>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 223055

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 143   tccacctttcttccccccag 162
             ||||||||||||||||||||
Sbjct: 31545 tccacctttcttccccccag 31526

>gb|BC044473.1| Danio rerio bridging integrator 2, like, mRNA (cDNA clone MGC:55758
            IMAGE:3816603), complete cds
          Length = 2134

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 209  gatgatgaagaagaaaagcc 228
            ||||||||||||||||||||
Sbjct: 1627 gatgatgaagaagaaaagcc 1646

>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome
          Length = 4403837

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 374     cggtggatccggatccggtg 393
               ||||||||||||||||||||
Sbjct: 4208889 cggtggatccggatccggtg 4208870

>ref|XM_387902.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG07726.1)
           partial mRNA
          Length = 1989

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 204 ctcccgatgatgaagaagaa 223
           ||||||||||||||||||||
Sbjct: 974 ctcccgatgatgaagaagaa 993

>emb|BX842584.1| Mycobacterium tuberculosis H37Rv complete genome; segment 13/13
          Length = 244800

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   cggtggatccggatccggtg 393
             ||||||||||||||||||||
Sbjct: 49844 cggtggatccggatccggtg 49825

>gb|AC153495.10| Mus musculus 10 BAC RP23-468D5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 179258

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 143    tccacctttcttccccccag 162
              ||||||||||||||||||||
Sbjct: 152848 tccacctttcttccccccag 152829

>emb|BX248360.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
             7/8
          Length = 349659

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   ccacctcttcctcgcagccg 132
             ||||||||||||||||||||
Sbjct: 75935 ccacctcttcctcgcagccg 75954

>emb|BX248347.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment
             14/14
          Length = 278492

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   cggtggatccggatccggtg 393
             ||||||||||||||||||||
Sbjct: 85870 cggtggatccggatccggtg 85851

>emb|AL672176.10| Zebrafish DNA sequence from clone BUSM1-12F11 in linkage group 19
             Contains the 3' part of the rxrb gene for retinoid x
             receptor beta, a novel gene, the col11a2 gene for collagen
             type XI alpha-2,  the fabgl gene for FabG
             (beta-ketoacyl-[acyl-carrier-protein] reductase, E. coli)
             like, and the 3' part of the brd2 gene for
             bromodomain-containing protein 2, complete sequence
          Length = 100037

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   gatgatgaagaagaaaagcc 228
             ||||||||||||||||||||
Sbjct: 51526 gatgatgaagaagaaaagcc 51545

>ref|NM_199796.1| Danio rerio bridging integrator 2, like (bin2l), mRNA
          Length = 2134

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 209  gatgatgaagaagaaaagcc 228
            ||||||||||||||||||||
Sbjct: 1627 gatgatgaagaagaaaagcc 1646

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 243     gccggccgggctcgagcgcg 262
               ||||||||||||||||||||
Sbjct: 5001405 gccggccgggctcgagcgcg 5001424

>gb|AD000012.1|MSGY126 Mycobacterium tuberculosis sequence from clone y126
          Length = 37164

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 374  cggtggatccggatccggtg 393
            ||||||||||||||||||||
Sbjct: 3228 cggtggatccggatccggtg 3209

>emb|AL591826.2|CNS07EGP BAC 13C18 of library CITB 129-Sv from chromosome 10 of strain 129 of Mus
              musculus
          Length = 172715

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 143    tccacctttcttccccccag 162
              ||||||||||||||||||||
Sbjct: 130183 tccacctttcttccccccag 130164


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,530,874
Number of Sequences: 3902068
Number of extensions: 2530874
Number of successful extensions: 56719
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56625
Number of HSP's gapped (non-prelim): 94
length of query: 437
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 415
effective length of database: 17,147,199,772
effective search space: 7116087905380
effective search space used: 7116087905380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)