Clone Name	bast46f09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|S66160.1| ric1=ras-related GTP binding protein possessing GTP...	454	e-124
2	gb|AY104866.1| Zea mays PCO122462 mRNA sequence	444	e-121
3	ref|NM_193488.1| Oryza sativa (japonica cultivar-group), predic...	438	e-120
4	dbj|AB024994.1| Cicer arietinum mRNA for rab-type small GTP-bind...	226	5e-56
5	emb|Z73932.1|LJRAB1C L.japonicus mRNA for small GTP-binding prot...	216	5e-53
6	dbj|D12548.1|PEAGTPBP09 Pisum sativum mRNA for GTP-binding prote...	208	1e-50
7	gb|AY103767.1| Zea mays PCO152592 mRNA sequence	204	2e-49
8	gb|DQ222936.1| Chlamydomonas incerta YptC1 (yptC1) mRNA, complet...	200	3e-48
9	emb|X72212.1|NTRRGBP N.tabacum mRNA for ras-related GTP-binding ...	198	1e-47
10	emb|X63278.1|ZMYPTM2A Z.mays yptm2 cDNA	196	4e-47
11	emb|AJ810707.1| Poa pratensis mRNA for RAB1-like (rab1-1 gene)	190	3e-45
12	emb|AJ810708.1| Poa pratensis mRNA for RAB1-like (rab1-2 gene)	180	3e-42
13	dbj|D12550.1|PEAGTPBP11 Pisum sativum mRNA for GTP-binding prote...	163	6e-37
14	gb|U38464.1|SLU38464 Solanum lycopersicum small GTP-binding prot...	163	6e-37
15	ref|XM_467097.1| Oryza sativa (japonica cultivar-group), mRNA	159	9e-36
16	dbj|AK069903.1| Oryza sativa (japonica cultivar-group) cDNA clon...	157	4e-35
17	dbj|AK059888.1| Oryza sativa (japonica cultivar-group) cDNA clon...	157	4e-35
18	ref|NM_124091.2| Arabidopsis thaliana GTP binding AT5G47200 mRNA...	153	6e-34
19	gb|AY114013.1| Arabidopsis thaliana putative ras-related small G...	153	6e-34
20	gb|AY080753.1| Arabidopsis thaliana putative ras-related small G...	153	6e-34
21	gb|BT023739.1| Arabidopsis thaliana At5g47200 gene, complete cds	153	6e-34
22	gb|AF324990.2|AF324990 Arabidopsis thaliana AT5g47200 (AT5g47200...	153	6e-34
23	gb|AY085384.1| Arabidopsis thaliana clone 1492 mRNA, complete se...	153	6e-34
24	gb|BC085118.1| Rattus norvegicus similar to Ras-related protein ...	151	2e-33
25	ref|NM_001008370.1| Rattus norvegicus similar to Ras-related pro...	151	2e-33
26	gb|BT019232.1| Zea mays clone Contig905.F mRNA sequence	149	9e-33
27	emb|Y08425.1|NP43GTP N.plumbaginifolia mRNA for small GTP-bindin...	149	9e-33
28	gb|AY105385.1| Zea mays PCO152591 mRNA sequence	149	9e-33
29	emb|Z29590.1|VFGNRPR1 V.faba mRNA for guanine nucleotide regulat...	147	4e-32
30	gb|U58854.1|GMU58854 Glycine max small GTP-binding protein (sra2...	147	4e-32
31	emb|BX831925.1|CNS09ZKA Arabidopsis thaliana Full-length cDNA Co...	145	1e-31
32	gb|L27417.1|SOYGTPBIND Soybean GTP binding protein mRNA, complet...	143	6e-31
33	dbj|D12549.1|PEAGTPBP10 Pisum sativum mRNA for GTP-binding prote...	141	2e-30
34	ref|XM_860883.1| PREDICTED: Canis familiaris similar to RAB1B, m...	137	3e-29
35	ref|XM_860865.1| PREDICTED: Canis familiaris similar to RAB1B, m...	137	3e-29
36	ref|XM_847452.1| PREDICTED: Canis familiaris similar to RAB1B, m...	137	3e-29
37	ref|XM_860855.1| PREDICTED: Canis familiaris similar to RAB1B, m...	135	1e-28
38	emb|X13905.1|RNRAB1B Rat cDNA for ras-related rab1B protein	135	1e-28
39	gb|AF108883.1|AF108883 Capsicum annuum small GTP-binding protein...	129	8e-27
40	ref|NM_201142.1| Danio rerio zgc:56049 (zgc:56049), mRNA	127	3e-26
41	gb|BC047816.1| Danio rerio zgc:56049, mRNA (cDNA clone MGC:56049...	127	3e-26
42	gb|U38466.1|SLU38466 Solanum lycopersicum small GTP-binding prot...	127	3e-26
43	gb|BC016408.1| Mus musculus RAB1B, member RAS oncogene family, m...	121	2e-24
44	ref|NM_029576.1| Mus musculus RAB1B, member RAS oncogene family ...	121	2e-24
45	emb|Z73931.1|LJRAB1B L.japonicus mRNA for small GTP-binding prot...	121	2e-24
46	emb|CR857726.1| Pongo pygmaeus mRNA; cDNA DKFZp469I1235 (from cl...	121	2e-24
47	dbj|AK156726.1| Mus musculus activated spleen cDNA, RIKEN full-l...	121	2e-24
48	dbj|AK003609.1| Mus musculus 18-day embryo whole body cDNA, RIKE...	121	2e-24
49	dbj|AK042020.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f...	121	2e-24
50	gb|L48181.1|BNAYPTRP Brassica campestris L. pekinensis ypt-relat...	119	8e-24
51	ref|NM_030981.1| Homo sapiens RAB1B, member RAS oncogene family ...	113	5e-22
52	gb|BC028331.1| Homo sapiens RAB1B, member RAS oncogene family, m...	113	5e-22
53	emb|AL136635.1|HSM801608 Homo sapiens mRNA; cDNA DKFZp564I172 (f...	113	5e-22
54	emb|CR625419.1| full-length cDNA clone CS0DM005YB17 of Fetal liv...	113	5e-22
55	emb|CR624810.1| full-length cDNA clone CS0DI083YB01 of Placenta ...	113	5e-22
56	emb|CR620997.1| full-length cDNA clone CS0DI067YJ10 of Placenta ...	113	5e-22
57	emb|CR612971.1| full-length cDNA clone CS0DG006YF11 of B cells (...	113	5e-22
58	emb|CR598883.1| full-length cDNA clone CS0DB004YE12 of Neuroblas...	113	5e-22
59	emb|CR595400.1| full-length cDNA clone CS0DB002YO10 of Neuroblas...	113	5e-22
60	emb|CR592347.1| full-length cDNA clone CS0DH004YE13 of T cells (...	113	5e-22
61	emb|CR591273.1| full-length cDNA clone CS0DC025YE18 of Neuroblas...	113	5e-22
62	gb|BC071169.1| Homo sapiens RAB1B, member RAS oncogene family, m...	113	5e-22
63	gb|AF092437.1| Homo sapiens rab1B mRNA, complete cds	111	2e-21
64	ref|NM_112005.2| Arabidopsis thaliana ATFP8; GTP binding AT3G117...	109	8e-21
65	emb|BX825467.1|CNS0A69O Arabidopsis thaliana Full-length cDNA Co...	109	8e-21
66	gb|BT005576.1| Arabidopsis thaliana clone U50900 putative GTP-bi...	109	8e-21
67	dbj|AK118150.1| Arabidopsis thaliana At3g11730 mRNA for putative...	109	8e-21
68	gb|U64911.1|ATU64911 Arabidopsis thaliana isoprenylated protein ...	109	8e-21
69	ref|XM_860833.1| PREDICTED: Canis familiaris similar to RAB1B, m...	107	3e-20
70	ref|XM_697369.1| PREDICTED: Danio rerio hypothetical protein LOC...	107	3e-20
71	dbj|AB168324.1| Macaca fascicularis testis cDNA clone: QtsA-1122...	107	3e-20
72	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
73	dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
74	dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic D...	107	3e-20
75	emb|AJ245875.1|HSA245875 Homo sapiens complete mRNA for putative...	105	1e-19
76	emb|Z73934.1|LJRAB1E L.japonicus mRNA for small GTP-binding prot...	103	5e-19
77	gb|U38465.1|SLU38465 Solanum lycopersicum small GTP-binding prot...	103	5e-19
78	gb|DQ123952.1| Coffea arabica x Coffea canephora clone HT-SSH1-A...	101	2e-18
79	gb|BC105393.1| Bos taurus cDNA clone MGC:128300 IMAGE:7960184, c...	100	7e-18
80	emb|CR533462.1| Homo sapiens full open reading frame cDNA clone ...	98	3e-17
81	emb|Z73933.1|LJRAB1D L.japonicus mRNA for small GTP-binding prot...	96	1e-16
82	gb|AF454362.1| Pythium graminicola isolate graminicolaTN ras-lik...	96	1e-16
83	gb|AF454360.1| Pythium myriotylum isolate P30 ras-like protein g...	96	1e-16
84	dbj|AK062838.1| Oryza sativa (japonica cultivar-group) cDNA clon...	96	1e-16
85	emb|X72688.1|LSRAB1 L.stagnalis LS-rab1 mRNA	90	7e-15
86	gb|AF127134.1|AF127134 Arabidopsis thaliana ras-related small GT...	86	1e-13
87	gb|AF454361.1| Pythium vanterpoolii isolate vanterpooliiTN ras-l...	84	4e-13
88	ref|NM_117859.2| Arabidopsis thaliana RAB1C; GTP binding AT4G175...	80	7e-12
89	ref|NG_005395.2| Homo sapiens RAB1C, member RAS oncogene family ...	80	7e-12
90	emb|AL513165.12| Human DNA sequence from clone RP11-613M10 on ch...	80	7e-12
91	gb|AC183495.1| Brassica oleracea Contig A, complete sequence	80	7e-12
92	gb|AC183493.1| Brassica oleracea Contig B, complete sequence	80	7e-12
93	gb|AF454357.1| Pythium aphanidermatum isolate aphanidermatumTN r...	80	7e-12
94	gb|AF454356.1| Pythium arrhenomanes isolate arrhenomanesTN ras-l...	80	7e-12
95	gb|AF454355.1| Pythium deliense isolate 20-1 ras-like protein ge...	80	7e-12
96	ref|XM_945537.1| PREDICTED: Homo sapiens small GTP-binding prote...	80	7e-12
97	ref|XM_941922.1| PREDICTED: Homo sapiens small GTP-binding prote...	80	7e-12
98	ref|XM_497021.2| PREDICTED: Homo sapiens small GTP-binding prote...	80	7e-12
99	ref|XM_929773.1| PREDICTED: Homo sapiens small GTP-binding prote...	80	7e-12
100	gb|AY052204.1| Arabidopsis thaliana AT4g17530/dl4800c mRNA, comp...	80	7e-12
101	dbj|AB018117.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	80	7e-12
102	gb|DQ372931.1| Pinus pinaster Rab1 mRNA, complete cds	78	3e-11
103	gb|AY060495.1| Arabidopsis thaliana AT4g17530/dl4800c mRNA, comp...	78	3e-11
104	gb|AF454358.1| Pythium torulosum isolate 18-5 ras-like protein g...	76	1e-10
105	ref|XM_940462.1| PREDICTED: Homo sapiens similar to RAB1, member...	76	1e-10
106	gb|U35026.1|PHU35026 Petunia hybrida Rab1-like small GTP-binding...	76	1e-10
107	ref|NM_001031787.1| Sus scrofa Ras-related protein Rab-1A (RAB1B...	74	4e-10
108	emb|X96991.1|PHRB1A P.hybrida mRNA for GTP-binding protein, homo...	74	4e-10
109	gb|DQ270324.1| Phytophthora boehmeriae strain SCRP23 ras-related...	74	4e-10
110	gb|AY996813.1| Sus scrofa Ras-related protein Rab-1A mRNA, compl...	74	4e-10
111	dbj|D10435.1|RIC241 Oryza sativa mRNA for ras-related Hrab1B pro...	74	4e-10
112	emb|AJ566493.1|TCA566493 Theobroma cacao microsatellite, clone m...	72	2e-09
113	ref|XM_844657.1| PREDICTED: Canis familiaris similar to RAB1B, m...	72	2e-09
114	ref|XM_568088.1| Cryptococcus neoformans var. neoformans JEC21 r...	72	2e-09
115	gb|AY232027.1| Drosophila yakuba clone yak-ad_Rab1 mRNA sequence	72	2e-09
116	gb|AY231907.1| Drosophila yakuba clone yak-em_Rab1 mRNA sequence	72	2e-09
117	emb|CR670292.2|CNS0FG62 Tetraodon nigroviridis full-length cDNA	72	2e-09
118	gb|DQ270315.1| Phytophthora idaei strain SCRP376 ras-related pro...	72	2e-09
119	gb|DQ270314.1| Phytophthora idaei strain SCRP373 ras-related pro...	72	2e-09
120	gb|DQ270313.1| Phytophthora idaei strain SCRP371 ras-related pro...	72	2e-09
121	gb|DQ270312.1| Phytophthora idaei strain SCRP370 ras-related pro...	72	2e-09
122	gb|DQ270311.1| Phytophthora cactorum strain SCRP30 ras-related p...	72	2e-09
123	gb|DQ270310.1| Phytophthora cactorum strain SCRP35 ras-related p...	72	2e-09
124	gb|DQ270309.1| Phytophthora cactorum strain SCRP39 ras-related p...	72	2e-09
125	gb|DQ270308.1| Phytophthora cactorum strain SCRP48 ras-related p...	72	2e-09
126	gb|AF454359.1| Pythium catenulatum isolate catenulatumTN ras-lik...	72	2e-09
127	gb|DQ162986.1| Phytophthora megasperma strain IMI133317 ras-like...	72	2e-09
128	gb|DQ162979.1| Phytophthora quercina strain SCRP550 ras-like pro...	72	2e-09
129	gb|DQ162978.1| Phytophthora quercina strain SCRP549 ras-like pro...	72	2e-09
130	gb|DQ162977.1| Phytophthora quercina strain SCRP547 ras-like pro...	72	2e-09
131	gb|DQ162976.1| Phytophthora quercina strain SCRP541 ras-like pro...	72	2e-09
132	gb|DQ162960.1| Phytophthora cactorum strain IMI296524 ras-like p...	72	2e-09
133	ref|NM_100093.2| Arabidopsis thaliana ATRAB1B; GTP binding AT1G0...	70	7e-09
134	gb|AY061905.1| Arabidopsis thaliana At1g02130/T7I23_6 mRNA, comp...	70	7e-09
135	gb|AY052333.1| Arabidopsis thaliana At1g02130/T7I23_6 mRNA, comp...	70	7e-09
136	dbj|D01027.1|ATHARA5 Arabidopsis thaliana mRNA for small GTP-bin...	70	7e-09
137	gb|AY441051.1| Armigeres subalbatus ASAP ID: 41801 Rho small mon...	68	3e-08
138	gb|AF454544.1| Pichia angusta strain DL-1 GTP-binding protein (Y...	68	3e-08
139	gb|BC074522.1| Xenopus tropicalis MGC69496 protein, mRNA (cDNA c...	68	3e-08
140	ref|NM_001004787.1| Xenopus tropicalis MGC69496 protein (MGC6949...	68	3e-08
141	gb|DQ162965.1| Phytophthora nemorosa strain SCRP910 ras-like pro...	68	3e-08
142	gb|DQ162964.1| Phytophthora psychrophila strain SCRP630 ras-like...	68	3e-08
143	gb|DQ162963.1| Phytophthora ilicis strain SCRP379 ras-like prote...	68	3e-08
144	gb|DQ162962.1| Phytophthora ilicis strain SCRP377 ras-like prote...	68	3e-08
145	gb|U13168.1|CRU13168 Chlamydomonas reinhardtii YptC1 (yptC1) gen...	68	3e-08
146	gb|AF346820.1| Pichia angusta GTP-binding protein (YPT1) gene, c...	68	3e-08
147	gb|DQ214477.1| Taeniopygia guttata clone 0065P0027C11 RAB1B memb...	66	1e-07
148	gb|DQ214476.1| Taeniopygia guttata clone 0063P0024A02 RAB1B memb...	66	1e-07
149	gb|DQ214475.1| Taeniopygia guttata clone 0058P0040G07 RAB1B memb...	66	1e-07
150	gb|DQ214474.1| Taeniopygia guttata clone 0063P0032G02 RAB1B memb...	66	1e-07
151	emb|X63277.1|ZMYPTM1 Z.mays yptm1 cDNA	66	1e-07
152	emb|CR353962.1| Gallus gallus finished cDNA, clone ChEST318m16	66	1e-07
153	gb|AY110905.1| Zea mays CL34283_1 mRNA sequence	66	1e-07
154	gb|AY109984.1| Zea mays CL2070_1 mRNA sequence	66	1e-07
155	ref|XM_630118.1| Dictyostelium discoideum Rab GTPase (DDB0201658...	64	4e-07
156	ref|NM_001031504.1| Gallus gallus RAB8A, member RAS oncogene fam...	64	4e-07
157	ref|NM_031090.2| Rattus norvegicus RAB1, member RAS oncogene fam...	64	4e-07
158	ref|XM_871338.1| PREDICTED: Bos taurus similar to RAB1, member R...	64	4e-07
159	emb|X97853.1|LJRAB1A L.japonicus mRNA for small GTP-binding prot...	64	4e-07
160	ref|XM_850035.1| PREDICTED: Canis familiaris similar to Ras-rela...	64	4e-07
161	gb|AY321327.1| Rattus norvegicus Ac2-048 mRNA, complete cds	64	4e-07
162	emb|AJ851430.1| Gallus gallus mRNA for hypothetical protein, clo...	64	4e-07
163	gb|BC066662.1| Rattus norvegicus RAB1, member RAS oncogene famil...	64	4e-07
164	emb|BX930100.2| Gallus gallus finished cDNA, clone ChEST1021d13	64	4e-07
165	emb|BX931166.1| Gallus gallus finished cDNA, clone ChEST1022e3	64	4e-07
166	emb|BX932054.1| Gallus gallus finished cDNA, clone ChEST417i18	64	4e-07
167	gb|L21011.1|DDIRABA Dictyostelium discoideum RabA mRNA, 3' end o...	64	4e-07
168	gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c...	62	2e-06
169	ref|XM_864244.1| PREDICTED: Bos taurus similar to RAB1, member R...	62	2e-06
170	ref|XM_612642.2| PREDICTED: Bos taurus similar to RAB1, member R...	62	2e-06
171	ref|NM_001003153.1| Canis familiaris RAB1A, member RAS oncogene ...	62	2e-06
172	ref|XM_842937.1| Leishmania major strain Friedlin small GTP-bind...	62	2e-06
173	ref|XM_546532.2| PREDICTED: Canis familiaris similar to Ras-rela...	62	2e-06
174	emb|X56384.1|CFRAB1 Canine rab1 mRNA for ras-related GTP-binding...	62	2e-06
175	emb|BX817998.1|CNS0ACJI Arabidopsis thaliana Full-length cDNA Co...	62	2e-06
176	gb|DQ162973.1| Phytophthora citrophthora strain IMI332632 ras-li...	62	2e-06
177	gb|L12031.1|LEIGTPHOM Leishmania major V121 GTP-binding protein ...	62	2e-06
178	gb|AY558467.1| Saccharomyces cerevisiae clone FLH111583.01X YFL0...	60	6e-06
179	gb|BC045014.1| Xenopus laevis RAB1, member RAS oncogene family, ...	60	6e-06
180	gb|AC124502.4| Mus musculus BAC clone RP23-414G6 from chromosome...	60	6e-06
181	ref|XM_950368.1| Theileria annulata strain Ankara hypothetical p...	60	6e-06
182	ref|XM_502561.1| Yarrowia lipolytica CLIB122, YALI0D08162g predi...	60	6e-06
183	emb|X00209.1|SCRASX Yeast YP2 gene The YP2 protein shows homolog...	60	6e-06
184	gb|DQ270323.1| Phytophthora kernoviae strain ker-CSL ras-related...	60	6e-06
185	gb|DQ270322.1| Phytophthora kernoviae strain SCRP957 ras-related...	60	6e-06
186	gb|DQ270321.1| Phytophthora kernoviae strain SCRP958 ras-related...	60	6e-06
187	emb|CR594164.1| full-length cDNA clone CS0DJ001YB19 of T cells (...	60	6e-06
188	gb|AF454369.1| Phytophthora citricola isolate 22297-97 ras-like ...	60	6e-06
189	ref|XM_690199.1| PREDICTED: Danio rerio similar to Rab1-prov pro...	60	6e-06
190	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
191	dbj|AP002485.2| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
192	dbj|AP002524.2| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
193	gb|DQ162991.1| Phytophthora lateralis strain IMI040503 ras-like ...	60	6e-06
194	gb|DQ162975.1| Phytophthora kernoviae strain SCRP722 ras-like pr...	60	6e-06
195	gb|DQ162974.1| Phytophthora insolita strain IMI288805 ras-like p...	60	6e-06
196	gb|DQ162972.1| Phytophthora capsici strain IMI352321 ras-like pr...	60	6e-06
197	gb|DQ162971.1| Phytophthora citricola strain SCRP143 ras-like pr...	60	6e-06
198	gb|DQ162970.1| Phytophthora citricola strain SCRP140 ras-like pr...	60	6e-06
199	gb|DQ162969.1| Phytophthora citricola strain SCRP136 ras-like pr...	60	6e-06
200	gb|DQ162968.1| Phytophthora citricola strain SCRP130 ras-like pr...	60	6e-06
201	gb|DQ162967.1| Phytophthora pseudosyringae strain SCRP734 ras-li...	60	6e-06
202	gb|DQ162966.1| Phytophthora pseudosyringae strain IMI390500 ras-...	60	6e-06
203	gb|U66621.1|HSU66621 Human small GTP-binding protein (rab1b) mRN...	60	6e-06
204	emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro...	60	6e-06
205	gb|M38390.1|DYGORA1 Discopyge ommata GTP-binding protein (ora1) ...	60	6e-06
206	dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI co...	60	6e-06
207	ref|XM_512463.1| PREDICTED: Pan troglodytes similar to cell line...	58	3e-05
208	gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, co...	58	3e-05
209	ref|XM_587868.2| PREDICTED: Bos taurus similar to cell line NK14...	58	3e-05
210	ref|NM_005370.4| Homo sapiens RAB8A, member RAS oncogene family ...	58	3e-05
211	ref|NM_001003152.1| Canis familiaris RAB8A, member RAS oncogene ...	58	3e-05
212	ref|XM_849306.1| PREDICTED: Canis familiaris similar to RAB11B, ...	58	3e-05
213	ref|XM_850476.1| PREDICTED: Canis familiaris RAB8A, member RAS o...	58	3e-05
214	emb|X56741.1|HSMRAB8 H.sapiens mRNA for rab8 gene	58	3e-05
215	emb|X56385.1|CFRAB8 Canine rab8 mRNA for ras-related GTP-binding...	58	3e-05
216	gb|BT008275.1| Synthetic construct Homo sapiens mel transforming...	58	3e-05
217	gb|BT007184.1| Homo sapiens mel transforming oncogene (derived f...	58	3e-05
218	emb|CR861352.1| Pongo pygmaeus mRNA; cDNA DKFZp459A1411 (from cl...	58	3e-05
219	gb|AC008894.9| Homo sapiens chromosome 19 clone CTD-2231E14, com...	58	3e-05
220	emb|CR625894.1| full-length cDNA clone CS0DA007YI13 of Neuroblas...	58	3e-05
221	dbj|AK125412.1| Homo sapiens cDNA FLJ43423 fis, clone OCBBF20269...	58	3e-05
222	emb|CR615093.1| full-length cDNA clone CS0DD005YJ20 of Neuroblas...	58	3e-05
223	emb|CR612819.1| full-length cDNA clone CS0DI081YF08 of Placenta ...	58	3e-05
224	emb|CR597154.1| full-length cDNA clone CS0DB001YM07 of Neuroblas...	58	3e-05
225	emb|CR590930.1| full-length cDNA clone CS0DC028YC15 of Neuroblas...	58	3e-05
226	gb|AC096622.14| Mus musculus strain 129/SvJ clone mgs1-182e11, c...	58	3e-05
227	gb|AF498943.1| Homo sapiens small GTP binding protein RAB8 (RAB8...	58	3e-05
228	ref|XM_680025.1| PREDICTED: Danio rerio similar to RAB1, member ...	58	3e-05
229	emb|CR542274.1| Homo sapiens full open reading frame cDNA clone ...	58	3e-05
230	emb|CR536583.1| Homo sapiens full open reading frame cDNA clone ...	58	3e-05
231	dbj|AB169502.1| Macaca fascicularis brain cDNA, clone: QccE-1174...	58	3e-05
232	gb|S53268.1| Homo sapiens RAS-related protein MEL (MEL) gene, co...	58	3e-05
233	dbj|AK002303.1| Mus musculus adult male kidney cDNA, RIKEN full-...	58	3e-05
234	gb|AC096623.31| Mus musculus strain 129/SvJ chromosome 3 clone m...	58	3e-05
235	ref|NM_026677.1| Mus musculus RAB13, member RAS oncogene family ...	58	3e-05
236	gb|AY892043.1| Synthetic construct Homo sapiens clone FLH110348....	58	3e-05
237	gb|AY892042.1| Synthetic construct Homo sapiens clone FLH110347....	58	3e-05
238	gb|AY889588.1| Synthetic construct Homo sapiens clone FLH110351....	58	3e-05
239	dbj|AK025165.1| Homo sapiens cDNA: FLJ21512 fis, clone COL05769	58	3e-05
240	gb|BC027214.1| Mus musculus RAB13, member RAS oncogene family, m...	58	3e-05
241	gb|BC002977.1| Homo sapiens RAB8A, member RAS oncogene family, m...	58	3e-05
242	dbj|AP001107.5| Homo sapiens genomic DNA, chromosome 11q clone:R...	58	3e-05
243	emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1...	58	3e-05
244	dbj|AB209767.1| Homo sapiens mRNA for mel transforming oncogene ...	58	3e-05
245	ref|XM_413757.1| PREDICTED: Gallus gallus similar to GTPase Rab8...	56	1e-04
246	ref|NM_008996.2| Mus musculus RAB1, member RAS oncogene family (...	56	1e-04
247	ref|XM_569689.1| Cryptococcus neoformans var. neoformans JEC21 R...	56	1e-04
248	ref|XM_570809.1| Cryptococcus neoformans var. neoformans JEC21 r...	56	1e-04
249	ref|XM_650833.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	56	1e-04
250	emb|Y00094.1|MMYPT1 Mouse mRNA for ras-related YPT1 protein	56	1e-04
251	gb|DQ179053.1| Phytophthora alni subsp. multiformis isolate PAM5...	56	1e-04
252	gb|DQ270299.1| Phytophthora alni subsp. alni strain SCRP8 ras-re...	56	1e-04
253	gb|DQ270298.1| Phytophthora alni strain SCRP14 ras-related prote...	56	1e-04
254	gb|DQ270297.1| Phytophthora alni subsp. alni strain SCRP4 ras-re...	56	1e-04
255	dbj|AK151085.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	56	1e-04
256	dbj|AK152978.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	56	1e-04
257	dbj|AK159425.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	56	1e-04
258	gb|DQ093990.1| Phytophthora cambivora isolate PCJC17 clone c1 RA...	56	1e-04
259	gb|DQ093988.1| Phytophthora cambivora isolate PC643 clone g1 RAS...	56	1e-04
260	gb|DQ093987.1| Phytophthora cambivora isolate PC643 clone a2 RAS...	56	1e-04
261	gb|DQ093986.1| Phytophthora fragariae var. rubi isolate PFR109 c...	56	1e-04
262	gb|DQ093985.1| Phytophthora fragariae var. fragariae isolate PFF...	56	1e-04
263	gb|DQ093984.1| Phytophthora alni subsp. alni isolate PAA162 clon...	56	1e-04
264	gb|DQ093983.1| Phytophthora alni subsp. alni isolate PAA162 clon...	56	1e-04
265	gb|DQ093981.1| Phytophthora alni subsp. alni isolate PAA151 clon...	56	1e-04
266	gb|DQ093979.1| Phytophthora alni subsp. alni isolate PAA143 clon...	56	1e-04
267	gb|DQ093978.1| Phytophthora alni subsp. alni isolate PAA143 clon...	56	1e-04
268	gb|DQ093977.1| Phytophthora alni subsp. alni isolate PAA130 clon...	56	1e-04
269	gb|DQ093975.1| Phytophthora alni subsp. alni isolate PAA130 clon...	56	1e-04
270	gb|DQ093974.1| Phytophthora alni subsp. alni isolate PAA129 clon...	56	1e-04
271	gb|DQ093970.1| Phytophthora alni subsp. multiformis isolate PAM7...	56	1e-04
272	gb|DQ093969.1| Phytophthora alni subsp. multiformis isolate PAM7...	56	1e-04
273	gb|DQ093968.1| Phytophthora alni subsp. multiformis isolate PAM7...	56	1e-04
274	gb|DQ093967.1| Phytophthora alni subsp. multiformis isolate PAM7...	56	1e-04
275	gb|DQ093966.1| Phytophthora alni subsp. multiformis isolate PAM5...	56	1e-04
276	dbj|AK166249.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD...	56	1e-04
277	dbj|AK167150.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	56	1e-04
278	dbj|AK034408.1| Mus musculus adult male diencephalon cDNA, RIKEN...	56	1e-04
279	ref|NG_005134.1| Rattus norvegicus clone rb9 rab1a related prote...	56	1e-04
280	ref|NG_005121.1| Rattus norvegicus clone rb2 rab1a related prote...	56	1e-04
281	ref|XM_392967.2| PREDICTED: Apis mellifera similar to CG3320-PA,...	56	1e-04
282	emb|BX934641.1| Gallus gallus finished cDNA, clone ChEST386e2	56	1e-04
283	dbj|AK129477.1| Mus musculus mRNA for mKIAA3012 protein	56	1e-04
284	gb|AF226873.1|AF226873 Mus musculus small GTP-binding protein RA...	56	1e-04
285	gb|BC002077.1| Mus musculus RAB1, member RAS oncogene family, mR...	56	1e-04
286	gb|U63024.1|RNU63024 Rattus norvegicus clone rb9 rab1a related p...	56	1e-04
287	gb|U63023.1|RNU63023 Rattus norvegicus clone rb2 rab1a related p...	56	1e-04
288	gb|J02998.1|RATRASA Rat ras-related protein mRNA, clone NTRAB1R	56	1e-04
289	gb|L14929.1|SOYRAB1P Glycine max (Rab1p) mRNA, complete cds	56	1e-04
290	ref|XM_633823.1| Dictyostelium discoideum Rab GTPase (DDB0191476...	54	4e-04
291	ref|XM_515516.1| PREDICTED: Pan troglodytes LOC459281 (LOC459281...	54	4e-04
292	gb|BT019529.1| Homo sapiens RAB1A, member RAS oncogene family mR...	54	4e-04
293	gb|BT019528.1| Homo sapiens RAB1A, member RAS oncogene family mR...	54	4e-04
294	gb|BT019527.1| Synthetic construct Homo sapiens RAB1A, member RA...	54	4e-04
295	gb|AY690483.1| Triticum aestivum rab GTP-binding protein mRNA, c...	54	4e-04
296	gb|BC000905.2| Homo sapiens RAB1A, member RAS oncogene family, m...	54	4e-04
297	ref|NM_004161.3| Homo sapiens RAB1A, member RAS oncogene family ...	54	4e-04
298	ref|XM_850477.1| PREDICTED: Canis familiaris RAB1A, member RAS o...	54	4e-04
299	gb|AC016795.6|ATAC016795 Arabidopsis thaliana chromosome III BAC...	54	4e-04
300	ref|XM_647217.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	54	4e-04
301	ref|XM_649666.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	54	4e-04
302	ref|XM_651982.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	54	4e-04
303	gb|BC000604.1| Homo sapiens mRNA similar to cisplatin resistance...	54	4e-04
304	emb|CR536488.1| Homo sapiens full open reading frame cDNA clone ...	54	4e-04
305	emb|BX571747.1|HSM806623 Homo sapiens mRNA; cDNA DKFZp686E08159 ...	54	4e-04
306	emb|AJ277108.1|TRE277108 Trichoderma reesei ypt1 gene for small ...	54	4e-04
307	emb|CR616184.1| full-length cDNA clone CS0DM010YN17 of Fetal liv...	54	4e-04
308	emb|CR593530.1| full-length cDNA clone CS0DC023YH06 of Neuroblas...	54	4e-04
309	gb|AF498929.1| Homo sapiens small GTP binding protein RAB1A (RAB...	54	4e-04
310	dbj|AB054586.1| Entamoeba histolytica EhRabH mRNA for small GTPa...	54	4e-04
311	gb|AY888246.1| Synthetic construct Homo sapiens clone FLH020311....	54	4e-04
312	gb|AY888245.1| Synthetic construct Homo sapiens clone FLH020310....	54	4e-04
313	gb|AY890834.1| Synthetic construct Homo sapiens clone FLH020306....	54	4e-04
314	gb|DQ162985.1| Phytophthora inundata strain SCRP649 ras-like pro...	54	4e-04
315	gb|DQ162984.1| Phytophthora inundata strain SCRP647 ras-like pro...	54	4e-04
316	gb|DQ162983.1| Phytophthora inundata strain IMI389750 ras-like p...	54	4e-04
317	gb|DQ162982.1| Phytophthora inundata strain IMI389751 ras-like p...	54	4e-04
318	gb|DQ162958.1| Phytophthora sojae strain SCRP555 ras-like protei...	54	4e-04
319	gb|DQ162957.1| Phytophthora pistaciae strain IMI386658 ras-like ...	54	4e-04
320	gb|L21009.1|DDIRAB1A Dictyostelium discoideum Rab1A mRNA, comple...	54	4e-04
321	gb|M28209.1|HUMRAB1A Homo sapiens GTP-binding protein (RAB1) mRN...	54	4e-04
322	gb|M93438.1|VVCYPTV Volvox carteri small G-protein (yptV1) gene,...	54	4e-04
323	ref|NM_123324.1| Arabidopsis thaliana GTP binding AT5G39620 mRNA...	52	0.002
324	ref|NM_001033628.1| Bos taurus GTP binding protein Rab1a (LOC539...	52	0.002
325	ref|XM_369329.1| Magnaporthe grisea 70-15 chromosome III hypothe...	52	0.002
326	gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome...	52	0.002
327	ref|XM_457265.1| Debaryomyces hansenii CBS767 hypothetical prote...	52	0.002
328	ref|XM_716457.1| Candida albicans SC5314 putative RAB family GTP...	52	0.002
329	ref|XM_716186.1| Candida albicans SC5314 putative RAB family GTP...	52	0.002
330	ref|XM_948191.1| Theileria annulata strain Ankara Rab GTPase (TA...	52	0.002
331	ref|XM_391049.1| Gibberella zeae PH-1 chromosome 3 YPT1_NEUCR GT...	52	0.002
332	ref|XM_504292.1| Yarrowia lipolytica CLIB122, YALI0E23067g predi...	52	0.002
333	ref|XM_970057.1| PREDICTED: Tribolium castaneum similar to CG332...	52	0.002
334	emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS...	52	0.002
335	gb|DQ222937.1| Chlamydomonas incerta YptC1 (yptC1) gene, partial...	52	0.002
336	gb|BC103436.1| Bos taurus GTP binding protein Rab1a, mRNA (cDNA ...	52	0.002
337	emb|CR603642.1| full-length cDNA clone CS0DC015YC15 of Neuroblas...	52	0.002
338	gb|L06969.1|YSJRYL1X Yarrowia lipolytica ras-like protein (RYL1)...	52	0.002
339	gb|AF330211.1|AF330211 Candida albicans small GTP-binding protei...	52	0.002
340	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	52	0.002
341	dbj|AK197899.1| Mus musculus cDNA, clone:Y1G0126I03, strand:minu...	52	0.002
342	dbj|AB162904.1| Loligo pealei rab3 gene for Rab3, complete cds	52	0.002
343	dbj|AK109344.2| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
344	dbj|AK073075.1| Oryza sativa (japonica cultivar-group) cDNA clon...	52	0.002
345	gb|DQ162989.1| Phytophthora drechsleri strain ATCC46724 ras-like...	52	0.002
346	dbj|AB048728.1| Physcomitrella patens gene for putative GTP bind...	52	0.002
347	gb|AF013572.1|AF013572 Bombyx mori small GTP-binding protein (ra...	52	0.002
348	emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ...	52	0.002
349	gb|L49400.1|SQDRAB3G Loligo pealii Rab3 gene, complete cds	52	0.002
350	gb|U89959.1| Arabidopsis thaliana BAC T7I23, complete sequence	52	0.002
351	dbj|AB071853.1| Arabidopsis thaliana mRNA for AtRab78, complete cds	52	0.002
352	gb|AY423722.1| Homo sapiens growth-inhibiting gene 4 protein mRN...	50	0.006
353	ref|XM_522433.1| PREDICTED: Pan troglodytes similar to RAB13 pro...	50	0.006
354	ref|XM_470212.1| Oryza sativa (japonica cultivar-group), predic...	50	0.006
355	ref|NM_002870.2| Homo sapiens RAB13, member RAS oncogene family ...	50	0.006
356	gb|BC105863.1| Rattus norvegicus cDNA clone MGC:124948 IMAGE:745...	50	0.006
357	ref|XM_513835.1| PREDICTED: Pan troglodytes LOC457343 (LOC457343...	50	0.006
358	gb|BT019701.1| Homo sapiens RAB13, member RAS oncogene family mR...	50	0.006
359	gb|BT019700.1| Homo sapiens RAB13, member RAS oncogene family mR...	50	0.006
360	gb|BT019699.1| Synthetic construct Homo sapiens RAB13, member RA...	50	0.006
361	gb|AE017350.1| Cryptococcus neoformans var. neoformans JEC21 chr...	50	0.006
362	gb|AY692843.1| Saccharomyces cerevisiae clone FLH111565.01X YFL0...	50	0.006
363	ref|XM_872373.1| PREDICTED: Bos taurus similar to RAB1, member R...	50	0.006
364	ref|XM_872159.1| PREDICTED: Bos taurus similar to RAB1, member R...	50	0.006
365	gb|BC000799.1| Homo sapiens RAB13, member RAS oncogene family, m...	50	0.006
366	ref|NM_023126.2| Mus musculus RAB8A, member RAS oncogene family ...	50	0.006
367	emb|AJ249367.1|KLA249367 Kluyveromyces lactis ypt1 gene	50	0.006
368	gb|AF244545.1| Aspergillus awamori YptA (yptA) gene, complete cds	50	0.006
369	ref|XM_567472.1| Cryptococcus neoformans var. neoformans JEC21 R...	50	0.006
370	ref|XM_651263.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	50	0.006
371	ref|XM_757806.1| Theileria parva strain Muguga chromosome 3 smal...	50	0.006
372	gb|AY896260.1| Trichomonas vaginalis strain G3 small Rab GTPase ...	50	0.006
373	emb|AL358472.54| Human DNA sequence from clone RP11-422P24 on ch...	50	0.006
374	emb|Y11889.1|TBRAB1ALP Trichinella britovi partial mRNA for rab1...	50	0.006
375	emb|X75593.1|HSRAB13 H.sapiens mRNA for rab 13	50	0.006
376	emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	50	0.006
377	emb|AL929352.1|PFA929352 Plasmodium falciparum strain 3D7, chrom...	50	0.006
378	emb|AL512562.1|SPAPB1A10 S.pombe chromosome I BAC pB1A10	50	0.006
379	emb|AJ278659.1|ANI278659 Aspergillus niger srgB gene for a secre...	50	0.006
380	emb|AJ237914.1|PFA237914 Plasmodium falciparum putative rab1A gene	50	0.006
381	emb|AL050268.1|HSM800023 Homo sapiens mRNA; cDNA DKFZp564B163 (f...	50	0.006
382	gb|AF525280.1| Rattus norvegicus GTP-binding protein RAB13 mRNA,...	50	0.006
383	dbj|AK128675.1| Homo sapiens cDNA FLJ46839 fis, clone UTERU20372...	50	0.006
384	emb|CR614708.1| full-length cDNA clone CS0DI012YL10 of Placenta ...	50	0.006
385	emb|CR612138.1| full-length cDNA clone CS0DB005YC05 of Neuroblas...	50	0.006
386	emb|CR606852.1| full-length cDNA clone CL0BA005ZB05 of Placenta ...	50	0.006
387	gb|AF498948.1| Homo sapiens small GTP binding protein RAB13 (RAB...	50	0.006
388	dbj|AK147178.1| Mus musculus 17 days pregnant adult female amnio...	50	0.006
389	dbj|AK165690.1| Mus musculus bone marrow stroma cell CRL-2028 SR...	50	0.006
390	ref|XM_938782.1| PREDICTED: Homo sapiens similar to Ras-related ...	50	0.006
391	ref|XM_927730.1| PREDICTED: Homo sapiens similar to Ras-related ...	50	0.006
392	emb|CR533479.1| Homo sapiens full open reading frame cDNA clone ...	50	0.006
393	gb|AC158898.7| Mus musculus chromosome 8, clone RP23-153P23, com...	50	0.006
394	gb|BC073168.1| Homo sapiens RAB13, member RAS oncogene family, m...	50	0.006
395	gb|S53270.1| MEL=RAS-related [mice, mRNA Partial, 638 nt]	50	0.006
396	dbj|AK010862.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu...	50	0.006
397	dbj|AK009259.1| Mus musculus adult male tongue cDNA, RIKEN full-...	50	0.006
398	ref|NM_001018958.1| Schizosaccharomyces pombe 972h- hypothetical...	50	0.006
399	dbj|AK080740.1| Mus musculus adult retina cDNA, RIKEN full-lengt...	50	0.006
400	dbj|AK079306.1| Mus musculus 16 days neonate cerebellum cDNA, RI...	50	0.006
401	dbj|AK076048.1| Mus musculus 11 days embryo whole body cDNA, RIK...	50	0.006
402	gb|BC094846.1| Homo sapiens RAB13, member RAS oncogene family, m...	50	0.006
403	ref|XM_392879.2| PREDICTED: Apis mellifera similar to ENSANGP000...	50	0.006
404	dbj|AB054579.1| Entamoeba histolytica EhRabC1 mRNA for small GTP...	50	0.006
405	gb|AC034102.32| Homo sapiens 12 BAC RP11-603J24 (Roswell Park Ca...	50	0.006
406	ref|NM_031092.1| Rattus norvegicus RAB13, member RAS oncogene fa...	50	0.006
407	gb|BC071176.1| Rattus norvegicus RAB8A, member RAS oncogene fami...	50	0.006
408	gb|AY888254.1| Synthetic construct Homo sapiens clone FLH009562....	50	0.006
409	gb|AY888253.1| Synthetic construct Homo sapiens clone FLH009561....	50	0.006
410	gb|AY890838.1| Synthetic construct Homo sapiens clone FLH009558....	50	0.006
411	gb|AY890837.1| Synthetic construct Homo sapiens clone FLH009557....	50	0.006
412	gb|AY893730.1| Synthetic construct Homo sapiens clone FLH131043....	50	0.006
413	gb|AY893729.1| Synthetic construct Homo sapiens clone FLH131041....	50	0.006
414	dbj|AK099130.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.006
415	gb|AF201953.1|AF201953 Plasmodium falciparum isolate FCC1/HN Rab...	50	0.006
416	dbj|AK061250.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.006
417	gb|AY110650.1| Zea mays CL35311_1 mRNA sequence	50	0.006
418	gb|AF107762.1|AF107762 Theileria parva small GTP-binding protein...	50	0.006
419	dbj|D12547.1|PEAGTPBP08 Pisum sativum mRNA for GTP-binding prote...	50	0.006
420	gb|BC019990.1| Mus musculus RAB8A, member RAS oncogene family, m...	50	0.006
421	gb|U41269.1|PFU41269 Plasmodium falciparum Rab1 protein (PfRab1)...	50	0.006
422	gb|U13169.1|CRU13169 Chlamydomonas reinhardtii YptC6 (yptC6) gen...	50	0.006
423	gb|M16507.1|YSCSEC4A S.cerevisiae SEC4 gene encoding ras-like pr...	50	0.006
424	ref|NM_001031097.1| Gallus gallus RAB10, member RAS oncogene fam...	48	0.025
425	ref|NM_001007161.1| Danio rerio RAB1A, member RAS oncogene famil...	48	0.025
426	ref|XM_802521.1| Trypanosoma cruzi strain CL Brener small GTP-bi...	48	0.025
427	ref|XM_647790.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	48	0.025
428	ref|XM_646244.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	48	0.025
429	ref|XM_652249.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	48	0.025
430	ref|XM_965694.1| PREDICTED: Tribolium castaneum similar to CG910...	48	0.025
431	gb|DQ179054.1| Phytophthora alni subsp. alni isolate PAA129 clon...	48	0.025
432	emb|AJ304407.1|PPA304407 Pichia pastoris partial frs1 gene for p...	48	0.025
433	emb|AJ278658.1|ANI278658 Aspergillus niger srgA gene for a secre...	48	0.025
434	gb|DQ270307.1| Phytophthora alni subsp. multiformis strain SCRP3...	48	0.025
435	gb|DQ270306.1| Phytophthora fragariae var. fragariae strain SCRP...	48	0.025
436	gb|DQ270305.1| Phytophthora fragariae var. rubi strain SCRP249 r...	48	0.025
437	gb|DQ270304.1| Phytophthora fragariae var. rubi strain SCRP278 r...	48	0.025
438	gb|DQ270303.1| Phytophthora fragariae var. rubi strain SCRP310 r...	48	0.025
439	gb|DQ270302.1| Phytophthora fragariae var. rubi strain SCRP339 r...	48	0.025
440	emb|AL606522.6| Mouse DNA sequence from clone RP23-19L22 on chro...	48	0.025
441	emb|AJ720699.1| Gallus gallus mRNA for hypothetical protein, clo...	48	0.025
442	dbj|AK123525.1| Homo sapiens cDNA FLJ41531 fis, clone BRTHA2014997	48	0.025
443	ref|XM_684089.1| PREDICTED: Danio rerio similar to RAB1A, member...	48	0.025
444	gb|AC007318.4| Homo sapiens BAC clone RP11-420C9 from 2, complet...	48	0.025
445	gb|DQ093989.1| Phytophthora cambivora isolate PCJC17 clone b2 RA...	48	0.025
446	gb|DQ093982.1| Phytophthora alni subsp. alni isolate PAA151 clon...	48	0.025
447	gb|DQ093980.1| Phytophthora alni subsp. alni isolate PAA143 clon...	48	0.025
448	gb|DQ093976.1| Phytophthora alni subsp. alni isolate PAA130 clon...	48	0.025
449	gb|DQ093973.1| Phytophthora alni subsp. uniformis isolate PAU89 ...	48	0.025
450	gb|DQ093972.1| Phytophthora alni subsp. uniformis isolate PAU84 ...	48	0.025
451	gb|DQ093971.1| Phytophthora alni subsp. uniformis isolate PAU60 ...	48	0.025
452	dbj|AB169492.1| Macaca fascicularis brain cDNA, clone: QccE-1096...	48	0.025
453	dbj|AB054578.1| Entamoeba histolytica EhRab1A mRNA for small GTP...	48	0.025
454	gb|AC084672.1|CBRG47I10 Caenorhabditis briggsae cosmid G47I10, c...	48	0.025
455	dbj|AB158369.1| Mesocricetus auratus mRNA for Rab13, complete cds	48	0.025
456	gb|BC062857.1| Danio rerio RAB1A, member RAS oncogene family, mR...	48	0.025
457	gb|BC050239.1| Danio rerio RAB1A, member RAS oncogene family, mR...	48	0.025
458	emb|X15747.1|MMYPT14 Mouse ypt1 gene for ras-related GTP-binding...	48	0.025
459	gb|BC082662.1| Xenopus laevis hypothetical LOC494677, mRNA (cDNA...	48	0.025
460	gb|DQ162956.1| Phytophthora cambivora strain SCRP82 ras-like pro...	48	0.025
461	gb|DQ162955.1| Phytophthora cambivora strain SCRP80 ras-like pro...	48	0.025
462	gb|DQ162954.1| Phytophthora cambivora strain IMI296831 ras-like ...	48	0.025
463	gb|DQ162953.1| Phytophthora alni subsp. alni strain SCRP2 ras-li...	48	0.025
464	gb|DQ162951.1| Phytophthora fragariae var. rubi strain IMI355974...	48	0.025
465	gb|DQ162950.1| Phytophthora fragariae var. fragariae strain SCRP...	48	0.025
466	gb|U82219.1|PAU82219 Prunus armeniaca Rab7 GTP binding protein m...	48	0.025
467	gb|DQ157704.1| Aiptasia pulchella Rab11 protein mRNA, complete cds	48	0.025
468	gb|L29272.1|TOBNTRAE Nicotiana tabacum SR1 Nt-rab11e mRNA, 3' end	48	0.025
469	gb|M38393.1|DYGORAB1 Discopyge ommata GTP-binding protein (o-rab...	48	0.025
470	ref|NM_103516.2| Arabidopsis thaliana ATRAB18; GTP binding AT1G4...	46	0.097
471	ref|XM_470131.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.097
472	ref|XM_466431.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.097
473	ref|XM_506841.1| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.097
474	ref|XM_506215.1| PREDICTED Oryza sativa (japonica cultivar-group...	46	0.097
475	ref|XM_476979.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.097
476	ref|XM_475071.1| Oryza sativa (japonica cultivar-group), predic...	46	0.097
477	gb|AY432398.1| Aedes aegypti ASAP ID: 36085 Rab small monomeric ...	46	0.097
478	gb|BC077245.1| Xenopus laevis hypothetical protein MGC80016, mRN...	46	0.097
479	gb|DQ443175.1| Bombyx mori Rab7 mRNA, complete cds	46	0.097
480	ref|XM_329521.1| Neurospora crassa OR74A GTP-BINDING PROTEIN YPT...	46	0.097
481	ref|XM_958053.1| Neurospora crassa OR74A GTP-BINDING PROTEIN YPT...	46	0.097
482	gb|DQ440351.1| Aedes aegypti clone AET-452 RAB protein mRNA, com...	46	0.097
483	gb|AY579410.1| Oryza sativa (japonica cultivar-group) small GTP-...	46	0.097
484	gb|AY576526.1| Oryza sativa (japonica cultivar-group) ethylene-r...	46	0.097
485	gb|AY552054.1| Aedes aegypti RAB-like GTP binding protein mRNA, ...	46	0.097
486	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	46	0.097
487	ref|XM_754656.1| Ustilago maydis 521 hypothetical protein (UM036...	46	0.097
488	emb|Z73943.1|LJRAB7D L.japonicus mRNA for small GTP-binding prot...	46	0.097
489	emb|AJ245570.1|LES245570 Lycopersicon esculentum mRNA for Rab11 ...	46	0.097
490	ref|XM_644517.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
491	ref|XM_647795.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
492	ref|XM_647959.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
493	ref|XM_649143.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
494	ref|XM_647684.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
495	ref|XM_649972.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
496	ref|XM_650011.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
497	ref|XM_652034.1| Entamoeba histolytica HM-1:IMSS Rab family GTPa...	46	0.097
498	emb|X77795.1|ZMYPTM3 Z.mays yptm3 mRNA	46	0.097
499	gb|AY063080.1| Arabidopsis thaliana putative GTP-binding protein...	46	0.097
500	gb|AF370263.1| Arabidopsis thaliana putative GTP-binding protein...	46	0.097

---

>gb|S66160.1| ric1=ras-related GTP binding protein possessing GTPase activity
           [Oryza sativa=rice, Yamahoushi, callus, mRNA, 955 nt]
          Length = 955

 Score =  454 bits (229), Expect = e-124
 Identities = 323/353 (91%), Gaps = 1/353 (0%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||| ||||| |||||||||||||||||||| |||||||| || |||||||
Sbjct: 96  ccgccgccatgaatcccgagtatgactacctcttcaagcttctgctcatcggagactcgg 155

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           |||| ||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||
Sbjct: 156 gcgtcgggaagtcttgcctgcttctgaggtttgcggacgattcatatctggagagctata 215

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           ||||||| || |||||||| || ||||||||||| |||||||||||||||||||| ||||
Sbjct: 216 tcagtaccatcggcgttgattttaaaatccgcactgttgagcaagatgggaagacaataa 275

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           ||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||
Sbjct: 276 agctgcaaatttgggatactgctggccaagagcgatttaggaccattacaagcagctact 335

                                                                       
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac- 391
           ||||||||||||| || |||||||| || |||||||||||||| ||||||||||||||| 
Sbjct: 336 accgtggtgcccacgggatcattgttgtttatgatgtgactgatcaggagagcttcaaca 395

                                                                
Query: 392 acgtcaaacagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           | ||||| |||||||| ||||||||||| ||||| ||||||||||||||||||
Sbjct: 396 atgtcaagcagtggctgaatgaaattgataggtatgctagtgaaaatgtgaac 448

---

>gb|AY104866.1| Zea mays PCO122462 mRNA sequence
          Length = 1057

 Score =  444 bits (224), Expect = e-121
 Identities = 318/348 (91%), Gaps = 1/348 (0%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| ||||| || |||||||||||||||||||| ||||| |||||||| || || 
Sbjct: 197 gccatgaatcccgagtacgactacctcttcaagctgctcctcatcggggactccggtgtt 256

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 257 gggaagtcttgcctgctgctgaggtttgcggatgattcatatctggagagctatatcagt 316

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           |||||||| ||||| || |||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 317 actattggagttgattttaaaatccgcaccgttgagcaagatgggaagacaataaagcta 376

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 377 cagatttgggatactgctggccaagaacgctttaggaccatcacaagcagctactaccgt 436

                                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtc 396
           || || |||||||| ||||| ||||||||||| ||||||||||||||||| ||| | |||
Sbjct: 437 ggagctcatggcattattgttgtgtatgatgtaactgaccaggagagctttaacaatgtc 496

                                                           
Query: 397 aaacagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || |||||||| ||||||||||| ||||| || |||||||||||||||
Sbjct: 497 aagcagtggctgaatgaaattgataggtatgccagtgaaaatgtgaac 544

---

>ref|NM_193488.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 612

 Score =  438 bits (221), Expect = e-120
 Identities = 315/345 (91%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| ||||| |||||||||||||||||||| |||||||| || ||||||||||| |||
Sbjct: 1   atgaatcccgagtatgactacctcttcaagcttctgctcatcggagactcgggcgtcggg 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           |||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 61  aagtcttgcctgcttctgaggtttgcggacgattcatatctggagagctatatcagtacc 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           || || ||||| || ||||||||||| |||||||||||||||||||| ||||||||||||
Sbjct: 121 atcggtgttgattttaaaatccgcactgttgagcaagatgggaagacaataaagctgcaa 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 181 atttgggatactgctggccaagagcgatttaggaccattacaagcagctactaccgtggt 240

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           ||||| || |||||||| || |||||||||||||| ||||||||||||||| | ||||| 
Sbjct: 241 gcccacgggatcattgttgtttatgatgtgactgatcaggagagcttcaacaatgtcaag 300

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           |||||||| ||||||||||| ||||| ||||||||||||||||||
Sbjct: 301 cagtggctgaatgaaattgataggtatgctagtgaaaatgtgaac 345

---

>dbj|AB024994.1| Cicer arietinum mRNA for rab-type small GTP-binding protein,
           complete cds
          Length = 1074

 Score =  226 bits (114), Expect = 5e-56
 Identities = 286/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||||||  | ||||||||  || | ||||| || || || |||||
Sbjct: 106 catgaatcccgaatatgactatttgttcaagcttttgttgattggagattctggtgtggg 165

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||| || || || ||||||||||| ||||||||||| ||||| ||||||||||||||
Sbjct: 166 caagtcatgtctcctcctgaggtttgctgatgattcataccttgacagctatatcagtac 225

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || ||||| ||||| ||||| ||||||||||| |||||||| || || || ||
Sbjct: 226 aattggagtggactttaaaattcgcactgttgagcaagacgggaagaccattaaacttca 285

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||||||||| |||||||| |||||||| ||  |||| ||||| ||||||||||| |||||
Sbjct: 286 aatttgggacactgctggtcaagaacgtttccggactatcactagcagctactatcgtgg 345

                                                                       
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaa 398
            || |||||||| ||||| || |||||||| |||||||| |||||||| ||| | || ||
Sbjct: 346 ggctcatggcataattgttgtttatgatgtcactgaccaagagagctttaacaatgttaa 405

                                                     
Query: 399 acagtggcttaatgaaattgacaggtacgctagtgaaaatgt 440
            |||||||| |||||||||||| | || || |||||||||||
Sbjct: 406 gcagtggctgaatgaaattgaccgttatgcaagtgaaaatgt 447

---

>emb|Z73932.1|LJRAB1C L.japonicus mRNA for small GTP-binding protein, RAB1C
          Length = 979

 Score =  216 bits (109), Expect = 5e-53
 Identities = 284/341 (83%), Gaps = 1/341 (0%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| || ||||| |||||  | ||||||||  |||| ||||| || || || || 
Sbjct: 117 gccatgaatcctgaatacgactatttgttcaagcttttgctgattggagattctggtgta 176

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| || || || ||||||||||| ||||||||||| ||||| ||||||||||||
Sbjct: 177 ggcaagtcatgtcttctcctgaggtttgctgatgattcataccttgacagctatatcagt 236

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| || ||||| |||||||| || |||||||| ||||| ||||| || || || 
Sbjct: 237 accattggagtggactttaaaatccgaactgttgagcaggatggaaagactattaaactt 296

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           ||||||||||| |||||||| |||||||| ||  |||| |||||||||||||||||||||
Sbjct: 297 caaatttgggacactgctggtcaagaacgtttccggacaatcacaagcagctactaccgt 356

                                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtc 396
           || || |||||||| ||||| || |||||||| |||||||| |||||||||||| | || 
Sbjct: 357 ggggctcatggcataattgttgtttatgatgtcactgaccaagagagcttcaacaatgtt 416

                                                    
Query: 397 aaacagtggcttaatgaaattgacaggtacgctagtgaaaa 437
           || || ||||| |||||||||||| | || || ||||||||
Sbjct: 417 aagcaatggctgaatgaaattgaccgttatgcaagtgaaaa 457

---

>dbj|D12548.1|PEAGTPBP09 Pisum sativum mRNA for GTP-binding protein, complete cds,
           clone:pra9A
          Length = 782

 Score =  208 bits (105), Expect = 1e-50
 Identities = 283/341 (82%), Gaps = 1/341 (0%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| || |||||||| ||  | ||||||||  || | ||||| || || || |||
Sbjct: 5   gccatgaatcctgaatatgattatttgttcaagcttttgttgattggagattctggtgtg 64

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| || || || ||||||||||| ||||||||||| ||||| ||||||||||||
Sbjct: 65  ggcaagtcatgtctcctcctgaggtttgctgatgattcataccttgacagctatatcagt 124

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| || ||||| ||||| ||||| ||||||||||| |||||||| || || || 
Sbjct: 125 accattggagtggactttaaaatacgcactgttgagcaagacgggaagaccattaaactt 184

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           ||||||||||| |||||||| |||||||| ||  | || ||||| |||||||||||||||
Sbjct: 185 caaatttgggacactgctggtcaagaacgtttccgtactatcactagcagctactaccgt 244

                                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtc 396
           || || |||||||| ||||| || |||||||| |||||||| |||||||||||| | || 
Sbjct: 245 ggggctcatggcataattgttgtttatgatgtcactgaccaagagagcttcaacaatgtt 304

                                                    
Query: 397 aaacagtggcttaatgaaattgacaggtacgctagtgaaaa 437
           || |||||||| |||||||| ||| | || || ||||||||
Sbjct: 305 aagcagtggctgaatgaaatcgaccgctatgcaagtgaaaa 345

---

>gb|AY103767.1| Zea mays PCO152592 mRNA sequence
          Length = 1117

 Score =  204 bits (103), Expect = 2e-49
 Identities = 244/291 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||| || |||||||| ||||| || ||||| ||||| || || || || ||
Sbjct: 200 catgaatcccgagtacgactaccttttcaaacttctgcttattggtgattctggtgttgg 259

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
           ||| || ||| |||| || || |||||||||||||||||| | || ||||| ||||| ||
Sbjct: 260 gaaatcatgcttgcttctcagatttgcggatgattcatatttggacagctacatcagcac 319

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| ||||| |||||||| ||||| || ||||||||||||||||| ||||| || ||
Sbjct: 320 aattggggttgatttcaaaattcgcacagtagagcaagatgggaagaccataaaacttca 379

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           |||||||||||||||||||||||| || || ||||| ||||| |||||||||||||||||
Sbjct: 380 aatttgggatactgctgggcaagagcgcttcaggacaatcactagcagctactaccgtgg 439

                                                              
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
            || ||||| |||||| | || ||||| ||||| ||||| || ||||||||
Sbjct: 440 agctcatggaatcattattgtatatgacgtgacagaccaagaaagcttcaa 490

---

>gb|DQ222936.1| Chlamydomonas incerta YptC1 (yptC1) mRNA, complete cds
          Length = 681

 Score =  200 bits (101), Expect = 3e-48
 Identities = 285/345 (82%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||||||||| || |||||||| |||||||| ||||||||||| ||||| || || || 
Sbjct: 41  atgaaccccgagtacgactacctgttcaagcttctgctcattggcgactccggtgttggc 100

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           |||||||||||||||||  | || || |||||  | ||    |||||||||||||| || 
Sbjct: 101 aagtcttgcctgctgcttcgtttcgctgatgacacctacaccgagagctatatcagcacc 160

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           || ||||| |||||||||||||||||||| ||||  |||||||||  ||| ||||| || 
Sbjct: 161 atcggcgtagacttcaaaatccgcaccgtggagctcgatgggaaggtgatcaagctccag 220

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           |||||||| || || || || || || ||  |||| ||||| ||||||||||||||||| 
Sbjct: 221 atttgggacacggccggtcaggagcgcttccggactatcaccagcagctactaccgtggc 280

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || || ||||||||||||||||| |||||||| |||||||||  ||||||| |||| || 
Sbjct: 281 gcgcacggcatcattgtcgtgtacgatgtgacggaccaggagtccttcaacaacgtgaag 340

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           |||||||| ||||| |||||| ||||||| || || |||||||||
Sbjct: 341 cagtggctcaatgagattgaccggtacgccagcgagaatgtgaac 385

---

>emb|X72212.1|NTRRGBP N.tabacum mRNA for ras-related GTP-binding protein
          Length = 898

 Score =  198 bits (100), Expect = 1e-47
 Identities = 266/320 (83%), Gaps = 1/320 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| ||||| |||||||||||||| |||||  |||||||||| || || ||||| |||
Sbjct: 106 atgaatcccgagtatgactacctctttaagcttttgctcattggtgattctggcgttggg 165

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || || || || ||||||||||| || ||  |||| || || || || || || |||
Sbjct: 166 aaatcatgtcttcttctgaggtttgccgacgacacatacctggaaagttacataagcact 225

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||| || |||||||| || || ||||||||||||||||| ||||| || || 
Sbjct: 226 attggagttgattttaaaatccggacagtagagcaagatgggaagactataaaacttcag 285

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||| ||||| |||||||| |||||||||||||| |||||||| || ||||||
Sbjct: 286 atttgggatacagctggacaagaacgctttaggaccatcactagcagctattatcgtggt 345

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaa 399
           |||||||| || || || |||||||||||||| || || |||||||||||  | || |||
Sbjct: 346 gcccatggaataatagttgtgtatgatgtgacagatcaagagagcttcaataatgtaaaa 405

                               
Query: 400 cagtggcttaatgaaattga 419
           |||||||| | |||||||||
Sbjct: 406 cagtggctgagtgaaattga 425

---

>emb|X63278.1|ZMYPTM2A Z.mays yptm2 cDNA
          Length = 1065

 Score =  196 bits (99), Expect = 4e-47
 Identities = 243/291 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||| || |||||||| ||||| || ||||| ||||| || || || || ||
Sbjct: 117 catgaatcccgagtacgactaccttttcaaacttctgcttattggtgattctggtgttgg 176

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
           ||| || ||| |||| || || |||||||||||||||||| | || ||||| ||||| ||
Sbjct: 177 gaaatcatgcttgcttctcagatttgcggatgattcatatttggacagctacatcagcac 236

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| ||||| || ||||| || || || ||||||||||||||||| ||||| || ||
Sbjct: 237 aattggggttgattttaaaattcggacagtagagcaagatgggaagaccataaaacttca 296

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           |||||||||||||||||||||||| || || ||||||||||| |||||||||||||||||
Sbjct: 297 aatttgggatactgctgggcaagagcgcttcaggaccatcactagcagctactaccgtgg 356

                                                              
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
            || ||||| |||||| | || ||||| ||||| ||||| || ||||||||
Sbjct: 357 agctcatggaatcattattgtatatgacgtgacagaccaagaaagcttcaa 407

---

>emb|AJ810707.1| Poa pratensis mRNA for RAB1-like (rab1-1 gene)
          Length = 1021

 Score =  190 bits (96), Expect = 3e-45
 Identities = 286/348 (82%), Gaps = 1/348 (0%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| ||||| |||||||| ||||| |||||  |||| ||||| |||||||| || 
Sbjct: 103 gccatgaatcccgagtatgactatctctttaagcttttgcttattggagactcgggtgtt 162

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| ||||| ||  | || ||||| || || |||||||| ||||| |||||||||
Sbjct: 163 ggcaagtcatgccttctcttaagatttgctgacgactcatatctggagagttatatcagt 222

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| ||||| |||||||| || || || ||||||||||| ||||| || ||||||
Sbjct: 223 acaattggagttgatttcaaaatacgtactgtggagcaagatggaaagactatgaagctg 282

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           ||||||||||| ||||||||||||||||| || || || || || ||||||||||| || 
Sbjct: 283 caaatttgggacactgctgggcaagaacgcttcagaactattactagcagctactatcga 342

                                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtc 396
           || || ||||| |||||| | || ||||||||||| ||||| || ||||||||| | || 
Sbjct: 343 ggggctcatgggatcattattgtctatgatgtgacagaccaagatagcttcaacaatgtg 402

                                                           
Query: 397 aaacagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || |||||| | ||||| |||||  | || |||||||| |||||||||
Sbjct: 403 aagcagtggttgaatgagattgatcgctatgctagtgataatgtgaac 450

---

>emb|AJ810708.1| Poa pratensis mRNA for RAB1-like (rab1-2 gene)
          Length = 938

 Score =  180 bits (91), Expect = 3e-42
 Identities = 244/295 (82%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| ||||| |||||||| ||||| |||||  |||| ||||| |||||||| || 
Sbjct: 108 gccatgaatcccgagtatgactatctctttaagcttttgcttattggagactcgggtgtt 167

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| ||||| ||  | || ||||| || || |||||||| ||||| |||||||||
Sbjct: 168 ggcaagtcatgccttctcttaagatttgctgacgactcatatctggagagttatatcagt 227

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| ||||| |||||||| || || || ||||||||||| ||||| || ||||||
Sbjct: 228 acaattggagttgatttcaaaatacgtactgtggagcaagatggaaagactatgaagctg 287

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           ||||||||||| ||||||||||||||||| || || || || || ||||||||||| || 
Sbjct: 288 caaatttgggacactgctgggcaagaacgcttcagaactattactagcagctactatcga 347

                                                                  
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaaca 392
           || || || || |||||| | || ||||||||||| ||||| || ||||||||||
Sbjct: 348 ggggctcacgggatcattattgtctatgatgtgacagaccaagatagcttcaaca 402

---

>dbj|D12550.1|PEAGTPBP11 Pisum sativum mRNA for GTP-binding protein, complete cds,
           clone:pra9C
          Length = 811

 Score =  163 bits (82), Expect = 6e-37
 Identities = 220/266 (82%)
 Strand = Plus / Plus

                                                                       
Query: 125 ttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgctgctgaggttt 184
           |||||||| || || ||||| ||||| || || || || || ||||| || ||||| |||
Sbjct: 85  ttcaagcttcttcttattggagactctggtgtcggcaaatcatgccttcttctgagattt 144

                                                                       
Query: 185 gcggatgattcatatcttgagagctatatcagtactattggcgttgacttcaaaatccgc 244
           || |||||||| ||  |||| ||||| || || || ||||| ||||| || |||||||| 
Sbjct: 145 gctgatgattcttacattgatagctacataagcaccattggagttgattttaaaatccgt 204

                                                                       
Query: 245 accgttgagcaagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaa 304
           ||||||||||| ||||||||||| || ||||| || ||||||||||| ||||| ||||||
Sbjct: 205 accgttgagcaggatgggaagactattaagctccagatttgggatacagctggccaagaa 264

                                                                       
Query: 305 cgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtat 364
           ||||||||||| ||||| || |||||||||||||| || ||||| |||||| | || |||
Sbjct: 265 cgatttaggacaatcaccagtagctactaccgtggggcacatggaatcattattgtttat 324

                                     
Query: 365 gatgtgactgaccaggagagcttcaa 390
           |||||||| ||  | |||||||||||
Sbjct: 325 gatgtgacagatgaagagagcttcaa 350

---

>gb|U38464.1|SLU38464 Solanum lycopersicum small GTP-binding protein (LeRab1A) mRNA,
           complete cds
          Length = 1008

 Score =  163 bits (82), Expect = 6e-37
 Identities = 181/214 (84%)
 Strand = Plus / Plus

                                                                       
Query: 177 tgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgttgacttca 236
           |||| ||||| |||||||||||||||||||| || ||||| || || || || ||||| |
Sbjct: 227 tgagatttgctgatgattcatatcttgagagttacatcagcaccatcggtgtggacttta 286

                                                                       
Query: 237 aaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactgctg 296
           |||||||||| ||||| || |||||||| || || || || |||||||||||||||||||
Sbjct: 287 aaatccgcacagttgatcaggatgggaaaaccattaaacttcaaatttgggatactgctg 346

                                                                       
Query: 297 ggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcattg 356
           | |||||||| |||||||| || || ||||| ||||| |||||||| |||||||| ||||
Sbjct: 347 gtcaagaacgttttaggacaattaccagcagttactatcgtggtgcacatggcataattg 406

                                             
Query: 357 tcgtgtatgatgtgactgaccaggagagcttcaa 390
           | || |||||||| || || || |||||||||||
Sbjct: 407 tggtttatgatgtaaccgatcaagagagcttcaa 440

---

>ref|XM_467097.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score =  159 bits (80), Expect = 9e-36
 Identities = 239/292 (81%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| ||||| || |||||||| ||||| || || |||||||| || || || || |||
Sbjct: 1   atgaatcccgagtacgactaccttttcaaacttctcctcattggtgattctggtgttggg 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||||||||||||||| || || ||||| ||||| || 
Sbjct: 61  aaatcgtgcttgcttctcagatttgcggatgattcatacctggacagctacatcagcaca 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||| || ||||| || || || ||||| ||||||||||| || ||||| |||
Sbjct: 121 attggagttgattttaaaatacggacagtagagcaggatgggaagaccatcaagcttcaa 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || 
Sbjct: 181 atctgggatactgctggacaagaacgtttcaggacaattacaagcagctattaccgggga 240

                                                               
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaaca 392
           || ||||| || ||| | || ||||||||||| ||||| || ||||||||||
Sbjct: 241 gctcatggaattattattgtatatgatgtgacagaccaagaaagcttcaaca 292

---

>dbj|AK069903.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J02, full
           insert sequence
          Length = 1043

 Score =  157 bits (79), Expect = 4e-35
 Identities = 241/295 (81%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| ||||| || |||||||| ||||| || || |||||||| || || || || 
Sbjct: 105 gccatgaatcccgagtacgactaccttttcaaacttctcctcattggtgattctggtgtt 164

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           ||||| || ||| |||| || || ||||||||||| ||||| || || ||||||||||| 
Sbjct: 165 gggaaatcgtgcttgcttctcagatttgcggatgactcatacctggacagctatatcagc 224

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| ||||| || ||||| || || || ||||| ||||||||||| || ||||| 
Sbjct: 225 acaattggagttgattttaaaatacggacagtagagcaggatgggaagaccatcaagctt 284

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           ||||| |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 285 caaatctgggatactgctggacaagaacgtttcaggacgattacaagcagctattaccgg 344

                                                                  
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaaca 392
           || || ||||| || ||| | || || |||||||| ||||| || ||||||||||
Sbjct: 345 ggagctcatggaataattattgtatacgatgtgacagaccaagaaagcttcaaca 399

---

>dbj|AK059888.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-C02, full
           insert sequence
          Length = 938

 Score =  157 bits (79), Expect = 4e-35
 Identities = 241/295 (81%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| ||||| || |||||||| ||||| || || |||||||| || || || || 
Sbjct: 114 gccatgaatcccgagtacgactaccttttcaaacttctcctcattggtgattctggtgtt 173

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           ||||| || ||| |||| || || ||||||||||| ||||| || || ||||||||||| 
Sbjct: 174 gggaaatcgtgcttgcttctcagatttgcggatgactcatacctggacagctatatcagc 233

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| ||||| || ||||| || || || ||||| ||||||||||| || ||||| 
Sbjct: 234 acaattggagttgattttaaaatacggacagtagagcaggatgggaagaccatcaagctt 293

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           ||||| |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| 
Sbjct: 294 caaatctgggatactgctggacaagaacgtttcaggacgattacaagcagctattaccgg 353

                                                                  
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaaca 392
           || || ||||| || ||| | || || |||||||| ||||| || ||||||||||
Sbjct: 354 ggagctcatggaataattattgtatacgatgtgacagaccaagaaagcttcaaca 408

---

>ref|NM_124091.2| Arabidopsis thaliana GTP binding AT5G47200 mRNA, complete cds
          Length = 948

 Score =  153 bits (77), Expect = 6e-34
 Identities = 279/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 125 atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 184

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 185 aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 244

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| ||||| |||||||| || || ||||| || || || || 
Sbjct: 245 attggtgttgactttaaaattcgcacagttgagcaggacggaaagaccatcaaactccag 304

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 305 atctgggacacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 364

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 365 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 424

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 425 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 469

---

>gb|AY114013.1| Arabidopsis thaliana putative ras-related small GTP-binding protein
           (At5g47200) mRNA, complete cds
          Length = 640

 Score =  153 bits (77), Expect = 6e-34
 Identities = 279/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 1   atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 61  aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| ||||| |||||||| || || ||||| || || || || 
Sbjct: 121 attggtgttgactttaaaattcgcacagttgagcaggacggaaagaccatcaaactccag 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 181 atctgggacacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 240

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 241 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 300

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 301 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 345

---

>gb|AY080753.1| Arabidopsis thaliana putative ras-related small GTP-binding protein
           (At5g47200) mRNA, complete cds
          Length = 939

 Score =  153 bits (77), Expect = 6e-34
 Identities = 279/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 100 atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 159

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 160 aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 219

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| ||||| |||||||| || || ||||| || || || || 
Sbjct: 220 attggtgttgactttaaaattcgcacagttgagcaggacggaaagaccatcaaactccag 279

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 280 atctgggacacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 339

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 340 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 399

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 400 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 444

---

>gb|BT023739.1| Arabidopsis thaliana At5g47200 gene, complete cds
          Length = 609

 Score =  153 bits (77), Expect = 6e-34
 Identities = 279/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 1   atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 61  aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| ||||| |||||||| || || ||||| || || || || 
Sbjct: 121 attggtgttgactttaaaattcgcacagttgagcaggacggaaagaccatcaaactccag 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 181 atctgggacacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 240

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 241 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 300

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 301 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 345

---

>gb|AF324990.2|AF324990 Arabidopsis thaliana AT5g47200 (AT5g47200/MQL5_5) mRNA, complete
           cds
          Length = 931

 Score =  153 bits (77), Expect = 6e-34
 Identities = 279/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 121 atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 180

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 181 aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 240

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| ||||| |||||||| || || ||||| || || || || 
Sbjct: 241 attggtgttgactttaaaattcgcacagttgagcaggacggaaagaccatcaaactccag 300

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 301 atctgggacacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 360

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 361 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 420

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 421 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 465

---

>gb|AY085384.1| Arabidopsis thaliana clone 1492 mRNA, complete sequence
          Length = 932

 Score =  153 bits (77), Expect = 6e-34
 Identities = 279/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 125 atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 184

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 185 aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 244

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| ||||| |||||||| || || ||||| || || || || 
Sbjct: 245 attggtgttgactttaaaattcgcacagttgagcaggacggaaagaccatcaaactccag 304

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 305 atctgggacacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 364

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 365 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 424

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 425 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 469

---

>gb|BC085118.1| Rattus norvegicus similar to Ras-related protein Rab-1B, mRNA (cDNA
           clone MGC:105830 IMAGE:7108294), complete cds
          Length = 1840

 Score =  151 bits (76), Expect = 2e-33
 Identities = 232/284 (81%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||||||||||
Sbjct: 36  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactcgggcgtg 95

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 96  ggcaagtcatgcctgcttctgcggtttgctgatgacacgtacacagagagctacatcagc 155

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| || |||||||| || || ||| |||| |  ||||| || || || || || 
Sbjct: 156 accattggggtggacttcaagattcgaaccattgaactggatggcaaaaccatcaaacta 215

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || ||||| || |||||||||||   ||||||||| || 
Sbjct: 216 cagatttgggacacagctggtcaggaacggttcaggaccatcacttccagctactatcgg 275

                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           ||||| |||||||||||||| |||||||| || |||||||||||
Sbjct: 276 ggtgctcatggcatcattgtggtgtatgacgtcactgaccagga 319

---

>ref|NM_001008370.1| Rattus norvegicus similar to Ras-related protein Rab-1B
           (MGC105830), mRNA
          Length = 1840

 Score =  151 bits (76), Expect = 2e-33
 Identities = 232/284 (81%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||||||||||
Sbjct: 36  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactcgggcgtg 95

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 96  ggcaagtcatgcctgcttctgcggtttgctgatgacacgtacacagagagctacatcagc 155

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| || |||||||| || || ||| |||| |  ||||| || || || || || 
Sbjct: 156 accattggggtggacttcaagattcgaaccattgaactggatggcaaaaccatcaaacta 215

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || ||||| || |||||||||||   ||||||||| || 
Sbjct: 216 cagatttgggacacagctggtcaggaacggttcaggaccatcacttccagctactatcgg 275

                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           ||||| |||||||||||||| |||||||| || |||||||||||
Sbjct: 276 ggtgctcatggcatcattgtggtgtatgacgtcactgaccagga 319

---

>gb|BT019232.1| Zea mays clone Contig905.F mRNA sequence
          Length = 881

 Score =  149 bits (75), Expect = 9e-33
 Identities = 237/291 (81%)
 Strand = Plus / Minus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||| ||||| ||||| ||||| || ||||| || || || || || || ||
Sbjct: 727 catgaatcccgagtatgattaccttttcaaacttctgcttatcggtgattctggtgttgg 668

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            || || ||| |||| || || ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 667 aaaatcatgcttgcttctcagatttgcagatgattcatatctggacagctacatcagcac 608

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| |||||||| |||||  | || || |||||||| |||||||| |||||||| ||
Sbjct: 607 aattggagttgactttaaaattaggacagtagagcaagacgggaagaccataaagcttca 548

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           |||||||||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||
Sbjct: 547 aatttgggatactgctggacaagagcgcttcaggacaatcactagcagctactaccgcgg 488

                                                              
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
            || || || |||||| | || ||||| ||||| ||||| || ||||||||
Sbjct: 487 agctcacggaatcattattgtatatgacgtgacagaccaagaaagcttcaa 437

---

>emb|Y08425.1|NP43GTP N.plumbaginifolia mRNA for small GTP-binding protein, clone Np43GTP
          Length = 1008

 Score =  149 bits (75), Expect = 9e-33
 Identities = 237/291 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| |||||||| ||||| || ||||||||  |||| ||||| || || || || ||
Sbjct: 142 catgaatcccgaatacgactatcttttcaagcttttgcttattggagattctggtgttgg 201

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            || || || || ||  |||| ||||| ||||| |||||||||||||| || ||||| ||
Sbjct: 202 caaatcatgtcttctcttgagatttgctgatgactcatatcttgagagttacatcagcac 261

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            || || || || || ||||||||||| |||||||| |||||||| || || || || ||
Sbjct: 262 catcggggtggattttaaaatccgcacagttgagcaggatgggaaaaccattaaacttca 321

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           |||||||||||||||||| ||||| || |||||||| || || ||||||||||| || ||
Sbjct: 322 aatttgggatactgctggtcaagagcgttttaggacaattaccagcagctactatcgcgg 381

                                                              
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
           ||| |||||||| ||||| || |||||||| || || || |||||||||||
Sbjct: 382 tgctcatggcataattgttgtctatgatgtaaccgatcaagagagcttcaa 432

---

>gb|AY105385.1| Zea mays PCO152591 mRNA sequence
          Length = 977

 Score =  149 bits (75), Expect = 9e-33
 Identities = 237/291 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||| ||||| ||||| ||||| || ||||| || || || || || || ||
Sbjct: 178 catgaatcccgagtatgattaccttttcaaacttctgcttatcggtgattctggtgttgg 237

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            || || ||| |||| || || ||||| |||||||||||||| || ||||| ||||| ||
Sbjct: 238 aaaatcatgcttgcttctcagatttgcagatgattcatatctggacagctacatcagcac 297

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| |||||||| |||||  | || || |||||||| |||||||| |||||||| ||
Sbjct: 298 aattggagttgactttaaaattaggacagtagagcaagacgggaagaccataaagcttca 357

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           |||||||||||||||||| ||||| || || ||||| ||||| |||||||||||||| ||
Sbjct: 358 aatttgggatactgctggacaagagcgcttcaggacaatcactagcagctactaccgcgg 417

                                                              
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
            || || || |||||| | || ||||| ||||| ||||| || ||||||||
Sbjct: 418 agctcacggaatcattattgtatatgacgtgacagaccaagaaagcttcaa 468

---

>emb|Z29590.1|VFGNRPR1 V.faba mRNA for guanine nucleotide regulatory protein (923bp)
          Length = 923

 Score =  147 bits (74), Expect = 4e-32
 Identities = 218/266 (81%)
 Strand = Plus / Plus

                                                                       
Query: 125 ttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgctgctgaggttt 184
           |||||||| || || ||||| ||||| || || || || || ||||| || ||||| |||
Sbjct: 122 ttcaagcttcttcttattggagactctggtgtcggcaaatcatgccttcttctgagattt 181

                                                                       
Query: 185 gcggatgattcatatcttgagagctatatcagtactattggcgttgacttcaaaatccgc 244
           || |||||||| ||  |||| ||||| || || || ||||| ||||| || |||||||| 
Sbjct: 182 gctgatgattcttacattgatagctacataagcaccattggggttgattttaaaatccgt 241

                                                                       
Query: 245 accgttgagcaagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaa 304
           ||||||||||| ||||||||||| || ||||| || ||||||||||| ||||| ||||||
Sbjct: 242 accgttgagcaggatgggaagactattaagctccagatttgggatacagctggccaagaa 301

                                                                       
Query: 305 cgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtat 364
           ||||||||||| ||||| || ||||||||||| || || ||||| |||||| | || |||
Sbjct: 302 cgatttaggacaatcaccagtagctactaccgcggggcacatggaatcattattgtttat 361

                                     
Query: 365 gatgtgactgaccaggagagcttcaa 390
           ||||| || ||  | |||||||||||
Sbjct: 362 gatgttacagatgaagagagcttcaa 387

---

>gb|U58854.1|GMU58854 Glycine max small GTP-binding protein (sra2) mRNA, complete cds
          Length = 885

 Score =  147 bits (74), Expect = 4e-32
 Identities = 236/290 (81%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| ||||| ||||| || || |||||||| || || ||||| ||||| || || || 
Sbjct: 96  atgaatcccgagtatgattatctgttcaagctccttcttattggagactctggtgttggt 155

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||||| || ||||| ||| | |||||||| ||  | || ||||| || || || 
Sbjct: 156 aaatcatgccttcttctgagattttctgatgattcgtacatcgaaagctacataagcacc 215

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||| || ||||| || ||||||||||||||||| ||||| || || || || 
Sbjct: 216 attggagttgattttaaaatacgtaccgttgagcaagatggaaagaccattaaactacag 275

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || ||||||||||||||||||||||| ||||| || |||||||||||||||
Sbjct: 276 atctgggacacagctgggcaagaacgatttaggacaatcaccagtagctactaccgtggt 335

                                                             
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
           |||||||| |||||| | || ||||||||||| ||  | |||||||||||
Sbjct: 336 gcccatgggatcattattgtttatgatgtgacagatgaagagagcttcaa 385

---

>emb|BX831925.1|CNS09ZKA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH3ZC07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 844

 Score =  145 bits (73), Expect = 1e-31
 Identities = 278/345 (80%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || ||||||||||| || |||||||| ||||| ||||| || || || || || 
Sbjct: 81  atgaatcctgaatatgactatctgttcaagcttctgcttattggtgattctggtgttgga 140

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||| |||| || || ||||| |||||||| || || || ||||| || || || 
Sbjct: 141 aaatcatgcttgcttctaagatttgctgatgattcttacctggatagctacataagcacc 200

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| |||||||| ||||| || || |||||||| || || ||||| || || || || 
Sbjct: 201 attggtgttgactttaaaattcgaacagttgagcaggacggaaagaccatcaaactccag 260

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || |||||||| || ||||| ||||| |||||||||||| | || 
Sbjct: 261 atctgggaaacagcaggccaagaacgtttcaggacaatcactagcagctactacagagga 320

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaa 399
           || ||||| |||||||||   |||||||| || ||||  |||||||||||| ||||||||
Sbjct: 321 gctcatgggatcattgtcacttatgatgtcacagacctagagagcttcaacaacgtcaaa 380

                                                        
Query: 400 cagtggcttaatgaaattgacaggtacgctagtgaaaatgtgaac 444
           || ||||| |||||||||||| | |||||||| ||||||||||||
Sbjct: 381 caatggctgaatgaaattgaccgttacgctagcgaaaatgtgaac 425

---

>gb|L27417.1|SOYGTPBIND Soybean GTP binding protein mRNA, complete cds
          Length = 1025

 Score =  143 bits (72), Expect = 6e-31
 Identities = 222/272 (81%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| ||||| ||||| || || |||||||| || || ||||| ||||| || || || 
Sbjct: 127 atgaatcccgagtatgattatctgttcaagctccttcttattggagactctggtgttggt 186

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           || || ||||| || ||||| ||| | |||||||| ||  | || ||||| || || || 
Sbjct: 187 aaatcatgccttcttctgagattttctgatgattcgtacatcgaaagctacataagcacc 246

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||| || ||||| || ||||||||||||||||| ||||| || || || || 
Sbjct: 247 attggagttgattttaaaatacgtaccgttgagcaagatggaaagaccattaaactacag 306

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || ||||||||||||||||||||||| ||||| || |||||||||||||||
Sbjct: 307 atctgggacacagctgggcaagaacgatttaggacaatcaccagtagctactaccgtggt 366

                                           
Query: 341 gcccatggcatcattgtcgtgtatgatgtgac 372
           |||||||| |||||| | || |||||||||||
Sbjct: 367 gcccatgggatcattattgtttatgatgtgac 398

---

>dbj|D12549.1|PEAGTPBP10 Pisum sativum mRNA for GTP-binding protein, complete cds,
           clone:pra9B
          Length = 864

 Score =  141 bits (71), Expect = 2e-30
 Identities = 236/291 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| || || |||||||| || || ||||| ||||| || || ||
Sbjct: 68  catgaatcccgaatatgattatctgttcaagctccttcttattggagactctggtgttgg 127

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            || || ||||| || || || ||||| |||||||||||  |||| ||||| || || ||
Sbjct: 128 taaatcgtgccttcttctaagatttgctgatgattcatacattgaaagctacataagcac 187

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
           |||||| ||||| || ||||| || || |||||||| ||||||||||| || || || ||
Sbjct: 188 tattggagttgattttaaaatacggactgttgagcaggatgggaagacaattaaactaca 247

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
            ||||||||||| || || ||||||||||||||||| || || || |||||||| |||||
Sbjct: 248 gatttgggataccgccggacaagaacgatttaggacaataaccagtagctactatcgtgg 307

                                                              
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa 390
            || ||||| |||||| | || ||||||||||| ||  | |||||||||||
Sbjct: 308 ggcacatggaatcattattgtttatgatgtgacagatgaagagagcttcaa 358

---

>ref|XM_860883.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene
           family, transcript variant 5 (LOC610762), mRNA
          Length = 979

 Score =  137 bits (69), Expect = 3e-29
 Identities = 234/289 (80%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| || ||||
Sbjct: 134 ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgattcgg 193

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  ||||    |||||||| |
Sbjct: 194 gcgtgggcaagtcatgcctgcttctgcggtttgctgatgacacatacacagagagctaca 253

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || ||||| || |||||||| ||||| ||| ||||||  ||||| || || || |
Sbjct: 254 tcagcaccattggggtggacttcaagatccgaaccattgagctggatggcaaaaccatca 313

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || ||||| || || || ||  ||||||||||   ||||||||
Sbjct: 314 aacttcagatctgggacacagctggtcaggagcggttccggaccatcacttccagctact 373

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 374 accggggggctcatggcatcattgtggtgtacgatgtcaccgaccagga 422

---

>ref|XM_860865.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene
           family, transcript variant 4 (LOC610762), mRNA
          Length = 483

 Score =  137 bits (69), Expect = 3e-29
 Identities = 234/289 (80%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| || ||||
Sbjct: 82  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgattcgg 141

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  ||||    |||||||| |
Sbjct: 142 gcgtgggcaagtcatgcctgcttctgcggtttgctgatgacacatacacagagagctaca 201

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || ||||| || |||||||| ||||| ||| ||||||  ||||| || || || |
Sbjct: 202 tcagcaccattggggtggacttcaagatccgaaccattgagctggatggcaaaaccatca 261

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || ||||| || || || ||  ||||||||||   ||||||||
Sbjct: 262 aacttcagatctgggacacagctggtcaggagcggttccggaccatcacttccagctact 321

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 322 accggggggctcatggcatcattgtggtgtacgatgtcaccgaccagga 370

---

>ref|XM_847452.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene
           family, transcript variant 1 (LOC610762), mRNA
          Length = 1986

 Score =  137 bits (69), Expect = 3e-29
 Identities = 234/289 (80%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| || ||||
Sbjct: 134 ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgattcgg 193

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  ||||    |||||||| |
Sbjct: 194 gcgtgggcaagtcatgcctgcttctgcggtttgctgatgacacatacacagagagctaca 253

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || ||||| || |||||||| ||||| ||| ||||||  ||||| || || || |
Sbjct: 254 tcagcaccattggggtggacttcaagatccgaaccattgagctggatggcaaaaccatca 313

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || ||||| || || || ||  ||||||||||   ||||||||
Sbjct: 314 aacttcagatctgggacacagctggtcaggagcggttccggaccatcacttccagctact 373

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || |||||||||||||| ||||| ||||| || ||||||||
Sbjct: 374 accggggggctcatggcatcattgtggtgtacgatgtcaccgaccagga 422

---

>ref|XM_860855.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene
           family, transcript variant 3 (LOC610762), mRNA
          Length = 837

 Score =  135 bits (68), Expect = 1e-28
 Identities = 233/288 (80%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| || ||||
Sbjct: 82  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgattcgg 141

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  ||||    |||||||| |
Sbjct: 142 gcgtgggcaagtcatgcctgcttctgcggtttgctgatgacacatacacagagagctaca 201

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || ||||| || |||||||| ||||| ||| ||||||  ||||| || || || |
Sbjct: 202 tcagcaccattggggtggacttcaagatccgaaccattgagctggatggcaaaaccatca 261

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || ||||| || || || ||  ||||||||||   ||||||||
Sbjct: 262 aacttcagatctgggacacagctggtcaggagcggttccggaccatcacttccagctact 321

                                                           
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagg 380
           |||| || || |||||||||||||| ||||| ||||| || |||||||
Sbjct: 322 accggggggctcatggcatcattgtggtgtacgatgtcaccgaccagg 369

---

>emb|X13905.1|RNRAB1B Rat cDNA for ras-related rab1B protein
          Length = 654

 Score =  135 bits (68), Expect = 1e-28
 Identities = 230/284 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||||||||||
Sbjct: 9   gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactcgggcgtg 68

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 69  ggcaagtcatgcctgcttctgcggtttgctgatgacacgtacacagagagctacatcagc 128

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || ||||| || |||||||| || || ||| |||| |  ||||| || || || || || 
Sbjct: 129 accattggggtggacttcaagattcgaaccattgaactggatggcaaaaccatcaaacta 188

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || ||||| || |||||  ||||   ||||||||| || 
Sbjct: 189 cagatttgggacacagctggtcaggaacggttcaggacagtcacttccagctactatcgg 248

                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           ||||| |||||||||||||| |||||||| || |||||||||||
Sbjct: 249 ggtgctcatggcatcattgtggtgtatgacgtcactgaccagga 292

---

>gb|AF108883.1|AF108883 Capsicum annuum small GTP-binding protein mRNA, complete cds
          Length = 1134

 Score =  129 bits (65), Expect = 8e-27
 Identities = 236/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||||||| | ||||| || ||| | || || || || || || ||
Sbjct: 130 catgaatcccgaatatgactacttgttcaaacttctgttgataggagattcaggtgttgg 189

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||| || || || ||||| ||||| ||||| || ||| | || ||||| ||||| ||
Sbjct: 190 aaagtcatgtcttctcctgagatttgccgatgactcttatttggacagctacatcagcac 249

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| |||||||| ||||| || || || ||||||||||||||||| || || || ||
Sbjct: 250 aattggtgttgactttaaaatacgtactgtggagcaagatgggaagactattaaacttca 309

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||||||||| |||||||| |||||||| || ||||| |||||||| || |||||||||||
Sbjct: 310 aatttgggacactgctggacaagaacgtttcaggacaatcacaagtagttactaccgtgg 369

                                                                
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaaca 392
            || |||||||| ||  | || |||||| | ||||| || || ||||||||||
Sbjct: 370 ggcacatggcataataatagtttatgatataactgatcaagaaagcttcaaca 422

---

>ref|NM_201142.1| Danio rerio zgc:56049 (zgc:56049), mRNA
          Length = 2982

 Score =  127 bits (64), Expect = 3e-26
 Identities = 229/284 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| || |||||||||||||| |||||| |||| ||||| || ||||| || |||
Sbjct: 270 gccatgaatcctgaatatgactacctgttcaagttgctcctcatcggtgactctggagtg 329

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| || ||| || |||| ||||| |||||  ||||   ||||||||||||||| 
Sbjct: 330 ggaaagtcgtgtctgttgttgagatttgctgatgacacatacactgagagctatatcagc 389

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || ||||| |||||||| ||||||||| |||| |  ||||| || || || ||||| 
Sbjct: 390 accatcggcgtggacttcaagatccgcaccattgaacttgatggcaaaaccattaagcta 449

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || || ||||||||||| ||||||||| ||||| | || |||||   ||| ||||| || 
Sbjct: 450 cagatatgggatactgcagggcaagaaagatttcgaactatcacctccagttactatcga 509

                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           || || ||||| |||||||| || ||||||||||| || |||||
Sbjct: 510 ggggctcatggaatcattgtggtctatgatgtgacggatcagga 553

---

>gb|BC047816.1| Danio rerio zgc:56049, mRNA (cDNA clone MGC:56049 IMAGE:3820257),
           complete cds
          Length = 2982

 Score =  127 bits (64), Expect = 3e-26
 Identities = 229/284 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||| || |||||||||||||| |||||| |||| ||||| || ||||| || |||
Sbjct: 270 gccatgaatcctgaatatgactacctgttcaagttgctcctcatcggtgactctggagtg 329

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| || ||| || |||| ||||| |||||  ||||   ||||||||||||||| 
Sbjct: 330 ggaaagtcgtgtctgttgttgagatttgctgatgacacatacactgagagctatatcagc 389

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || ||||| |||||||| ||||||||| |||| |  ||||| || || || ||||| 
Sbjct: 390 accatcggcgtggacttcaagatccgcaccattgaacttgatggcaaaaccattaagcta 449

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || || ||||||||||| ||||||||| ||||| | || |||||   ||| ||||| || 
Sbjct: 450 cagatatgggatactgcagggcaagaaagatttcgaactatcacctccagttactatcga 509

                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           || || ||||| |||||||| || ||||||||||| || |||||
Sbjct: 510 ggggctcatggaatcattgtggtctatgatgtgacggatcagga 553

---

>gb|U38466.1|SLU38466 Solanum lycopersicum small GTP-binding protein  (LeRab1C) mRNA,
           complete cds
          Length = 1082

 Score =  127 bits (64), Expect = 3e-26
 Identities = 148/176 (84%)
 Strand = Plus / Plus

                                                                       
Query: 176 ctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgttgacttc 235
           ||||| ||||| |||||||| ||| | || ||||| ||||| || ||||| |||||||| 
Sbjct: 184 ctgagatttgccgatgattcttatttggacagctacatcagcacaattggtgttgacttt 243

                                                                       
Query: 236 aaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactgct 295
           ||||| || || || ||||||||||||||||| || || || ||||||||||| ||||||
Sbjct: 244 aaaatacgtactgtggagcaagatgggaagactattaaacttcaaatttgggacactgct 303

                                                                   
Query: 296 gggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcat 351
           || |||||||| || ||||| |||||||| || ||||||||||| || ||||||||
Sbjct: 304 ggacaagaacgtttcaggacaatcacaagtagttactaccgtggggcacatggcat 359

---

>gb|BC016408.1| Mus musculus RAB1B, member RAS oncogene family, mRNA (cDNA clone
           MGC:25456 IMAGE:4242206), complete cds
          Length = 1859

 Score =  121 bits (61), Expect = 2e-24
 Identities = 229/285 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 51  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactccggcgtg 110

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 111 ggcaagtcgtgcctgctcctgcggtttgctgatgacacttacacagagagctacatcagc 170

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || || ||||| || || ||| ||||||  || || || || || || |||
Sbjct: 171 accatcggtgtggatttcaagattcgaaccattgagctggacggcaaaaccatcaaactg 230

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || || || || |||||||||||   ||||||||| || 
Sbjct: 231 cagatttgggacacagctggtcaggagcggttcaggaccatcacttccagctactatcgc 290

                                                        
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           || || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 291 ggggctcatggcatcattgtggtgtatgacgtcactgaccaggag 335

---

>ref|NM_029576.1| Mus musculus RAB1B, member RAS oncogene family (Rab1b), mRNA
          Length = 1837

 Score =  121 bits (61), Expect = 2e-24
 Identities = 229/285 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 57  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactccggcgtg 116

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 117 ggcaagtcgtgcctgctcctgcggtttgctgatgacacttacacagagagctacatcagc 176

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || || ||||| || || ||| ||||||  || || || || || || |||
Sbjct: 177 accatcggtgtggatttcaagattcgaaccattgagctggacggcaaaaccatcaaactg 236

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || || || || |||||||||||   ||||||||| || 
Sbjct: 237 cagatttgggacacagctggtcaggagcggttcaggaccatcacttccagctactatcgc 296

                                                        
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           || || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 297 ggggctcatggcatcattgtggtgtatgacgtcactgaccaggag 341

---

>emb|Z73931.1|LJRAB1B L.japonicus mRNA for small GTP-binding protein,
          Length = 860

 Score =  121 bits (61), Expect = 2e-24
 Identities = 199/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 125 ttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgctgctgaggttt 184
           |||||||| || || ||||| ||||| || || || || || ||||| || ||||| |||
Sbjct: 1   ttcaagctccttcttattggtgactctggtgttggcaaatcatgccttcttctgagattt 60

                                                                       
Query: 185 gcggatgattcatatcttgagagctatatcagtactattggcgttgacttcaaaatccgc 244
           || |||||||||||  |||||||||| || || || ||||| ||||| || ||||| |||
Sbjct: 61  gctgatgattcatacattgagagctacataagcacaattggagttgattttaaaatacgc 120

                                                                       
Query: 245 accgttgagcaagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaa 304
           ||||||||||| ||||  || || || || || || || |||||||| ||||||||||||
Sbjct: 121 accgttgagcaggatgcaaaaaccattaaactccagatctgggatacagctgggcaagaa 180

                                                                       
Query: 305 cgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtat 364
            |||||||||| ||||| || |||||||||||||| || || || |||||| | || |||
Sbjct: 181 agatttaggacaatcaccagtagctactaccgtggggcacacgggatcattattgtttat 240

                
Query: 365 gatgt 369
           |||||
Sbjct: 241 gatgt 245

---

>emb|CR857726.1| Pongo pygmaeus mRNA; cDNA DKFZp469I1235 (from clone DKFZp469I1235)
          Length = 1922

 Score =  121 bits (61), Expect = 2e-24
 Identities = 229/285 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 56  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtg 115

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 116 ggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagc 175

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || |||||||| ||||| ||| | |||| |||||| || || || || || 
Sbjct: 176 accatcggggtggacttcaagatccgaaccatcgagctagatggcaaaactatcaaactt 235

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || || ||||| || || || || ||||| ||  ||||||||||   |||||||||||| 
Sbjct: 236 cagatctgggacacagcgggccaggaacggttccggaccatcacttccagctactaccgg 295

                                                        
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           || || ||||||||||| || |||||||| || ||||||||||||
Sbjct: 296 ggggctcatggcatcatcgtggtgtatgacgtcactgaccaggag 340

---

>dbj|AK156726.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830044G10 product:Ras-related protein
           Rab-1B homolog [Homo sapiens], full insert sequence
          Length = 1858

 Score =  121 bits (61), Expect = 2e-24
 Identities = 229/285 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 79  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactccggcgtg 138

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 139 ggcaagtcgtgcctgctcctgcggtttgctgatgacacttacacagagagctacatcagc 198

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || || ||||| || || ||| ||||||  || || || || || || |||
Sbjct: 199 accatcggtgtggatttcaagattcgaaccattgagctggacggcaaaaccatcaaactg 258

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || || || || |||||||||||   ||||||||| || 
Sbjct: 259 cagatttgggacacagctggtcaggagcggttcaggaccatcacttccagctactatcgc 318

                                                        
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           || || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 319 ggggctcatggcatcattgtggtgtatgacgtcactgaccaggag 363

---

>dbj|AK003609.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110011F09 product:RAS-RELATED
           PROTEIN RAB-1B homolog [Rattus norvegicus], full insert
           sequence
          Length = 1837

 Score =  121 bits (61), Expect = 2e-24
 Identities = 229/285 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 57  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactccggcgtg 116

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 117 ggcaagtcgtgcctgctcctgcggtttgctgatgacacttacacagagagctacatcagc 176

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || || ||||| || || ||| ||||||  || || || || || || |||
Sbjct: 177 accatcggtgtggatttcaagattcgaaccattgagctggacggcaaaaccatcaaactg 236

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || || || || |||||||||||   ||||||||| || 
Sbjct: 237 cagatttgggacacagctggtcaggagcggttcaggaccatcacttccagctactatcgc 296

                                                        
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           || || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 297 ggggctcatggcatcattgtggtgtatgacgtcactgaccaggag 341

---

>dbj|AK042020.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630052K04 product:Ras-related protein
           Rab-1B homolog [Homo sapiens], full insert sequence
          Length = 1833

 Score =  121 bits (61), Expect = 2e-24
 Identities = 229/285 (80%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 58  gccatgaaccccgaatatgactacctgtttaagctgcttatgattggtgactccggcgtg 117

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 118 ggcaagtcgtgcctgctcctgcggtttgctgatgacacttacacagagagctacatcagc 177

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || || ||||| || || ||| ||||||  || || || || || || |||
Sbjct: 178 accatcggtgtggatttcaagattcgaaccattgagctggacggcaaaaccatcaaactg 237

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || |||||||| || ||||| || || || || |||||||||||   ||||||||| || 
Sbjct: 238 cagatttgggacacagctggtcaggagcggttcaggaccatcacttccagctactatcgc 297

                                                        
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           || || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 298 ggggctcatggcatcattgtggtgtatgacgtcactgaccaggag 342

---

>gb|L48181.1|BNAYPTRP Brassica campestris L. pekinensis ypt-related protein mRNA,
           complete cds
          Length = 817

 Score =  119 bits (60), Expect = 8e-24
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                       
Query: 215 agtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaag 274
           ||||| ||||| ||||||||||||||  | ||  ||||||| |||||||||||||| |||
Sbjct: 166 agtaccattggtgttgacttcaaaattaggacgattgagcaggatgggaagacgattaag 225

                                                                       
Query: 275 ctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactac 334
           |||||||| ||||||||||||||||| || || || ||||||||||| ||||||||||||
Sbjct: 226 ctgcaaatctgggatactgctgggcaggagcgtttcaggaccatcactagcagctactac 285

---

>ref|NM_030981.1| Homo sapiens RAB1B, member RAS oncogene family (RAB1B), mRNA
          Length = 1985

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 40  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 99

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 100 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 159

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 160 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 219

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 220 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 279

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 280 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 328

---

>gb|BC028331.1| Homo sapiens RAB1B, member RAS oncogene family, mRNA (cDNA clone
           IMAGE:4537849)
          Length = 1926

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 39  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 98

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 99  gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 158

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 159 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 218

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 219 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 278

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 279 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 327

---

>emb|AL136635.1|HSM801608 Homo sapiens mRNA; cDNA DKFZp564I172 (from clone DKFZp564I172)
          Length = 1985

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 40  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 99

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 100 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 159

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 160 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 219

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 220 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 279

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 280 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 328

---

>emb|CR625419.1| full-length cDNA clone CS0DM005YB17 of Fetal liver of Homo sapiens
           (human)
          Length = 1844

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 16  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 75

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 76  gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 135

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 136 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 195

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 196 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 255

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 256 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 304

---

>emb|CR624810.1| full-length cDNA clone CS0DI083YB01 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1851

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 26  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 85

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 86  gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 145

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 146 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 205

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 206 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 265

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 266 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 314

---

>emb|CR620997.1| full-length cDNA clone CS0DI067YJ10 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1809

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 3   ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 62

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 63  gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 122

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 123 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 182

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 183 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 242

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 243 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 291

---

>emb|CR612971.1| full-length cDNA clone CS0DG006YF11 of B cells (Ramos cell line) of
           Homo sapiens (human)
          Length = 1901

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 68  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 127

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 128 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 187

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 188 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 247

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 248 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 307

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 308 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 356

---

>emb|CR598883.1| full-length cDNA clone CS0DB004YE12 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1894

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 47  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 106

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 107 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 166

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 167 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 226

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 227 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 286

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 287 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 335

---

>emb|CR595400.1| full-length cDNA clone CS0DB002YO10 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1882

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 47  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 106

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 107 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 166

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 167 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 226

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 227 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 286

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 287 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 335

---

>emb|CR592347.1| full-length cDNA clone CS0DH004YE13 of T cells (Jurkat cell line)
           of Homo sapiens (human)
          Length = 1868

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 39  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 98

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 99  gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 158

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 159 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 218

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 219 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 278

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 279 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 327

---

>emb|CR591273.1| full-length cDNA clone CS0DC025YE18 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1895

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 68  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 127

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 128 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 187

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 188 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 247

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 248 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 307

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 308 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 356

---

>gb|BC071169.1| Homo sapiens RAB1B, member RAS oncogene family, mRNA (cDNA clone
           MGC:87903 IMAGE:6026121), complete cds
          Length = 1956

 Score =  113 bits (57), Expect = 5e-22
 Identities = 231/289 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 27  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 86

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 87  gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 146

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 147 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 206

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 207 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 266

                                                            
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||| || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 267 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 315

---

>gb|AF092437.1| Homo sapiens rab1B mRNA, complete cds
          Length = 1038

 Score =  111 bits (56), Expect = 2e-21
 Identities = 227/284 (79%)
 Strand = Plus / Plus

                                                                       
Query: 98  gccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtg 157
           |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| ||||||
Sbjct: 11  gccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtg 70

                                                                       
Query: 158 gggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagt 217
           || ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| 
Sbjct: 71  ggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagc 130

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           || || || || |||||||| ||||| ||| | ||||  ||||| || || || || || 
Sbjct: 131 accatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaactt 190

                                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgt 337
           || || ||||| || || || || ||||| ||  ||||||||||   |||||||||||| 
Sbjct: 191 cagatctgggacacagcgggccaggaacggttccggaccatcacttccagctactaccgg 250

                                                       
Query: 338 ggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           || || ||||||||||| || |||||||| || |||||||||||
Sbjct: 251 ggggctcatggcatcatcgtggtgtatgacgtcactgaccagga 294

---

>ref|NM_112005.2| Arabidopsis thaliana ATFP8; GTP binding AT3G11730 (ATFP8) mRNA,
           complete cds
          Length = 868

 Score =  109 bits (55), Expect = 8e-21
 Identities = 115/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||||||||||||  | ||  ||||||| |||||||||||||| |||||||||
Sbjct: 207 attggtgttgacttcaaaattaggacgattgagcaggatgggaagacgattaagctgcaa 266

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||||||||| || || || || ||||||||||| |||||||| ||| | || 
Sbjct: 267 atttgggatactgctggacaggagcgtttcaggaccatcactagcagctattacagagga 326

                          
Query: 341 gcccatggcatcatt 355
           || ||||| ||||||
Sbjct: 327 gctcatggaatcatt 341

---

>emb|BX825467.1|CNS0A69O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL38ZG11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 833

 Score =  109 bits (55), Expect = 8e-21
 Identities = 115/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||||||||||||  | ||  ||||||| |||||||||||||| |||||||||
Sbjct: 224 attggtgttgacttcaaaattaggacgattgagcaggatgggaagacgattaagctgcaa 283

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||||||||| || || || || ||||||||||| |||||||| ||| | || 
Sbjct: 284 atttgggatactgctggacaggagcgtttcaggaccatcactagcagctattacagagga 343

                          
Query: 341 gcccatggcatcatt 355
           || ||||| ||||||
Sbjct: 344 gctcatggaatcatt 358

---

>gb|BT005576.1| Arabidopsis thaliana clone U50900 putative GTP-binding protein
           (ATFP8) (At3g11730) mRNA, complete cds
          Length = 649

 Score =  109 bits (55), Expect = 8e-21
 Identities = 115/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||||||||||||  | ||  ||||||| |||||||||||||| |||||||||
Sbjct: 121 attggtgttgacttcaaaattaggacgattgagcaggatgggaagacgattaagctgcaa 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||||||||| || || || || ||||||||||| |||||||| ||| | || 
Sbjct: 181 atttgggatactgctggacaggagcgtttcaggaccatcactagcagctattacagagga 240

                          
Query: 341 gcccatggcatcatt 355
           || ||||| ||||||
Sbjct: 241 gctcatggaatcatt 255

---

>dbj|AK118150.1| Arabidopsis thaliana At3g11730 mRNA for putative GTP-binding
           protein (ATFP8), complete cds, clone: RAFL19-45-D16
          Length = 889

 Score =  109 bits (55), Expect = 8e-21
 Identities = 115/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||||||||||||  | ||  ||||||| |||||||||||||| |||||||||
Sbjct: 228 attggtgttgacttcaaaattaggacgattgagcaggatgggaagacgattaagctgcaa 287

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||||||||| || || || || ||||||||||| |||||||| ||| | || 
Sbjct: 288 atttgggatactgctggacaggagcgtttcaggaccatcactagcagctattacagagga 347

                          
Query: 341 gcccatggcatcatt 355
           || ||||| ||||||
Sbjct: 348 gctcatggaatcatt 362

---

>gb|U64911.1|ATU64911 Arabidopsis thaliana isoprenylated protein ATFP8 mRNA, complete cds
          Length = 838

 Score =  109 bits (55), Expect = 8e-21
 Identities = 115/135 (85%)
 Strand = Plus / Plus

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| ||||||||||||||  | ||  ||||||| |||||||||||||| |||||||||
Sbjct: 204 attggtgttgacttcaaaattaggacgattgagcaggatgggaagacgattaagctgcaa 263

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           ||||||||||||||||| || || || || ||||||||||| |||||||| ||| | || 
Sbjct: 264 atttgggatactgctggacaggagcgtttcaggaccatcactagcagctattacagagga 323

                          
Query: 341 gcccatggcatcatt 355
           || ||||| ||||||
Sbjct: 324 gctcatggaatcatt 338

---

>ref|XM_860833.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene
           family, transcript variant 2 (LOC610762), mRNA
          Length = 1799

 Score =  107 bits (54), Expect = 3e-20
 Identities = 135/162 (83%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| || ||||
Sbjct: 43  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgattcgg 102

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  ||||    |||||||| |
Sbjct: 103 gcgtgggcaagtcatgcctgcttctgcggtttgctgatgacacatacacagagagctaca 162

                                                     
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagc 254
           |||| || ||||| || |||||||| ||||| ||| ||||||
Sbjct: 163 tcagcaccattggggtggacttcaagatccgaaccattgagc 204

---

>ref|XM_697369.1| PREDICTED: Danio rerio hypothetical protein LOC555127 (LOC555127),
           mRNA
          Length = 2689

 Score =  107 bits (54), Expect = 3e-20
 Identities = 207/258 (80%)
 Strand = Plus / Plus

                                                                       
Query: 115 tgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
           ||||||||| |||||| |||| ||||| || ||||| || ||||| ||||| || ||| |
Sbjct: 1   tgactacctgttcaagttgctcctcatcggtgactctggagtgggaaagtcgtgtctgtt 60

                                                                       
Query: 175 gctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgttgactt 234
           | |||| ||||| |||||  ||||   ||||||||||||||| || || ||||| |||||
Sbjct: 61  gttgagatttgctgatgacacatacactgagagctatatcagcaccatcggcgtggactt 120

                                                                       
Query: 235 caaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactgc 294
           ||| ||||||||| |||| |  ||||| || || || ||||| || || |||||||||||
Sbjct: 121 caagatccgcaccattgaacttgatggcaaaaccattaagctacagatatgggatactgc 180

                                                                       
Query: 295 tgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcat 354
            ||||||||| ||||| | || |||||   ||| ||||| || || || ||||| |||||
Sbjct: 181 agggcaagaaagatttcgaactatcacctccagttactatcgaggggctcatggaatcat 240

                             
Query: 355 tgtcgtgtatgatgtgac 372
           ||| || |||||||||||
Sbjct: 241 tgtggtttatgatgtgac 258

---

>dbj|AB168324.1| Macaca fascicularis testis cDNA clone: QtsA-11222, similar to human
           RAB1B, member RAS oncogene family (RAB1B), mRNA, RefSeq:
           NM_030981.1
          Length = 2028

 Score =  107 bits (54), Expect = 3e-20
 Identities = 231/290 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| ||||| |
Sbjct: 77  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcag 136

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| |
Sbjct: 137 gcgtgggcaagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctaca 196

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| | ||||  ||||| || || || |
Sbjct: 197 tcagcaccatcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatca 256

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || || || || ||||| ||  ||||||||||   ||||||||
Sbjct: 257 aacttcagatctgggacacagcgggccaggaacggttccggaccatcacttccagctact 316

                                                             
Query: 333 accgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||| || || ||||||||||| || |||||||| || ||||||| ||||
Sbjct: 317 accggggggctcatggcatcatcgtggtgtatgacgtcactgaccgggag 366

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                            
Query: 115      tgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
                |||||||||||||||||| |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 21141879 tgactacctcttcaagcttctgctcatcggagactcgggcgtcgggaagtcttgcctgct 21141820

                              
Query: 175      gctgaggtttgcgg 188
                 |||||||||||||
Sbjct: 21141819 tctgaggtttgcgg 21141806



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                            
Query: 284      tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
                |||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 21140693 tgggatactgctggccaagagcgatttaggaccattacaagcagctactaccgtggtgcc 21140634

                              
Query: 344      catggcatcattgt 357
                || || ||||||||
Sbjct: 21140633 cacgggatcattgt 21140620



 Score =  103 bits (52), Expect = 5e-19
 Identities = 77/84 (91%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                            
Query: 362      tatgatgtgactgaccaggagagcttcaacac-gtcaaacagtggcttaatgaaattgac 420
                |||||||||||||| ||||||||||||||||  ||||| |||||||| ||||||||||| 
Sbjct: 21140528 tatgatgtgactgatcaggagagcttcaacaatgtcaagcagtggctgaatgaaattgat 21140469

                                        
Query: 421      aggtacgctagtgaaaatgtgaac 444
                ||||| ||||||||||||||||||
Sbjct: 21140468 aggtatgctagtgaaaatgtgaac 21140445



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                                
Query: 236      aaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatt 283
                ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 21140829 aaaatccgcactgttgagcaagatgggaagacaataaagctgcaaatt 21140782



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                           
Query: 284     tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
               |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 4160700 tgggatactgctggacaagaacgtttcaggacgattacaagcagctattaccggggagct 4160641

                             
Query: 344     catggcatcattgt 357
               ||||| || |||||
Sbjct: 4160640 catggaataattgt 4160627



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 191      gattcatatcttgagagctatatcagtac 219
                ||||||||||| |||||||||||||||||
Sbjct: 21140967 gattcatatctggagagctatatcagtac 21140939

---

>dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1144D11
          Length = 157943

 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                          
Query: 115    tgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
              |||||||||||||||||| |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 109424 tgactacctcttcaagcttctgctcatcggagactcgggcgtcgggaagtcttgcctgct 109365

                            
Query: 175    gctgaggtttgcgg 188
               |||||||||||||
Sbjct: 109364 tctgaggtttgcgg 109351



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                          
Query: 284    tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
              |||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 108238 tgggatactgctggccaagagcgatttaggaccattacaagcagctactaccgtggtgcc 108179

                            
Query: 344    catggcatcattgt 357
              || || ||||||||
Sbjct: 108178 cacgggatcattgt 108165



 Score =  103 bits (52), Expect = 5e-19
 Identities = 77/84 (91%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                          
Query: 362    tatgatgtgactgaccaggagagcttcaacac-gtcaaacagtggcttaatgaaattgac 420
              |||||||||||||| ||||||||||||||||  ||||| |||||||| ||||||||||| 
Sbjct: 108073 tatgatgtgactgatcaggagagcttcaacaatgtcaagcagtggctgaatgaaattgat 108014

                                      
Query: 421    aggtacgctagtgaaaatgtgaac 444
              ||||| ||||||||||||||||||
Sbjct: 108013 aggtatgctagtgaaaatgtgaac 107990



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                              
Query: 236    aaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatt 283
              ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 108374 aaaatccgcactgttgagcaagatgggaagacaataaagctgcaaatt 108327



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 191    gattcatatcttgagagctatatcagtac 219
              ||||||||||| |||||||||||||||||
Sbjct: 108512 gattcatatctggagagctatatcagtac 108484

---

>dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1064G04
          Length = 186704

 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                         
Query: 115   tgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
             |||||||||||||||||| |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 39388 tgactacctcttcaagcttctgctcatcggagactcgggcgtcgggaagtcttgcctgct 39329

                           
Query: 175   gctgaggtttgcgg 188
              |||||||||||||
Sbjct: 39328 tctgaggtttgcgg 39315



 Score =  107 bits (54), Expect = 3e-20
 Identities = 69/74 (93%)
 Strand = Plus / Minus

                                                                         
Query: 284   tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
             |||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||
Sbjct: 38202 tgggatactgctggccaagagcgatttaggaccattacaagcagctactaccgtggtgcc 38143

                           
Query: 344   catggcatcattgt 357
             || || ||||||||
Sbjct: 38142 cacgggatcattgt 38129



 Score =  103 bits (52), Expect = 5e-19
 Identities = 77/84 (91%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                         
Query: 362   tatgatgtgactgaccaggagagcttcaacac-gtcaaacagtggcttaatgaaattgac 420
             |||||||||||||| ||||||||||||||||  ||||| |||||||| ||||||||||| 
Sbjct: 38037 tatgatgtgactgatcaggagagcttcaacaatgtcaagcagtggctgaatgaaattgat 37978

                                     
Query: 421   aggtacgctagtgaaaatgtgaac 444
             ||||| ||||||||||||||||||
Sbjct: 37977 aggtatgctagtgaaaatgtgaac 37954



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                             
Query: 236   aaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatt 283
             ||||||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 38338 aaaatccgcactgttgagcaagatgggaagacaataaagctgcaaatt 38291



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 191   gattcatatcttgagagctatatcagtac 219
             ||||||||||| |||||||||||||||||
Sbjct: 38476 gattcatatctggagagctatatcagtac 38448

---

>emb|AJ245875.1|HSA245875 Homo sapiens complete mRNA for putative small GTP-binding protein
           (rab1b)
          Length = 1858

 Score =  105 bits (53), Expect = 1e-19
 Identities = 224/281 (79%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||||||||||||||||||||| || ||||||||  | ||||| ||||| |||||||| 
Sbjct: 1   atgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtgggc 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           ||||| |||||||| ||| ||||||| |||||  | ||    |||||||| ||||| || 
Sbjct: 61  aagtcatgcctgctcctgcggtttgctgatgacacgtacacagagagctacatcagcacc 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           || || || |||||||| ||||| ||| | ||||  ||||| || || || || || || 
Sbjct: 121 atcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaacttcag 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || || ||||| ||  ||||||||||   |||||||||||| || 
Sbjct: 181 atctgggacacagcgggccaggaacggttccggaccatcacttccagctactaccggggg 240

                                                    
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           || ||||||||||| || |||||||| || |||||||||||
Sbjct: 241 gctcatggcatcatcgtggtgtatgacgtcactgaccagga 281

---

>emb|Z73934.1|LJRAB1E L.japonicus mRNA for small GTP-binding protein, RAB1E
          Length = 860

 Score =  103 bits (52), Expect = 5e-19
 Identities = 211/264 (79%)
 Strand = Plus / Plus

                                                                       
Query: 92  tccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcg 151
           ||||| || ||||| ||||| ||||| || || |||||||| || || ||||| ||||| 
Sbjct: 17  tccgccgctatgaatcccgagtatgattatctgttcaagctccttcttattggagactct 76

                                                                       
Query: 152 ggcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctat 211
           || || || || || ||||| || ||||| ||||| |||||||| ||  |||| ||||| 
Sbjct: 77  ggtgttggaaaatcatgccttcttctgagatttgctgatgattcttacattgaaagctac 136

                                                                       
Query: 212 atcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgata 271
           || || || || || ||||| || ||||| ||||| |||||||| ||||  ||||| || 
Sbjct: 137 ataagcaccatcggagttgattttaaaattcgcactgttgagcaggatgcaaagaccatt 196

                                                                       
Query: 272 aagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctac 331
           || || || ||||||||||||||||||||||| || |||||||| || || || ||||||
Sbjct: 197 aaactacagatttgggatactgctgggcaagagcgttttaggacaataaccagtagctac 256

                                   
Query: 332 taccgtggtgcccatggcatcatt 355
           || ||||| || ||||| ||||||
Sbjct: 257 tatcgtggggctcatggaatcatt 280

---

>gb|U38465.1|SLU38465 Solanum lycopersicum small GTP-binding protein (LeRab1B) mRNA,
           complete cds
          Length = 860

 Score =  103 bits (52), Expect = 5e-19
 Identities = 191/236 (80%), Gaps = 1/236 (0%)
 Strand = Plus / Plus

                                                                       
Query: 188 gatgattcatatcttgagagctatatcagtactattggcgttgacttcaaaatccgcacc 247
           |||||||| ||| |||| || || || || || ||||| ||||| ||||||||  | || 
Sbjct: 157 gatgattcgtatgttgacagttacattagcaccattggagttgatttcaaaattaggact 216

                                                                       
Query: 248 gttgagcaagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacga 307
           || ||||| ||||| ||||| || |||||||||||||||||||||||||| || ||||| 
Sbjct: 217 gtggagcaggatggaaagacaatcaagctgcaaatttgggatactgctggacaggaacgt 276

                                                                       
Query: 308 tttaggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgat 367
           ||  |||| || |||||||| |||||| | || || ||||| || ||| | || ||||||
Sbjct: 277 ttccggactataacaagcagttactacaggggagcgcatgggattattattgtttatgat 336

                                                                   
Query: 368 gtgactgaccaggagagcttcaac-acgtcaaacagtggcttaatgaaattgacag 422
           || |||||   ||||||||||||| | ||||| || ||||| ||||||||||||||
Sbjct: 337 gtaactgaaatggagagcttcaacaatgtcaagcaatggctgaatgaaattgacag 392

---

>gb|DQ123952.1| Coffea arabica x Coffea canephora clone HT-SSH1-A04 mRNA sequence
          Length = 389

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/186 (82%), Gaps = 1/186 (0%)
 Strand = Plus / Plus

                                                                       
Query: 236 aaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactgct 295
           ||||| ||||| || ||||| |||||||| || || || || ||||||||||| ||||| 
Sbjct: 21  aaaatncgcacagtagagcacgatgggaaaaccattaaactccaaatttgggacactgca 80

                                                                       
Query: 296 gggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcatt 355
            |||||||||| |||||||| || ||||||||||| || ||||| || ||||| ||||||
Sbjct: 81  tggcaagaacgttttaggacaattacaagcagctattatcgtggcgctcatggtatcatt 140

                                                                       
Query: 356 gtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaacagtggcttaatgaa 414
           || || |||||||| || || || || ||||| ||  |||| || |||||||| ||||||
Sbjct: 141 gtggtttatgatgtcaccgatcaagaaagctttaataacgtaaagcagtggctgaatgaa 200

                 
Query: 415 attgac 420
           ||||||
Sbjct: 201 attgac 206

---

>gb|BC105393.1| Bos taurus cDNA clone MGC:128300 IMAGE:7960184, complete cds
          Length = 2022

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 209/262 (79%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| |||||||||||||||||||||||||| || ||||||||  | ||||| |||||||
Sbjct: 40  ccgccgccatgaaccccgaatatgactacctgtttaagctgcttttgattggtgactcgg 99

                                                                       
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctata 212
           ||||||| ||||| |||||||| ||  ||||||| |||||  ||||    |||||||| |
Sbjct: 100 gcgtgggcaagtcatgcctgctcctacggtttgctgatgacacatacacagagagctaca 159

                                                                       
Query: 213 tcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataa 272
           |||| || || || || |||||||| ||||| ||| ||||||  || || || || || |
Sbjct: 160 tcagcaccatcggggtggacttcaagatccgaaccattgagctggacggcaaaaccatca 219

                                                                       
Query: 273 agctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctact 332
           | || || || ||||| || ||||| || ||||| ||  ||||||||||   ||||||||
Sbjct: 220 aacttcagatctgggacacagctggtcaggaacggttccggaccatcacttccagctact 279

                                 
Query: 333 accgtggtgcccatggcatcat 354
           |||| || || || ||||||||
Sbjct: 280 accggggggctcacggcatcat 301

---

>emb|CR533462.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0317D for
           gene RAB1B, RAB1B, member RAS oncogene family; complete
           cds, incl. stopcodon
          Length = 757

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 223/281 (79%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||||||||||||||||||||| || ||||||||  | ||||| ||||| |||||||| 
Sbjct: 1   atgaaccccgaatatgactacctgtttaagctgcttttgattggcgactcaggcgtgggc 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           ||||| |||||||| ||| ||||||| |||||  | ||    |||| ||| ||||| || 
Sbjct: 61  aagtcatgcctgctcctgcggtttgctgatgacacgtacacagagaactacatcagcacc 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           || || || |||||||| ||||| ||| | ||||  ||||| || || || || || || 
Sbjct: 121 atcggggtggacttcaagatccgaaccatcgagctggatggcaaaactatcaaacttcag 180

                                                                       
Query: 281 atttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggt 340
           || ||||| || || || || ||||| ||  ||||||||||   |||||||||||| || 
Sbjct: 181 atctgggacacagcgggccaggaacggttccggaccatcacttccagctactaccggggg 240

                                                    
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           || ||||||||||| || |||||||| || |||||||||||
Sbjct: 241 gctcatggcatcatcgtggtgtatgacgtcactgaccagga 281

---

>emb|Z73933.1|LJRAB1D L.japonicus mRNA for small GTP-binding protein, RAB1D
          Length = 1129

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 210/264 (79%)
 Strand = Plus / Plus

                                                                       
Query: 92  tccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcg 151
           ||||| || ||||| ||||| ||||| || || |||||||| || || ||||| ||||| 
Sbjct: 268 tccgccgctatgaatcccgagtatgattatctgttcaagctccttcttattggagactct 327

                                                                       
Query: 152 ggcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctat 211
           || || || || || ||||| || ||||| ||||  |||||||| ||  |||| ||||| 
Sbjct: 328 ggtgttggaaaatcatgccttcttctgagatttggtgatgattcttacattgaaagctac 387

                                                                       
Query: 212 atcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgata 271
           || || || || || ||||| || ||||| ||||| |||||||| ||||  ||||| || 
Sbjct: 388 ataagcaccatcggagttgattttaaaattcgcactgttgagcaggatgcaaagaccatt 447

                                                                       
Query: 272 aagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctac 331
           || || || ||||||||||||||||||||||| || |||||||| || || || ||||||
Sbjct: 448 aaactacagatttgggatactgctgggcaagagcgttttaggacaataaccagtagctac 507

                                   
Query: 332 taccgtggtgcccatggcatcatt 355
           || ||||| || ||||| ||||||
Sbjct: 508 tatcgtggggctcatggaatcatt 531

---

>gb|AF454362.1| Pythium graminicola isolate graminicolaTN ras-like protein gene,
           partial cds
          Length = 399

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 136/164 (82%), Gaps = 1/164 (0%)
 Strand = Plus / Plus

                                                                       
Query: 257 gatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggacc 316
           ||||| |||||||| ||||| || ||||||||||| || || || ||||| ||  | || 
Sbjct: 119 gatggcaagacgatcaagcttcagatttgggataccgccggccaggaacgtttccgcacg 178

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| ||||| |||||||||||||| || || |||||||||||||| |||||||| |||
Sbjct: 179 atcactagcagttactaccgtggtgcacacggtatcattgtcgtgtacgatgtgacggac 238

                                                       
Query: 377 caggagagcttcaac-acgtcaaacagtggcttaatgaaattga 419
           ||||||   |||||| ||||||| || |||||  ||||||||||
Sbjct: 239 caggagtcattcaacaacgtcaagcaatggctgcatgaaattga 282

---

>gb|AF454360.1| Pythium myriotylum isolate P30 ras-like protein gene, partial cds
          Length = 373

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 139/168 (82%), Gaps = 1/168 (0%)
 Strand = Plus / Plus

                                                                       
Query: 263 aagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcaca 322
           ||||| || ||||| || ||||||||||| ||||| || ||||| ||  | |||||||| 
Sbjct: 117 aagaccatcaagctccagatttgggatacggctggtcaggaacgtttccgtaccatcacg 176

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           ||||||||||||||||| ||||| |||||||| || ||||| ||||| || || ||||||
Sbjct: 177 agcagctactaccgtggcgcccacggcatcatcgttgtgtacgatgtcacggatcaggag 236

                                                           
Query: 383 agcttcaac-acgtcaaacagtggcttaatgaaattgacaggtacgct 429
              |||||| ||||||| ||||||||  |||| |||||| ||||||||
Sbjct: 237 tcgttcaacaacgtcaagcagtggctgcatgagattgaccggtacgct 284

---

>dbj|AK062838.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-H02, full
           insert sequence
          Length = 949

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 225/284 (79%)
 Strand = Plus / Plus

                                                                       
Query: 99  ccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgg 158
           |||||||||| ||||| |||||||| |||||||| ||||| || || ||||||||||| |
Sbjct: 81  ccatgaacccggaatacgactaccttttcaagctcctgcttatcggtgactcgggcgtcg 140

                                                                       
Query: 159 ggaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagta 218
           | ||||| |||||  ||||| | || || |||||  | ||    |||||||| |||   |
Sbjct: 141 gaaagtcgtgcctcttgctgcgtttcgccgatgacacgtacacggagagctacatctcga 200

                                                                       
Query: 219 ctattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgc 278
           | ||||| || |||||||||||||| ||  | ||||  || || ||||| || ||||| |
Sbjct: 201 ccattggtgtcgacttcaaaatccgaactatcgagctcgacggtaagaccatcaagctcc 260

                                                                       
Query: 279 aaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtg 338
           | |||||||||||||| || || || || ||  | || ||||| ||||| |||||||| |
Sbjct: 261 agatttgggatactgccggccaggagcgtttccgtacgatcacgagcagttactaccgcg 320

                                                       
Query: 339 gtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           | ||||| |||||||| |||||||| |||||||| |||||||||
Sbjct: 321 gcgcccacggcatcatcgtcgtgtacgatgtgacggaccaggag 364

---

>emb|X72688.1|LSRAB1 L.stagnalis LS-rab1 mRNA
          Length = 718

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 151/185 (81%), Gaps = 1/185 (0%)
 Strand = Plus / Plus

                                                                       
Query: 257 gatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggacc 316
           ||||| ||||| ||||| || ||||| ||||||||||| || || ||  ||||||| |||
Sbjct: 236 gatggcaagacaataaaacttcaaatatgggatactgcaggacaggagagatttagaacc 295

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||||  ||| |||||| | || ||||||||||| ||||| || |||||||| || || 
Sbjct: 296 atcacatccagttactacagaggagcccatggcattattgttgtctatgatgtaacagat 355

                                                                       
Query: 377 caggagagcttcaac-acgtcaaacagtggcttaatgaaattgacaggtacgctagtgaa 435
           ||||||   |||||| | || |||||||||||  | ||||||||||| || |||||||||
Sbjct: 356 caggagtctttcaacaatgtaaaacagtggctccaagaaattgacagatatgctagtgaa 415

                
Query: 436 aatgt 440
           |||||
Sbjct: 416 aatgt 420

---

>gb|AF127134.1|AF127134 Arabidopsis thaliana ras-related small GTP-binding protein (RAB1c)
           mRNA, complete cds
          Length = 950

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 187/235 (79%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| || |||||||||||  | ||||||||  |||||||||| || || || || ||
Sbjct: 153 catgaatcctgaatatgactatttgttcaagcttttgctcattggtgattctggtgttgg 212

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||| ||| |||| || |||||||| |||||||| || || || ||||| ||||| ||
Sbjct: 213 aaagtcgtgcttgcttctaaggtttgctgatgattcctacctggatagctacatcagcac 272

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || ||||| |||||||| || || || |||||||| ||||| || || || ||
Sbjct: 273 cattggtgtcgactttaaaatccgaacagtcgaacaagatggaaagaccatcaaactcca 332

                                                                  
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactac 334
            ||||||||||| || || || ||||| ||||| || || || ||||| ||||||
Sbjct: 333 gatttgggatacggcaggccaggaacgttttagaacgattactagcagttactac 387

---

>gb|AF454361.1| Pythium vanterpoolii isolate vanterpooliiTN ras-like protein gene,
           partial cds
          Length = 387

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 136/166 (81%), Gaps = 1/166 (0%)
 Strand = Plus / Plus

                                                                       
Query: 263 aagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcaca 322
           ||||| || ||||| || ||||||||||| || ||||| ||||| ||  | || ||||| 
Sbjct: 123 aagaccatcaagctccagatttgggataccgccgggcaggaacgtttccgcacgatcacg 182

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           ||||||||||||||||| ||||| || || ||||||||||| || ||||| ||||| |||
Sbjct: 183 agcagctactaccgtggcgcccacggtattattgtcgtgtacgacgtgacggaccaagag 242

                                                         
Query: 383 agcttcaac-acgtcaaacagtggcttaatgaaattgacaggtacg 427
              |||||| ||||||| ||||||||  |||| |||||| ||||||
Sbjct: 243 tcgttcaacaacgtcaagcagtggctgcatgagattgaccggtacg 288

---

>ref|NM_117859.2| Arabidopsis thaliana RAB1C; GTP binding AT4G17530 (RAB1C) mRNA,
           complete cds
          Length = 1410

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| || |||||||||||  | ||||||||  |||||||||| || || || || ||
Sbjct: 161 catgaatcctgaatatgactatttgttcaagcttttgctcattggtgattctggtgttgg 220

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||| ||| |||| || |||||||| |||||||| || || || ||||| ||||| ||
Sbjct: 221 aaagtcgtgcttgcttctaaggtttgctgatgattcctacctggatagctacatcagcac 280

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || ||||| |||||||| || || || |||||||| ||||| || || || ||
Sbjct: 281 cattggtgtcgactttaaaatccgaacagtcgaacaagatggaaagaccatcaaactcca 340

                       
Query: 280 aatttgggatac 291
            |||||||||||
Sbjct: 341 gatttgggatac 352

---

>ref|NG_005395.2| Homo sapiens RAB1C, member RAS oncogene family (RAB1C) pseudogene
           on chromosome 9
          Length = 806

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| ||||||||||||| |||||||| ||| || ||||||||  | ||||| ||||| |
Sbjct: 93  ccgccgccatgaaccccggatatgactgcctgtttaagctgcttttgattggcgactcag 152

                                                   
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
           ||||||| ||||| |||||||| ||| ||||||| |||||
Sbjct: 153 gcgtgggcaagtcatgcctgctcctgcggtttgctgatga 192

---

>emb|AL513165.12| Human DNA sequence from clone RP11-613M10 on chromosome 9 Contains part
              of a novel gene, the FBXO10 gene (FBX10) for F-box only
              protein 10, two novel genes, a RAB1B (member RAS oncogene
              family) pseudogene the 5' end of a novel gene (KIAA0967)
              and three CpG islands, complete sequence
          Length = 194976

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                          
Query: 93     ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
              |||| ||||||||||||| |||||||| ||| || ||||||||  | ||||| ||||| |
Sbjct: 132970 ccgccgccatgaaccccggatatgactgcctgtttaagctgcttttgattggcgactcag 132911

                                                      
Query: 153    gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
              ||||||| ||||| |||||||| ||| ||||||| |||||
Sbjct: 132910 gcgtgggcaagtcatgcctgctcctgcggtttgctgatga 132871

---

>gb|AC183495.1| Brassica oleracea Contig A, complete sequence
          Length = 356505

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 74/84 (88%), Gaps = 1/84 (1%)
 Strand = Plus / Minus

                                                                          
Query: 362    tatgatgtgactgaccaggagagcttcaaca-cgtcaaacagtggcttaatgaaattgac 420
              |||||||| |||||||| ||||||||||||| |||||| || ||||| |||||||| |||
Sbjct: 208246 tatgatgtcactgaccaagagagcttcaacaacgtcaagcaatggctcaatgaaatcgac 208187

                                      
Query: 421    aggtacgctagtgaaaatgtgaac 444
               | ||||||||||| |||||||||
Sbjct: 208186 cgttacgctagtgagaatgtgaac 208163



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                           
Query: 187    ggatgattcatatcttgagagctatatcagtactattggcgttga 231
              ||||||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 208687 ggatgattcttaccttgatagctatatcagtaccattggtgttga 208643

---

>gb|AC183493.1| Brassica oleracea Contig B, complete sequence
          Length = 284024

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 71/80 (88%), Gaps = 1/80 (1%)
 Strand = Plus / Minus

                                                                          
Query: 362    tatgatgtgactgaccaggagagcttcaaca-cgtcaaacagtggcttaatgaaattgac 420
              |||||||| |||||||| ||||||||||||| ||||||||| |||||||||||||| |||
Sbjct: 223884 tatgatgtcactgaccaagagagcttcaacaacgtcaaacaatggcttaatgaaatcgac 223825

                                  
Query: 421    aggtacgctagtgaaaatgt 440
               | ||||| ||||| |||||
Sbjct: 223824 cgttacgccagtgagaatgt 223805



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                         
Query: 299    caagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcattgt 357
              |||||||| || ||||| ||||| |||||||||||| | || || ||||| ||||||||
Sbjct: 224047 caagaacgtttcaggacaatcaccagcagctactacagaggagctcatgggatcattgt 223989

---

>gb|AF454357.1| Pythium aphanidermatum isolate aphanidermatumTN ras-like protein
           gene, partial cds
          Length = 453

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || |||||||| ||||||||||| || || |||
Sbjct: 250 atcacgagcagctactaccgtggtgcgcacggcatcatcgtcgtgtatgacgtcacggac 309

                           
Query: 377 caggagagcttcaaca 392
           ||||||  ||||||||
Sbjct: 310 caggagtccttcaaca 325

---

>gb|AF454356.1| Pythium arrhenomanes isolate arrhenomanesTN ras-like protein gene,
           partial cds
          Length = 453

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || |||||||| ||||||||||| || || |||
Sbjct: 250 atcacgagcagctactaccgtggtgcgcacggcatcatcgtcgtgtatgacgtcacggac 309

                           
Query: 377 caggagagcttcaaca 392
           ||||||  ||||||||
Sbjct: 310 caggagtccttcaaca 325

---

>gb|AF454355.1| Pythium deliense isolate 20-1 ras-like protein gene, partial cds
          Length = 439

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 67/76 (88%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || |||||||| ||||||||||| || || |||
Sbjct: 250 atcacgagcagctactaccgtggtgcgcacggcatcatcgtcgtgtatgacgtcacggac 309

                           
Query: 377 caggagagcttcaaca 392
           ||||||  ||||||||
Sbjct: 310 caggagtccttcaaca 325

---

>ref|XM_945537.1| PREDICTED: Homo sapiens small GTP-binding protein, transcript
           variant 4 (rab1c), mRNA
          Length = 1085

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| ||||||||||||| |||||||| ||| || ||||||||  | ||||| ||||| |
Sbjct: 59  ccgccgccatgaaccccggatatgactgcctgtttaagctgcttttgattggcgactcag 118

                                                   
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
           ||||||| ||||| |||||||| ||| ||||||| |||||
Sbjct: 119 gcgtgggcaagtcatgcctgctcctgcggtttgctgatga 158

---

>ref|XM_941922.1| PREDICTED: Homo sapiens small GTP-binding protein, transcript
           variant 3 (rab1c), mRNA
          Length = 1931

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| ||||||||||||| |||||||| ||| || ||||||||  | ||||| ||||| |
Sbjct: 59  ccgccgccatgaaccccggatatgactgcctgtttaagctgcttttgattggcgactcag 118

                                                   
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
           ||||||| ||||| |||||||| ||| ||||||| |||||
Sbjct: 119 gcgtgggcaagtcatgcctgctcctgcggtttgctgatga 158

---

>ref|XM_497021.2| PREDICTED: Homo sapiens small GTP-binding protein, transcript
           variant 1 (rab1c), mRNA
          Length = 1085

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| ||||||||||||| |||||||| ||| || ||||||||  | ||||| ||||| |
Sbjct: 59  ccgccgccatgaaccccggatatgactgcctgtttaagctgcttttgattggcgactcag 118

                                                   
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
           ||||||| ||||| |||||||| ||| ||||||| |||||
Sbjct: 119 gcgtgggcaagtcatgcctgctcctgcggtttgctgatga 158

---

>ref|XM_929773.1| PREDICTED: Homo sapiens small GTP-binding protein, transcript
           variant 2 (rab1c), mRNA
          Length = 1931

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           |||| ||||||||||||| |||||||| ||| || ||||||||  | ||||| ||||| |
Sbjct: 59  ccgccgccatgaaccccggatatgactgcctgtttaagctgcttttgattggcgactcag 118

                                                   
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
           ||||||| ||||| |||||||| ||| ||||||| |||||
Sbjct: 119 gcgtgggcaagtcatgcctgctcctgcggtttgctgatga 158

---

>gb|AY052204.1| Arabidopsis thaliana AT4g17530/dl4800c mRNA, complete cds
          Length = 938

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 154/192 (80%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| || |||||||||||  | ||||||||  |||||||||| || || || || ||
Sbjct: 161 catgaatcctgaatatgactatttgttcaagcttttgctcattggtgattctggtgttgg 220

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||| ||| |||| || |||||||| |||||||| || || || ||||| ||||| ||
Sbjct: 221 aaagtcgtgcttgcttctaaggtttgctgatgattcctacctggatagctacatcagcac 280

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || ||||| |||||||| || || || |||||||| ||||| || || || ||
Sbjct: 281 cattggtgtcgactttaaaatccgaacagtcgaacaagatggaaagaccatcaaactcca 340

                       
Query: 280 aatttgggatac 291
            |||||||||||
Sbjct: 341 gatttgggatac 352

---

>dbj|AB018117.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQL5
          Length = 88398

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 74/84 (88%), Gaps = 1/84 (1%)
 Strand = Plus / Plus

                                                                         
Query: 362   tatgatgtgactgaccaggagagcttcaaca-cgtcaaacagtggcttaatgaaattgac 420
             |||||||| || ||||  ||||||||||||| ||||||||| ||||| ||||||||||||
Sbjct: 16544 tatgatgtcacagacctagagagcttcaacaacgtcaaacaatggctgaatgaaattgac 16603

                                     
Query: 421   aggtacgctagtgaaaatgtgaac 444
              | |||||||| ||||||||||||
Sbjct: 16604 cgttacgctagcgaaaatgtgaac 16627



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                        
Query: 299   caagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcattgt 357
             |||||||| || ||||| ||||| |||||||||||| | || || ||||| ||||||||
Sbjct: 16394 caagaacgtttcaggacaatcactagcagctactacagaggagctcatgggatcattgt 16452

---

>gb|DQ372931.1| Pinus pinaster Rab1 mRNA, complete cds
          Length = 910

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 207/263 (78%)
 Strand = Plus / Plus

                                                                       
Query: 110 gaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgc 169
           ||||| |||||| | ||||||||  |||| ||||| || || || || || ||||| || 
Sbjct: 84  gaatacgactacttgttcaagcttttgctgattggtgattctggggttggaaagtcatgt 143

                                                                       
Query: 170 ctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgtt 229
            |||| ||| ||||||| |||||||||||  |||  || || ||||| || ||||| || 
Sbjct: 144 ttgctactgcggtttgctgatgattcatacgttggcagttacatcagcaccattggtgta 203

                                                                       
Query: 230 gacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggat 289
           || ||||||||| | ||  |||||   ||||| ||| | || ||||| ||||||||||||
Sbjct: 204 gatttcaaaatcagaacaattgagttggatggcaaggcaatcaagcttcaaatttgggat 263

                                                                       
Query: 290 actgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggc 349
           ||||| || || || ||||| |||||||| ||||||||||| ||||| || || || || 
Sbjct: 264 actgcaggacaggagcgattcaggaccataacaagcagctattaccgcggagctcacgga 323

                                  
Query: 350 atcattgtcgtgtatgatgtgac 372
           |||||| | || |||||||||||
Sbjct: 324 atcattattgtttatgatgtgac 346

---

>gb|AY060495.1| Arabidopsis thaliana AT4g17530/dl4800c mRNA, complete cds
          Length = 609

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 153/191 (80%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || |||||||||||  | ||||||||  |||||||||| || || || || || 
Sbjct: 1   atgaatcctgaatatgactatttgttcaagcttttgctcattggtgattctggtgttgga 60

                                                                       
Query: 161 aagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtact 220
           ||||| ||| |||| || |||||||| |||||||| || || || ||||| ||||| || 
Sbjct: 61  aagtcgtgcttgcttctaaggtttgctgatgattcctacctggatagctacatcagcacc 120

                                                                       
Query: 221 attggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaa 280
           ||||| || ||||| |||||||| || || || |||||||| ||||| || || || || 
Sbjct: 121 attggtgtcgactttaaaatccgaacagtcgaacaagatggaaagaccatcaaactccag 180

                      
Query: 281 atttgggatac 291
           |||||||||||
Sbjct: 181 atttgggatac 191

---

>gb|AF454358.1| Pythium torulosum isolate 18-5 ras-like protein gene, partial
           sequence
          Length = 415

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 120/146 (82%), Gaps = 1/146 (0%)
 Strand = Plus / Plus

                                                                       
Query: 263 aagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcaca 322
           |||||||| ||||| || ||||||||||| || || || || || ||  | || ||||| 
Sbjct: 135 aagacgatcaagctccagatttgggataccgccggccaggagcgtttccgcacgatcacg 194

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           ||||||||||||||||| || || |||||||| |||||||| || ||||| |||||||||
Sbjct: 195 agcagctactaccgtggcgcgcacggcatcatcgtcgtgtacgacgtgacggaccaggag 254

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 255 tcgttcaacaacgtcaagcagtggct 280

---

>ref|XM_940462.1| PREDICTED: Homo sapiens similar to RAB1, member RAS oncogene family
           (LOC651324), mRNA
          Length = 1202

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 209/266 (78%)
 Strand = Plus / Plus

                                                                       
Query: 115 tgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
           ||||||||| || ||||||||  | ||||| ||||| |||||||| ||||| ||||||||
Sbjct: 6   tgactacctgtttaagctgcttttgattggcgactcaggcgtgggcaagtcatgcctgct 65

                                                                       
Query: 175 gctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgttgactt 234
            ||| ||||||| |||||  | ||    |||||||| ||||| || || || || |||||
Sbjct: 66  cctgcggtttgctgatgacacgtacacagagagctacatcagcaccatcggggtggactt 125

                                                                       
Query: 235 caaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactgc 294
           ||| ||||| ||| | ||||  ||||| || || || || || || || ||||| || ||
Sbjct: 126 caagatccgaaccatcgagctggatggcaaaactatcaaacttcagatctgggacacagc 185

                                                                       
Query: 295 tgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcat 354
            || || ||||| ||  ||||||||||   |||||||||||| || || |||||||||||
Sbjct: 186 gggccaggaacggttccggaccatcacttccagctactaccggggggctcatggcatcat 245

                                     
Query: 355 tgtcgtgtatgatgtgactgaccagg 380
            || |||||||| || ||||||||||
Sbjct: 246 cgtggtgtatgacgtcactgaccagg 271

---

>gb|U35026.1|PHU35026 Petunia hybrida Rab1-like small GTP-binding protein mRNA, complete
           cds
          Length = 886

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 165/206 (80%), Gaps = 1/206 (0%)
 Strand = Plus / Plus

                                                                       
Query: 224 ggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatt 283
           |||||||| ||||||||  | || || ||||  ||||| ||||| || ||||||||||||
Sbjct: 190 ggcgttgatttcaaaattaggactgtagagctggatggaaagactatcaagctgcaaatt 249

                                                                       
Query: 284 tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
           ||||||||||| || || ||||| ||  |||| || |||||||| ||||| || || || 
Sbjct: 250 tgggatactgcaggccaggaacggttccggactataacaagcagttactatcggggagca 309

                                                                       
Query: 344 catggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaacag 402
           ||||| || ||| | || |||||||| |||||   ||||||||||||| | ||||| || 
Sbjct: 310 catggaattattattgtttatgatgtaactgaaatggagagcttcaacaatgtcaagcaa 369

                                     
Query: 403 tggcttaatgaaattgacaggtacgc 428
           ||||| | ||| |||||||| |||||
Sbjct: 370 tggctgagtgagattgacagatacgc 395

---

>ref|NM_001031787.1| Sus scrofa Ras-related protein Rab-1A (RAB1B), mRNA
          Length = 618

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 214/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 9   catgaatcccgaatatgattatttattcaagttacttctgattggcgactctggggttgg 68

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||||||||| || || |||||||| |||||| |||||   || ||||||||||| ||
Sbjct: 69  aaagtcttgcctccttcttaggtttgcagatgatacatatacagaaagctatatcagcac 128

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || || ||||||||  | ||  | |||  ||||||||| || || || || ||
Sbjct: 129 aattggtgtggatttcaaaataagaactatagagttagatgggaaaacaatcaaacttca 188

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||| ||||| || || || |||||| ||||| | || |||||   ||| |||||| | ||
Sbjct: 189 aatatgggacacagcaggccaagaaagatttcgaacaatcacctccagttactacagagg 248

                                            
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgac 372
            |||||||||||||| || ||||||||||||||
Sbjct: 249 agcccatggcatcatagttgtgtatgatgtgac 281

---

>emb|X96991.1|PHRB1A P.hybrida mRNA for GTP-binding protein, homologue to RB1A-human
          Length = 273

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 91/109 (83%)
 Strand = Plus / Plus

                                                                       
Query: 284 tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
           ||||| || |||||||||||||| || ||||| || || || || ||||||||||| || 
Sbjct: 1   tgggacacagctgggcaagaacgcttcaggacaattaccagtagttactaccgtggggca 60

                                                            
Query: 344 catggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaaca 392
           |||||||||||  | || |||||||| |||||||| || ||||||||||
Sbjct: 61  catggcatcataatagtttatgatgtaactgaccaagaaagcttcaaca 109

---

>gb|DQ270324.1| Phytophthora boehmeriae strain SCRP23 ras-related protein Ypt1
           (ypt1) gene, partial cds
          Length = 437

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 61/69 (88%)
 Strand = Plus / Plus

                                                                       
Query: 314 accatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgact 373
           |||||||| ||||| ||||||||||| ||||| |||||||| || ||||| |||||||| 
Sbjct: 243 accatcactagcagttactaccgtggcgcccacggcatcatcgtagtgtacgatgtgacg 302

                    
Query: 374 gaccaggag 382
           |||||||||
Sbjct: 303 gaccaggag 311

---

>gb|AY996813.1| Sus scrofa Ras-related protein Rab-1A mRNA, complete cds
          Length = 618

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 214/273 (78%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 9   catgaatcccgaatatgattatttattcaagttacttctgattggcgactctggggttgg 68

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||||||||| || || |||||||| |||||| |||||   || ||||||||||| ||
Sbjct: 69  aaagtcttgcctccttcttaggtttgcagatgatacatatacagaaagctatatcagcac 128

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || || ||||||||  | ||  | |||  ||||||||| || || || || ||
Sbjct: 129 aattggtgtggatttcaaaataagaactatagagttagatgggaaaacaatcaaacttca 188

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||| ||||| || || || |||||| ||||| | || |||||   ||| |||||| | ||
Sbjct: 189 aatatgggacacagcaggccaagaaagatttcgaacaatcacctccagttactacagagg 248

                                            
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgac 372
            |||||||||||||| || ||||||||||||||
Sbjct: 249 agcccatggcatcatagttgtgtatgatgtgac 281

---

>dbj|D10435.1|RIC241 Oryza sativa mRNA for ras-related Hrab1B protein (241 gene),
           partial sequence
          Length = 255

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgt 156
           |||||| ||||| |||||||||||||||||||| |||||||| || |||||||||||
Sbjct: 104 catgaatcccgagtatgactacctcttcaagcttctgctcatcggagactcgggcgt 160

---

>emb|AJ566493.1|TCA566493 Theobroma cacao microsatellite, clone mTcCIR164
          Length = 492

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Plus

                                                                       
Query: 284 tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
           ||||||||||| || |||||||| || ||||| ||||| ||||||||||||||||| || 
Sbjct: 40  tgggatactgcaggacaagaacggttcaggacaatcactagcagctactaccgtggagca 99

                   
Query: 344 catggcat 351
           ||||||||
Sbjct: 100 catggcat 107

---

>ref|XM_844657.1| PREDICTED: Canis familiaris similar to RAB1B, member RAS oncogene
           family (LOC607834), mRNA
          Length = 1622

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                       
Query: 93  ccgctgccatgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgg 152
           ||||||||||||||||| ||||||||||||| || ||||||||  | ||||| || ||||
Sbjct: 62  ccgctgccatgaaccccaaatatgactacctatttaagctgcttttgattggtgattcgg 121

                                                   
Query: 153 gcgtggggaagtcttgcctgctgctgaggtttgcggatga 192
           |  |||| ||||| |||||||| |||  |||||| |||||
Sbjct: 122 gtatgggcaagtcatgcctgcttctgcagtttgctgatga 161

---

>ref|XM_568088.1| Cryptococcus neoformans var. neoformans JEC21 ras-related protein
           ypt1 (CNL05520) partial mRNA
          Length = 938

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 87/104 (83%)
 Strand = Plus / Plus

                                                                       
Query: 218 actattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctg 277
           ||||| |||||||||||||| ||||| ||| ||||||  || || |||||  | ||||| 
Sbjct: 212 actatcggcgttgacttcaagatccgaaccattgagctcgaaggcaagaccgtcaagctc 271

                                                       
Query: 278 caaatttgggatactgctgggcaagaacgatttaggaccatcac 321
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 272 caaatttgggacactgccggacaagagcgattcaggaccatcac 315

---

>gb|AY232027.1| Drosophila yakuba clone yak-ad_Rab1 mRNA sequence
          Length = 369

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 108/132 (81%)
 Strand = Plus / Plus

                                                                       
Query: 110 gaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgc 169
           ||||| ||||| ||||| ||| ||||||||||||| ||||||||||| || ||||| || 
Sbjct: 19  gaatacgactatctctttaagttgctgctcattggagactcgggcgttggaaagtcctgt 78

                                                                       
Query: 170 ctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgtt 229
           || |||||| | ||||| |||||  |||||   || ||||||||||| || ||||| || 
Sbjct: 79  cttctgctgcgatttgccgatgacacatatacagaaagctatatcagcacaattggagtg 138

                       
Query: 230 gacttcaaaatc 241
           || |||||||||
Sbjct: 139 gatttcaaaatc 150



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 341 gcccatggcatcattgtcgt 360
           ||||||||||||||||||||
Sbjct: 250 gcccatggcatcattgtcgt 269

---

>gb|AY231907.1| Drosophila yakuba clone yak-em_Rab1 mRNA sequence
          Length = 357

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 108/132 (81%)
 Strand = Plus / Plus

                                                                       
Query: 110 gaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgc 169
           ||||| ||||| ||||| ||| ||||||||||||| ||||||||||| || ||||| || 
Sbjct: 19  gaatacgactatctctttaagttgctgctcattggagactcgggcgttggaaagtcctgt 78

                                                                       
Query: 170 ctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgtt 229
           || |||||| | ||||| |||||  |||||   || ||||||||||| || ||||| || 
Sbjct: 79  cttctgctgcgatttgccgatgacacatatacagaaagctatatcagcacaattggagtg 138

                       
Query: 230 gacttcaaaatc 241
           || |||||||||
Sbjct: 139 gatttcaaaatc 150



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 341 gcccatggcatcattgtcgt 360
           ||||||||||||||||||||
Sbjct: 250 gcccatggcatcattgtcgt 269

---

>emb|CR670292.2|CNS0FG62 Tetraodon nigroviridis full-length cDNA
          Length = 560

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 54/60 (90%)
 Strand = Plus / Plus

                                                                       
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgctgctg 178
           |||||||||||||| || || || ||||||||||| ||||||||||| ||||||||||||
Sbjct: 5   tacctcttcaagctcctcctgatcggggactcgggagtggggaagtcctgcctgctgctg 64

---

>gb|DQ270315.1| Phytophthora idaei strain SCRP376 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270314.1| Phytophthora idaei strain SCRP373 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270313.1| Phytophthora idaei strain SCRP371 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270312.1| Phytophthora idaei strain SCRP370 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270311.1| Phytophthora cactorum strain SCRP30 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270310.1| Phytophthora cactorum strain SCRP35 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270309.1| Phytophthora cactorum strain SCRP39 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|DQ270308.1| Phytophthora cactorum strain SCRP48 ras-related protein Ypt1 (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>gb|AF454359.1| Pythium catenulatum isolate catenulatumTN ras-like protein gene,
           partial sequence
          Length = 403

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| ||||||||||||||||| || || |||||||| |||||||| || ||||| |||
Sbjct: 189 atcacgagcagctactaccgtggcgcgcacggcatcatcgtcgtgtacgacgtgacggac 248

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| ||||||| ||||||||
Sbjct: 249 caggagtcgttcaacaacgtcaagcagtggct 280

---

>gb|DQ162986.1| Phytophthora megasperma strain IMI133317 ras-like protein (ypt1)
           gene, partial cds
          Length = 454

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 88/104 (84%), Gaps = 1/104 (0%)
 Strand = Plus / Plus

                                                                       
Query: 314 accatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgact 373
           |||||||| |||||||||||||| || || || |||||||| |||||||| ||||| || 
Sbjct: 260 accatcactagcagctactaccgcggcgcgcacggcatcatcgtcgtgtacgatgtcacg 319

                                                       
Query: 374 gaccaggagagcttcaac-acgtcaaacagtggcttaatgaaat 416
           |||||||||   |||||| ||||||| ||||||||  |||||||
Sbjct: 320 gaccaggagtcgttcaacaacgtcaagcagtggctgcatgaaat 363

---

>gb|DQ162979.1| Phytophthora quercina strain SCRP550 ras-like protein (ypt1) gene,
           partial cds
          Length = 450

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || ||||| || |||||||| || ||||| |||
Sbjct: 260 atcactagcagctactaccgtggtgcgcacggcattatcgtcgtgtacgacgtgacggac 319

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| ||||||| ||||||||
Sbjct: 320 caggagtcgttcaacaacgtcaagcagtggct 351

---

>gb|DQ162978.1| Phytophthora quercina strain SCRP549 ras-like protein (ypt1) gene,
           partial cds
          Length = 450

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || ||||| || |||||||| || ||||| |||
Sbjct: 260 atcactagcagctactaccgtggtgcgcacggcattatcgtcgtgtacgacgtgacggac 319

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| ||||||| ||||||||
Sbjct: 320 caggagtcgttcaacaacgtcaagcagtggct 351

---

>gb|DQ162977.1| Phytophthora quercina strain SCRP547 ras-like protein (ypt1) gene,
           partial cds
          Length = 450

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || ||||| || |||||||| || ||||| |||
Sbjct: 260 atcactagcagctactaccgtggtgcgcacggcattatcgtcgtgtacgacgtgacggac 319

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| ||||||| ||||||||
Sbjct: 320 caggagtcgttcaacaacgtcaagcagtggct 351

---

>gb|DQ162976.1| Phytophthora quercina strain SCRP541 ras-like protein (ypt1) gene,
           partial cds
          Length = 450

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||||||||| || ||||| || |||||||| || ||||| |||
Sbjct: 260 atcactagcagctactaccgtggtgcgcacggcattatcgtcgtgtacgacgtgacggac 319

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| ||||||| ||||||||
Sbjct: 320 caggagtcgttcaacaacgtcaagcagtggct 351

---

>gb|DQ162960.1| Phytophthora cactorum strain IMI296524 ras-like protein (ypt1)
           gene, partial cds
          Length = 429

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 79/92 (85%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||
Sbjct: 245 atcactagcagctactaccgcggtgcccatggcattatcgtggtgtacgacgtgacggac 304

                                           
Query: 377 caggagagcttcaac-acgtcaaacagtggct 407
           ||||||   |||||| |||| |||||||||||
Sbjct: 305 caggagtcgttcaacaacgtgaaacagtggct 336

---

>ref|NM_100093.2| Arabidopsis thaliana ATRAB1B; GTP binding AT1G02130 (ATRAB1B) mRNA,
           complete cds
          Length = 983

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 254 caagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttagg 313
           |||||||| || || || ||||| ||||||||||| |||||||| |||||||| || |||
Sbjct: 220 caagatggcaaaacaattaagctccaaatttgggacactgctggtcaagaacggttcagg 279

                                              
Query: 314 accatcacaagcagctactaccgtggtgcccatgg 348
           || || || ||||| ||||||||||| || |||||
Sbjct: 280 actattactagcagttactaccgtggggcacatgg 314

---

>gb|AY061905.1| Arabidopsis thaliana At1g02130/T7I23_6 mRNA, complete cds
          Length = 612

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 254 caagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttagg 313
           |||||||| || || || ||||| ||||||||||| |||||||| |||||||| || |||
Sbjct: 154 caagatggcaaaacaattaagctccaaatttgggacactgctggtcaagaacggttcagg 213

                                              
Query: 314 accatcacaagcagctactaccgtggtgcccatgg 348
           || || || ||||| ||||||||||| || |||||
Sbjct: 214 actattactagcagttactaccgtggggcacatgg 248

---

>gb|AY052333.1| Arabidopsis thaliana At1g02130/T7I23_6 mRNA, complete cds
          Length = 821

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 254 caagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttagg 313
           |||||||| || || || ||||| ||||||||||| |||||||| |||||||| || |||
Sbjct: 209 caagatggcaaaacaattaagctccaaatttgggacactgctggtcaagaacggttcagg 268

                                              
Query: 314 accatcacaagcagctactaccgtggtgcccatgg 348
           || || || ||||| ||||||||||| || |||||
Sbjct: 269 actattactagcagttactaccgtggggcacatgg 303

---

>dbj|D01027.1|ATHARA5 Arabidopsis thaliana mRNA for small GTP-binding protein (ara-5),
           partial cds
          Length = 734

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 254 caagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttagg 313
           |||||||| || || || ||||| ||||||||||| |||||||| |||||||| || |||
Sbjct: 132 caagatggcaaaacaattaagctccaaatttgggacactgctggtcaagaacggttcagg 191

                                              
Query: 314 accatcacaagcagctactaccgtggtgcccatgg 348
           || || || ||||| ||||||||||| || |||||
Sbjct: 192 actattactagcagttactaccgtggggcacatgg 226

---

>gb|AY441051.1| Armigeres subalbatus ASAP ID: 41801 Rho small monomeric GTPase mRNA
           sequence
          Length = 579

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 107 cccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtct 166
           |||||||| ||||| || ||||| |||||||| ||||| |||||||| ||||| ||||||
Sbjct: 406 cccgaatacgactatctgttcaaactgctgctgattggcgactcgggagtgggaaagtct 465

                         
Query: 167 tgcctgctgctgag 180
           ||||| ||| ||||
Sbjct: 466 tgccttctgttgag 479

---

>gb|AF454544.1| Pichia angusta strain DL-1 GTP-binding protein (YPT1) and
            phosphomannose isomerase (PMI40) genes, complete cds; and
            unknown genes
          Length = 6000

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Minus

                                                                        
Query: 109  cgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
            |||||| |||||||| |||||||||||||| || || ||||| |||||||| ||||| ||
Sbjct: 1596 cgaatacgactaccttttcaagctgctgcttatcggcgactccggcgtgggcaagtcctg 1537

                              
Query: 169  cctgctgctgaggtttgc 186
             || |||||| |||||||
Sbjct: 1536 tcttctgctgcggtttgc 1519

---

>gb|BC074522.1| Xenopus tropicalis MGC69496 protein, mRNA (cDNA clone MGC:69496
           IMAGE:5336329), complete cds
          Length = 1490

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 190/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 140 attggggactcgggcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatat 199
           ||||| ||||| || ||||| |||||||| || ||||| |||||||| |||||  |||| 
Sbjct: 318 attggagactccggtgtgggaaagtcttgtcttctgcttaggtttgcagatgacacatac 377

                                                                       
Query: 200 cttgagagctatatcagtactattggcgttgacttcaaaatccgcaccgttgagcaagat 259
              || || || |||||||| ||||| ||||| || |||||| | ||  | |||  ||||
Sbjct: 378 acagaaagttacatcagtacaattggtgttgattttaaaatcaggactatagagttagat 437

                                                                       
Query: 260 gggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatc 319
           ||||| || || || || ||||||||||||||||| || || ||| ||||| | || || 
Sbjct: 438 gggaaaacaatcaaacttcaaatttgggatactgccggccaggaaagatttcgaactatt 497

                                                                       
Query: 320 acaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccag 379
           |||   || |||||| | || ||||||||||||||||| |||||||| || || ||||||
Sbjct: 498 acatcaagttactacaggggagcccatggcatcattgttgtgtatgacgtaacagaccag 557

             
Query: 380 ga 381
           ||
Sbjct: 558 ga 559

---

>ref|NM_001004787.1| Xenopus tropicalis MGC69496 protein (MGC69496), mRNA
          Length = 1490

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 190/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 140 attggggactcgggcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatat 199
           ||||| ||||| || ||||| |||||||| || ||||| |||||||| |||||  |||| 
Sbjct: 318 attggagactccggtgtgggaaagtcttgtcttctgcttaggtttgcagatgacacatac 377

                                                                       
Query: 200 cttgagagctatatcagtactattggcgttgacttcaaaatccgcaccgttgagcaagat 259
              || || || |||||||| ||||| ||||| || |||||| | ||  | |||  ||||
Sbjct: 378 acagaaagttacatcagtacaattggtgttgattttaaaatcaggactatagagttagat 437

                                                                       
Query: 260 gggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatc 319
           ||||| || || || || ||||||||||||||||| || || ||| ||||| | || || 
Sbjct: 438 gggaaaacaatcaaacttcaaatttgggatactgccggccaggaaagatttcgaactatt 497

                                                                       
Query: 320 acaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccag 379
           |||   || |||||| | || ||||||||||||||||| |||||||| || || ||||||
Sbjct: 498 acatcaagttactacaggggagcccatggcatcattgttgtgtatgacgtaacagaccag 557

             
Query: 380 ga 381
           ||
Sbjct: 558 ga 559

---

>gb|DQ162965.1| Phytophthora nemorosa strain SCRP910 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||| ||||| || |||||||| || ||||| |||
Sbjct: 276 atcactagcagctactaccgcggtgcccacggcattatcgtcgtgtacgacgtgaccgac 335

                 
Query: 377 caggag 382
           ||||||
Sbjct: 336 caggag 341

---

>gb|DQ162964.1| Phytophthora psychrophila strain SCRP630 ras-like protein (ypt1)
           gene, partial cds
          Length = 477

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||| ||||| || |||||||| || ||||| |||
Sbjct: 290 atcactagcagctactaccgcggtgcccacggcattatcgtcgtgtacgacgtgacggac 349

                 
Query: 377 caggag 382
           ||||||
Sbjct: 350 caggag 355

---

>gb|DQ162963.1| Phytophthora ilicis strain SCRP379 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||| ||||| || |||||||| || ||||| |||
Sbjct: 276 atcactagcagctactaccgcggtgcccacggcattatcgtcgtgtacgacgtgacggac 335

                 
Query: 377 caggag 382
           ||||||
Sbjct: 336 caggag 341

---

>gb|DQ162962.1| Phytophthora ilicis strain SCRP377 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| |||||||| ||||| || |||||||| || ||||| |||
Sbjct: 276 atcactagcagctactaccgcggtgcccacggcattatcgtcgtgtacgacgtgacggac 335

                 
Query: 377 caggag 382
           ||||||
Sbjct: 336 caggag 341

---

>gb|U13168.1|CRU13168 Chlamydomonas reinhardtii YptC1 (yptC1) gene, complete cds
          Length = 3337

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 65/74 (87%), Gaps = 1/74 (1%)
 Strand = Plus / Plus

                                                                        
Query: 356  gtcgtgtatgatgtgactgaccaggagagcttcaac-acgtcaaacagtggcttaatgaa 414
            ||||| || |||||||| |||||||||||||||||| ||||||| |||||||| || || 
Sbjct: 1701 gtcgtatacgatgtgacggaccaggagagcttcaacaacgtcaagcagtggctcaacgag 1760

                          
Query: 415  attgacaggtacgc 428
            |||||| |||||||
Sbjct: 1761 attgaccggtacgc 1774



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 312  ggaccatcacaagcagctactaccgtggtgcccatggcatcattgt 357
            |||| ||||| ||||||||||||||||| || || |||||||||||
Sbjct: 1517 ggactatcaccagcagctactaccgtggcgcgcacggcatcattgt 1562



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 129  agctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
            |||| ||||||||||| ||||| || || || ||||||||||||||
Sbjct: 1077 agcttctgctcattggcgactccggtgttggcaagtcttgcctgct 1122

---

>gb|AF346820.1| Pichia angusta GTP-binding protein (YPT1) gene, complete cds
          Length = 1680

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 67/78 (85%)
 Strand = Plus / Plus

                                                                       
Query: 109 cgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
           |||||| |||||||| |||||||||||||| || || ||||| |||||||| ||||| ||
Sbjct: 621 cgaatacgactaccttttcaagctgctgcttatcggcgactccggcgtgggcaagtcctg 680

                             
Query: 169 cctgctgctgaggtttgc 186
            || |||||| |||||||
Sbjct: 681 tcttctgctgcggtttgc 698

---

>gb|DQ214477.1| Taeniopygia guttata clone 0065P0027C11 RAB1B member RAS oncogene
           family variant 1 internal polyA priming-like mRNA,
           complete sequence
          Length = 865

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||||||||||||||||||  | |||||||| || || ||||| ||||| || || ||
Sbjct: 188 catgaaccccgaatatgactatttattcaagcttcttctgattggagactccggtgttgg 247

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
           ||| |||||||| || || |||||||| |||||
Sbjct: 248 gaaatcttgccttctacttaggtttgcagatga 280

---

>gb|DQ214476.1| Taeniopygia guttata clone 0063P0024A02 RAB1B member RAS oncogene
           family variant 1 internal polyA priming-like mRNA,
           complete sequence
          Length = 888

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||||||||||||||||||  | |||||||| || || ||||| ||||| || || ||
Sbjct: 211 catgaaccccgaatatgactatttattcaagcttcttctgattggagactccggtgttgg 270

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
           ||| |||||||| || || |||||||| |||||
Sbjct: 271 gaaatcttgccttctacttaggtttgcagatga 303

---

>gb|DQ214475.1| Taeniopygia guttata clone 0058P0040G07 RAB1B member RAS oncogene
           family variant 1-like mRNA, complete sequence
          Length = 1401

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||||||||||||||||||  | |||||||| || || ||||| ||||| || || ||
Sbjct: 168 catgaaccccgaatatgactatttattcaagcttcttctgattggagactccggtgttgg 227

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
           ||| |||||||| || || |||||||| |||||
Sbjct: 228 gaaatcttgccttctacttaggtttgcagatga 260

---

>gb|DQ214474.1| Taeniopygia guttata clone 0063P0032G02 RAB1B member RAS oncogene
           family variant 1-like mRNA, complete sequence
          Length = 1448

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||||||||||||||||||  | |||||||| || || ||||| ||||| || || ||
Sbjct: 214 catgaaccccgaatatgactatttattcaagcttcttctgattggagactccggtgttgg 273

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
           ||| |||||||| || || |||||||| |||||
Sbjct: 274 gaaatcttgccttctacttaggtttgcagatga 306

---

>emb|X63277.1|ZMYPTM1 Z.mays yptm1 cDNA
          Length = 996

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 agctatatcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaag 265
           ||||| ||||| || || ||||| ||||| ||||||||||| || |||   || || |||
Sbjct: 298 agctacatcagcacgatcggcgtcgactttaaaatccgcacggtcgaggtggagggcaag 357

                                                                       
Query: 266 acgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagc 325
           ||  |||||||||| |||||||| || || ||||| || || || ||||||||||| |||
Sbjct: 358 accgtaaagctgcagatttgggacacagcagggcaggagcggttcaggaccatcacgagc 417

                    
Query: 326 agctactac 334
           |||||||||
Sbjct: 418 agctactac 426

---

>emb|CR353962.1| Gallus gallus finished cDNA, clone ChEST318m16
          Length = 656

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||||||||||||||||||  | |||||||| || || ||||| ||||| || || ||
Sbjct: 227 catgaaccccgaatatgactatttattcaagctacttctgattggagactccggtgttgg 286

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
           ||| |||||||| || || |||||||| |||||
Sbjct: 287 gaaatcttgccttctacttaggtttgcagatga 319

---

>gb|AY110905.1| Zea mays CL34283_1 mRNA sequence
          Length = 990

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 94/113 (83%), Gaps = 1/113 (0%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||| || || ||||| |||||| |||||||||| ||||| |||  ||||
Sbjct: 296 agcagctactaccgaggagctcatggaatcattatcgtgtatgacgtgacagacatggag 355

                                                                
Query: 383 agcttcaa-cacgtcaaacagtggcttaatgaaattgacaggtacgctagtga 434
           ||||||||  || |||| |||||||| | ||| ||||| ||||| || |||||
Sbjct: 356 agcttcaataacatcaagcagtggctgagtgagattgataggtatgccagtga 408

---

>gb|AY109984.1| Zea mays CL2070_1 mRNA sequence
          Length = 994

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 105/129 (81%)
 Strand = Plus / Plus

                                                                       
Query: 206 agctatatcagtactattggcgttgacttcaaaatccgcaccgttgagcaagatgggaag 265
           ||||| ||||| || || ||||| ||||| ||||||||||| || |||   || || |||
Sbjct: 298 agctacatcagcacgatcggcgtcgactttaaaatccgcacggtcgaggtggagggcaag 357

                                                                       
Query: 266 acgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagc 325
           ||  |||||||||| |||||||| || || ||||| || || || ||||||||||| |||
Sbjct: 358 accgtaaagctgcagatttgggacacagcagggcaggagcggttcaggaccatcacgagc 417

                    
Query: 326 agctactac 334
           |||||||||
Sbjct: 418 agctactac 426

---

>ref|XM_630118.1| Dictyostelium discoideum Rab GTPase (DDB0201658), partial mRNA
          Length = 567

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 269 ataaagctgcaaatttgggatactgctgggcaagaacgatttag 312
           ||||| || |||||||||||||||||||| ||||||||||||||
Sbjct: 130 ataaaacttcaaatttgggatactgctggacaagaacgatttag 173

---

>ref|NM_001031504.1| Gallus gallus RAB8A, member RAS oncogene family (RAB8A), mRNA
          Length = 5888

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 116  gactacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
            ||||| || ||||||||||||||||| || ||||||||||||||||||
Sbjct: 1338 gactatctgttcaagctgctgctcatcggcgactcgggcgtggggaag 1385

---

>ref|NM_031090.2| Rattus norvegicus RAB1, member RAS oncogene family (Rab1), mRNA
          Length = 1425

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 60/68 (88%), Gaps = 1/68 (1%)
 Strand = Plus / Plus

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaa 399
           |||||||||||||| || |||||||||||||| |||||||||  ||||||  |||| |||
Sbjct: 427 gcccatggcatcatagttgtgtatgatgtgacagaccaggagtccttcaataacgtgaaa 486

                   
Query: 400 cagtggct 407
           ||||||||
Sbjct: 487 cagtggct 494



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 76/93 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 186 catgaatcccgaatatgattatttattcaagttactcctgattggcgactctggggttgg 245

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
            ||||||||||| || || ||||||||||||||
Sbjct: 246 aaagtcttgccttctccttaggtttgcggatga 278

---

>ref|XM_871338.1| PREDICTED: Bos taurus similar to RAB1, member RAS oncogene family
           (LOC619025), partial mRNA
          Length = 275

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 188/240 (78%)
 Strand = Plus / Plus

                                                                       
Query: 115 tgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
           ||||||||| || ||||||||  | ||||| |||||||||||||| ||||| ||||||||
Sbjct: 11  tgactacctgtttaagctgcttttgattggtgactcgggcgtgggcaagtcatgcctgct 70

                                                                       
Query: 175 gctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgttgactt 234
            ||  ||||||| |||||  ||||    |||||||| ||||| || || || || |||||
Sbjct: 71  cctacggtttgctgatgacacatacacagagagctacatcagcaccatcggggtggactt 130

                                                                       
Query: 235 caaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactgc 294
           ||| ||||| ||| ||||||  || || || || || || || || || ||||| || ||
Sbjct: 131 caagatccgaaccattgagctggacggcaaaaccatcaaacttcagatctgggacacagc 190

                                                                       
Query: 295 tgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcccatggcatcat 354
           ||| || ||||| ||  ||||||||||   |||||||||||| || || || ||||||||
Sbjct: 191 tggtcaggaacggttccggaccatcacttccagctactaccggggggctcacggcatcat 250

---

>emb|X97853.1|LJRAB1A L.japonicus mRNA for small GTP-binding protein, RAB1A
          Length = 905

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 123/152 (80%), Gaps = 1/152 (0%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctac 331
           |||||||| ||||||||||||||||| || || || || ||||| || |||||||| |||
Sbjct: 300 aagctgcagatttgggatactgctggacaggagcgcttcaggactataacaagcagttac 359

                                                                       
Query: 332 taccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaac 391
           ||  | || || ||||| || ||| | || |||||||| |||||   ||| |||||||||
Sbjct: 360 tatagaggagcacatggaataattattgtctatgatgtcactgagatggaaagcttcaac 419

                                           
Query: 392 -acgtcaaacagtggcttaatgaaattgacag 422
            | ||||| |||||| | ||||||||||||||
Sbjct: 420 aatgtcaagcagtggttgaatgaaattgacag 451

---

>ref|XM_850035.1| PREDICTED: Canis familiaris similar to Ras-related protein Rab-13
           (LOC612294), mRNA
          Length = 747

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 38/40 (95%)
 Strand = Plus / Plus

                                                   
Query: 120 acctcttcaagctgctgctcattggggactcgggcgtggg 159
           ||||||||||| |||||||||| |||||||||||||||||
Sbjct: 155 acctcttcaagttgctgctcatcggggactcgggcgtggg 194

---

>gb|AY321327.1| Rattus norvegicus Ac2-048 mRNA, complete cds
          Length = 937

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 60/68 (88%), Gaps = 1/68 (1%)
 Strand = Plus / Plus

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaa 399
           |||||||||||||| || |||||||||||||| |||||||||  ||||||  |||| |||
Sbjct: 383 gcccatggcatcatagttgtgtatgatgtgacagaccaggagtccttcaataacgtgaaa 442

                   
Query: 400 cagtggct 407
           ||||||||
Sbjct: 443 cagtggct 450

---

>emb|AJ851430.1| Gallus gallus mRNA for hypothetical protein, clone 2k8
          Length = 5888

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                            
Query: 116  gactacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
            ||||| || ||||||||||||||||| || ||||||||||||||||||
Sbjct: 1338 gactatctgttcaagctgctgctcatcggcgactcgggcgtggggaag 1385

---

>gb|BC066662.1| Rattus norvegicus RAB1, member RAS oncogene family, mRNA (cDNA
           clone MGC:72414 IMAGE:5623442), complete cds
          Length = 1425

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 60/68 (88%), Gaps = 1/68 (1%)
 Strand = Plus / Plus

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaa 399
           |||||||||||||| || |||||||||||||| |||||||||  ||||||  |||| |||
Sbjct: 427 gcccatggcatcatagttgtgtatgatgtgacagaccaggagtccttcaataacgtgaaa 486

                   
Query: 400 cagtggct 407
           ||||||||
Sbjct: 487 cagtggct 494



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 76/93 (81%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 186 catgaatcccgaatatgattatttattcaagttactcctgattggcgactctggggttgg 245

                                            
Query: 160 gaagtcttgcctgctgctgaggtttgcggatga 192
            ||||||||||| || || ||||||||||||||
Sbjct: 246 aaagtcttgccttctccttaggtttgcggatga 278

---

>emb|BX930100.2| Gallus gallus finished cDNA, clone ChEST1021d13
          Length = 1018

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 116 gactacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| || ||||||||||||||||| || ||||||||||||||||||
Sbjct: 22  gactatctgttcaagctgctgctcatcggcgactcgggcgtggggaag 69

---

>emb|BX931166.1| Gallus gallus finished cDNA, clone ChEST1022e3
          Length = 983

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 116 gactacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| || ||||||||||||||||| || ||||||||||||||||||
Sbjct: 23  gactatctgttcaagctgctgctcatcggcgactcgggcgtggggaag 70

---

>emb|BX932054.1| Gallus gallus finished cDNA, clone ChEST417i18
          Length = 928

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 116 gactacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| || ||||||||||||||||| || ||||||||||||||||||
Sbjct: 390 gactatctgttcaagctgctgctcatcggcgactcgggcgtggggaag 343

---

>gb|L21011.1|DDIRABA Dictyostelium discoideum RabA mRNA, 3' end of cds
          Length = 641

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                       
Query: 269 ataaagctgcaaatttgggatactgctgggcaagaacgatttag 312
           ||||| || |||||||||||||||||||| ||||||||||||||
Sbjct: 163 ataaaacttcaaatttgggatactgctggacaagaacgatttag 206

---

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                          
Query: 272    aagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctac 331
              |||||||| ||||||||||| || || || || || ||  | |||||||| || ||||||
Sbjct: 302036 aagctgcagatttgggataccgccggccaggagcgcttccgcaccatcacgagtagctac 302095

                                     
Query: 332    taccgtggtgcccatggcatcat 354
              |||||||||||||| ||||||||
Sbjct: 302096 taccgtggtgcccacggcatcat 302118



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 116    gactacctcttcaagctgctgct 138
              |||||||||||||||||||||||
Sbjct: 301880 gactacctcttcaagctgctgct 301902

---

>ref|XM_864244.1| PREDICTED: Bos taurus similar to RAB1, member RAS oncogene family,
           transcript variant 2 (LOC540685), mRNA
          Length = 3552

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 220/283 (77%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 504 catgaatcccgaatatgattatttattcaagttacttctgattggcgactctggggttgg 563

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||||||||| || || |||||||| |||||| |||||   || ||||| ||||| ||
Sbjct: 564 aaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcac 623

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || || ||||||||  | ||  | |||  ||||||||| || || || || ||
Sbjct: 624 aattggtgtggatttcaaaataagaactatagagttagatgggaaaacaatcaaacttca 683

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||| ||||| || || || |||||| ||||| | || |||||   ||| || ||| | ||
Sbjct: 684 aatatgggacacagcgggccaagaaagatttcgaacaatcacctccagttattacagagg 743

                                                      
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
            |||||||||||||| || |||||||||||||| || ||||||
Sbjct: 744 agcccatggcatcatagttgtgtatgatgtgacagatcaggag 786

---

>ref|XM_612642.2| PREDICTED: Bos taurus similar to RAB1, member RAS oncogene family,
           transcript variant 1 (LOC540685), mRNA
          Length = 3887

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 220/283 (77%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 504 catgaatcccgaatatgattatttattcaagttacttctgattggcgactctggggttgg 563

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||||||||| || || |||||||| |||||| |||||   || ||||| ||||| ||
Sbjct: 564 aaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcac 623

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || || ||||||||  | ||  | |||  ||||||||| || || || || ||
Sbjct: 624 aattggtgtggatttcaaaataagaactatagagttagatgggaaaacaatcaaacttca 683

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||| ||||| || || || |||||| ||||| | || |||||   ||| || ||| | ||
Sbjct: 684 aatatgggacacagcgggccaagaaagatttcgaacaatcacctccagttattacagagg 743

                                                      
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
            |||||||||||||| || |||||||||||||| || ||||||
Sbjct: 744 agcccatggcatcatagttgtgtatgatgtgacagatcaggag 786

---

>ref|NM_001003153.1| Canis familiaris RAB1A, member RAS oncogene family (RAB1A), mRNA
          Length = 840

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 220/283 (77%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 157 catgaatcccgaatatgattatttattcaagttacttctgattggcgactctggggttgg 216

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||||||||| || || |||||||| |||||| |||||   || ||||| ||||| ||
Sbjct: 217 aaagtcttgcctccttcttaggtttgcagatgatacatatacagaaagctacatcagcac 276

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || || ||||||||  | ||  | |||  ||||||||| || || ||||| ||
Sbjct: 277 aattggtgtggatttcaaaataagaactatagagttagatgggaaaacaatcaagcttca 336

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||| ||||| || || || |||||| ||||| | || |||||   ||| || ||| | ||
Sbjct: 337 aatatgggacacagcaggccaagaaagatttcgaacaatcacctccagttattacagagg 396

                                                      
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
            |||||||||||||| || |||||||| ||||| || ||||||
Sbjct: 397 agcccatggcatcatagttgtgtatgacgtgacagatcaggag 439

---

>ref|XM_842937.1| Leishmania major strain Friedlin small GTP-binding protein Rab1
           (LMJ_0333) partial mRNA
          Length = 603

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctac 331
           |||||||| ||||||||||| || || || || || ||  | |||||||| || ||||||
Sbjct: 172 aagctgcagatttgggataccgccggccaggagcgcttccgcaccatcacgagtagctac 231

                                  
Query: 332 taccgtggtgcccatggcatcat 354
           |||||||||||||| ||||||||
Sbjct: 232 taccgtggtgcccacggcatcat 254



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 116 gactacctcttcaagctgctgct 138
           |||||||||||||||||||||||
Sbjct: 16  gactacctcttcaagctgctgct 38

---

>ref|XM_546532.2| PREDICTED: Canis familiaris similar to Ras-related protein Rab-13
           (LOC489414), mRNA
          Length = 849

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 120 acctcttcaagctgctgctcattggggactcgggc 154
           ||||||||||| |||||||||||||||||||||||
Sbjct: 212 acctcttcaagttgctgctcattggggactcgggc 246

---

>emb|X56384.1|CFRAB1 Canine rab1 mRNA for ras-related GTP-binding protein involved in
           membrane traffic
          Length = 840

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 220/283 (77%)
 Strand = Plus / Plus

                                                                       
Query: 100 catgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggg 159
           |||||| ||||||||||| ||  | |||||| | || || ||||| ||||| || || ||
Sbjct: 157 catgaatcccgaatatgattatttattcaagttacttctgattggcgactctggggttgg 216

                                                                       
Query: 160 gaagtcttgcctgctgctgaggtttgcggatgattcatatcttgagagctatatcagtac 219
            ||||||||||| || || |||||||| |||||| |||||   || ||||| ||||| ||
Sbjct: 217 aaagtcttgcctccttcttaggtttgcagatgatacatatacagaaagctacatcagcac 276

                                                                       
Query: 220 tattggcgttgacttcaaaatccgcaccgttgagcaagatgggaagacgataaagctgca 279
            ||||| || || ||||||||  | ||  | |||  ||||||||| || || ||||| ||
Sbjct: 277 aattggtgtggatttcaaaataagaactatagagttagatgggaaaacaatcaagcttca 336

                                                                       
Query: 280 aatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtgg 339
           ||| ||||| || || || |||||| ||||| | || |||||   ||| || ||| | ||
Sbjct: 337 aatatgggacacagcaggccaagaaagatttcgaacaatcacctccagttattacagagg 396

                                                      
Query: 340 tgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
            |||||||||||||| || |||||||| ||||| || ||||||
Sbjct: 397 agcccatggcatcatagttgtgtatgacgtgacagatcaggag 439

---

>emb|BX817998.1|CNS0ACJI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL55ZF03 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 906

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 254 caagatgggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttagg 313
           |||||||| || || || ||||| ||||||||||| |||||||| |||||||| || |||
Sbjct: 190 caagatggcaaaacaattaagctccaaatttgggacactgctggtcaagaacggttcagg 249

                                              
Query: 314 accatcacaagcagctactaccgtggtgcccatgg 348
           || || || |||||  |||||||||| || |||||
Sbjct: 250 actattactagcagtaactaccgtggggcacatgg 284

---

>gb|DQ162973.1| Phytophthora citrophthora strain IMI332632 ras-like protein (ypt1)
           gene, partial cds
          Length = 441

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 86/103 (83%), Gaps = 1/103 (0%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||||||||| || ||||| || || ||||| |||||||| ||||| |||
Sbjct: 260 agcagctactaccgtggtgctcacggcattatcgtggtgtacgatgtgacggaccaagag 319

                                                      
Query: 383 agcttcaac-acgtcaaacagtggcttaatgaaattgacaggt 424
              |||||| ||||||| ||||||||  |||| ||||| ||||
Sbjct: 320 tcgttcaacaacgtcaagcagtggctgcatgagattgataggt 362

---

>gb|L12031.1|LEIGTPHOM Leishmania major V121 GTP-binding protein homologue (YPT) gene,
           complete cds
          Length = 776

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 aagctgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaagcagctac 331
           |||||||| ||||||||||| || || || || || ||  | |||||||| || ||||||
Sbjct: 246 aagctgcagatttgggataccgccggccaggagcgcttccgcaccatcacgagtagctac 305

                                  
Query: 332 taccgtggtgcccatggcatcat 354
           |||||||||||||| ||||||||
Sbjct: 306 taccgtggtgcccacggcatcat 328



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 116 gactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgct 174
           ||||||||||||||||||||||| || || ||| |||| || || ||||| ||||||||
Sbjct: 90  gactacctcttcaagctgctgctgatcggcgacacgggtgtcggtaagtcctgcctgct 148

---

>gb|AY558467.1| Saccharomyces cerevisiae clone FLH111583.01X YFL038C gene, complete
           cds
          Length = 621

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 329 tactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgacca 378
           |||||||||||| | ||||| |||||| ||||||||||||| ||||||||
Sbjct: 229 tactaccgtggttcgcatgggatcattatcgtgtatgatgtcactgacca 278

---

>gb|BC045014.1| Xenopus laevis RAB1, member RAS oncogene family, mRNA (cDNA clone
           MGC:53138 IMAGE:5542649), complete cds
          Length = 1616

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 189/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 140 attggggactcgggcgtggggaagtcttgcctgctgctgaggtttgcggatgattcatat 199
           ||||| ||||| || ||||| |||||||| || ||||| |||||||| |||||  |||| 
Sbjct: 292 attggagactctggtgtgggaaagtcttgtcttctgcttaggtttgcagatgacacatac 351

                                                                       
Query: 200 cttgagagctatatcagtactattggcgttgacttcaaaatccgcaccgttgagcaagat 259
              || || || |||||||| ||||| ||||| || |||||| | ||  | |||  ||||
Sbjct: 352 acagaaagttacatcagtacaattggtgttgattttaaaatcaggactatagagttagat 411

                                                                       
Query: 260 gggaagacgataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccatc 319
           || || || || || |||||||||||||| ||||| || || ||| ||||| | ||||| 
Sbjct: 412 ggaaaaacaatcaaactgcaaatttgggacactgccggccaggaaagatttcgaaccatt 471

                                                                       
Query: 320 acaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccag 379
           |||   || |||||| | || ||||| ||||||||||| |||||||| || || ||||||
Sbjct: 472 acatcaagttactacaggggagcccacggcatcattgttgtgtatgacgtaacagaccag 531

             
Query: 380 ga 381
           ||
Sbjct: 532 ga 533

---

>gb|AC124502.4| Mus musculus BAC clone RP23-414G6 from chromosome 19, complete sequence
          Length = 219212

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                         
Query: 311   aggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtg 370
             |||||||||||   ||||||||| || || || |||||||||||||| |||||||| || 
Sbjct: 18879 aggaccatcacttccagctactatcgcggggctcatggcatcattgtggtgtatgacgtc 18938

                       
Query: 371   actgaccagg 380
             ||||||||||
Sbjct: 18939 actgaccagg 18948

---

>ref|XM_950368.1| Theileria annulata strain Ankara hypothetical protein (TA18180)
           partial mRNA
          Length = 663

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 269 ataaagctgcaaatttgggatactgctgggcaagaacgatttaggaccat 318
           ||||| || ||||||||||||||||| || |||||||| |||||||||||
Sbjct: 166 ataaaactacaaatttgggatactgccggccaagaacgttttaggaccat 215

---

>ref|XM_502561.1| Yarrowia lipolytica CLIB122, YALI0D08162g predicted mRNA
          Length = 609

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 108 ccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtctt 167
           ||||||| |||||||||||||||||||| |||||||| || || || || || |||||||
Sbjct: 8   ccgaatacgactacctcttcaagctgcttctcattggagattctggtgttggcaagtctt 67

                     
Query: 168 gcctgctgct 177
           | || |||||
Sbjct: 68  gtcttctgct 77



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 329 tactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
           |||||||| || ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 229 tactaccgaggagcccacggtatcattgtcgtctacgatgtgactgaccagga 281

---

>emb|X00209.1|SCRASX Yeast YP2 gene The YP2 protein shows homology with the p21 proteins
           encoded by the human c-has/bas proto-oncogenes and
           transforming p21 proteins of the Harvey (v-rasH) and
           Kirsten (v-rasK) murine sarcoma viral oncogenes
          Length = 1190

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 329 tactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgacca 378
           |||||||||||| | ||||| |||||| ||||||||||||| ||||||||
Sbjct: 602 tactaccgtggttcgcatgggatcattatcgtgtatgatgtcactgacca 651

---

>gb|DQ270323.1| Phytophthora kernoviae strain ker-CSL ras-related protein Ypt1
           (ypt1) gene, partial cds
          Length = 457

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| ||||| ||||| ||||||||||| |||||||| || ||||| || ||||| |||
Sbjct: 265 atcactagcagttactatcgtggtgcccacggcatcatcgtggtgtacgacgtgacggac 324

                 
Query: 377 caggag 382
           ||||||
Sbjct: 325 caggag 330

---

>gb|DQ270322.1| Phytophthora kernoviae strain SCRP957 ras-related protein Ypt1
           (ypt1) gene, partial cds
          Length = 457

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| ||||| ||||| ||||||||||| |||||||| || ||||| || ||||| |||
Sbjct: 265 atcactagcagttactatcgtggtgcccacggcatcatcgtggtgtacgacgtgacggac 324

                 
Query: 377 caggag 382
           ||||||
Sbjct: 325 caggag 330

---

>gb|DQ270321.1| Phytophthora kernoviae strain SCRP958 ras-related protein Ypt1
           (ypt1) gene, partial cds
          Length = 457

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| ||||| ||||| ||||||||||| |||||||| || ||||| || ||||| |||
Sbjct: 265 atcactagcagttactatcgtggtgcccacggcatcatcgtggtgtacgacgtgacggac 324

                 
Query: 377 caggag 382
           ||||||
Sbjct: 325 caggag 330

---

>emb|CR594164.1| full-length cDNA clone CS0DJ001YB19 of T cells (Jurkat cell line)
           Cot 10-normalized of Homo sapiens (human)
          Length = 1717

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 312 ggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtga 371
           ||||||||||   |||||||||||| || || ||||||||||| || |||||||| || |
Sbjct: 97  ggaccatcacttccagctactaccggggggctcatggcatcatcgtggtgtatgacgtca 156

                     
Query: 372 ctgaccagga 381
           ||||||||||
Sbjct: 157 ctgaccagga 166

---

>gb|AF454369.1| Phytophthora citricola isolate 22297-97 ras-like protein gene,
           partial cds
          Length = 514

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||| ||||| || ||||| || || ||||| |||||||| |||||||||
Sbjct: 294 agcagctactaccgcggtgctcacggcattatcgtggtgtacgatgtgacggaccaggag 353

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 354 tcattcaacaacgtcaagcagtggct 379

---

>ref|XM_690199.1| PREDICTED: Danio rerio similar to Rab1-prov protein (LOC566914),
           mRNA
          Length = 606

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 101 atgaaccccgaatatgactacctcttcaagctgctgctcattggggactcgggcgtgggg 160
           ||||| || |||||||| ||||| ||||| || ||||| || || ||||| ||||| |||
Sbjct: 1   atgaatcctgaatatgattacctgttcaaactcctgctgatcggagactctggcgtcggg 60

                             
Query: 161 aagtcttgcctgctgctg 178
           ||||||||||| ||||||
Sbjct: 61  aagtcttgccttctgctg 78

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                            
Query: 284      tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
                |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 26387990 tgggatactgctggacaagaacgtttcaggacaattacaagcagctattaccggggagct 26388049

                              
Query: 344      catggcatcattgt 357
                ||||| || |||||
Sbjct: 26388050 catggaattattgt 26388063



 Score = 46.1 bits (23), Expect = 0.097
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 152      ggcgtggggaagtcttgcctgctgctg 178
                |||||||||||||| ||||||||||||
Sbjct: 22619205 ggcgtggggaagtcgtgcctgctgctg 22619231

---

>dbj|AP002485.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:P0491E01
          Length = 136150

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                          
Query: 284    tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
              |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 120342 tgggatactgctggacaagaacgtttcaggacaattacaagcagctattaccggggagct 120401

                            
Query: 344    catggcatcattgt 357
              ||||| || |||||
Sbjct: 120402 catggaattattgt 120415

---

>dbj|AP002524.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0406H10
          Length = 156419

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                          
Query: 284    tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
              |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 107671 tgggatactgctggacaagaacgtttcaggacgattacaagcagctattaccggggagct 107612

                            
Query: 344    catggcatcattgt 357
              ||||| || |||||
Sbjct: 107611 catggaataattgt 107598

---

>gb|DQ162991.1| Phytophthora lateralis strain IMI040503 ras-like protein (ypt1)
           gene, partial cds
          Length = 461

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           |||||||||||||||||||| || ||||| || ||||| || ||||| || ||||| |||
Sbjct: 276 atcacaagcagctactaccgcggcgcccacggtatcatcgtggtgtacgacgtgacggac 335

                 
Query: 377 caggag 382
           ||||||
Sbjct: 336 caggag 341

---

>gb|DQ162975.1| Phytophthora kernoviae strain SCRP722 ras-like protein (ypt1) gene,
           partial cds
          Length = 457

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| ||||| ||||| ||||||||||| |||||||| || ||||| || ||||| |||
Sbjct: 265 atcactagcagttactatcgtggtgcccacggcatcatcgtggtgtacgacgtgacggac 324

                 
Query: 377 caggag 382
           ||||||
Sbjct: 325 caggag 330

---

>gb|DQ162974.1| Phytophthora insolita strain IMI288805 ras-like protein (ypt1)
           gene, partial cds
          Length = 430

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 329 tactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           ||||||||||||||||| |||||||| || ||||| || ||||| |||||||||
Sbjct: 259 tactaccgtggtgcccacggcatcatcgtggtgtacgacgtgacggaccaggag 312

---

>gb|DQ162972.1| Phytophthora capsici strain IMI352321 ras-like protein (ypt1) gene,
           partial cds
          Length = 449

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           ||||||||||||||||||||||| ||||| || || ||||| ||||| || ||||| |||
Sbjct: 263 agcagctactaccgtggtgcccacggcattatcgtggtgtacgatgttacggaccaagag 322

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 323 tctttcaacaacgtcaagcagtggct 348

---

>gb|DQ162971.1| Phytophthora citricola strain SCRP143 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||| ||||| || ||||| || || ||||| |||||||| |||||||||
Sbjct: 272 agcagctactaccgcggtgctcacggcattatcgtggtgtacgatgtgacggaccaggag 331

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 332 tcattcaacaacgtcaagcagtggct 357

---

>gb|DQ162970.1| Phytophthora citricola strain SCRP140 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||| ||||| || ||||| || || ||||| |||||||| |||||||||
Sbjct: 272 agcagctactaccgcggtgctcacggcattatcgtggtgtacgatgtgacggaccaggag 331

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 332 tcattcaacaacgtcaagcagtggct 357

---

>gb|DQ162969.1| Phytophthora citricola strain SCRP136 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||| ||||| || ||||| || || ||||| |||||||| |||||||||
Sbjct: 272 agcagctactaccgcggtgctcacggcattatcgtggtgtacgatgtgacggaccaggag 331

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 332 tcattcaacaacgtcaagcagtggct 357

---

>gb|DQ162968.1| Phytophthora citricola strain SCRP130 ras-like protein (ypt1) gene,
           partial cds
          Length = 463

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 73/86 (84%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 323 agcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccaggag 382
           |||||||||||||| ||||| || ||||| || || ||||| |||||||| |||||||||
Sbjct: 272 agcagctactaccgcggtgctcacggcattatcgtggtgtacgatgtgacggaccaggag 331

                                     
Query: 383 agcttcaac-acgtcaaacagtggct 407
              |||||| ||||||| ||||||||
Sbjct: 332 tcattcaacaacgtcaagcagtggct 357

---

>gb|DQ162967.1| Phytophthora pseudosyringae strain SCRP734 ras-like protein (ypt1)
           gene, partial cds
          Length = 472

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| || ||||| ||||| || |||||||| || ||||| |||
Sbjct: 284 atcactagcagctactaccgcggcgcccacggcattatcgtcgtgtacgacgtgacggac 343

                 
Query: 377 caggag 382
           ||||||
Sbjct: 344 caggag 349

---

>gb|DQ162966.1| Phytophthora pseudosyringae strain IMI390500 ras-like protein
           (ypt1) gene, partial cds
          Length = 472

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 57/66 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 atcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgac 376
           ||||| |||||||||||||| || ||||| ||||| || |||||||| || ||||| |||
Sbjct: 284 atcactagcagctactaccgcggcgcccacggcattatcgtcgtgtacgacgtgacggac 343

                 
Query: 377 caggag 382
           ||||||
Sbjct: 344 caggag 349

---

>gb|U66621.1|HSU66621 Human small GTP-binding protein (rab1b) mRNA, partial cds
          Length = 160

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 312 ggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtga 371
           ||||||||||   |||||||||||| || || ||||||||||| || |||||||| || |
Sbjct: 15  ggaccatcacttccagctactaccggggggctcatggcatcatcgtggtgtatgacgtca 74

                     
Query: 372 ctgaccagga 381
           ||||||||||
Sbjct: 75  ctgaccagga 84

---

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                          
Query: 284    tgggatactgctgggcaagaacgatttaggaccatcacaagcagctactaccgtggtgcc 343
              |||||||||||||| |||||||| || ||||| || ||||||||||| ||||| || || 
Sbjct: 110156 tgggatactgctggacaagaacgtttcaggacaattacaagcagctattaccggggagct 110215

                            
Query: 344    catggcatcattgt 357
              ||||| || |||||
Sbjct: 110216 catggaattattgt 110229

---

>gb|M38390.1|DYGORA1 Discopyge ommata GTP-binding protein (ora1) mRNA, complete cds
          Length = 840

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 122 ctcttcaagctgctgctcattggggactcgggcgtggg 159
           ||||||||||||||||| |||||||| |||||||||||
Sbjct: 97  ctcttcaagctgctgctgattggggattcgggcgtggg 134

---

>dbj|D50617.1|YSCCHRVIN Saccharomyces cerevisiae chromosome VI complete DNA sequence
          Length = 270148

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 329   tactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgacca 378
             |||||||||||| | ||||| |||||| ||||||||||||| ||||||||
Sbjct: 55757 tactaccgtggttcgcatgggatcattatcgtgtatgatgtcactgacca 55708



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                   
Query: 270    taaagctgcaaatttgggatactgctgggcaagaacg 306
              ||||||||||| |||||||||| ||||| ||||||||
Sbjct: 130533 taaagctgcaactttgggataccgctggtcaagaacg 130569

---

>ref|XM_512463.1| PREDICTED: Pan troglodytes similar to cell line NK14 derived
           transforming oncogene (LOC455806), mRNA
          Length = 714

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 76  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 120

---

>gb|AC119825.11| Mus musculus chromosome 3, clone RP23-358O22, complete sequence
          Length = 205291

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 120    acctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
              ||||||||||| |||||||||| ||||||||||| ||||| ||| ||||
Sbjct: 116361 acctcttcaagttgctgctcatcggggactcgggggtgggcaagacttg 116409

---

>ref|XM_587868.2| PREDICTED: Bos taurus similar to cell line NK14 derived
           transforming oncogene (LOC510694), mRNA
          Length = 635

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 105 tacctgttcaagctgctgctgatcggggactcgggggtggggaag 149

---

>ref|NM_005370.4| Homo sapiens RAB8A, member RAS oncogene family (RAB8A), mRNA
          Length = 2194

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 241 tacctgttcaagctgctgctgatcggggactcgggggtggggaag 285

---

>ref|NM_001003152.1| Canis familiaris RAB8A, member RAS oncogene family (RAB8A), mRNA
          Length = 760

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 28  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 72

---

>ref|XM_849306.1| PREDICTED: Canis familiaris similar to RAB11B, member RAS oncogene
           family (LOC611619), mRNA
          Length = 2137

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Plus

                                        
Query: 135 tgctcattggggactcgggcgtggggaag 163
           |||||||||||||||||||||||||||||
Sbjct: 620 tgctcattggggactcgggcgtggggaag 648

---

>ref|XM_850476.1| PREDICTED: Canis familiaris RAB8A, member RAS oncogene family
           (RAB8A), mRNA
          Length = 760

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 28  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 72

---

>emb|X56741.1|HSMRAB8 H.sapiens mRNA for rab8 gene
          Length = 660

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 29  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 73

---

>emb|X56385.1|CFRAB8 Canine rab8 mRNA for ras-related GTP-binding protein
          Length = 760

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 28  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 72

---

>gb|BT008275.1| Synthetic construct Homo sapiens mel transforming oncogene (derived
           from cell line NK14)- RAB8 homolog mRNA, partial cds
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>gb|BT007184.1| Homo sapiens mel transforming oncogene (derived from cell line
           NK14)- RAB8 homolog mRNA, complete cds
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>emb|CR861352.1| Pongo pygmaeus mRNA; cDNA DKFZp459A1411 (from clone DKFZp459A1411)
          Length = 2104

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 32  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 76

---

>gb|AC008894.9| Homo sapiens chromosome 19 clone CTD-2231E14, complete sequence
          Length = 112067

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                          
Query: 119   tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
             ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 71187 tacctgttcaagctgctgctgatcggggactcgggggtggggaag 71231

---

>emb|CR625894.1| full-length cDNA clone CS0DA007YI13 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1822

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 15  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 59

---

>dbj|AK125412.1| Homo sapiens cDNA FLJ43423 fis, clone OCBBF2026981, weakly  similar
           to alpha 1C adrenergic receptor isoform 2
          Length = 2777

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 312 ggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtga 371
           ||||||||||   |||||||||||| || || ||||||||||| || |||||||| || |
Sbjct: 231 ggaccatcacttccagctactaccggggggctcatggcatcatcgtggtgtatgacgtca 172

                    
Query: 372 ctgaccagg 380
           |||||||||
Sbjct: 171 ctgaccagg 163

---

>emb|CR615093.1| full-length cDNA clone CS0DD005YJ20 of Neuroblastoma Cot
           50-normalized of Homo sapiens (human)
          Length = 1933

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 16  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 60

---

>emb|CR612819.1| full-length cDNA clone CS0DI081YF08 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1825

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 11  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 55

---

>emb|CR597154.1| full-length cDNA clone CS0DB001YM07 of Neuroblastoma Cot
           10-normalized of Homo sapiens (human)
          Length = 1844

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 5   tacctgttcaagctgctgctgatcggggactcgggggtggggaag 49

---

>emb|CR590930.1| full-length cDNA clone CS0DC028YC15 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1832

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 15  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 59

---

>gb|AC096622.14| Mus musculus strain 129/SvJ clone mgs1-182e11, complete sequence
          Length = 131919

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                              
Query: 120   acctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
             ||||||||||| |||||||||| ||||||||||| ||||| ||| ||||
Sbjct: 50270 acctcttcaagttgctgctcatcggggactcgggggtgggcaagacttg 50222

---

>gb|AF498943.1| Homo sapiens small GTP binding protein RAB8 (RAB8) mRNA, complete
           cds
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>ref|XM_680025.1| PREDICTED: Danio rerio similar to RAB1, member RAS oncogene family
           (LOC557049), mRNA
          Length = 636

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 155/197 (78%)
 Strand = Plus / Plus

                                                                       
Query: 114 atgactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgc 173
           |||| ||||| |||||| ||||||| ||||||||||| || || || ||||| ||  | |
Sbjct: 23  atgattacctattcaagttgctgctgattggggactctggtgttggaaagtcatgtttac 82

                                                                       
Query: 174 tgctgaggtttgcggatgattcatatcttgagagctatatcagtactattggcgttgact 233
           | ||  |||||||||||||  |||||   |||||||| ||||| |||||||| || || |
Sbjct: 83  tcctacggtttgcggatgacacatatacagagagctacatcagcactattggggtagatt 142

                                                                       
Query: 234 tcaaaatccgcaccgttgagcaagatgggaagacgataaagctgcaaatttgggatactg 293
           |||||||| | ||  ||||    || ||||||||  | || ||||| ||||||||||| |
Sbjct: 143 tcaaaatcagaactattgaaatggaggggaagactgtcaaactgcagatttgggatacag 202

                            
Query: 294 ctgggcaagaacgattt 310
           | || ||||||||||||
Sbjct: 203 caggacaagaacgattt 219

---

>emb|CR542274.1| Homo sapiens full open reading frame cDNA clone RZPDo834F0726D for
           gene RAB8A, RAB8A, member RAS oncogene family; complete
           cds, without stopcodon
          Length = 621

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>emb|CR536583.1| Homo sapiens full open reading frame cDNA clone RZPDo834C0322D for
           gene RAB8A, RAB8A, member RAS oncogene family; complete
           cds, incl. stopcodon
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>dbj|AB169502.1| Macaca fascicularis brain cDNA, clone: QccE-11745, similar to human
           RAB8A, member RAS oncogene family (RAB8A), mRNA, RefSeq:
           NM_005370.4
          Length = 1914

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 31  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 75

---

>gb|S53268.1| Homo sapiens RAS-related protein MEL (MEL) gene, complete cds
          Length = 1980

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>dbj|AK002303.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610007N03 product:RAB13, MEMBER RAS
           ONCOGENE FAMILY homolog [Homo sapiens], full insert
           sequence
          Length = 1073

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 120 acctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
           ||||||||||| |||||||||| ||||||||||| ||||| ||| ||||
Sbjct: 102 acctcttcaagttgctgctcatcggggactcgggggtgggcaagacttg 150

---

>gb|AC096623.31| Mus musculus strain 129/SvJ chromosome 3 clone mgs1-30a13, complete
             sequence
          Length = 196824

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                              
Query: 120   acctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
             ||||||||||| |||||||||| ||||||||||| ||||| ||| ||||
Sbjct: 86628 acctcttcaagttgctgctcatcggggactcgggggtgggcaagacttg 86676

---

>ref|NM_026677.1| Mus musculus RAB13, member RAS oncogene family (Rab13), mRNA
          Length = 1073

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 120 acctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
           ||||||||||| |||||||||| ||||||||||| ||||| ||| ||||
Sbjct: 102 acctcttcaagttgctgctcatcggggactcgggggtgggcaagacttg 150

---

>gb|AY892043.1| Synthetic construct Homo sapiens clone FLH110348.01L RAB8A member
           RAS oncogene family (MEL) mRNA, partial cds
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>gb|AY892042.1| Synthetic construct Homo sapiens clone FLH110347.01L RAB8A member
           RAS oncogene family (MEL) mRNA, partial cds
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>gb|AY889588.1| Synthetic construct Homo sapiens clone FLH110351.01X RAB8A (MEL)
           mRNA, complete cds
          Length = 624

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 19  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 63

---

>dbj|AK025165.1| Homo sapiens cDNA: FLJ21512 fis, clone COL05769
          Length = 2818

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 264 tacctgttcaagctgctgctgatcggggactcgggggtggggaag 308

---

>gb|BC027214.1| Mus musculus RAB13, member RAS oncogene family, mRNA (cDNA clone
           MGC:25544 IMAGE:3709140), complete cds
          Length = 1118

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                            
Query: 120 acctcttcaagctgctgctcattggggactcgggcgtggggaagtcttg 168
           ||||||||||| |||||||||| ||||||||||| ||||| ||| ||||
Sbjct: 128 acctcttcaagttgctgctcatcggggactcgggggtgggcaagacttg 176

---

>gb|BC002977.1| Homo sapiens RAB8A, member RAS oncogene family, mRNA (cDNA clone
           MGC:2196 IMAGE:3547214), complete cds
          Length = 2048

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 95  tacctgttcaagctgctgctgatcggggactcgggggtggggaag 139

---

>dbj|AP001107.5| Homo sapiens genomic DNA, chromosome 11q clone:RP11-867G23, complete
             sequences
          Length = 196662

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Plus

                                                                         
Query: 312   ggaccatcacaagcagctactaccgtggtgcccatggcatcattgtcgtgtatgatgtga 371
             ||||||||||   |||||||||||| || || ||||||||||| || |||||||| || |
Sbjct: 12649 ggaccatcacttccagctactaccggggggctcatggcatcatcgtggtgtatgacgtca 12708

                      
Query: 372   ctgaccagg 380
             |||||||||
Sbjct: 12709 ctgaccagg 12717

---

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                    
Query: 329     tactaccgtggtgcccatggcatcattgtcgtgtatgatgtgactgaccagga 381
               |||||||| || ||||| || ||||||||||| || |||||||||||||||||
Sbjct: 1042106 tactaccgaggagcccacggtatcattgtcgtctacgatgtgactgaccagga 1042054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                           
Query: 116     gactacctcttcaagctgctgctcattggggactcgggcgtggggaagtcttgcctgctg 175
               |||||||||||||||||||| |||||||| || || || || || |||||||| || |||
Sbjct: 1042371 gactacctcttcaagctgcttctcattggagattctggtgttggcaagtcttgtcttctg 1042312

                 
Query: 176     ct 177
               ||
Sbjct: 1042311 ct 1042310

---

>dbj|AB209767.1| Homo sapiens mRNA for mel transforming oncogene variant protein
          Length = 1754

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 119 tacctcttcaagctgctgctcattggggactcgggcgtggggaag 163
           ||||| |||||||||||||| || ||||||||||| |||||||||
Sbjct: 6   tacctgttcaagctgctgctgatcggggactcgggggtggggaag 50

---

>ref|XM_413757.1| PREDICTED: Gallus gallus similar to GTPase Rab8b (LOC415371), mRNA
          Length = 856

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 128 aagctgctgctcattggggactcgggcgtggggaagtcttgcctgctg 175
           ||||||||||| || ||||||||||||||||| ||| | |||||||||
Sbjct: 97  aagctgctgctgatcggggactcgggcgtgggcaagacctgcctgctg 144

---

>ref|NM_008996.2| Mus musculus RAB1, member RAS oncogene family (Rab1), mRNA
          Length = 2686

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 59/68 (86%), Gaps = 1/68 (1%)
 Strand = Plus / Plus

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaa 399
           |||||||||||||| || |||||||||||||| || ||||||  ||||||  |||| |||
Sbjct: 278 gcccatggcatcatagttgtgtatgatgtgacagatcaggagtccttcaataacgttaaa 337

                   
Query: 400 cagtggct 407
           ||||||||
Sbjct: 338 cagtggct 345

---

>ref|XM_569689.1| Cryptococcus neoformans var. neoformans JEC21 Rab/GTPase (CNC04340)
           partial mRNA
          Length = 997

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 276 tgcaaatttgggatactgctgggcaagaacgatttaggaccatcacaa 323
           |||| |||||||||||||||||||||||||| ||  | ||||||||||
Sbjct: 208 tgcagatttgggatactgctgggcaagaacgtttccgaaccatcacaa 255

---

>ref|XM_570809.1| Cryptococcus neoformans var. neoformans JEC21 ras-related protein
           ypt3 (rab) (CNE01820) partial mRNA
          Length = 900

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 277 gcaaatttgggatactgctgggcaagaacgat 308
           ||||||||||||||||||||| ||||||||||
Sbjct: 191 gcaaatttgggatactgctggacaagaacgat 222

---

>ref|XM_650833.1| Entamoeba histolytica HM-1:IMSS Rab family GTPase (20.t00035)
           partial mRNA
          Length = 606

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 281 atttgggatactgctgggcaagaacgatttag 312
           ||||||||||||||||| ||||||||||||||
Sbjct: 172 atttgggatactgctggtcaagaacgatttag 203

---

>emb|Y00094.1|MMYPT1 Mouse mRNA for ras-related YPT1 protein
          Length = 1428

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 59/68 (86%), Gaps = 1/68 (1%)
 Strand = Plus / Plus

                                                                       
Query: 341 gcccatggcatcattgtcgtgtatgatgtgactgaccaggagagcttcaa-cacgtcaaa 399
           |||||||||||||| || |||||||||||||| || ||||||  ||||||  |||| |||
Sbjct: 379 gcccatggcatcatagttgtgtatgatgtgacagatcaggagtccttcaataacgttaaa 438

                   
Query: 400 cagtggct 407
           ||||||||
Sbjct: 439 cagtggct 446


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,437,005
Number of Sequences: 3902068
Number of extensions: 3437005
Number of successful extensions: 67841
Number of sequences better than 10.0: 767
Number of HSP's better than 10.0 without gapping: 767
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 66367
Number of HSP's gapped (non-prelim): 1428
length of query: 444
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 422
effective length of database: 17,147,199,772
effective search space: 7236118303784
effective search space used: 7236118303784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---