>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score = 85.7 bits (43), Expect = 6e-15
 Identities = 43/43 (100%)
 Strand = Plus / Plus

                                                     
Query: 1  tcttcttcttctctagcgagctaggcttggaggtgagcgaaaa 43
          |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22 tcttcttcttctctagcgagctaggcttggaggtgagcgaaaa 64

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
          complete cds
          Length = 1133

 Score = 50.1 bits (25), Expect = 3e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                       
Query: 15 agcgagctaggcttggaggtgagcgaaaa 43
          ||||||||||||| |||||||||||||||
Sbjct: 67 agcgagctaggctcggaggtgagcgaaaa 95

>emb|AL772131.5| Mouse DNA sequence from clone RP23-472I13 on chromosome 4, complete
             sequence
          Length = 179035

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 18    gagctaggcttggaggtga 36
             |||||||||||||||||||
Sbjct: 48053 gagctaggcttggaggtga 48071

>gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca coagulata), complete
              genome
          Length = 686194

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      tcttcttcttctctagcg 18
              ||||||||||||||||||
Sbjct: 426648 tcttcttcttctctagcg 426665

>gb|AC131804.4| Mus musculus BAC clone RP24-553C6 from chromosome 1, complete sequence
          Length = 138699

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 22    taggcttggaggtgagcg 39
             ||||||||||||||||||
Sbjct: 89048 taggcttggaggtgagcg 89031

>emb|AL606594.4| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0029H02,
            complete sequence
          Length = 173171

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    tcttcttcttctctagcgagct 22
            ||||||||||||| ||||||||
Sbjct: 1136 tcttcttcttctccagcgagct 1115

>gb|AE004312.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 220
            of 251 of the complete chromosome
          Length = 12625

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 19   agctaggcttggaggtgagcga 40
            ||||||||||| ||||||||||
Sbjct: 8413 agctaggcttgaaggtgagcga 8392

>emb|AL353782.23| Human DNA sequence from clone RP11-207C11 on chromosome 9 Contains the 5'
              end of the GPR51 gene for G protein-coupled receptor 51
              (HG20, GABBR2, GPRC3B, GABABR2), the 3' end of a novel gene
              (FLJ36928), a CDC10 cell division cycle 10 homolog (S.
              cerevisiae) (SEPT7) pseudogene and a CpG island, complete
              sequence
          Length = 165358

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      tcttcttcttctctagcg 18
              ||||||||||||||||||
Sbjct: 105629 tcttcttcttctctagcg 105612

>emb|BX033490.1|CNS08Y06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 22  taggcttggaggtgagcg 39
           ||||||||||||||||||
Sbjct: 573 taggcttggaggtgagcg 556

>gb|AC154538.2| Mus musculus BAC clone RP23-451M23 from chromosome 16, complete
             sequence
          Length = 176390

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 21    ctaggcttggaggtgagc 38
             ||||||||||||||||||
Sbjct: 35660 ctaggcttggaggtgagc 35643

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                      
Query: 1        tcttcttcttctctagcgagct 22
                ||||||||||||| ||||||||
Sbjct: 24880551 tcttcttcttctccagcgagct 24880530

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 1        tcttcttcttctctagcg 18
                ||||||||||||||||||
Sbjct: 27204869 tcttcttcttctctagcg 27204886

>emb|AL442115.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0711G06, complete
            sequence
          Length = 148644

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 1    tcttcttcttctctagcgagct 22
            ||||||||||||| ||||||||
Sbjct: 1110 tcttcttcttctccagcgagct 1089

>gb|AE000511.1| Helicobacter pylori 26695, complete genome
          Length = 1667867

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 4       tcttcttctctagcgagc 21
               ||||||||||||||||||
Sbjct: 1022898 tcttcttctctagcgagc 1022915

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                  
Query: 1        tcttcttcttctctagcg 18
                ||||||||||||||||||
Sbjct: 27130469 tcttcttcttctctagcg 27130486

>emb|AL359183.16| Human DNA sequence from clone RP11-327E2 on chromosome 10 Contains the
             3' end of the gene for equilibrative nucleoside
             transporter 3 (ENT3), the 5' end of the CDH23 gene for
             cadherin related 23, a novel gene and one CpG island,
             complete sequence
          Length = 180745

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 18    gagctaggcttggaggtg 35
             ||||||||||||||||||
Sbjct: 55095 gagctaggcttggaggtg 55078

>emb|AL731887.5|CNS08C8R Oryza sativa chromosome 12, . BAC OJ1559_C07 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 145816

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      tcttcttcttctctagcg 18
              ||||||||||||||||||
Sbjct: 143768 tcttcttcttctctagcg 143785

>emb|AL606627.3|OSJN00052 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0067K08,
              complete sequence
          Length = 170765

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 1      tcttcttcttctctagcgagct 22
              ||||||||||||| ||||||||
Sbjct: 142267 tcttcttcttctccagcgagct 142246

>emb|AL831809.3|CNS08CAM Oryza sativa chromosome 12, . BAC OJ1268_D02 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146585

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 1     tcttcttcttctctagcg 18
             ||||||||||||||||||
Sbjct: 17901 tcttcttcttctctagcg 17918


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,133,600
Number of Sequences: 3902068
Number of extensions: 1133600
Number of successful extensions: 761709
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 761157
Number of HSP's gapped (non-prelim): 552
length of query: 43
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 23
effective length of database: 17,155,003,908
effective search space: 394565089884
effective search space used: 394565089884
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)