ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast47a09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_476727.1| Oryza sativa (japonica cultivar-group), mRNA 369 5e-99
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 369 5e-99
3dbj|AP003842.5| Oryza sativa (japonica cultivar-group) genomic D... 369 5e-99
4dbj|AP004267.3| Oryza sativa (japonica cultivar-group) genomic D... 369 5e-99
5gb|BT018853.1| Zea mays clone EL01N0555H12.d mRNA sequence 321 1e-84
6gb|AY104657.1| Zea mays PCO103082 mRNA sequence 180 3e-42
7gb|AY089122.1| Arabidopsis thaliana clone 36005 mRNA, complete s... 101 2e-18
8ref|NM_179083.2| Arabidopsis thaliana SMB AT4G20440 (SMB) transc... 94 5e-16
9ref|NM_118163.3| Arabidopsis thaliana SMB AT4G20440 (SMB) transc... 94 5e-16
10ref|NM_001036605.1| Arabidopsis thaliana SMB AT4G20440 (SMB) tra... 94 5e-16
11emb|AL161553.2|ATCHRIV53 Arabidopsis thaliana DNA chromosome 4, ... 94 5e-16
12emb|AL080253.2|ATF9F13 Arabidopsis thaliana DNA chromosome 4, BA... 94 5e-16
13emb|BX816797.1|CNS0ABKF Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
14emb|BX827183.1|CNS0A3ND Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
15emb|BX829261.1|CNS0A3DY Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
16emb|BX828785.1|CNS0A3FA Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
17emb|BX828575.1|CNS0A3KN Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
18emb|BX841518.1|CNS09YHM Arabidopsis thaliana Full-length cDNA Co... 94 5e-16
19gb|BT004219.1| Arabidopsis thaliana clone RAFL15-21-A10 (R20778)... 94 5e-16
20emb|BX828989.1|CNS0A3FE Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
21gb|BT005057.1| Arabidopsis thaliana clone U20778 putative snRNP ... 86 1e-13
22gb|AY106878.1| Zea mays PCO069584 mRNA sequence 74 4e-10
23emb|BX827918.1|CNS0A3V1 Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
24emb|BX828590.1|CNS0A3EN Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
25gb|DQ217171.1| Taeniopygia guttata clone 0058P0033B10 small nucl... 52 0.002
26ref|NM_001036934.1| Arabidopsis thaliana unknown protein AT5G445... 50 0.006
27ref|NM_123817.2| Arabidopsis thaliana unknown protein AT5G44500 ... 50 0.006
28ref|NM_204599.1| Gallus gallus small nuclear ribonucleoprotein p... 50 0.006
29gb|AC093102.2| Drosophila melanogaster clone BACR34C10, complete... 50 0.006
30emb|BX070074.1|CNS09Q8E Single read from an extremity of a full-... 50 0.006
31emb|BX053862.1|CNS09DQ2 Single read from an extremity of a full-... 50 0.006
32emb|BX053861.1|CNS09DQ1 Single read from an extremity of a full-... 50 0.006
33emb|BX052865.1|CNS09CYD Single read from an extremity of a full-... 50 0.006
34emb|BX052864.1|CNS09CYC Single read from an extremity of a full-... 50 0.006
35emb|BX038934.1|CNS0927E Single read from an extremity of a full-... 50 0.006
36emb|BX036592.1|CNS090EC Single read from an extremity of a full-... 50 0.006
37emb|BX036591.1|CNS090EB Single read from an extremity of a full-... 50 0.006
38emb|BX035332.1|CNS08ZFC Single read from an extremity of a full-... 50 0.006
39emb|BX034912.1|CNS08Z3O Single read from an extremity of a full-... 50 0.006
40emb|BX021223.1|CNS08OJF Single read from an extremity of a full-... 50 0.006
41ref|NM_057573.3| Drosophila melanogaster Small ribonucleoprotein... 50 0.006
42gb|AY072470.1| Arabidopsis thaliana unknown protein (At5g44500; ... 50 0.006
43gb|AY061171.1| Drosophila melanogaster LD14049 full length cDNA 50 0.006
44gb|AF134830.1|AF134830 Gallus gallus small nuclear ribonucleopro... 50 0.006
45dbj|AK221574.1| Arabidopsis thaliana mRNA for hypothetical prote... 50 0.006
46emb|CR385829.1| Gallus gallus finished cDNA, clone ChEST67k15 50 0.006
47gb|AY042856.1| Arabidopsis thaliana Unknown protein (MFC16.13) m... 50 0.006
48gb|AY084467.1| Arabidopsis thaliana clone 10879 mRNA, complete s... 50 0.006
49dbj|AK176849.1| Arabidopsis thaliana mRNA, complete cds, clone: ... 50 0.006
50dbj|AK176073.1| Arabidopsis thaliana mRNA, complete cds, clone: ... 50 0.006
51dbj|AB017065.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 50 0.006
52ref|XM_315523.2| Anopheles gambiae str. PEST ENSANGP00000007148 ... 50 0.006
53gb|AC007451.1|AC007451 Drosophila melanogaster, chromosome 2L, r... 50 0.006
54gb|AE003628.2| Drosophila melanogaster chromosome 2L, section 37... 50 0.006
55gb|L02919.1|DRORNP Drosophila melanogaster ribonucleoprotein mRN... 50 0.006
56emb|BX021224.1|CNS08OJG Single read from an extremity of a full-... 48 0.025
57ref|NM_079108.2| Drosophila melanogaster benign gonial cell neop... 46 0.100
58gb|AY089246.1| Drosophila melanogaster AT03323 full insert cDNA 46 0.100
59gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, r... 46 0.100
60gb|AF255662.1|AF255662 Drosophila melanogaster benign gonial cel... 46 0.100
61gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69... 46 0.100
62dbj|AB010261.1| Drosophila melanogaster genes at 60A locus in ch... 46 0.100
63gb|AC005267.1|AC005267 Drosophila melanogaster DNA sequence (P1s... 46 0.100
64emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 44 0.39
65emb|BX070075.1|CNS09Q8F Single read from an extremity of a full-... 44 0.39
66dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 44 0.39
67gb|AE011709.1| Xanthomonas axonopodis pv. citri str. 306, secti... 44 0.39
68gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 44 0.39
69gb|DQ440505.1| Aedes aegypti clone AET-9714 U1 snRNP component m... 42 1.6
70ref|XM_969236.1| PREDICTED: Tribolium castaneum similar to Small... 42 1.6
71gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 1.6
72gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, comp... 40 6.2
73ref|XM_783552.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 6.2
74gb|CP000088.1| Thermobifida fusca YX, complete genome 40 6.2
75emb|AJ414559.1|SAE414559 Saccharothrix aerocolonigenes gene clus... 40 6.2
76gb|AF534707.1| Lechevalieria aerocolonigenes putative regulatory... 40 6.2
77gb|CP000249.1| Frankia sp. CcI3, complete genome 40 6.2
78dbj|AB090952.1| Lechevalieria aerocolonigenes rebeccamycin biosy... 40 6.2
79gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, co... 40 6.2
80gb|AC120024.22| Homo sapiens chromosome 17, clone CTD-2526A2, co... 40 6.2
81emb|AL627086.22| Mouse DNA sequence from clone RP23-477P14 on ch... 40 6.2 
>ref|XM_476727.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 786

 Score =  369 bits (186), Expect = 5e-99
 Identities = 264/290 (91%)
 Strand = Plus / Plus

                                                                       
Query: 1   tgtcgaaccccaagggttcgaaaatgctccagttcgtcaactaccggatgcgcgtgacca 60
           |||||||||| ||||| || || ||||||||||||||||||||||||||||||||||| |
Sbjct: 2   tgtcgaacccgaagggctccaagatgctccagttcgtcaactaccggatgcgcgtgacga 61

                                                                       
Query: 61  tccaggacggccgccaactcgtggggaagttcatggcctccgatcgccacatgaacctcg 120
           |||||||||| ||||| || || || ||||||||||| | ||| ||||||||||||||||
Sbjct: 62  tccaggacgggcgccagctggtcggcaagttcatggcgttcgaccgccacatgaacctcg 121

                                                                       
Query: 121 tcctcggcgactgcgaggagttccacaagctcccgccctcaaaatcttccaagaccacag 180
           |||||||||||||||||||||||| ||||||||||||||| || || ||||||||||| |
Sbjct: 122 tcctcggcgactgcgaggagttccgcaagctcccgccctccaagtcctccaagaccaccg 181

                                                                       
Query: 181 gcgagcgcgaggagcggaggacgctcggcctgctccttctccgtggcgaggaggtcgtct 240
           ||||||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||
Sbjct: 182 gcgagcgcgaggagcggaggacgctgggcctcctgctgctccgcggcgaggaggtcgtct 241

                                                             
Query: 241 ccatgaccgtcgagggcccgcccccgcccgatgagtcccgggccaaggcc 290
           |||||||||||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 242 ccatgaccgtcgagggcccgccaccgcccgacgagtcccgcgccaaggcc 291



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                       
Query: 364 tgctccaggcgcagcccggtctctctggccctgttcggngtgtaggcggtccggctcctg 423
           |||||||||| ||||| || ||| | ||||| || ||  | || ||||| ||||| || |
Sbjct: 365 tgctccaggcccagccagggctcgccggcccggtgcgtggcgtgggcgggccggcccccg 424

                                    
Query: 424 gcatgatgcagccgcagatctcgcg 448
           |||||||||||||||||||||||||
Sbjct: 425 gcatgatgcagccgcagatctcgcg 449
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
               sequence
          Length = 29644043

 Score =  369 bits (186), Expect = 5e-99
 Identities = 264/290 (91%)
 Strand = Plus / Plus

                                                                           
Query: 1       tgtcgaaccccaagggttcgaaaatgctccagttcgtcaactaccggatgcgcgtgacca 60
               |||||||||| ||||| || || ||||||||||||||||||||||||||||||||||| |
Sbjct: 3606664 tgtcgaacccgaagggctccaagatgctccagttcgtcaactaccggatgcgcgtgacga 3606723

                                                                           
Query: 61      tccaggacggccgccaactcgtggggaagttcatggcctccgatcgccacatgaacctcg 120
               |||||||||| ||||| || || || ||||||||||| | ||| ||||||||||||||||
Sbjct: 3606724 tccaggacgggcgccagctggtcggcaagttcatggcgttcgaccgccacatgaacctcg 3606783

                                                                           
Query: 121     tcctcggcgactgcgaggagttccacaagctcccgccctcaaaatcttccaagaccacag 180
               |||||||||||||||||||||||| ||||||||||||||| || || ||||||||||| |
Sbjct: 3606784 tcctcggcgactgcgaggagttccgcaagctcccgccctccaagtcctccaagaccaccg 3606843

                                                                           
Query: 181     gcgagcgcgaggagcggaggacgctcggcctgctccttctccgtggcgaggaggtcgtct 240
               ||||||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||
Sbjct: 3606844 gcgagcgcgaggagcggaggacgctgggcctcctgctgctccgcggcgaggaggtcgtct 3606903

                                                                 
Query: 241     ccatgaccgtcgagggcccgcccccgcccgatgagtcccgggccaaggcc 290
               |||||||||||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 3606904 ccatgaccgtcgagggcccgccaccgcccgacgagtcccgcgccaaggcc 3606953



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                           
Query: 364     tgctccaggcgcagcccggtctctctggccctgttcggngtgtaggcggtccggctcctg 423
               |||||||||| ||||| || ||| | ||||| || ||  | || ||||| ||||| || |
Sbjct: 3607027 tgctccaggcccagccagggctcgccggcccggtgcgtggcgtgggcgggccggcccccg 3607086

                                        
Query: 424     gcatgatgcagccgcagatctcgcg 448
               |||||||||||||||||||||||||
Sbjct: 3607087 gcatgatgcagccgcagatctcgcg 3607111
to top
>dbj|AP003842.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1641_C04
          Length = 134367

 Score =  369 bits (186), Expect = 5e-99
 Identities = 264/290 (91%)
 Strand = Plus / Plus

                                                                         
Query: 1     tgtcgaaccccaagggttcgaaaatgctccagttcgtcaactaccggatgcgcgtgacca 60
             |||||||||| ||||| || || ||||||||||||||||||||||||||||||||||| |
Sbjct: 75981 tgtcgaacccgaagggctccaagatgctccagttcgtcaactaccggatgcgcgtgacga 76040

                                                                         
Query: 61    tccaggacggccgccaactcgtggggaagttcatggcctccgatcgccacatgaacctcg 120
             |||||||||| ||||| || || || ||||||||||| | ||| ||||||||||||||||
Sbjct: 76041 tccaggacgggcgccagctggtcggcaagttcatggcgttcgaccgccacatgaacctcg 76100

                                                                         
Query: 121   tcctcggcgactgcgaggagttccacaagctcccgccctcaaaatcttccaagaccacag 180
             |||||||||||||||||||||||| ||||||||||||||| || || ||||||||||| |
Sbjct: 76101 tcctcggcgactgcgaggagttccgcaagctcccgccctccaagtcctccaagaccaccg 76160

                                                                         
Query: 181   gcgagcgcgaggagcggaggacgctcggcctgctccttctccgtggcgaggaggtcgtct 240
             ||||||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||
Sbjct: 76161 gcgagcgcgaggagcggaggacgctgggcctcctgctgctccgcggcgaggaggtcgtct 76220

                                                               
Query: 241   ccatgaccgtcgagggcccgcccccgcccgatgagtcccgggccaaggcc 290
             |||||||||||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 76221 ccatgaccgtcgagggcccgccaccgcccgacgagtcccgcgccaaggcc 76270



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                         
Query: 364   tgctccaggcgcagcccggtctctctggccctgttcggngtgtaggcggtccggctcctg 423
             |||||||||| ||||| || ||| | ||||| || ||  | || ||||| ||||| || |
Sbjct: 76344 tgctccaggcccagccagggctcgccggcccggtgcgtggcgtgggcgggccggcccccg 76403

                                      
Query: 424   gcatgatgcagccgcagatctcgcg 448
             |||||||||||||||||||||||||
Sbjct: 76404 gcatgatgcagccgcagatctcgcg 76428
to top
>dbj|AP004267.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0039H02
          Length = 169162

 Score =  369 bits (186), Expect = 5e-99
 Identities = 264/290 (91%)
 Strand = Plus / Plus

                                                                          
Query: 1      tgtcgaaccccaagggttcgaaaatgctccagttcgtcaactaccggatgcgcgtgacca 60
              |||||||||| ||||| || || ||||||||||||||||||||||||||||||||||| |
Sbjct: 144614 tgtcgaacccgaagggctccaagatgctccagttcgtcaactaccggatgcgcgtgacga 144673

                                                                          
Query: 61     tccaggacggccgccaactcgtggggaagttcatggcctccgatcgccacatgaacctcg 120
              |||||||||| ||||| || || || ||||||||||| | ||| ||||||||||||||||
Sbjct: 144674 tccaggacgggcgccagctggtcggcaagttcatggcgttcgaccgccacatgaacctcg 144733

                                                                          
Query: 121    tcctcggcgactgcgaggagttccacaagctcccgccctcaaaatcttccaagaccacag 180
              |||||||||||||||||||||||| ||||||||||||||| || || ||||||||||| |
Sbjct: 144734 tcctcggcgactgcgaggagttccgcaagctcccgccctccaagtcctccaagaccaccg 144793

                                                                          
Query: 181    gcgagcgcgaggagcggaggacgctcggcctgctccttctccgtggcgaggaggtcgtct 240
              ||||||||||||||||||||||||| ||||| || || ||||| ||||||||||||||||
Sbjct: 144794 gcgagcgcgaggagcggaggacgctgggcctcctgctgctccgcggcgaggaggtcgtct 144853

                                                                
Query: 241    ccatgaccgtcgagggcccgcccccgcccgatgagtcccgggccaaggcc 290
              |||||||||||||||||||||| |||||||| |||||||| |||||||||
Sbjct: 144854 ccatgaccgtcgagggcccgccaccgcccgacgagtcccgcgccaaggcc 144903



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                          
Query: 364    tgctccaggcgcagcccggtctctctggccctgttcggngtgtaggcggtccggctcctg 423
              |||||||||| ||||| || ||| | ||||| || ||  | || ||||| ||||| || |
Sbjct: 144977 tgctccaggcccagccagggctcgccggcccggtgcgtggcgtgggcgggccggcccccg 145036

                                       
Query: 424    gcatgatgcagccgcagatctcgcg 448
              |||||||||||||||||||||||||
Sbjct: 145037 gcatgatgcagccgcagatctcgcg 145061
to top
>gb|BT018853.1| Zea mays clone EL01N0555H12.d mRNA sequence
          Length = 1287

 Score =  321 bits (162), Expect = 1e-84
 Identities = 318/370 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   tgtcgaaccccaagggttcgaaaatgctccagttcgtcaactaccggatgcgcgtgacca 60
           |||||||||| ||||| || || |||||||||||| |||||||||| ||||| ||||| |
Sbjct: 127 tgtcgaacccgaagggctccaagatgctccagttcatcaactaccgcatgcgggtgacga 186

                                                                       
Query: 61  tccaggacggccgccaactcgtggggaagttcatggcctccgatcgccacatgaacctcg 120
           |||||||||| ||||| |||||||| ||| ||||||| | ||| ||||||||||||||||
Sbjct: 187 tccaggacggtcgccagctcgtgggcaaggtcatggcgttcgaccgccacatgaacctcg 246

                                                                       
Query: 121 tcctcggcgactgcgaggagttccacaagctcccgccctcaaaatcttccaagaccacag 180
           |||||||||||||||||||||||| |   ||||||||||| || || |||||| |||| |
Sbjct: 247 tcctcggcgactgcgaggagttccgccgcctcccgccctccaagtcctccaaggccaccg 306

                                                                       
Query: 181 gcgagcgcgaggagcggaggacgctcggcctgctccttctccgtggcgaggaggtcgtct 240
           |||| |||||||||||  | ||||||||||| ||||| ||||| ||||||||||||||||
Sbjct: 307 gcgaacgcgaggagcgccgcacgctcggcctcctcctgctccgcggcgaggaggtcgtct 366

                                                                       
Query: 241 ccatgaccgtcgagggcccgcccccgcccgatgagtcccgggccaaggcctccgctggcg 300
           |||||||||||||||||||||| |||||||| ||||| || ||||||||| | || |  |
Sbjct: 367 ccatgaccgtcgagggcccgccgccgcccgacgagtcgcgcgccaaggccgcggcggcgg 426

                                                                       
Query: 301 gtggcgccctttccggcactggcgttggtcgcgctgccggccgtggggtggccaccggcc 360
           | || |||||  ||||| ||||||| || ||||| || || || |||||| |||||||||
Sbjct: 427 gcggagccctcgccggccctggcgtgggccgcgccgctgggcgcggggtgcccaccggcc 486

                     
Query: 361 cgctgctcca 370
           ||||||||||
Sbjct: 487 cgctgctcca 496
to top
>gb|AY104657.1| Zea mays PCO103082 mRNA sequence
          Length = 312

 Score =  180 bits (91), Expect = 3e-42
 Identities = 190/223 (85%)
 Strand = Plus / Plus

                                                                       
Query: 1   tgtcgaaccccaagggttcgaaaatgctccagttcgtcaactaccggatgcgcgtgacca 60
           |||||||||| ||||| || || |||||||||||| |||||||||| ||||| ||||| |
Sbjct: 90  tgtcgaacccgaagggctccaagatgctccagttcatcaactaccgcatgcgggtgacga 149

                                                                       
Query: 61  tccaggacggccgccaactcgtggggaagttcatggcctccgatcgccacatgaacctcg 120
           |||||||||| |||||||| ||||| ||||||||||| | ||| ||||||||||||||||
Sbjct: 150 tccaggacgggcgccaacttgtgggcaagttcatggcgttcgaccgccacatgaacctcg 209

                                                                       
Query: 121 tcctcggcgactgcgaggagttccacaagctcccgccctcaaaatcttccaagaccacag 180
           |||||||||| ||||||||||| | |   ||||||||||| |  || |||||||| || |
Sbjct: 210 tcctcggcgattgcgaggagtttcgccgcctcccgccctccaggtcctccaagactaccg 269

                                                      
Query: 181 gcgagcgcgaggagcggaggacgctcggcctgctccttctccg 223
           | || |||||||||||  | ||||||||||| ||||| |||||
Sbjct: 270 gtgaacgcgaggagcgccgcacgctcggcctcctcctcctccg 312
to top
>gb|AY089122.1| Arabidopsis thaliana clone 36005 mRNA, complete sequence
          Length = 1164

 Score =  101 bits (51), Expect = 2e-18
 Identities = 108/127 (85%)
 Strand = Plus / Plus

                                                                       
Query: 16  gttcgaaaatgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgcc 75
           |||| |||||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | |
Sbjct: 154 gttcaaaaatgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagac 213

                                                                       
Query: 76  aactcgtggggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcg 135
           | ||||| |||||||||||||| |  || || |||||||||||||| |||||||| ||||
Sbjct: 214 agctcgttgggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcg 273

                  
Query: 136 aggagtt 142
           |||||||
Sbjct: 274 aggagtt 280



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 520 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 579

                
Query: 447 cgtcc 451
           |||||
Sbjct: 580 cgtcc 584
to top
>ref|NM_179083.2| Arabidopsis thaliana SMB AT4G20440 (SMB) transcript variant
           AT4G20440.2 mRNA, complete cds
          Length = 1109

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 157 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 216

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 217 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 275



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 517 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 576

                
Query: 447 cgtcc 451
           |||||
Sbjct: 577 cgtcc 581
to top
>ref|NM_118163.3| Arabidopsis thaliana SMB AT4G20440 (SMB) transcript variant
           AT4G20440.1 mRNA, complete cds
          Length = 1611

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 161 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 220

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 221 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 279



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 521 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 580

                
Query: 447 cgtcc 451
           |||||
Sbjct: 581 cgtcc 585
to top
>ref|NM_001036605.1| Arabidopsis thaliana SMB AT4G20440 (SMB) transcript variant
           AT4G20440.3 mRNA, complete cds
          Length = 1476

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 164 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 223

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 224 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 282



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 524 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 583

                
Query: 447 cgtcc 451
           |||||
Sbjct: 584 cgtcc 588
to top
>emb|AL161553.2|ATCHRIV53 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 53
          Length = 197568

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                         
Query: 24    atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
             ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 27737 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 27678

                                                                        
Query: 84    gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
             |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 27677 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 27619



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 387   tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
             ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 27377 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 27318

                  
Query: 447   cgtcc 451
             |||||
Sbjct: 27317 cgtcc 27313
to top
>emb|AL080253.2|ATF9F13 Arabidopsis thaliana DNA chromosome 4, BAC clone F9F13 (ESSA project)
          Length = 109936

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                         
Query: 24    atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
             ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 42190 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 42131

                                                                        
Query: 84    gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
             |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 42130 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 42072



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 387   tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
             ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 41830 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 41771

                  
Query: 447   cgtcc 451
             |||||
Sbjct: 41770 cgtcc 41766
to top
>emb|BX816797.1|CNS0ABKF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH69ZC10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1295

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 911 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 852

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 851 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 793



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 551 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 492

                
Query: 447 cgtcc 451
           |||||
Sbjct: 491 cgtcc 487
to top
>emb|BX827183.1|CNS0A3ND Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS1ZH04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1174

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 144 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 203

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 204 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 262



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 504 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 563

                
Query: 447 cgtcc 451
           |||||
Sbjct: 564 cgtcc 568
to top
>emb|BX829261.1|CNS0A3DY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL84ZH08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1107

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 133 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 192

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 193 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 251



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 49/59 (83%)
 Strand = Plus / Plus

                                                                      
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctc 445
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| ||||||||
Sbjct: 493 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctc 551
to top
>emb|BX828785.1|CNS0A3FA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL38ZE06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1147

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 132 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 191

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 192 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 250



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 492 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 551

                
Query: 447 cgtcc 451
           |||||
Sbjct: 552 cgtcc 556
to top
>emb|BX828575.1|CNS0A3KN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL18ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1111

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 145 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 204

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 205 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 263



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 505 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 564

                
Query: 447 cgtcc 451
           |||||
Sbjct: 565 cgtcc 569
to top
>emb|BX841518.1|CNS09YHM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB69ZG03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1142

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 133 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 192

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 193 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 251



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 493 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 552

                
Query: 447 cgtcc 451
           |||||
Sbjct: 553 cgtcc 557
to top
>gb|BT004219.1| Arabidopsis thaliana clone RAFL15-21-A10 (R20778) putative snRNP
           protein (At4g20440) mRNA, complete cds
          Length = 1125

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 157 atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 216

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 217 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 275



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 517 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 576

                
Query: 447 cgtcc 451
           |||||
Sbjct: 577 cgtcc 581
to top
>emb|BX828989.1|CNS0A3FE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL57ZG12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1104

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| || || ||||| |||||  | || ||||| 
Sbjct: 92  atgcttcagttcatcaactacaggatgcgagttacgatccaagacggaagacagctcgtt 151

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| |||||||||||
Sbjct: 152 gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgcgaggagtt 210



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 452 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 511

                
Query: 447 cgtcc 451
           |||||
Sbjct: 512 cgtcc 516
to top
>gb|BT005057.1| Arabidopsis thaliana clone U20778 putative snRNP protein
           (At4g20440) mRNA, complete cds
          Length = 805

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||||| |||||||| ||||||| ||||| ||||| |||||  | || ||||| 
Sbjct: 25  atgcttcagttcatcaactacaggatgcgagtgacgatccaagacggaagacagctcgtt 84

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || || |||||||||||||| |||||||| || ||||||||
Sbjct: 85  gggaagttcatggcgtttgaccgtcacatgaacctcgttctcggcgattgtgaggagtt 143



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 387 tctggccctgttcggngtgtaggcggtccggctcctggcatgatgcagccgcagatctcg 446
           ||||| ||||||||  |||| || || || ||||| || ||||||||||| |||||||| 
Sbjct: 385 tctggtcctgttcgtggtgttggtggacctgctccgggaatgatgcagcctcagatctct 444

                
Query: 447 cgtcc 451
           |||||
Sbjct: 445 cgtcc 449
to top
>gb|AY106878.1| Zea mays PCO069584 mRNA sequence
          Length = 718

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 111/136 (81%)
 Strand = Plus / Plus

                                                                       
Query: 313 ccggcactggcgttggtcgcgctgccggccgtggggtggccaccggcccgctgctccagg 372
           ||||| ||||||| || ||||| || || || || ||| |||||||||||||||||||||
Sbjct: 25  ccggccctggcgtcggccgcgccgctgggcgcggcgtgcccaccggcccgctgctccagg 84

                                                                       
Query: 373 cgcagcccggtctctctggccctgttcggngtgtaggcggtccggctcctggcatgatgc 432
           |    || |||||  |||||||||| ||| | || || || || || |||||||||||||
Sbjct: 85  cagctcctggtcttgctggccctgtgcggggcgtgggtggacccgcccctggcatgatgc 144

                           
Query: 433 agccgcagatctcgcg 448
           |||| |||||||||||
Sbjct: 145 agccccagatctcgcg 160
to top
>emb|BX827918.1|CNS0A3V1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1595

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||||||||| |  || ||  ||||||||||||| |||||||| |||||||||||
Sbjct: 204 gggaagttcatggcgtttgaccgtgacatgaacctcgttctcggcgattgcgaggagtt 262
to top
>emb|BX828590.1|CNS0A3EN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZA05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 981

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 93/115 (80%)
 Strand = Plus / Plus

                                                                       
Query: 24  atgctccagttcgtcaactaccggatgcgcgtgaccatccaggacggccgccaactcgtg 83
           ||||| |||| | |||||||| ||||||| ||||| ||||| |||||  |  | ||||| 
Sbjct: 133 atgcttcagtgcatcaactacaggatgcgagtgacgatccaagacggaagagagctcgtt 192

                                                                  
Query: 84  gggaagttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgagg 138
           |||||||||||||| |  || ||  |||||| |||||| |||||||| |||||||
Sbjct: 193 gggaagttcatggcgtttgagcgtgacatgagcctcgttctcggcgattgcgagg 247
to top
>gb|DQ217171.1| Taeniopygia guttata clone 0058P0033B10 small nuclear
           ribonucleoprotein polypeptide B variant 1-like mRNA,
           complete sequence
          Length = 980

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttccacaag 149
           |||||||||||| ||||| |||||||||| ||||||| ||||
Sbjct: 208 cacatgaacctcatcctctgcgactgcgacgagttccgcaag 249
to top
>ref|NM_001036934.1| Arabidopsis thaliana unknown protein AT5G44500 transcript variant
           AT5G44500.2 mRNA, complete cds
          Length = 991

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 143 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 195



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 470 gctcctggaatgatgcagcctcagatctc 498
to top
>ref|NM_123817.2| Arabidopsis thaliana unknown protein AT5G44500 transcript variant
           AT5G44500.1 mRNA, complete cds
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 143 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 195



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 470 gctcctggaatgatgcagcctcagatctc 498
to top
>ref|NM_204599.1| Gallus gallus small nuclear ribonucleoprotein polypeptides B and B1
           (SNRPB), mRNA
          Length = 951

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| ||||| |||||||||| |||||||
Sbjct: 188 cacatgaacctcatcctctgcgactgcgacgagttcc 224
to top
>gb|AC093102.2| Drosophila melanogaster clone BACR34C10, complete sequence
          Length = 179428

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 108    cacatgaacctcgtcctcggcgactgcgaggagttcc 144
              ||||||||| |  ||||||||||||||||||||||||
Sbjct: 163244 cacatgaacttgatcctcggcgactgcgaggagttcc 163280
to top
>emb|BX070074.1|CNS09Q8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 258 cacatgaacctcatcctgggggactgcgaggagttcc 294
to top
>emb|BX053862.1|CNS09DQ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 734 cacatgaacctcatcctgggggactgcgaggagttcc 698
to top
>emb|BX053861.1|CNS09DQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 281 cacatgaacctcatcctgggggactgcgaggagttcc 317
to top
>emb|BX052865.1|CNS09CYD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 714 cacatgaacctcatcctgggggactgcgaggagttcc 678
to top
>emb|BX052864.1|CNS09CYC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 265 cacatgaacctcatcctgggggactgcgaggagttcc 301
to top
>emb|BX038934.1|CNS0927E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 274 cacatgaacctcatcctgggggactgcgaggagttcc 310
to top
>emb|BX036592.1|CNS090EC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 703 cacatgaacctcatcctgggggactgcgaggagttcc 667
to top
>emb|BX036591.1|CNS090EB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 253 cacatgaacctcatcctgggggactgcgaggagttcc 289
to top
>emb|BX035332.1|CNS08ZFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 256 cacatgaacctcatcctgggggactgcgaggagttcc 292
to top
>emb|BX034912.1|CNS08Z3O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 259 cacatgaacctcatcctgggggactgcgaggagttcc 295
to top
>emb|BX021223.1|CNS08OJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 849

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 219 cacatgaacctcatcctgggggactgcgaggagttcc 255
to top
>ref|NM_057573.3| Drosophila melanogaster Small ribonucleoprotein particle protein B
           CG5352-RA (SmB), mRNA
          Length = 940

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 404 cacatgaacttgatcctcggcgactgcgaggagttcc 440
to top
>gb|AY072470.1| Arabidopsis thaliana unknown protein (At5g44500; MFC16.18) mRNA,
           complete cds
          Length = 809

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 91  ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 143



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 418 gctcctggaatgatgcagcctcagatctc 446
to top
>gb|AY061171.1| Drosophila melanogaster LD14049 full length cDNA
          Length = 959

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 404 cacatgaacttgatcctcggcgactgcgaggagttcc 440
to top
>gb|AF134830.1|AF134830 Gallus gallus small nuclear ribonucleoprotein B' (SNRPB') mRNA,
           complete cds
          Length = 951

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| ||||| |||||||||| |||||||
Sbjct: 188 cacatgaacctcatcctctgcgactgcgacgagttcc 224
to top
>dbj|AK221574.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL07-82-D21
          Length = 1014

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 155 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 207



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 482 gctcctggaatgatgcagcctcagatctc 510
to top
>emb|CR385829.1| Gallus gallus finished cDNA, clone ChEST67k15
          Length = 924

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| ||||| |||||||||| |||||||
Sbjct: 168 cacatgaacctcatcctctgcgactgcgacgagttcc 204
to top
>gb|AY042856.1| Arabidopsis thaliana Unknown protein (MFC16.13) mRNA, complete cds
          Length = 1090

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 140 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 192



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 467 gctcctggaatgatgcagcctcagatctc 495
to top
>gb|AY084467.1| Arabidopsis thaliana clone 10879 mRNA, complete sequence
          Length = 1049

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 144 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 196



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 471 gctcctggaatgatgcagcctcagatctc 499
to top
>dbj|AK176849.1| Arabidopsis thaliana mRNA, complete cds, clone: RAFL25-40-O12
          Length = 1139

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 140 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 192



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 467 gctcctggaatgatgcagcctcagatctc 495
to top
>dbj|AK176073.1| Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-82-D18
          Length = 1105

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 90  ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
           |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 143 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 195



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 417 gctcctggcatgatgcagccgcagatctc 445
           |||||||| ||||||||||| ||||||||
Sbjct: 470 gctcctggaatgatgcagcctcagatctc 498
to top
>dbj|AB017065.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFC16
          Length = 61290

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 90    ttcatggcctccgatcgccacatgaacctcgtcctcggcgactgcgaggagtt 142
             |||||||| | ||||||||||||||| || || || ||||||||||| |||||
Sbjct: 41040 ttcatggcgttcgatcgccacatgaatcttgttcttggcgactgcgaagagtt 41092



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 417   gctcctggcatgatgcagccgcagatctc 445
             |||||||| ||||||||||| ||||||||
Sbjct: 41367 gctcctggaatgatgcagcctcagatctc 41395
to top
>ref|XM_315523.2| Anopheles gambiae str. PEST ENSANGP00000007148
           (ENSANGG00000005384), partial mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||| |||| || ||||||||||||||||
Sbjct: 109 cacatgaacctcatcctgggggactgcgaggagttcc 145
to top
>gb|AC007451.1|AC007451 Drosophila melanogaster, chromosome 2L, region 31D1-31F4, BAC clones
             DS00953 and BACR48K04, complete sequence
          Length = 161754

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 108   cacatgaacctcgtcctcggcgactgcgaggagttcc 144
             ||||||||| |  ||||||||||||||||||||||||
Sbjct: 85866 cacatgaacttgatcctcggcgactgcgaggagttcc 85830
to top
>gb|AE003628.2| Drosophila melanogaster chromosome 2L, section 37 of 83 of the complete
              sequence
          Length = 269102

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                   
Query: 108    cacatgaacctcgtcctcggcgactgcgaggagttcc 144
              ||||||||| |  ||||||||||||||||||||||||
Sbjct: 188134 cacatgaacttgatcctcggcgactgcgaggagttcc 188098
to top
>gb|L02919.1|DRORNP Drosophila melanogaster ribonucleoprotein mRNA, complete cds
          Length = 704

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           ||||||||| |  ||||||||||||||||||||||||
Sbjct: 172 cacatgaacttgatcctcggcgactgcgaggagttcc 208
to top
>emb|BX021224.1|CNS08OJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 729

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 109 acatgaacctcgtcctcggcgactgcgaggagttcc 144
           ||||||||||| |||| || ||||||||||||||||
Sbjct: 620 acatgaacctcatcctgggggactgcgaggagttcc 585
to top
>ref|NM_079108.2| Drosophila melanogaster benign gonial cell neoplasm CG30170-RA
            (bgcn), mRNA
          Length = 4021

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 125  cggcgactgcgaggagttccaca 147
            |||||||||||||||||||||||
Sbjct: 3383 cggcgactgcgaggagttccaca 3405
to top
>gb|AY089246.1| Drosophila melanogaster AT03323 full insert cDNA
          Length = 2411

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 125  cggcgactgcgaggagttccaca 147
            |||||||||||||||||||||||
Sbjct: 1747 cggcgactgcgaggagttccaca 1769
to top
>gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, region 60A2-60A3, BAC clone
             BACR05F24, complete sequence
          Length = 147086

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 125   cggcgactgcgaggagttccaca 147
             |||||||||||||||||||||||
Sbjct: 78675 cggcgactgcgaggagttccaca 78653
to top
>gb|AF255662.1|AF255662 Drosophila melanogaster benign gonial cell neoplasm protein mRNA,
            complete cds
          Length = 4021

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 125  cggcgactgcgaggagttccaca 147
            |||||||||||||||||||||||
Sbjct: 3383 cggcgactgcgaggagttccaca 3405
to top
>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete
              sequence
          Length = 598988

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 125    cggcgactgcgaggagttccaca 147
              |||||||||||||||||||||||
Sbjct: 375160 cggcgactgcgaggagttccaca 375138
to top
>dbj|AB010261.1| Drosophila melanogaster genes at 60A locus in chromosome 2R
          Length = 33480

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 125   cggcgactgcgaggagttccaca 147
             |||||||||||||||||||||||
Sbjct: 32633 cggcgactgcgaggagttccaca 32655
to top
>gb|AC005267.1|AC005267 Drosophila melanogaster DNA sequence (P1s DS03050 (D194) and DS06185
            (D246)), complete sequence
          Length = 98645

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 125  cggcgactgcgaggagttccaca 147
            |||||||||||||||||||||||
Sbjct: 7359 cggcgactgcgaggagttccaca 7337
to top
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 319    ctggcgttggtcgcgctgccgg 340
              ||||||||||||||||||||||
Sbjct: 949677 ctggcgttggtcgcgctgccgg 949698
to top
>emb|BX070075.1|CNS09Q8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 111 atgaacctcgtcctcggcgactgcgaggagttcc 144
           ||||||||| |||| || ||||||||||||||||
Sbjct: 724 atgaacctcatcctgggggactgcgaggagttcc 691
to top
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 319     ctggcgttggtcgcgctgccgg 340
               ||||||||||||||||||||||
Sbjct: 4075055 ctggcgttggtcgcgctgccgg 4075034
to top
>gb|AE011709.1| Xanthomonas axonopodis pv. citri str. 306,  section 87 of 469 of
           the complete genome
          Length = 10667

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 319 ctggcgttggtcgcgctgccgg 340
           ||||||||||||||||||||||
Sbjct: 123 ctggcgttggtcgcgctgccgg 144
to top
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 319     ctggcgttggtcgcgctgccgg 340
               ||||||||||||||||||||||
Sbjct: 4078992 ctggcgttggtcgcgctgccgg 4078971
to top
>gb|DQ440505.1| Aedes aegypti clone AET-9714 U1 snRNP component mRNA, complete cds
          Length = 618

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           |||||||||||  |||| || ||||||||||||||||
Sbjct: 109 cacatgaacctaatcctgggggactgcgaggagttcc 145
to top
>ref|XM_969236.1| PREDICTED: Tribolium castaneum similar to Small nuclear
           ribonucleoprotein associated protein B (snRNP-B) (Sm
           protein B) (Sm-B) (SmB) (LOC663178), mRNA
          Length = 699

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttcc 144
           ||||||||| |  ||||||||||||||||||| ||||
Sbjct: 103 cacatgaacatgatcctcggcgactgcgaggaattcc 139
to top
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 123     ctcggcgactgcgaggagttc 143
               |||||||||||||||||||||
Sbjct: 2915633 ctcggcgactgcgaggagttc 2915613
to top
>gb|AC110508.8| Mus musculus chromosome 3, clone RP23-382L1, complete sequence
          Length = 224790

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 143    ccacaagctcccgccctcaaaatc 166
              |||||||||||| |||||||||||
Sbjct: 119844 ccacaagctccctccctcaaaatc 119867
to top
>ref|XM_783552.1| PREDICTED: Strongylocentrotus purpuratus similar to Small nuclear
           ribonucleoprotein associated protein B (snRNP-B) (Sm
           protein B) (Sm-B) (SmB) (LOC583650), mRNA
          Length = 1260

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                               
Query: 108 cacatgaacctcgtcctcggcgactgcgaggagttc 143
           ||||||||| |||| || || |||||||||||||||
Sbjct: 121 cacatgaacatcgttctgggtgactgcgaggagttc 156
to top
>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 313    ccggcactggcgttggtcgc 332
              ||||||||||||||||||||
Sbjct: 345064 ccggcactggcgttggtcgc 345083
to top
>emb|AJ414559.1|SAE414559 Saccharothrix aerocolonigenes gene cluster for rebeccamycin
            biosynthesis
          Length = 25681

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 220  tccgtggcgaggaggtcgtc 239
            ||||||||||||||||||||
Sbjct: 6690 tccgtggcgaggaggtcgtc 6709
to top
>gb|AF534707.1| Lechevalieria aerocolonigenes putative regulatory protein, putative
             antibiotic antiporter (rbmK), tryptophan halogenase
             (rbmJ), putative transporter (rbmI), flavin dependent
             oxidoreductase (rbmH), putative regulatory protein (rbmG),
             methyltransferase (rbmF), cytochrome P450 enzyme (rbmE),
             putative polyketide hydroxylase (rbmD), VioB (rbmC),
             putative L-tryptophan oxidase (rbmB), putative
             glycosyltransferase (rbmA), hypothetical protein, putative
             esterase, and putative dipeptidase genes, complete cds;
             and unknown gene
          Length = 28654

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 220   tccgtggcgaggaggtcgtc 239
             ||||||||||||||||||||
Sbjct: 20721 tccgtggcgaggaggtcgtc 20702
to top
>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     ctccagttcgtcaactaccg 46
              ||||||||||||||||||||
Sbjct: 650064 ctccagttcgtcaactaccg 650045
to top
>dbj|AB090952.1| Lechevalieria aerocolonigenes rebeccamycin biosynthetic gene cluster,
            complete cds
          Length = 26144

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 220  tccgtggcgaggaggtcgtc 239
            ||||||||||||||||||||
Sbjct: 6810 tccgtggcgaggaggtcgtc 6829
to top
>gb|AC109327.10| Homo sapiens chromosome 17, clone RP11-93C20, complete sequence
          Length = 113000

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     gaaccccaagggttcgaaaa 24
             ||||||||||||||||||||
Sbjct: 84079 gaaccccaagggttcgaaaa 84098
to top
>gb|AC120024.22| Homo sapiens chromosome 17, clone CTD-2526A2, complete sequence
          Length = 136002

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 5     gaaccccaagggttcgaaaa 24
             ||||||||||||||||||||
Sbjct: 14505 gaaccccaagggttcgaaaa 14524
to top
>emb|AL627086.22| Mouse DNA sequence from clone RP23-477P14 on chromosome 3, complete
             sequence
          Length = 106019

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 143   ccacaagctcccgccctcaaaatc 166
             |||||||||||| |||||||||||
Sbjct: 82172 ccacaagctccctccctcaaaatc 82195


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,448,938
Number of Sequences: 3902068
Number of extensions: 2448938
Number of successful extensions: 56939
Number of sequences better than 10.0: 81
Number of HSP's better than 10.0 without gapping: 80
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 56245
Number of HSP's gapped (non-prelim): 691
length of query: 457
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 435
effective length of database: 17,147,199,772
effective search space: 7459031900820
effective search space used: 7459031900820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top