||||||
Sbjct: 159149 tcttcttcttcctcctcctc 159130



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              ||||||||| ||||||||||||||
Sbjct: 126838 ctcttcttcctcttcctcctcctc 126815



to top

>gb|AC132302.3| Mus musculus BAC clone RP24-279N5 from chromosome 3, complete sequence
          Length = 157307

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||| ||||||||||||||||||||||||
Sbjct: 93549 ccttttcttcttcttcttcctcctcctcc 93521



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 113046 tcttcttcttcttcctcctcctcc 113023



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 113049 tcttcttcttcttcttcctcctcc 113026



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 113043 tcttcttcttcctcctcctcctcc 113020



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||| |||||||||||||||||
Sbjct: 112903 tcttctccttcttcctcctcctcc 112880



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 93541 tcttcttcttcctcctcctcctcc 93518



to top

>gb|AC117239.4| Mus musculus BAC clone RP24-117K6 from chromosome 18, complete sequence
          Length = 150804

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 134609 ctcttcttcttcttcctcctcctcc 134633



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||| |||||||||||||||||
Sbjct: 134450 ctcttcctcttcttcctcctcctc 134473



to top

>gb|AC130541.4| Mus musculus BAC clone RP24-124P9 from chromosome 3, complete sequence
          Length = 191814

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 143828 ctcttcttcttcttcctcctcctcc 143852



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 143832 tcttcttcttcctcctcctcctcc 143855



to top

>gb|AC132100.3| Mus musculus BAC clone RP24-294D10 from chromosome 18, complete
             sequence
          Length = 173949

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 43463 ctcttcttcttcttcctcctcctcc 43487



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 164770 tcttcttcttcttcctcctcctcc 164793



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 164773 tcttcttcttcctcctcctcctcc 164796



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 164767 tcttcttcttcttcttcctcctcc 164790



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             |||||| |||||||||||||||||
Sbjct: 43304 ctcttcctcttcttcctcctcctc 43327



to top

>gb|AC132268.3| Mus musculus BAC clone RP24-399H6 from chromosome 19, complete sequence
          Length = 191573

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 34311 ctcttcttcttcttcctcctcctcc 34287



to top

>gb|AC130549.4| Mus musculus BAC clone RP24-456I3 from chromosome 7, complete sequence
          Length = 160449

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 85182 tcttcttcttcttcctcctcctccc 85158



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 85185 tcttcttcttcttcttcctcctcc 85162



to top

>gb|AC116557.30| Mus musculus strain C57BL/6J clone rp23-239f10 map 8, complete sequence
          Length = 232571

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 44     tcttcttcttcttcctcctcctccc 68
              |||||||||||||||||||||||||
Sbjct: 225465 tcttcttcttcttcctcctcctccc 225489



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 225462 tcttcttcttcttcttcctcctcc 225485



to top

>gb|AC122288.4| Mus musculus BAC clone RP23-254F4 from chromosome 13, complete
            sequence
          Length = 146420

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 39   ccttctcttcttcttcttcctcctcctcc 67
            |||| ||||||||||||||||||||||||
Sbjct: 8428 ccttttcttcttcttcttcctcctcctcc 8456



to top

>gb|AC125381.4| Mus musculus BAC clone RP23-250N10 from chromosome 19, complete
             sequence
          Length = 155214

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 72422 ctcttcttcttcttcctcctcctcc 72446



to top

>gb|AC125484.4| Mus musculus BAC clone RP23-127L14 from chromosome 13, complete
             sequence
          Length = 207318

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||||||||||||||| ||||||||||||
Sbjct: 61773 ccttctcttcttcttcctcctcctcctcc 61745



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 43    ctcttcttcttcttcctcctcctccc 68
             ||||||||| ||||||||||||||||
Sbjct: 61811 ctcttcttcctcttcctcctcctccc 61786



to top

>gb|BC051413.1| Mus musculus calcium channel, voltage-dependent, alpha 1F subunit,
            mRNA (cDNA clone IMAGE:6493332), containing frame-shift
            errors
          Length = 6035

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2480 ctcttcttcttcttcctcctcctcc 2456



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2476 tcttcttcttcctcctcctcctcc 2453



to top

>gb|BC043482.1| Mus musculus calcium channel, voltage-dependent, alpha 1F subunit,
            mRNA (cDNA clone IMAGE:5369391), containing frame-shift
            errors
          Length = 6636

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2907 ctcttcttcttcttcctcctcctcc 2883



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2903 tcttcttcttcctcctcctcctcc 2880



to top

>gb|AC125108.3| Mus musculus BAC clone RP24-226A8 from chromosome 10, complete sequence
          Length = 148202

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 29650 ctcttcttcttcttcctcctcctcc 29674



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 39    ccttctcttcttcttcttcctcctcct 65
             |||||||||||||||| ||||||||||
Sbjct: 72984 ccttctcttcttcttcctcctcctcct 72958



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 72979 tcttcttcttcctcctcctcc 72959



to top

>gb|AC127678.9| Mus musculus BAC clone RP24-233M12 from chromosome 18, complete
             sequence
          Length = 157430

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 64561 ctcttcttcttcttcctcctcctcc 64537



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 44     tcttcttcttcttcctcctcctc 66
              |||||||||||||||||||||||
Sbjct: 144471 tcttcttcttcttcctcctcctc 144493



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 44     tcttcttcttcttcctcctcctc 66
              |||||||||||||||||||||||
Sbjct: 144372 tcttcttcttcttcctcctcctc 144394



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 144444 tcttcttcttcctcctcctcc 144464



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 144345 tcttcttcttcctcctcctcc 144365



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 144444 tcttcttcttcctcctcctcctcc 144467



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 144345 tcttcttcttcctcctcctcctcc 144368



to top

>gb|AC124382.4| Mus musculus BAC clone RP24-409N22 from chromosome 1, complete sequence
          Length = 168354

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 75664 tcttcttcttcttcctcctcctccc 75688



to top

>gb|AC126430.3| Mus musculus BAC clone RP24-406F17 from chromosome 10, complete
             sequence
          Length = 154482

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 59554 tcttcttcttcttcctcctcctccc 59530



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 46    ttcttcttcttcctcctcctc 66
             |||||||||||||||||||||
Sbjct: 34659 ttcttcttcttcctcctcctc 34679



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 59557 tcttcttcttcttcttcctcctcc 59534



to top

>gb|AC131773.3| Mus musculus BAC clone RP24-308A19 from chromosome 15, complete sequence
          Length = 168423

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 44     tcttcttcttcttcctcctcctccc 68
              |||||||||||||||||||||||||
Sbjct: 145569 tcttcttcttcttcctcctcctccc 145593



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 56918 tcttcttcttcttcctcctcctcc 56895



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 145566 tcttcttcttcttcttcctcctcc 145589



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 56921 tcttcttcttcttcttcctcctcc 56898



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 56915 tcttcttcttcctcctcctcctcc 56892



to top

>gb|AC122456.4| Mus musculus BAC clone RP24-265M23 from chromosome 16, complete sequence
          Length = 158610

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 128343 ctcttcttcttcttcctcctcctcc 128367



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 128347 tcttcttcttcctcctcctcctcc 128370



to top

>gb|AC121914.3| Mus musculus BAC clone RP24-186A10 from chromosome 3, complete sequence
          Length = 172937

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||| ||||||||||||||||||||||||
Sbjct: 114125 ccttgtcttcttcttcttcctcctcctcc 114153



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 43     ctcttcttcttcttcctcctcctccc 68
              ||||||||| ||||||||||||||||
Sbjct: 163844 ctcttcttcctcttcctcctcctccc 163869



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 114133 tcttcttcttcctcctcctcctcc 114156



to top

>gb|AC122837.4| Mus musculus BAC clone RP23-189N3 from 16, complete sequence
          Length = 199988

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||| ||||||||||||||||||
Sbjct: 159942 ccttctcttcctcttcttcctcctcctcc 159914



to top

>gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, complete sequence
          Length = 200727

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 34014 ctcttcttcttcttcctcctcctcc 34038



to top

>gb|AC126273.3| Mus musculus BAC clone RP23-99P15 from 7, complete sequence
          Length = 182698

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 159791 ctcttcttcttcttcctcctcctcc 159815



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    tcttcttcttcctcctcctc 66
             ||||||||||||||||||||
Sbjct: 77048 tcttcttcttcctcctcctc 77067



to top

>gb|AC122295.4| Mus musculus BAC clone RP23-263E3 from 13, complete sequence
          Length = 200289

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 58415 ctcttcttcttcttcctcctcctcc 58439



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 58419 tcttcttcttcctcctcctcctcc 58442



to top

>gb|AC125191.4| Mus musculus BAC clone RP23-262C22 from 16, complete sequence
          Length = 196580

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||| ||||||||||||||||||||||||
Sbjct: 74088 ccttttcttcttcttcttcctcctcctcc 74060



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 74174 tcttcttcttcttcctcctcctcc 74151



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 73995 tcttcttcttcttcctcctcctcc 73972



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 73892 tcttcttcttcttcctcctcctcc 73869



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 73813 tcttcttcttcttcctcctcctcc 73790



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||| |||||||||||||| |||||||||
Sbjct: 74182 ccttttcttcttcttcttcttcctcctcc 74154



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             ||||||||||| |||||||||||||
Sbjct: 74171 tcttcttcttcctcctcctcctccc 74147



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 74080 tcttcttcttcctcctcctcctcc 74057



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 73998 tcttcttcttcttcttcctcctcc 73975



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 73992 tcttcttcttcctcctcctcctcc 73969



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 73895 tcttcttcttcttcttcctcctcc 73872



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 73889 tcttcttcttcctcctcctcctcc 73866



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 73816 tcttcttcttcttcttcctcctcc 73793



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 73810 tcttcttcttcctcctcctcctcc 73787



to top

>gb|AC124545.4| Mus musculus BAC clone RP23-272D9 from 7, complete sequence
          Length = 169442

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 15983 ctcttcttcttcttcctcctcctcc 16007



to top

>gb|AC122196.2| Mus musculus BAC clone RP23-50P5 from 5, complete sequence
          Length = 151406

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 94904 ctcttcttcttcttcctcctcctcc 94928



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 43    ctcttcttcttcttcctcctc 63
             |||||||||||||||||||||
Sbjct: 94886 ctcttcttcttcttcctcctc 94906



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 94908 tcttcttcttcctcctcctcctcc 94931



to top

>gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, complete sequence
          Length = 172114

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 46163 ctcttcttcttcttcctcctcctcc 46139



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 125800 tcttcttcttcttcctcctcctcc 125777



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 125803 tcttcttcttcttcttcctcctcc 125780



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 125797 tcttcttcttcctcctcctcctcc 125774



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 46159 tcttcttcttcctcctcctcctcc 46136



to top

>gb|AC121886.2| Mus musculus BAC clone RP24-141K3 from 18, complete sequence
          Length = 140819

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||| |||||
Sbjct: 96839 ccttctcttcttcttcttcctccccctcc 96867



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 47     tcttcttcttcctcctcctccc 68
              ||||||||||||||||||||||
Sbjct: 131613 tcttcttcttcctcctcctccc 131592



to top

>gb|AC121950.2| Mus musculus BAC clone RP24-216M19 from 6, complete sequence
          Length = 170988

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 38     cccttctcttcttcttcttcctcctcctc 66
              |||| ||||||||||||||||||||||||
Sbjct: 100323 ccctcctcttcttcttcttcctcctcctc 100351



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 100281 ctcttcttcttcttcctcctcctcc 100305



to top

>emb|CR730287.2|CNS0GQFO Tetraodon nigroviridis full-length cDNA
          Length = 1332

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 718 ctcttcttcttcttcctcctcctcc 694



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 44  tcttcttcttcttcctcctcctcc 67
           ||||||||||| ||||||||||||
Sbjct: 714 tcttcttcttcctcctcctcctcc 691



to top

>emb|CR725274.2|CNS0GMKG Tetraodon nigroviridis full-length cDNA
          Length = 1396

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 752 ctcttcttcttcttcctcctcctcc 728



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 44  tcttcttcttcttcctcctcctcc 67
           ||||||||||| ||||||||||||
Sbjct: 748 tcttcttcttcctcctcctcctcc 725



to top

>gb|AC110240.8| Mus musculus chromosome 3, clone RP23-113O9, complete sequence
          Length = 237590

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||||||||| |||||||||||||||
Sbjct: 176196 ccttctcttcttcctcttcctcctcctcc 176168



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 224902 tcttcttcttcttcctcctcctcc 224925



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 224905 tcttcttcttcctcctcctcctcc 224928



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 224899 tcttcttcttcttcttcctcctcc 224922



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 39     ccttctcttcttcttcttcctcct 62
              ||||||||||||| ||||||||||
Sbjct: 176217 ccttctcttcttcctcttcctcct 176194



to top

>gb|AC004745.2| Homo sapiens BAC clone CTA-281B9 from 7, complete sequence
          Length = 97137

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||| ||||||||||||||||||||||||
Sbjct: 53858 ccttttcttcttcttcttcctcctcctcc 53830



to top

>gb|AC113292.6| Mus musculus chromosome 15, clone RP23-418M3, complete sequence
          Length = 218109

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 38    cccttctcttcttcttcttcctcctcctc 66
             ||||||||||||||||| |||||||||||
Sbjct: 51963 cccttctcttcttcttcctcctcctcctc 51991



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 51969 tcttcttcttcctcctcctcc 51989



to top

>gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, complete sequence
          Length = 134825

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||||||||| |||||||||||||||
Sbjct: 61690 ccttctcttcttcctcttcctcctcctcc 61662



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||| |||||||||||||||
Sbjct: 112240 ctcttcttcctcttcctcctcctcc 112264



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||| |||||||||||||||
Sbjct: 61712 tcttcttcctcttcctcctcctcc 61689



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 39    ccttctcttcttcttcttcctcctcctc 66
             |||||||||| ||||||||||| |||||
Sbjct: 61654 ccttctcttcctcttcttcctcttcctc 61627



to top

>ref|XM_661336.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.40415)
            partial mRNA
          Length = 3129

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1330 ctcttcttcttcttcctcctcctcc 1306



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 1326 tcttcttcttcctcctcctcctcc 1303



to top

>gb|AC149067.3| Mus musculus BAC clone RP23-56C20 from chromosome 7, complete sequence
          Length = 267610

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 74650 tcttcttcttcttcctcctcctccc 74626



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     ttcttcttcttcctcctcctc 66
              |||||||||||||||||||||
Sbjct: 174788 ttcttcttcttcctcctcctc 174768



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              ||||||||||||||||| ||||||
Sbjct: 174747 ctcttcttcttcttccttctcctc 174724



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              ||||||||||||||||| ||||||
Sbjct: 174590 ctcttcttcttcttccttctcctc 174567



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              ||||||||||||||||| ||||||
Sbjct: 174399 ctcttcttcttcttccttctcctc 174376



to top

>gb|AC109240.30| Mus musculus chromosome 1, clone RP23-445I23, complete sequence
          Length = 189545

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 73377 ctcttcttcttcttcctcctcctcc 73353



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 73373 tcttcttcttcctcctcctcctcc 73350



to top

>gb|AC116718.21| Mus musculus chromosome 5, clone RP23-203O7, complete sequence
          Length = 204327

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 23401 ctcttcttcttcttcctcctcctcc 23425



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 131004 tcttcttcttcttcctcctcctcc 131027



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 131007 tcttcttcttcctcctcctcctcc 131030



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 131001 tcttcttcttcttcttcctcctcc 131024



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 23405 tcttcttcttcctcctcctcctcc 23428



to top

>gb|AC160978.4| Mus musculus BAC clone RP23-426B17 from chromosome 13, complete sequence
          Length = 197652

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 155319 ctcttcttcttcttcctcctcctcc 155343



to top

>gb|AC162689.3| Mus musculus chromosome 5, clone RP23-396K22, complete sequence
          Length = 168260

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 30020 ctcttcttcttcttcctcctcctcc 29996



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 30016 tcttcttcttcctcctcctcctcc 29993



to top

>gb|BC089559.1| Mus musculus extracellular matrix protein 2, female organ and
            adipocyte specific, mRNA (cDNA clone MGC:107322
            IMAGE:30295705), complete cds
          Length = 3627

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1011 ctcttcttcttcttcctcctcctcc 987



to top

>gb|AC144799.3| Mus musculus chromosome 18 clone RP24-299J7, complete sequence
          Length = 192272

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 155408 ctcttcttcttcttcctcctcctcc 155432



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 155412 tcttcttcttcctcctcctcctcc 155435



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 40     cttctcttcttcttcttcctcctcctcc 67
              |||||| ||||||||||| |||||||||
Sbjct: 155402 cttctcctcttcttcttcttcctcctcc 155429



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    tcttcttcttcttcctcctc 63
             ||||||||||||||||||||
Sbjct: 70317 tcttcttcttcttcctcctc 70298



to top

>gb|AC157809.4| Mus musculus chromosome 1, clone RP24-375B12, complete sequence
          Length = 138350

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 41919 ctcttcttcttcttcctcctcctcc 41943



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             |||||| ||||||||||| |||||||||
Sbjct: 41913 cttctcctcttcttcttcttcctcctcc 41940



to top

>gb|AC161037.3| Mus musculus chromosome 7, clone RP24-255H18, complete sequence
          Length = 184362

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 146215 ctcttcttcttcttcctcctcctcc 146191



to top

>gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 293757

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 162122 ctcttcttcttcttcctcctcctcc 162146



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 18704 tcttcttcttcttcctcctcctcc 18681



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||| |||||||||||||||||
Sbjct: 253955 ctcttcctcttcttcctcctcctc 253932



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 162126 tcttcttcttcctcctcctcctcc 162149



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||| ||||||||||||||||||
Sbjct: 26655 tcttcctcttcttcctcctcctcc 26632



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 18707 tcttcttcttcttcttcctcctcc 18684



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 18701 tcttcttcttcctcctcctcctcc 18678



to top

>emb|AL671862.6| Human DNA sequence from clone RP11-810H18 on chromosome 1, complete
             sequence
          Length = 62080

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 39826 ctcttcttcttcttcctcctcctcc 39850



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||||
Sbjct: 39865 ctcttcttcttcttcctcctcctc 39888



to top

>gb|BC017800.1| Homo sapiens AT rich interactive domain 4B (RBP1- like), mRNA (cDNA
           clone IMAGE:4663973), containing frame-shift errors
          Length = 1193

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 885 ctcttcttcttcttcctcctcctcc 861



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 44  tcttcttcttcttcctcctcctcc 67
           ||||||||||| ||||||||||||
Sbjct: 881 tcttcttcttcctcctcctcctcc 858



to top

>emb|AL450363.12| Human DNA sequence from clone RP11-469M2 on chromosome 10, complete
             sequence
          Length = 114333

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 86307 ctcttcttcttcttcctcctcctcc 86283



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 86303 tcttcttcttcctcctcctcctcc 86280



to top

>ref|XM_785026.1| PREDICTED: Strongylocentrotus purpuratus similar to cell division
           cycle 2-like 1 (PITSLRE proteins) isoform 1 (LOC585189),
           mRNA
          Length = 2612

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 219 ctcttcttcttcttcctcctcctcc 195



to top

>emb|AL391417.7| Human DNA sequence from clone RP11-15J23 on chromosome 6 Contains a
             novel pseudogene, complete sequence
          Length = 91355

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 67315 ctcttcttcttcttcctcctcctcc 67291



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||||| |||||||
Sbjct: 67494 tcttcttcttcttccttctcctcc 67471



to top

>emb|AL355137.23| Human DNA sequence from clone RP11-511D14 on chromosome 6p23-24.3
              Contains the gene for a novel protein isentical to
              ribosomal protein L15 (RPL15), complete sequence
          Length = 190223

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 38     cccttctcttcttcttcttcctcctcctc 66
              ||||| |||||||||||||||||||||||
Sbjct: 148066 cccttttcttcttcttcttcctcctcctc 148038



to top

>emb|AL356503.18| Human DNA sequence from clone RP13-159A24 on chromosome Xq27.1-28,
             complete sequence
          Length = 147043

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 53199 ctcttcttcttcttcctcctcctcc 53175



to top

>emb|AL353093.18| Human DNA sequence from clone RP11-224P11 on chromosome 10 Contains a
             single-stranded DNA binding protein (SSBP1)(SSBP)
             pseudogene, complete sequence
          Length = 156008

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             ||||||| |||||||||||||||||||||
Sbjct: 80181 ccttctcctcttcttcttcctcctcctcc 80153



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||| ||||||||||||
Sbjct: 80174 ctcttcttcttcctcctcctcctcc 80150



to top

>gb|AC128353.6| Rattus norvegicus 13 BAC CH230-148A5 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 207556

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||| ||||||||||||||||||
Sbjct: 149193 ccttctcttcctcttcttcctcctcctcc 149221



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||| || |||||||||||||||
Sbjct: 149160 ccttctcttcctcctcttcctcctcctcc 149188



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||| || |||||||||||||||
Sbjct: 149013 ccttctcttcctcctcttcctcctcctcc 149041



to top

>gb|AC095390.9| Rattus norvegicus 12 BAC CH230-7C24 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 226532

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 132293 ctcttcttcttcttcctcctcctcc 132317



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 43   ctcttcttcttcttcctcctcctc 66
            |||||| |||||||||||||||||
Sbjct: 9096 ctcttcctcttcttcctcctcctc 9119



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 47   tcttcttcttcctcctcctc 66
            ||||||||||||||||||||
Sbjct: 5657 tcttcttcttcctcctcctc 5638



to top

>emb|AL139009.14| Human DNA sequence from clone RP5-976H8 on chromosome 10p14-15.3,
              complete sequence
          Length = 172657

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 110691 ctcttcttcttcttcctcctcctcc 110667



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 110642 tcttcttcttcttcctcctcctcc 110619



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||||||||| |||||||||
Sbjct: 110646 ctcttcttcttcttcttcctcctcc 110622



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              ||||||| ||||||||||||||||
Sbjct: 110712 ctcttctgcttcttcctcctcctc 110689



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              ||||||| ||||||||||||||||
Sbjct: 110667 ctcttctgcttcttcctcctcctc 110644



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 110639 tcttcttcttcctcctcctcctcc 110616



to top

>emb|AL138919.12| Human DNA sequence from clone RP3-492L20 on chromosome 6, complete
             sequence
          Length = 72535

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 45224 ctcttcttcttcttcctcctcctcc 45248



to top

>emb|AL133274.8| Human DNA sequence from clone RP13-94P8 on chromosome X Contains part
             of the PCDH11X gene for protocadherin 11 X-linked,
             complete sequence
          Length = 96062

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 55944 tcttcttcttcttcctcctcctccc 55920



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 56026 tcttcttcttcttcctcctcctcc 56003



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||||||||| |||||||||
Sbjct: 55948 ctcttcttcttcttcttcctcctcc 55924



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 56029 tcttcttcttcttcttcctcctcc 56006



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 56023 tcttcttcttcctcctcctcctcc 56000



to top

>emb|AL133418.4| Human DNA sequence from clone RP5-835G14 on chromosome 1q42.1-43
             Contains the 3' end of a novel gene (KIAA0117), the 3' end
             of the ARID4B gene for AT rich interactive domain 4B
             (RBP1- like), a novel gene and a CpG island, complete
             sequence
          Length = 77585

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 71610 ctcttcttcttcttcctcctcctcc 71634



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 71614 tcttcttcttcctcctcctcctcc 71637



to top

>gb|AC158565.2| Mus musculus chromosome 15, clone RP24-354O12, complete sequence
          Length = 150125

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 25514 ctcttcttcttcttcctcctcctcc 25490



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             ||||||||||||||||||||||||
Sbjct: 25454 ctcttcttcttcttcctcctcctc 25431



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 40    cttctcttcttcttcttcctcctcctc 66
             ||||||||| |||||||||||||||||
Sbjct: 71610 cttctcttcctcttcttcctcctcctc 71636



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 25577 ctctttttcttcttcctcctcctcc 25553



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 25484 ctctttttcttcttcctcctcctcc 25460



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 25334 ctctttttcttcttcctcctcctcc 25310



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||| |||||||||||||||||||
Sbjct: 25301 ctctttttcttcttcctcctcctcc 25277



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             ||||| ||||||||||||||||||
Sbjct: 25427 ctctttttcttcttcctcctcctc 25404



to top

>gb|AC159978.4| Mus musculus chromosome 15, clone RP24-173F4, complete sequence
          Length = 113570

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 110709 ctcttcttcttcttcctcctcctcc 110685



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||| ||||||||||||||||||
Sbjct: 110744 tcttcctcttcttcctcctcctcc 110721



to top

>gb|AC162857.5| Mus musculus chromosome 15, clone RP23-333C11, complete sequence
          Length = 224913

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 99117 ctcttcttcttcttcctcctcctcc 99093



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 46     ttcttcttcttcctcctcctc 66
              |||||||||||||||||||||
Sbjct: 120500 ttcttcttcttcctcctcctc 120480



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 99113 tcttcttcttcctcctcctcctcc 99090



to top

>gb|AC128768.4| Rattus norvegicus 1 BAC CH230-445L3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 156228

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||||||||| |||||||||||||||
Sbjct: 113955 ccttctcttcttcctcttcctcctcctcc 113927



to top

>ref|XM_788157.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC588475 (LOC588475), partial mRNA
          Length = 3543

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 825 ctcttcttcttcttcctcctcctcc 801



to top

>ref|XM_793630.1| PREDICTED: Strongylocentrotus purpuratus similar to PHD finger
            protein 16 (LOC594182), mRNA
          Length = 3324

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 39   ccttctcttcttcttcttcctcctcctcc 67
            ||||||||||||||||||| |||||||||
Sbjct: 1690 ccttctcttcttcttcttcttcctcctcc 1662



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||||||||||||||||
Sbjct: 1682 tcttcttcttcttcctcctcctcc 1659



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 1679 tcttcttcttcctcctcctcctcc 1656



to top

>ref|XM_794037.1| PREDICTED: Strongylocentrotus purpuratus similar to cell division
           cycle 2-like 1 (PITSLRE proteins) isoform 1 (LOC594603),
           mRNA
          Length = 1893

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 726 ctcttcttcttcttcctcctcctcc 702



to top

>gb|AC164638.4| Mus musculus BAC clone RP23-198N12 from chromosome 7, complete sequence
          Length = 242297

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||||||||| |||||||||||||||
Sbjct: 233554 ccttctcttcttcctcttcctcctcctcc 233582



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 233495 tcttcttcttcatcctcctcctcc 233518



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 233492 tcttcttcttcttcatcctcctcc 233515



to top

>gb|AC158238.2| Mus musculus BAC clone RP23-106F10 from chromosome 9, complete sequence
          Length = 242356

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 200532 ctcttcttcttcttcctcctcctcc 200508



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 200478 ctcttcttcttcttcctcctcctcc 200454



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||| |||||||| ||||||||||||
Sbjct: 200593 ccttctcctcttcttcctcctcctcctcc 200565



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 200552 tcttcttcttcctcctcctcc 200532



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||||||||| |||||||||||
Sbjct: 200553 ctcttcttcttcctcctcctcctc 200530



to top

>ref|NM_001016610.1| Xenopus tropicalis WD repeat domain 42A (wdr42a), mRNA
          Length = 2038

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 430 ctcttcttcttcttcctcctcctcc 406



to top

>ref|NM_020815.1| Homo sapiens protocadherin 10 (PCDH10), transcript variant 2, mRNA
          Length = 3935

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 386 ctcttcttcttcttcctcctcctcc 410



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 44  tcttcttcttcttcctcctcctcc 67
           ||||||||||| ||||||||||||
Sbjct: 390 tcttcttcttcctcctcctcctcc 413



to top

>ref|NM_032961.1| Homo sapiens protocadherin 10 (PCDH10), transcript variant 1, mRNA
          Length = 5384

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 386 ctcttcttcttcttcctcctcctcc 410



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 44  tcttcttcttcttcctcctcctcc 67
           ||||||||||| ||||||||||||
Sbjct: 390 tcttcttcttcctcctcctcctcc 413



to top

>emb|AL645637.18| Mouse DNA sequence from clone RP23-388B5 on chromosome 1 Contains the
             5' end of the Adam23 gene for a disintegrin and
             metalloprotease domain 23, a pleckstrin homology
             domain-containing family A (phosphoinositide binding
             specific) member 3 (Plekha3) pseudogene, a px19-like
             protein (PX19) pseudogene and a CpG island, complete
             sequence
          Length = 207629

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 38139 tcttcttcttcttcctcctcctccc 38163



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 38136 tcttcttcttcttcttcctcctcc 38159



to top

>emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chromosome 11 Contains the
              Taf15 gene for TAF15 RNA polymerase II TATA box binding
              protein (TBP)-associated factor, two novel genes, the Ccl5,
              Ccl9, Ccl6, Ccl3 and Ccl4 genes for chemokine (C-C motif)
              ligand 5, 9, 6, 3 and 4, a ribosomal protein L9 (Rpl9)
              pseudogene, three extracellular proteinase inhibitor (Expi)
              pseudogene and an H+ transporting mitochondrial F1F0
              complex ATP synthase subunit e (Atp5k) pseudogene,,
              complete sequence
          Length = 211873

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 39     ccttctcttcttcttcttcctcctc 63
              |||||||||||||||||||||||||
Sbjct: 136508 ccttctcttcttcttcttcctcctc 136484



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 39     ccttctcttcttcttcttcctcctc 63
              |||||||||||||||||||||||||
Sbjct: 136481 ccttctcttcttcttcttcctcctc 136457



to top

>emb|AL591065.17| Mouse DNA sequence from clone RP23-199H17 on chromosome 11 Contains the
              Myo18a gene for myosin XVIIIa, the Pipox gene for pipecolic
              acid oxidase, a novel gene (LOC327969), the 5' end of the
              Sez6 gene for seizure related gene 6 and two CpG islands,
              complete sequence
          Length = 220176

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 167508 ctcttcttcttcttcctcctcctcc 167484



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||| |||||||||||||||
Sbjct: 17136 ctcttcttcctcttcctcctcctcc 17160



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 167504 tcttcttcttcctcctcctcctcc 167481



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||| |||||||||||||||
Sbjct: 98561 tcttcttcctcttcctcctcctcc 98584



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||| ||||||||||||||||||
Sbjct: 98440 tcttcctcttcttcctcctcctcc 98463



to top

>emb|AJ579852.2|MMU579852 Mus musculus mRNA for L-type dihydropyridine-sensitive calcium
            channel alpha-1f subunit (Cav1.4 gene), strain C57Bl6
          Length = 5955

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2463 ctcttcttcttcttcctcctcctcc 2439



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 2459 tcttcttcttcctcctcctcctcc 2436



to top

>gb|AC156610.10| Mus musculus chromosome 7, clone RP23-331C4, complete sequence
          Length = 237129

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||||||||| |||||||||||||||
Sbjct: 150283 ccttctcttcttcatcttcctcctcctcc 150311



to top

>emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chromosome 11 Contains two
             novel genes, the AI503894 gene for expressed sequence
             AI503894, a laminin receptor 1 (ribosomal protein
             SA)(Lamr1) pseudogene and a CpG island, complete sequence
          Length = 201664

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 98675 ctcttcttcttcttcctcctcctcc 98651



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 41    ttctcttcttcttcttcctc 60
             ||||||||||||||||||||
Sbjct: 98878 ttctcttcttcttcttcctc 98859



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 98671 tcttcttcttcctcctcctcctcc 98648



to top

>emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on chromosome 11 Contains a
             pseudogene similar to part of glyceraldehyde-3-phosphate
             dehydrogenase (Gapd), the Irf1 gene for interferon
             regulatory factor 1, a novel gene, the Slc22a5 gene for
             solute carrier family 22 (organic cation transporter)
             member 5, a ribosomal protein L27a (Rpl27a) pseudogene, a
             cyclin-dependent kinase 4 (Cdk4) pseudogene and two CpG
             islands, complete sequence
          Length = 191494

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 80205 ctcttcttcttcttcctcctcctcc 80181



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 80201 tcttcttcttcctcctcctcctcc 80178



to top

>gb|AC151908.8| Mus musculus BAC clone RP23-109A22 from chromosome 8, complete sequence
          Length = 233606

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||| |||||||||||||||||||||
Sbjct: 208957 ccttctcctcttcttcttcctcctcctcc 208985



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||| ||||||||||||
Sbjct: 208964 ctcttcttcttcctcctcctcctcc 208988



to top

>emb|AL646042.14| Mouse DNA sequence from clone RP23-70A15 on chromosome 11 Contains the 5'
              end of the Ulk2 gene for Unc-51 like kinase 2 (C. elegans),
              two novel genes (A530017D24Rik, D630015H07), the Akap10
              gene for  A kinase (PRKA) anchor protein 10, the 5' end of
              the gene for a novel protein similar to human sperm antigen
              HCMOGT-1 (B230396K10Rik) and three CpG islands, complete
              sequence
          Length = 159693

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 99979  ctcttcttcttcttcctcctcctcc 100003



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 39    ccttctcttcttcttcttcctcctcctc 66
             |||||||||| |||||||||||||||||
Sbjct: 45040 ccttctcttcctcttcttcctcctcctc 45013



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     tcttcttcttcctcctcctc 66
              ||||||||||||||||||||
Sbjct: 100007 tcttcttcttcctcctcctc 100026



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 99983  tcttcttcttcctcctcctcctcc 100006



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||| |||||||||||||||||||
Sbjct: 20304 tctttttcttcttcctcctcctcc 20281



to top

>gb|AC155255.3| Mus musculus BAC clone RP24-143P3 from chromosome 12, complete sequence
          Length = 201217

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              ||||||||||||| |||||||||||||||
Sbjct: 138231 ccttctcttcttcctcttcctcctcctcc 138203



to top

>gb|AC109488.3| Homo sapiens chromosome 5 clone RP11-57H15, complete sequence
          Length = 48733

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 28684 tcttcttcttcttcctcctcctccc 28708



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 40    cttctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||| |||||||||
Sbjct: 28677 cttctcttcttcttcttcttcctcctcc 28704



to top

>gb|AC156615.7| Mus musculus chromosome 3, clone RP23-1B20, complete sequence
          Length = 210003

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||| ||||||||||||||||||||||||
Sbjct: 174772 ccttttcttcttcttcttcctcctcctcc 174744



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 194269 tcttcttcttcttcctcctcctcc 194246



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 194272 tcttcttcttcttcttcctcctcc 194249



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 194266 tcttcttcttcctcctcctcctcc 194243



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||| |||||||||||||||||
Sbjct: 194126 tcttctccttcttcctcctcctcc 194103



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 174764 tcttcttcttcctcctcctcctcc 174741



to top

>emb|AL671983.18| Mouse DNA sequence from clone RP23-232B3 on chromosome X, complete
             sequence
          Length = 176577

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 71442 ctcttcttcttcttcctcctcctcc 71418



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||||||||||||||||
Sbjct: 132618 tcttcttcttcttcctcctcctcc 132595



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 132621 tcttcttcttcttcttcctcctcc 132598



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 132615 tcttcttcttcctcctcctcctcc 132592



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 71438 tcttcttcttcctcctcctcctcc 71415



to top

>gb|AE014181.1| Mus musculus piebald deletion region section 9 of 11 of the complete
             sequence
          Length = 400029

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 86444 ctcttcttcttcttcctcctcctcc 86468



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 86421 tcttcttcttcttcctcctcctcc 86444



 Score = 48.1 bits (24), Expect = 0.025
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||||||||||
Sbjct: 86334 tcttcttcttcttcctcctcctcc 86357



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||||||||| |||||||||
Sbjct: 86417 ctcttcttcttcttcttcctcctcc 86441



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 47    tcttcttcttcctcctcctcc 67
             |||||||||||||||||||||
Sbjct: 86373 tcttcttcttcctcctcctcc 86393



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||| ||||||||||||||||||
Sbjct: 86490 tcttcctcttcttcctcctcctcc 86513



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 43    ctcttcttcttcttcctcctcctc 66
             |||||||||||| |||||||||||
Sbjct: 86372 ctcttcttcttcctcctcctcctc 86395



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 86337 tcttcttcttcctcctcctcctcc 86360



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 86331 tcttcttcttcttcttcctcctcc 86354



to top

>ref|NM_133249.1| Mus musculus peroxisome proliferative activated receptor, gamma,
            coactivator 1 beta (Ppargc1b), mRNA
          Length = 3664

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1387 ctcttcttcttcttcctcctcctcc 1363



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 1383 tcttcttcttcctcctcctcctcc 1360



to top

>dbj|AK097262.1| Homo sapiens cDNA FLJ39943 fis, clone SPLEN2023118
          Length = 2701

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 846 ctcttcttcttcttcctcctcctcc 822



to top

>dbj|AK092601.1| Homo sapiens cDNA FLJ35282 fis, clone PROST2007328
          Length = 2349

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 281 ctcttcttcttcttcctcctcctcc 257



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 38  cccttctcttcttcttcttcctcctcctcc 67
           |||||||| ||||||||||| |||||||||
Sbjct: 289 cccttctcctcttcttcttcttcctcctcc 260



to top

>gb|AC034299.8| Homo sapiens chromosome 18, clone RP11-500P9, complete sequence
          Length = 130795

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 39    ccttctcttcttcttcttcctcctcctcc 67
             |||| ||||||||||||||||||||||||
Sbjct: 93601 ccttttcttcttcttcttcctcctcctcc 93629



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 93609 tcttcttcttcctcctcctcctcc 93632



to top

>gb|AC023789.8| Mus musculus chromosome 4 clone RP23-43A16, complete sequence
          Length = 146120

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 84622 ctcttcttcttcttcctcctcctcc 84646



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||| |||||||||||||||
Sbjct: 59511 ctcttcttcctcttcctcctcctcc 59487



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 84626 tcttcttcttcctcctcctcctcc 84649



to top

>gb|AC019026.12| Mus musculus chromosome 6 clone RP23-188E5 strain C57BL6/J, complete
             sequence
          Length = 157996

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 38    cccttctcttcttcttcttcctcctcctc 66
             |||| ||||||||||||||||||||||||
Sbjct: 24107 ccctcctcttcttcttcttcctcctcctc 24135



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 24065 ctcttcttcttcttcctcctcctcc 24089



to top

>dbj|AB051897.1| Mus musculus Scya6, Scya9, Scya16-ps, Scya5 genes for small inducible
             cytokine A6 precursor, small inducible cytokine A9
             precursor, Scya16 pseudogene, small inducible cytokine A5
             precursor, complete cds
          Length = 122436

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 39    ccttctcttcttcttcttcctcctc 63
             |||||||||||||||||||||||||
Sbjct: 22371 ccttctcttcttcttcttcctcctc 22395



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 39    ccttctcttcttcttcttcctcctc 63
             |||||||||||||||||||||||||
Sbjct: 22344 ccttctcttcttcttcttcctcctc 22368



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||||||||| ||||||
Sbjct: 22280 tcttcttcttcttcctcttcctcc 22303



to top

>gb|AC164572.4| Mus musculus 6 BAC RP24-89J17 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 221464

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 44    tcttcttcttcttcctcctcctccc 68
             |||||||||||||||||||||||||
Sbjct: 48829 tcttcttcttcttcctcctcctccc 48805



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             |||||||||||||| |||||||||
Sbjct: 48832 tcttcttcttcttcttcctcctcc 48809



to top

>gb|AC112640.3| Homo sapiens 3 BAC RP11-817M15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 211335

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 181418 ctcttcttcttcttcctcctcctcc 181442



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||| ||||||
Sbjct: 181388 ctcttcttcttcttcctcttcctcc 181412



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||| |||||||||||||||
Sbjct: 181395 tcttcttcctcttcctcctcctcc 181418



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 43     ctcttcttcttcttcctcctcctc 66
              |||||||||||||||||| |||||
Sbjct: 181352 ctcttcttcttcttcctcttcctc 181375



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||| |||||||||||||||
Sbjct: 181329 tcttcttcctcttcctcctcctcc 181352



to top

>gb|AC091923.3| Homo sapiens chromosome 5 clone RP11-268H4, complete sequence
          Length = 78413

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 41    ttctcttcttcttcttcctcctcct 65
             |||||||||||||||||||||||||
Sbjct: 71864 ttctcttcttcttcttcctcctcct 71840



to top

>dbj|AK134746.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
           enriched library, clone:6330547B13 product:similar to
           Extracellular matrix protein 2 precursor (Matrix
           glycoprotein SC1/ECM2) [Homo sapiens], full insert
           sequence
          Length = 2408

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 965 ctcttcttcttcttcctcctcctcc 941



to top

>dbj|AK132894.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930502I03 product:Sperm protamine P3
           homolog [Mus musculus], full insert sequence
          Length = 409

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 215 ctcttcttcttcttcctcctcctcc 191



to top

>ref|XM_943852.1| PREDICTED: Homo sapiens similar to mariner transposase (FLJ35282),
           mRNA
          Length = 2335

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 275 ctcttcttcttcttcctcctcctcc 251



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 38  cccttctcttcttcttcttcctcctcctcc 67
           |||||||| ||||||||||| |||||||||
Sbjct: 283 cccttctcctcttcttcttcttcctcctcc 254



to top

>ref|XM_497010.2| PREDICTED: Homo sapiens similar to mariner transposase (FLJ35282),
           mRNA
          Length = 2335

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 275 ctcttcttcttcttcctcctcctcc 251



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 38  cccttctcttcttcttcttcctcctcctcc 67
           |||||||| ||||||||||| |||||||||
Sbjct: 283 cccttctcctcttcttcttcttcctcctcc 254



to top

>gb|AC099670.2| Homo sapiens chromosome 1 clone RP11-84O12, complete sequence
          Length = 171226

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 44     tcttcttcttcttcctcctcctccc 68
              |||||||||||||||||||||||||
Sbjct: 163109 tcttcttcttcttcctcctcctccc 163085



to top

>gb|AF312994.1|AF312994 Mus musculus chromosome 1 clone MML, complete sequence
          Length = 228283

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 134969 ctcttcttcttcttcctcctcctcc 134993



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||| |||||||||||||||
Sbjct: 136607 ctcttcttcctcttcctcctcctcc 136583



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||| ||||||||||||||||||
Sbjct: 148815 tcttcctcttcttcctcctcctcc 148792



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 134973 tcttcttcttcctcctcctcctcc 134996



to top

>gb|AC016670.7| Homo sapiens BAC clone RP11-11K6 from 2, complete sequence
          Length = 148415

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 61820 ctcttcttcttcttcctcctcctcc 61796



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||||||||| ||||||||||||
Sbjct: 61816 tcttcttcttcctcctcctcctcc 61793



to top

>dbj|AK163501.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length
            enriched library, clone:B230312F04 product:hypothetical
            protein, full insert sequence
          Length = 5617

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 3033 ctcttcttcttcttcctcctcctcc 3009



to top

>gb|AF453324.1|AF453324 Mus musculus PPAR gamma coactivator-1beta protein mRNA, complete cds
          Length = 3664

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1387 ctcttcttcttcttcctcctcctcc 1363



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 1383 tcttcttcttcctcctcctcctcc 1360



to top

>gb|AC160655.2| Pan troglodytes BAC clone CH251-26F13 from chromosome unknown, complete
              sequence
          Length = 197508

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 103367 ctcttcttcttcttcctcctcctcc 103343



to top

>gb|AC175205.2| Sporobolomyces roseus clone JGIBAIF-5L1, complete sequence
          Length = 36144

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 34    aaaacccttctcttcttcttcttcctcctcctc 66
             ||||||||  |||||||||||||||||||||||
Sbjct: 27962 aaaaccctattcttcttcttcttcctcctcctc 27930



to top

>gb|AF332093.1|AF332093 White spot syndrome virus, complete genome
          Length = 305107

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 44     tcttcttcttcttcctcctcctccc 68
              |||||||||||||||||||||||||
Sbjct: 263969 tcttcttcttcttcctcctcctccc 263993



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 47     tcttcttcttcctcctcctcc 67
              |||||||||||||||||||||
Sbjct: 264795 tcttcttcttcctcctcctcc 264775



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             ||||||||| |||||||||||||||
Sbjct: 18883 ctcttcttcctcttcctcctcctcc 18859



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 152164 tcttcttcttcatcctcctcctcc 152187



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              |||||||||||||| |||||||||
Sbjct: 152161 tcttcttcttcttcatcctcctcc 152184



to top

>ref|XM_678008.1| PREDICTED: Danio rerio similar to START domain containing 13 isoform
            alpha (LOC555484), partial mRNA
          Length = 3241

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 2537 ctcttcttcttcttcctcctcctcc 2513



to top

>ref|XM_679095.1| PREDICTED: Danio rerio similar to vacuolar protein sorting 13A
           isoform B (LOC556326), mRNA
          Length = 2235

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 43  ctcttcttcttcttcctcctcctcc 67
           |||||||||||||||||||||||||
Sbjct: 852 ctcttcttcttcttcctcctcctcc 828



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 44  tcttcttcttcttcctcctcctcc 67
           ||||||||||| ||||||||||||
Sbjct: 848 tcttcttcttcctcctcctcctcc 825



to top

>gb|AC157791.6| Mus musculus chromosome 3, clone RP24-176D22, complete sequence
          Length = 179897

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 43    ctcttcttcttcttcctcctcctcc 67
             |||||||||||||||||||||||||
Sbjct: 33085 ctcttcttcttcttcctcctcctcc 33061



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 44    tcttcttcttcttcctcctcctcc 67
             ||||| ||||||||||||||||||
Sbjct: 14729 tcttcctcttcttcctcctcctcc 14706



to top

>gb|AY220790.1| Homo sapiens SIN3A-associated protein 180 mRNA, complete cds
          Length = 3939

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 43   ctcttcttcttcttcctcctcctcc 67
            |||||||||||||||||||||||||
Sbjct: 1659 ctcttcttcttcttcctcctcctcc 1635



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 44   tcttcttcttcttcctcctcctcc 67
            ||||||||||| ||||||||||||
Sbjct: 1655 tcttcttcttcctcctcctcctcc 1632



to top

>gb|AC133096.3| Mus musculus BAC clone RP23-271C13 from chromosome 1, complete sequence
          Length = 195512

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||||||||||||| ||||||||||||
Sbjct: 121502 ccttctcttcttcttcctcctcctcctcc 121530



to top

>gb|AC158394.2| Mus musculus BAC clone RP23-406A1 from chromosome 14, complete sequence
          Length = 185214

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              |||||||||||||||||||||||||
Sbjct: 102154 ctcttcttcttcttcctcctcctcc 102130



 Score = 46.1 bits (23), Expect = 0.098
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 43     ctcttcttcttcttcctcctcct 65
              |||||||||||||||||||||||
Sbjct: 102100 ctcttcttcttcttcctcctcct 102078



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 44     tcttcttcttcttcctcctcct 65
              ||||||||||||||||||||||
Sbjct: 102210 tcttcttcttcttcctcctcct 102189



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 43     ctcttcttcttcttcctcctcctcc 67
              ||||||||||||||| |||||||||
Sbjct: 102214 ctcttcttcttcttcttcctcctcc 102190



to top

>gb|AC153132.4| Mus musculus BAC clone RP24-362N19 from chromosome 13, complete sequence
          Length = 178970

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||| ||||||||||||||||||||||||
Sbjct: 154724 ccttttcttcttcttcttcctcctcctcc 154752



to top

>gb|AC154751.2| Mus musculus BAC clone RP24-399L21 from chromosome 14, complete sequence
          Length = 176992

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 39     ccttctcttcttcttcttcctcctcctcc 67
              |||||| ||||||||||||||||||||||
Sbjct: 160324 ccttcttttcttcttcttcctcctcctcc 160296



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 44     tcttcttcttcttcctcctcctcc 67
              ||||||||||| ||||||||||||
Sbjct: 160316 tcttcttcttcctcctcctcctcc 160293


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,940,074
Number of Sequences: 3902068
Number of extensions: 6940074
Number of successful extensions: 862587
Number of sequences better than 10.0: 8532
Number of HSP's better than 10.0 without gapping: 8577
Number of HSP's successfully gapped in prelim test: 33
Number of HSP's that attempted gapping in prelim test: 602822
Number of HSP's gapped (non-prelim): 256798
length of query: 450
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 428
effective length of database: 17,147,199,772
effective search space: 7339001502416
effective search space used: 7339001502416
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top