ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast40f09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016485.1| Zea mays clone Contig318 mRNA sequence 464 e-127
2gb|BT016521.1| Zea mays clone Contig354 mRNA sequence 440 e-120
3gb|AY103617.1| Zea mays PCO143386 mRNA sequence 440 e-120
4dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-120
5dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-120
6dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-120
7dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-120
8ref|XM_470555.1| Oryza sativa (japonica cultivar-group), predic... 432 e-118
9gb|BT016624.1| Zea mays clone Contig457 mRNA sequence 410 e-111
10dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clon... 325 7e-86
11ref|XM_479167.1| Oryza sativa (japonica cultivar-group), mRNA 295 6e-77
12ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group... 295 6e-77
13ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group... 295 6e-77
14ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group... 295 6e-77
15dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 6e-77
16dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 6e-77
17dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 6e-77
18dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clon... 295 6e-77
19dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clon... 268 1e-68
20dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 1e-68
21dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 268 1e-68
22gb|AY105034.1| Zea mays PCO130341 mRNA sequence 266 6e-68
23gb|BT016512.1| Zea mays clone Contig345 mRNA sequence 258 1e-65
24gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 244 2e-61
25gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nippon... 244 2e-61
26dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 244 2e-61
27dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 224 2e-55
28dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 172 6e-40
29dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic D... 172 6e-40
30gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p... 133 5e-28
31ref|NM_001036190.1| Arabidopsis thaliana P40; structural constit... 127 3e-26
32ref|NM_105896.2| Arabidopsis thaliana P40; structural constituen... 127 3e-26
33gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal prote... 127 3e-26
34emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue 127 3e-26
35gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal prote... 127 3e-26
36gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal prote... 127 3e-26
37gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co... 127 3e-26
38gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal prote... 127 3e-26
39gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co... 127 3e-26
40gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, co... 127 3e-26
41emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Co... 127 3e-26
42emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Co... 127 3e-26
43gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete s... 127 3e-26
44gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin recep... 127 3e-26
45emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40 119 8e-24
46emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene 119 8e-24
47gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10... 119 8e-24
48gb|AF097522.1|AF097522 Brassica napus laminin receptor-like prot... 117 3e-23
49gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence 84 4e-13
50gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence 84 4e-13
51gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA 82 2e-12
52gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence 82 2e-12
53gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence 82 2e-12
54emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7 82 2e-12
55gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ... 82 2e-12
56gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA 82 2e-12
57gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA 82 2e-12
58ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, ... 82 2e-12
59ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, ... 82 2e-12
60gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end 82 2e-12
61ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, ... 82 2e-12
62gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 82 2e-12
63gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k1... 82 2e-12
64dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, parti... 82 2e-12
65dbj|AB032438.1| Drosophila erecta sta gene for stubarista, parti... 80 7e-12
66dbj|AB032439.1| Drosophila orena sta gene for stubarista, partia... 72 2e-09
67dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complet... 66 1e-07
68emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
69gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associate... 62 2e-06
70emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associa... 60 7e-06
71gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein m... 54 4e-04
72ref|XM_749197.1| Aspergillus fumigatus Af293 40S ribosomal prote... 54 4e-04
73gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ... 54 4e-04
74gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete se... 54 4e-04
75gb|BC061298.1| Xenopus tropicalis ribosomal protein SA, mRNA (cD... 54 4e-04
76ref|NM_203737.1| Xenopus tropicalis ribosomal protein SA (MGC757... 54 4e-04
77emb|CR942700.2| Xenopus tropicalis finished cDNA, clone TNeu119p20 54 4e-04
78ref|XM_322650.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
79ref|XM_951747.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
80gb|DQ440314.1| Aedes aegypti clone AET-398 40S ribosomal protein... 52 0.002
81ref|XM_391081.1| Gibberella zeae PH-1 chromosome 3 conserved hyp... 52 0.002
82ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predi... 52 0.002
83emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II B... 52 0.002
84emb|CR938589.1| Single read from an extremity of a full-length c... 52 0.002
85emb|CR938120.1| Single read from an extremity of a full-length c... 52 0.002
86emb|CR938108.1| Single read from an extremity of a full-length c... 52 0.002
87emb|CR937995.1| Single read from an extremity of a full-length c... 52 0.002
88emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1... 52 0.002
89emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-... 50 0.006
90emb|BX053371.1|CNS09DCF Single read from an extremity of a full-... 50 0.006
91emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-... 50 0.006
92emb|BX071531.1|CNS09RCV Single read from an extremity of a full-... 50 0.006
93emb|BX071203.1|CNS09R3R Single read from an extremity of a full-... 50 0.006
94emb|BX071128.1|CNS09R1O Single read from an extremity of a full-... 50 0.006
95emb|BX071053.1|CNS09QZL Single read from an extremity of a full-... 50 0.006
96emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-... 50 0.006
97emb|BX070730.1|CNS09QQM Single read from an extremity of a full-... 50 0.006
98emb|BX070261.1|CNS09QDL Single read from an extremity of a full-... 50 0.006
99emb|BX070237.1|CNS09QCX Single read from an extremity of a full-... 50 0.006
100emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-... 50 0.006
101emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-... 50 0.006
102emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-... 50 0.006
103emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-... 50 0.006
104emb|BX068381.1|CNS09OXD Single read from an extremity of a full-... 50 0.006
105emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-... 50 0.006
106emb|BX067522.1|CNS09O9I Single read from an extremity of a full-... 50 0.006
107emb|BX067353.1|CNS09O4T Single read from an extremity of a full-... 50 0.006
108emb|BX067352.1|CNS09O4S Single read from an extremity of a full-... 50 0.006
109emb|BX067347.1|CNS09O4N Single read from an extremity of a full-... 50 0.006
110emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-... 50 0.006
111emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-... 50 0.006
112emb|BX067213.1|CNS09O0X Single read from an extremity of a full-... 50 0.006
113emb|BX066172.1|CNS09N80 Single read from an extremity of a full-... 50 0.006
114emb|BX065840.1|CNS09MYS Single read from an extremity of a full-... 50 0.006
115emb|BX065656.1|CNS09MTO Single read from an extremity of a full-... 50 0.006
116emb|BX065484.1|CNS09MOW Single read from an extremity of a full-... 50 0.006
117emb|BX065339.1|CNS09MKV Single read from an extremity of a full-... 50 0.006
118emb|BX064723.1|CNS09M3R Single read from an extremity of a full-... 50 0.006
119emb|BX064630.1|CNS09M16 Single read from an extremity of a full-... 50 0.006
120emb|BX064621.1|CNS09M0X Single read from an extremity of a full-... 50 0.006
121emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-... 50 0.006
122emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-... 50 0.006
123emb|BX063172.1|CNS09KWO Single read from an extremity of a full-... 50 0.006
124emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-... 50 0.006
125emb|BX062255.1|CNS09K77 Single read from an extremity of a full-... 50 0.006
126emb|BX062254.1|CNS09K76 Single read from an extremity of a full-... 50 0.006
127emb|BX062187.1|CNS09K5B Single read from an extremity of a full-... 50 0.006
128emb|BX061828.1|CNS09JVC Single read from an extremity of a full-... 50 0.006
129emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-... 50 0.006
130emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-... 50 0.006
131emb|BX061413.1|CNS09JJT Single read from an extremity of a full-... 50 0.006
132emb|BX061395.1|CNS09JJB Single read from an extremity of a full-... 50 0.006
133emb|BX060764.1|CNS09J1S Single read from an extremity of a full-... 50 0.006
134emb|BX060566.1|CNS09IWA Single read from an extremity of a full-... 50 0.006
135emb|BX060291.1|CNS09ION Single read from an extremity of a full-... 50 0.006
136emb|BX060009.1|CNS09IGT Single read from an extremity of a full-... 50 0.006
137emb|BX059650.1|CNS09I6U Single read from an extremity of a full-... 50 0.006
138emb|BX059559.1|CNS09I4B Single read from an extremity of a full-... 50 0.006
139emb|BX059479.1|CNS09I23 Single read from an extremity of a full-... 50 0.006
140emb|BX059203.1|CNS09HUF Single read from an extremity of a full-... 50 0.006
141emb|BX059202.1|CNS09HUE Single read from an extremity of a full-... 50 0.006
142emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-... 50 0.006
143emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-... 50 0.006
144emb|BX058368.1|CNS09H78 Single read from an extremity of a full-... 50 0.006
145emb|BX058299.1|CNS09H5B Single read from an extremity of a full-... 50 0.006
146emb|BX058273.1|CNS09H4L Single read from an extremity of a full-... 50 0.006
147emb|BX058144.1|CNS09H10 Single read from an extremity of a full-... 50 0.006
148emb|BX058069.1|CNS09GYX Single read from an extremity of a full-... 50 0.006
149emb|BX056716.1|CNS09FXC Single read from an extremity of a full-... 50 0.006
150emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-... 50 0.006
151emb|BX057691.1|CNS09GOF Single read from an extremity of a full-... 50 0.006
152emb|BX057689.1|CNS09GOD Single read from an extremity of a full-... 50 0.006
153emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-... 50 0.006
154emb|BX057084.1|CNS09G7K Single read from an extremity of a full-... 50 0.006
155emb|BX056920.1|CNS09G30 Single read from an extremity of a full-... 50 0.006
156emb|BX056570.1|CNS09FTA Single read from an extremity of a full-... 50 0.006
157emb|BX056337.1|CNS09FMT Single read from an extremity of a full-... 50 0.006
158emb|BX056336.1|CNS09FMS Single read from an extremity of a full-... 50 0.006
159emb|BX056269.1|CNS09FKX Single read from an extremity of a full-... 50 0.006
160emb|BX056116.1|CNS09FGO Single read from an extremity of a full-... 50 0.006
161emb|BX056090.1|CNS09FFY Single read from an extremity of a full-... 50 0.006
162emb|BX055751.1|CNS09F6J Single read from an extremity of a full-... 50 0.006
163emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-... 50 0.006
164emb|BX054928.1|CNS09EJO Single read from an extremity of a full-... 50 0.006
165emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-... 50 0.006
166emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-... 50 0.006
167emb|BX053590.1|CNS09DII Single read from an extremity of a full-... 50 0.006
168emb|BX052800.1|CNS09CWK Single read from an extremity of a full-... 50 0.006
169emb|BX052798.1|CNS09CWI Single read from an extremity of a full-... 50 0.006
170emb|BX052551.1|CNS09CPN Single read from an extremity of a full-... 50 0.006
171emb|BX052477.1|CNS09CNL Single read from an extremity of a full-... 50 0.006
172emb|BX052476.1|CNS09CNK Single read from an extremity of a full-... 50 0.006
173emb|BX051837.1|CNS09C5T Single read from an extremity of a full-... 50 0.006
174emb|BX051209.1|CNS09BOD Single read from an extremity of a full-... 50 0.006
175emb|BX049918.1|CNS09AOI Single read from an extremity of a full-... 50 0.006
176emb|BX049879.1|CNS09ANF Single read from an extremity of a full-... 50 0.006
177emb|BX049604.1|CNS09AFS Single read from an extremity of a full-... 50 0.006
178emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-... 50 0.006
179emb|BX049364.1|CNS09A94 Single read from an extremity of a full-... 50 0.006
180emb|BX049219.1|CNS09A53 Single read from an extremity of a full-... 50 0.006
181emb|BX049063.1|CNS09A0R Single read from an extremity of a full-... 50 0.006
182emb|BX048945.1|CNS099XH Single read from an extremity of a full-... 50 0.006
183emb|BX048268.1|CNS099EO Single read from an extremity of a full-... 50 0.006
184emb|BX047396.1|CNS098QG Single read from an extremity of a full-... 50 0.006
185emb|BX046740.1|CNS09888 Single read from an extremity of a full-... 50 0.006
186emb|BX046217.1|CNS097TP Single read from an extremity of a full-... 50 0.006
187emb|BX046120.1|CNS097R0 Single read from an extremity of a full-... 50 0.006
188emb|BX045820.1|CNS097IO Single read from an extremity of a full-... 50 0.006
189emb|BX045707.1|CNS097FJ Single read from an extremity of a full-... 50 0.006
190emb|BX044948.1|CNS096UG Single read from an extremity of a full-... 50 0.006
191emb|BX044495.1|CNS096HV Single read from an extremity of a full-... 50 0.006
192emb|BX043740.1|CNS095WW Single read from an extremity of a full-... 50 0.006
193emb|BX043445.1|CNS095OP Single read from an extremity of a full-... 50 0.006
194emb|BX043330.1|CNS095LI Single read from an extremity of a full-... 50 0.006
195emb|BX042876.1|CNS0958W Single read from an extremity of a full-... 50 0.006
196emb|BX042850.1|CNS09586 Single read from an extremity of a full-... 50 0.006
197emb|BX042652.1|CNS0952O Single read from an extremity of a full-... 50 0.006
198emb|BX042358.1|CNS094UI Single read from an extremity of a full-... 50 0.006
199emb|BX042337.1|CNS094TX Single read from an extremity of a full-... 50 0.006
200emb|BX041420.1|CNS0944G Single read from an extremity of a full-... 50 0.006
201emb|BX041297.1|CNS09411 Single read from an extremity of a full-... 50 0.006
202emb|BX039405.1|CNS092KH Single read from an extremity of a full-... 50 0.006
203emb|BX039319.1|CNS092I3 Single read from an extremity of a full-... 50 0.006
204emb|BX037243.1|CNS090WF Single read from an extremity of a full-... 50 0.006
205emb|BX036479.1|CNS090B7 Single read from an extremity of a full-... 50 0.006
206emb|BX036426.1|CNS0909Q Single read from an extremity of a full-... 50 0.006
207emb|BX036415.1|CNS0909F Single read from an extremity of a full-... 50 0.006
208emb|BX036246.1|CNS0904Q Single read from an extremity of a full-... 50 0.006
209emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-... 50 0.006
210emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-... 50 0.006
211emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-... 50 0.006
212emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-... 50 0.006
213emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-... 50 0.006
214emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-... 50 0.006
215emb|BX034628.1|CNS08YVS Single read from an extremity of a full-... 50 0.006
216emb|BX034627.1|CNS08YVR Single read from an extremity of a full-... 50 0.006
217emb|BX034339.1|CNS08YNR Single read from an extremity of a full-... 50 0.006
218emb|BX034214.1|CNS08YKA Single read from an extremity of a full-... 50 0.006
219emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-... 50 0.006
220emb|BX033175.1|CNS08XRF Single read from an extremity of a full-... 50 0.006
221emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-... 50 0.006
222emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-... 50 0.006
223emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-... 50 0.006
224emb|BX032290.1|CNS08X2U Single read from an extremity of a full-... 50 0.006
225emb|BX032289.1|CNS08X2T Single read from an extremity of a full-... 50 0.006
226emb|BX032041.1|CNS08WVX Single read from an extremity of a full-... 50 0.006
227emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-... 50 0.006
228emb|BX031898.1|CNS08WRY Single read from an extremity of a full-... 50 0.006
229emb|BX031717.1|CNS08WMX Single read from an extremity of a full-... 50 0.006
230emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-... 50 0.006
231emb|BX031483.1|CNS08WGF Single read from an extremity of a full-... 50 0.006
232emb|BX031337.1|CNS08WCD Single read from an extremity of a full-... 50 0.006
233emb|BX031303.1|CNS08WBF Single read from an extremity of a full-... 50 0.006
234emb|BX030674.1|CNS08VTY Single read from an extremity of a full-... 50 0.006
235emb|BX031154.1|CNS08W7A Single read from an extremity of a full-... 50 0.006
236emb|BX031118.1|CNS08W6A Single read from an extremity of a full-... 50 0.006
237emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-... 50 0.006
238emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-... 50 0.006
239emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-... 50 0.006
240emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-... 50 0.006
241emb|BX029939.1|CNS08V9J Single read from an extremity of a full-... 50 0.006
242emb|BX029906.1|CNS08V8M Single read from an extremity of a full-... 50 0.006
243emb|BX029898.1|CNS08V8E Single read from an extremity of a full-... 50 0.006
244emb|BX029447.1|CNS08UVV Single read from an extremity of a full-... 50 0.006
245emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-... 50 0.006
246emb|BX028713.1|CNS08UBH Single read from an extremity of a full-... 50 0.006
247emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-... 50 0.006
248emb|BX028388.1|CNS08U2G Single read from an extremity of a full-... 50 0.006
249emb|BX028172.1|CNS08TWG Single read from an extremity of a full-... 50 0.006
250emb|BX027823.1|CNS08TMR Single read from an extremity of a full-... 50 0.006
251emb|BX027638.1|CNS08THM Single read from an extremity of a full-... 50 0.006
252emb|BX027470.1|CNS08TCY Single read from an extremity of a full-... 50 0.006
253emb|BX026965.1|CNS08SYX Single read from an extremity of a full-... 50 0.006
254emb|BX026808.1|CNS08SUK Single read from an extremity of a full-... 50 0.006
255emb|BX026757.1|CNS08ST5 Single read from an extremity of a full-... 50 0.006
256emb|BX026536.1|CNS08SN0 Single read from an extremity of a full-... 50 0.006
257emb|BX026482.1|CNS08SLI Single read from an extremity of a full-... 50 0.006
258emb|BX026481.1|CNS08SLH Single read from an extremity of a full-... 50 0.006
259emb|BX025854.1|CNS08S42 Single read from an extremity of a full-... 50 0.006
260emb|BX025749.1|CNS08S15 Single read from an extremity of a full-... 50 0.006
261emb|BX025670.1|CNS08RYY Single read from an extremity of a full-... 50 0.006
262emb|BX025450.1|CNS08RSU Single read from an extremity of a full-... 50 0.006
263emb|BX025107.1|CNS08RJB Single read from an extremity of a full-... 50 0.006
264emb|BX025103.1|CNS08RJ7 Single read from an extremity of a full-... 50 0.006
265emb|BX024846.1|CNS08RC2 Single read from an extremity of a full-... 50 0.006
266emb|BX024832.1|CNS08RBO Single read from an extremity of a full-... 50 0.006
267emb|BX024754.1|CNS08R9I Single read from an extremity of a full-... 50 0.006
268emb|BX024652.1|CNS08R6O Single read from an extremity of a full-... 50 0.006
269emb|BX024344.1|CNS08QY4 Single read from an extremity of a full-... 50 0.006
270emb|BX024069.1|CNS08QQH Single read from an extremity of a full-... 50 0.006
271emb|BX023999.1|CNS08QOJ Single read from an extremity of a full-... 50 0.006
272emb|BX023956.1|CNS08QNC Single read from an extremity of a full-... 50 0.006
273emb|BX023909.1|CNS08QM1 Single read from an extremity of a full-... 50 0.006
274emb|BX023824.1|CNS08QJO Single read from an extremity of a full-... 50 0.006
275emb|BX023742.1|CNS08QHE Single read from an extremity of a full-... 50 0.006
276emb|BX023643.1|CNS08QEN Single read from an extremity of a full-... 50 0.006
277emb|BX023296.1|CNS08Q50 Single read from an extremity of a full-... 50 0.006
278emb|BX023108.1|CNS08PZS Single read from an extremity of a full-... 50 0.006
279emb|BX022975.1|CNS08PW3 Single read from an extremity of a full-... 50 0.006
280emb|BX022548.1|CNS08PK8 Single read from an extremity of a full-... 50 0.006
281emb|BX021908.1|CNS08P2G Single read from an extremity of a full-... 50 0.006
282emb|BX021737.1|CNS08OXP Single read from an extremity of a full-... 50 0.006
283emb|BX021571.1|CNS08OT3 Single read from an extremity of a full-... 50 0.006
284emb|BX021462.1|CNS08OQ2 Single read from an extremity of a full-... 50 0.006
285emb|BX021331.1|CNS08OMF Single read from an extremity of a full-... 50 0.006
286emb|BX020818.1|CNS08O86 Single read from an extremity of a full-... 50 0.006
287emb|BX020770.1|CNS08O6U Single read from an extremity of a full-... 50 0.006
288emb|BX020718.1|CNS08O5E Single read from an extremity of a full-... 50 0.006
289emb|BX020438.1|CNS08NXM Single read from an extremity of a full-... 50 0.006
290emb|BX019922.1|CNS08NJA Single read from an extremity of a full-... 50 0.006
291emb|BX019254.1|CNS08N0Q Single read from an extremity of a full-... 50 0.006
292emb|BX019220.1|CNS08MZS Single read from an extremity of a full-... 50 0.006
293emb|BX018801.1|CNS08MO5 Single read from an extremity of a full-... 50 0.006
294emb|BX018535.1|CNS08MGR Single read from an extremity of a full-... 50 0.006
295emb|BX017379.1|CNS08LKN Single read from an extremity of a full-... 50 0.006
296emb|BX017311.1|CNS08LIR Single read from an extremity of a full-... 50 0.006
297emb|BX017271.1|CNS08LHN Single read from an extremity of a full-... 50 0.006
298emb|BX017270.1|CNS08LHM Single read from an extremity of a full-... 50 0.006
299emb|BX016954.1|CNS08L8U Single read from an extremity of a full-... 50 0.006
300emb|BX016896.1|CNS08L78 Single read from an extremity of a full-... 50 0.006
301emb|BX016856.1|CNS08L64 Single read from an extremity of a full-... 50 0.006
302emb|BX016665.1|CNS08L0T Single read from an extremity of a full-... 50 0.006
303emb|BX015859.1|CNS08KEF Single read from an extremity of a full-... 50 0.006
304emb|BX015858.1|CNS08KEE Single read from an extremity of a full-... 50 0.006
305emb|BX015795.1|CNS08KCN Single read from an extremity of a full-... 50 0.006
306emb|BX015743.1|CNS08KB7 Single read from an extremity of a full-... 50 0.006
307emb|BX016230.1|CNS08KOQ Single read from an extremity of a full-... 50 0.006
308emb|BX015945.1|CNS08KGT Single read from an extremity of a full-... 50 0.006
309emb|BX015925.1|CNS08KG9 Single read from an extremity of a full-... 50 0.006
310emb|BX015305.1|CNS08JZ1 Single read from an extremity of a full-... 50 0.006
311emb|BX015611.1|CNS08K7J Single read from an extremity of a full-... 50 0.006
312emb|BX014926.1|CNS08JOI Single read from an extremity of a full-... 50 0.006
313emb|BX014301.1|CNS08J75 Single read from an extremity of a full-... 50 0.006
314emb|BX013989.1|CNS08IYH Single read from an extremity of a full-... 50 0.006
315emb|BX013692.1|CNS08IQ8 Single read from an extremity of a full-... 50 0.006
316emb|BX013507.1|CNS08IL3 Single read from an extremity of a full-... 50 0.006
317emb|BX013495.1|CNS08IKR Single read from an extremity of a full-... 50 0.006
318emb|BX013299.1|CNS08IFB Single read from an extremity of a full-... 50 0.006
319emb|BX013295.1|CNS08IF7 Single read from an extremity of a full-... 50 0.006
320emb|BX013103.1|CNS08I9V Single read from an extremity of a full-... 50 0.006
321emb|BX012511.1|CNS08HTF Single read from an extremity of a full-... 50 0.006
322emb|BX012242.1|CNS08HLY Single read from an extremity of a full-... 50 0.006
323emb|BX012147.1|CNS08HJB Single read from an extremity of a full-... 50 0.006
324emb|BX012005.1|CNS08HFD Single read from an extremity of a full-... 50 0.006
325emb|BX011777.1|CNS08H91 Single read from an extremity of a full-... 50 0.006
326emb|BX011776.1|CNS08H90 Single read from an extremity of a full-... 50 0.006
327emb|BX011772.1|CNS08H8W Single read from an extremity of a full-... 50 0.006
328emb|BX011603.1|CNS08H47 Single read from an extremity of a full-... 50 0.006
329emb|BX011581.1|CNS08H3L Single read from an extremity of a full-... 50 0.006
330emb|BX011489.1|CNS08H11 Single read from an extremity of a full-... 50 0.006
331emb|BX011488.1|CNS08H10 Single read from an extremity of a full-... 50 0.006
332emb|BX011178.1|CNS08GSE Single read from an extremity of a full-... 50 0.006
333emb|BX010356.1|CNS08G5K Single read from an extremity of a full-... 50 0.006
334emb|BX010127.1|CNS08FZ7 Single read from an extremity of a full-... 50 0.006
335emb|BX010071.1|CNS08FXN Single read from an extremity of a full-... 50 0.006
336emb|BX009592.1|CNS08FKC Single read from an extremity of a full-... 50 0.006
337emb|BX008659.1|CNS08EUF Single read from an extremity of a full-... 50 0.006
338emb|BX008505.1|CNS08EQ5 Single read from an extremity of a full-... 50 0.006
339emb|BX008395.1|CNS08EN3 Single read from an extremity of a full-... 50 0.006
340emb|BX008250.1|CNS08EJ2 Single read from an extremity of a full-... 50 0.006
341emb|BX007865.1|CNS08E8D Single read from an extremity of a full-... 50 0.006
342emb|BX007549.1|CNS08DZL Single read from an extremity of a full-... 50 0.006
343emb|BX007204.1|CNS08DQ0 Single read from an extremity of a full-... 50 0.006
344emb|BX007203.1|CNS08DPZ Single read from an extremity of a full-... 50 0.006
345emb|BX007147.1|CNS08DOF Single read from an extremity of a full-... 50 0.006
346emb|BX006304.1|CNS08D10 Single read from an extremity of a full-... 50 0.006
347emb|BX005921.1|CNS08CQD Single read from an extremity of a full-... 50 0.006
348emb|BX005588.1|CNS08CH4 Single read from an extremity of a full-... 50 0.006
349emb|CR938650.1| Single read from an extremity of a full-length c... 50 0.006
350ref|XM_320736.2| Anopheles gambiae str. PEST ENSANGP00000020171 ... 50 0.006
351emb|BX041242.1|CNS093ZI Single read from an extremity of a full-... 48 0.025
352emb|BX023957.1|CNS08QND Single read from an extremity of a full-... 48 0.025
353emb|BX015037.1|CNS08JRL Single read from an extremity of a full-... 48 0.025
354gb|AY190671.1| Pagrus major 40S ribosomal protein Sa mRNA, parti... 46 0.098
355gb|AY351649.1| Acanthamoeba healyi laminin-binding protein mRNA,... 46 0.098
356emb|BX024000.1|CNS08QOK Single read from an extremity of a full-... 46 0.098
357emb|BX006256.1|CNS08CZO Single read from an extremity of a full-... 46 0.098
358gb|AY550956.1| Sparus aurata 40S ribosomal protein Sa-like prote... 46 0.098
359gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.39
360ref|XM_572918.1| Cryptococcus neoformans var. neoformans JEC21 4... 44 0.39
361ref|XM_792701.1| PREDICTED: Strongylocentrotus purpuratus simila... 44 0.39
362emb|BX069252.1|CNS09PLK Single read from an extremity of a full-... 44 0.39
363emb|BX048785.1|CNS099T1 Single read from an extremity of a full-... 44 0.39
364emb|BX014555.1|CNS08JE7 Single read from an extremity of a full-... 44 0.39
365emb|CR938492.1| Single read from an extremity of a full-length c... 44 0.39
366gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome 44 0.39
367gb|AC023825.8| Homo sapiens chromosome 16 clone RP11-322D14, com... 44 0.39
368dbj|AK108362.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.39
369gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome 42 1.5
370ref|NM_193932.1| Oryza sativa (japonica cultivar-group), predic... 42 1.5
371gb|AF101045.1| Oryza sativa (japonica cultivar-group) putative A... 42 1.5
372gb|U70541.1|OSU70541 Oryza sativa (indica cultivar-group) putati... 42 1.5
373emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chr... 42 1.5
374emb|AL096767.14|HSJ579N16 Human DNA sequence from clone RP4-579N... 42 1.5
375emb|BX060346.1|CNS09IQ6 Single read from an extremity of a full-... 42 1.5
376emb|BX060345.1|CNS09IQ5 Single read from an extremity of a full-... 42 1.5
377emb|BX059338.1|CNS09HY6 Single read from an extremity of a full-... 42 1.5
378emb|BX056727.1|CNS09FXN Single read from an extremity of a full-... 42 1.5
379emb|BX030897.1|CNS08W05 Single read from an extremity of a full-... 42 1.5
380emb|BX047263.1|CNS098MR Single read from an extremity of a full-... 42 1.5
381emb|BX045530.1|CNS097AM Single read from an extremity of a full-... 42 1.5
382emb|BX035678.1|CNS08ZOY Single read from an extremity of a full-... 42 1.5
383emb|BX035677.1|CNS08ZOX Single read from an extremity of a full-... 42 1.5
384emb|BX033928.1|CNS08YCC Single read from an extremity of a full-... 42 1.5
385emb|BX032604.1|CNS08XBK Single read from an extremity of a full-... 42 1.5
386emb|BX027127.1|CNS08T3F Single read from an extremity of a full-... 42 1.5
387emb|BX027126.1|CNS08T3E Single read from an extremity of a full-... 42 1.5
388emb|BX026703.1|CNS08SRN Single read from an extremity of a full-... 42 1.5
389emb|BX024221.1|CNS08QUP Single read from an extremity of a full-... 42 1.5
390emb|BX023584.1|CNS08QD0 Single read from an extremity of a full-... 42 1.5
391emb|BX019733.1|CNS08NE1 Single read from an extremity of a full-... 42 1.5
392emb|BX021163.1|CNS08OHR Single read from an extremity of a full-... 42 1.5
393emb|BX020765.1|CNS08O6P Single read from an extremity of a full-... 42 1.5
394emb|BX020707.1|CNS08O53 Single read from an extremity of a full-... 42 1.5
395emb|BX018984.1|CNS08MT8 Single read from an extremity of a full-... 42 1.5
396emb|BX012873.1|CNS08I3H Single read from an extremity of a full-... 42 1.5
397emb|BX012174.1|CNS08HK2 Single read from an extremity of a full-... 42 1.5
398emb|BX011604.1|CNS08H48 Single read from an extremity of a full-... 42 1.5
399emb|BX011136.1|CNS08GR8 Single read from an extremity of a full-... 42 1.5
400emb|BX007568.1|CNS08E04 Single read from an extremity of a full-... 42 1.5
401emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,... 42 1.5
402dbj|AB225911.1| Aspergillus oryzae cDNA, contig sequence: AoEST2766 42 1.5
403dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 42 1.5
404gb|AC161538.7| Mus musculus 6 BAC RP23-1D15 (Roswell Park Cancer... 42 1.5
405gb|AC160148.7| Mus musculus 6 BAC RP23-384N6 (Roswell Park Cance... 42 1.5
406dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
407dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
408dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
409gb|AE004832.1| Pseudomonas aeruginosa PAO1, section 393 of 529 o... 42 1.5
410dbj|AP003853.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
411dbj|AP004317.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
412dbj|AP005689.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
413dbj|AP005685.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
414emb|Y07956.1|OSDIHYFLA O.sativa mRNA for dihydroflavonol reductase 42 1.5
415dbj|AK065335.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
416dbj|AB003495.1| Oryza sativa (japonica cultivar-group) DNA for d... 42 1.5
417gb|L48340.1|MTBKATA Methylobacterium extorquens catalase (katA) ... 42 1.5
418dbj|AB003496.1| Oryza sativa (japonica cultivar-group) mRNA for ... 42 1.5
419ref|NM_180184.1| Arabidopsis thaliana RPSAB; structural constitu... 40 6.0
420ref|NM_111349.2| Arabidopsis thaliana RPSAB; structural constitu... 40 6.0
421gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 6.0
422ref|XM_520453.1| PREDICTED: Pan troglodytes similar to GLSR2492 ... 40 6.0
423ref|NM_020144.4| Homo sapiens poly(A) polymerase beta (testis sp... 40 6.0
424ref|NM_191948.1| Oryza sativa (japonica cultivar-group), predic... 40 6.0
425ref|XM_468611.1| Oryza sativa (japonica cultivar-group), mRNA 40 6.0
426gb|AC146338.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
427gb|AC145272.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
428gb|AC136229.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
429ref|XM_953899.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.0
430ref|XM_331436.1| Neurospora crassa OR74A hypothetical protein (N... 40 6.0
431gb|AY730625.1| Xenopus laevis 67kD laminin receptor precursor, m... 40 6.0
432gb|AC092610.1| Homo sapiens BAC clone RP11-160E17 from 7, comple... 40 6.0
433gb|BC060578.1| Rattus norvegicus ribosomal protein SA, mRNA (cDN... 40 6.0
434gb|BC046271.1| Xenopus laevis laminin receptor 1 (ribosomal prot... 40 6.0
435gb|AC137693.2| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
436gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, compl... 40 6.0
437ref|NM_017138.1| Rattus norvegicus ribosomal protein SA (Rpsa), ... 40 6.0
438gb|BT000551.1| Arabidopsis thaliana putative 40S ribosomal prote... 40 6.0
439emb|BX029512.1|CNS08UXO Single read from an extremity of a full-... 40 6.0
440emb|BX022896.1|CNS08PTW Single read from an extremity of a full-... 40 6.0
441gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 6.0
442gb|BC036653.2| Homo sapiens poly(A) polymerase beta (testis spec... 40 6.0
443gb|AC073392.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
444gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 40 6.0
445gb|AY075693.1| Arabidopsis thaliana AT3g04770/F7O18_26 mRNA, com... 40 6.0
446ref|XM_682448.1| PREDICTED: Danio rerio similar to urotensin 2 r... 40 6.0
447gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 6.0
448gb|AC135559.4| Oryza sativa chromosome 3 BAC OSJNBa0030J19 genom... 40 6.0
449gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 6.0
450dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
451dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
452dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
453dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
454gb|AY087423.1| Arabidopsis thaliana clone 35242 mRNA, complete s... 40 6.0
455dbj|AP004194.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
456dbj|AP004145.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
457dbj|AP005912.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
458dbj|AP005648.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
459dbj|AP005654.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
460dbj|AP005694.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
461dbj|AP005533.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
462dbj|AP005474.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.0
463emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E ... 40 6.0
464emb|AL732334.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 6.0
465gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
466gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.0
467emb|AL662988.4|OSJN00186 Oryza sativa genomic DNA, chromosome 4,... 40 6.0
468emb|AL662983.3|OSJN00181 Oryza sativa genomic DNA, chromosome 4,... 40 6.0
469gb|U66223.1|ATU66223 Arabidopsis thaliana p40 protein homolog mR... 40 6.0
470gb|U02370.1|UCU02370 Urechis caupo 34/67 kD laminin binding prot... 40 6.0
471gb|AC151298.3| Mus musculus BAC clone RP23-7F9 from chromosome 1... 40 6.0
472emb|AL840633.8| Mouse DNA sequence from clone RP23-290E9 on chro... 40 6.0
473dbj|D25224.1|RAT40RP Rat mRNA for 40kDa ribosomal protein, compl... 40 6.0

>gb|BT016485.1| Zea mays clone Contig318 mRNA sequence
          Length = 1267

 Score =  464 bits (234), Expect = e-127
 Identities = 312/338 (92%)
 Strand = Plus / Plus

                                                                       
Query: 110 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 169
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||
Sbjct: 139 gcgctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggc 198

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||||||||| ||||||||||||||||| ||||  ||||||||| |||||||||||
Sbjct: 199 accaagaactgcgatttccagatggagcgctatgcctttaagcgccgcaccgacggcatc 258

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||||||||||| ||||||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 259 tacatcatcaaccttggcaagacatgggagaaactgcagcttgcagcgagggttatcgtt 318

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 319 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctatggccagcgtgct 378

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           |||||||||||||| ||| |||| |||||  | |||||||| ||||||||||||||||||
Sbjct: 379 gtcctcaagttcgctcagtacactggcgctcatgccatcgctgggaggcacacccctggt 438

                                                 
Query: 410 accttcaccaaccagatgcagacctccttcagcgagcc 447
           |||||||| |||||| | ||||||||||||||||||||
Sbjct: 439 accttcactaaccagctccagacctccttcagcgagcc 476



to top

>gb|BT016521.1| Zea mays clone Contig354 mRNA sequence
          Length = 1275

 Score =  440 bits (222), Expect = e-120
 Identities = 309/338 (91%)
 Strand = Plus / Plus

                                                                       
Query: 110 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 169
           |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 178 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 237

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||||||||| |||||||||||||| || | ||  ||||| ||| |||||||||||
Sbjct: 238 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 297

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           ||||||||||||||||||||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 298 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 357

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 358 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 417

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           |||||||||||||||||| |||| |||||| | |||||||| ||||||||||||||||||
Sbjct: 418 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 477

                                                 
Query: 410 accttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||||||||| ||| | |||||||| |||||||||||
Sbjct: 478 accttcaccaatcagctccagacctctttcagcgagcc 515



to top

>gb|AY103617.1| Zea mays PCO143386 mRNA sequence
          Length = 1516

 Score =  440 bits (222), Expect = e-120
 Identities = 309/338 (91%)
 Strand = Plus / Plus

                                                                       
Query: 110 gcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggc 169
           |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 217 gcgctgtcccagaaggagcaggacatacagatgatgctcgcggccgacgtccacctcggc 276

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||||||||| |||||||||||||| || | ||  ||||| ||| |||||||||||
Sbjct: 277 accaagaactgcgatttccagatggagcggtatgtctttaagcgtcgcaccgacggcatc 336

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           ||||||||||||||||||||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 337 tacatcatcaacctgggcaagacatgggataagctccagctcgcggcgagggttattgtt 396

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||||| 
Sbjct: 397 gccattgagaacccacaagacatcatcgtccagtcggcccgcccctacggccagcgtgct 456

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           |||||||||||||||||| |||| |||||| | |||||||| ||||||||||||||||||
Sbjct: 457 gtcctcaagttcgcgcagtacactggcgcccatgccatcgctgggaggcacacccctggt 516

                                                 
Query: 410 accttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||||||||| ||| | |||||||| |||||||||||
Sbjct: 517 accttcaccaatcagctccagacctctttcagcgagcc 554



to top

>dbj|AK104842.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F12, full
           insert sequence
          Length = 1310

 Score =  438 bits (221), Expect = e-120
 Identities = 335/373 (89%)
 Strand = Plus / Plus

                                                                       
Query: 77  accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 197 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 256
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                                       
Query: 257 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 316
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 321

                                                                       
Query: 317 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 376
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 322 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 381

                                                                       
Query: 377 gccaacgccatcgccgggaggcacacccctggtaccttcaccaaccagatgcagacctcc 436
           ||  ||||||| || || ||||| || |||||||| || ||||| ||| | |||||||||
Sbjct: 382 gcgcacgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctcc 441

                        
Query: 437 ttcagcgagcccc 449
           |||||||||||||
Sbjct: 442 ttcagcgagcccc 454



to top

>dbj|AK104620.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-F12, full
           insert sequence
          Length = 1276

 Score =  438 bits (221), Expect = e-120
 Identities = 335/373 (89%)
 Strand = Plus / Plus

                                                                       
Query: 77  accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 197 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 256
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                                       
Query: 257 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 316
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 321

                                                                       
Query: 317 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 376
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 322 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 381

                                                                       
Query: 377 gccaacgccatcgccgggaggcacacccctggtaccttcaccaaccagatgcagacctcc 436
           ||  ||||||| || || ||||| || |||||||| || ||||| ||| | |||||||||
Sbjct: 382 gcgcacgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctcc 441

                        
Query: 437 ttcagcgagcccc 449
           |||||||||||||
Sbjct: 442 ttcagcgagcccc 454



to top

>dbj|AK104286.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-D06, full
           insert sequence
          Length = 1223

 Score =  438 bits (221), Expect = e-120
 Identities = 335/373 (89%)
 Strand = Plus / Plus

                                                                       
Query: 77  accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 82  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 141

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 201

                                                                       
Query: 197 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 256
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 202 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 261

                                                                       
Query: 257 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 316
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 262 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 321

                                                                       
Query: 317 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 376
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 322 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 381

                                                                       
Query: 377 gccaacgccatcgccgggaggcacacccctggtaccttcaccaaccagatgcagacctcc 436
           ||  ||||||| || || ||||| || |||||||| || ||||| ||| | |||||||||
Sbjct: 382 gcgcacgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctcc 441

                        
Query: 437 ttcagcgagcccc 449
           |||||||||||||
Sbjct: 442 ttcagcgagcccc 454



to top

>dbj|AK070905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065M10, full
           insert sequence
          Length = 1320

 Score =  438 bits (221), Expect = e-120
 Identities = 335/373 (89%)
 Strand = Plus / Plus

                                                                       
Query: 77  accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 92  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 151

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 152 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 211

                                                                       
Query: 197 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 256
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 212 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 271

                                                                       
Query: 257 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 316
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 272 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 331

                                                                       
Query: 317 gtccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggc 376
           |||||||| |||||||||||||||||||| ||||||||||||||||||||| |||| |||
Sbjct: 332 gtccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggc 391

                                                                       
Query: 377 gccaacgccatcgccgggaggcacacccctggtaccttcaccaaccagatgcagacctcc 436
           ||  ||||||| || || ||||| || |||||||| || ||||| ||| | |||||||||
Sbjct: 392 gcgcacgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctcc 451

                        
Query: 437 ttcagcgagcccc 449
           |||||||||||||
Sbjct: 452 ttcagcgagcccc 464



to top

>ref|XM_470555.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 918

 Score =  432 bits (218), Expect = e-118
 Identities = 332/370 (89%)
 Strand = Plus / Plus

                                                                       
Query: 80  atggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgtacag 139
           |||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| |||
Sbjct: 1   atggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtgcag 60

                                                                       
Query: 140 atgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgc 199
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  atgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgc 120

                                                                       
Query: 200 tacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgggag 259
           |||| |||||||||||||||||| || ||||||||||||||||| |||||||||||||||
Sbjct: 121 tacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgggag 180

                                                                       
Query: 260 aagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatcgtc 319
           ||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| |||
Sbjct: 181 aagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgtc 240

                                                                       
Query: 320 cagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggcgcc 379
           ||||| |||||||||||||||||||| ||||||||||||||||||||| |||| ||||| 
Sbjct: 241 cagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcagtacactggcgcg 300

                                                                       
Query: 380 aacgccatcgccgggaggcacacccctggtaccttcaccaaccagatgcagacctccttc 439
            ||||||| || || ||||| || |||||||| || ||||| ||| | ||||||||||||
Sbjct: 301 cacgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctccttc 360

                     
Query: 440 agcgagcccc 449
           ||||||||||
Sbjct: 361 agcgagcccc 370



to top

>gb|BT016624.1| Zea mays clone Contig457 mRNA sequence
          Length = 1418

 Score =  410 bits (207), Expect = e-111
 Identities = 303/335 (90%)
 Strand = Plus / Plus

                                                                       
Query: 113 ctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacc 172
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||
Sbjct: 133 ctgtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccaccttggcacc 192

                                                                       
Query: 173 aagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctac 232
           ||||||||||| ||||||| ||||||||| | ||  |||||||| |||||||||||||||
Sbjct: 193 aagaactgcgatttccagacggagcgctatgtctttaagcgccgttccgacggcatctac 252

                                                                       
Query: 233 atcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcc 292
           |||||||| || |||||||||||||| || |||||||| || |||||||| ||||| |||
Sbjct: 253 atcatcaatcttggcaagacatgggataaactccagcttgcagcgagggttatcgttgcc 312

                                                                       
Query: 293 atcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgccgtc 352
           |||||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||
Sbjct: 313 atcgagaacccgcaggacatcatcgtccagtctgcccgcccatatggccagcgtgctgtc 372

                                                                       
Query: 353 ctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggtacc 412
           ||||||||||| ||| |||| |||||| | |||||||| |||||||||||||||||||| 
Sbjct: 373 ctcaagttcgctcagtacactggcgcccatgccatcgctgggaggcacacccctggtaca 432

                                              
Query: 413 ttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||| | ||||||||||||||||||||
Sbjct: 433 ttcactaatcagctccagacctccttcagcgagcc 467



to top

>dbj|AK066899.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091K05, full
           insert sequence
          Length = 1182

 Score =  325 bits (164), Expect = 7e-86
 Identities = 233/256 (91%)
 Strand = Plus / Plus

                                                                       
Query: 77  accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 83  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 142

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 143 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 202

                                                                       
Query: 197 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 256
           ||||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||
Sbjct: 203 cgctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatgg 262

                                                                       
Query: 257 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatc 316
           |||||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| 
Sbjct: 263 gagaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcatt 322

                           
Query: 317 gtccagtccgcccgcc 332
           |||||||| |||||||
Sbjct: 323 gtccagtcggcccgcc 338



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                       
Query: 382 cgccatcgccgggaggcacacccctggtaccttcaccaaccagatgcagacctccttcag 441
           |||||| || || ||||| || |||||||| || ||||| ||| | ||||||||||||||
Sbjct: 335 cgccattgctggaaggcatacgcctggtacatttaccaatcagctccagacctccttcag 394

                   
Query: 442 cgagcccc 449
           ||||||||
Sbjct: 395 cgagcccc 402



to top

>ref|XM_479167.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1280

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 120 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 179

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 180 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 239

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 240 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 299

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 300 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 359

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 360 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 419

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 420 ggtacatttaccaaccagctgcagacctcattcagtgagcc 460



to top

>ref|XM_507392.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1298

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 122 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 181

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 241

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 242 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 301

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 302 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 361

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 362 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 421

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 422 ggtacatttaccaaccagctgcagacctcattcagtgagcc 462



to top

>ref|XM_507391.1| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1310

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 123 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 182

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 183 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 242

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 243 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 302

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 303 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 362

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 363 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 422

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 423 ggtacatttaccaaccagctgcagacctcattcagtgagcc 463



to top

>ref|XM_506471.2| PREDICTED Oryza sativa (japonica cultivar-group), B1056G08.113 mRNA
          Length = 1343

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 125 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 184

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 185 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 244

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 245 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 304

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 305 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 364

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 365 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 424

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 425 ggtacatttaccaaccagctgcagacctcattcagtgagcc 465



to top

>dbj|AK105968.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-E10, full
           insert sequence
          Length = 1298

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 122 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 181

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 182 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 241

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 242 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 301

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 302 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 361

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 362 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 421

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 422 ggtacatttaccaaccagctgcagacctcattcagtgagcc 462



to top

>dbj|AK103952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-F07, full
           insert sequence
          Length = 1280

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 120 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 179

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 180 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 239

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 240 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 299

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 300 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 359

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 360 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 419

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 420 ggtacatttaccaaccagctgcagacctcattcagtgagcc 460



to top

>dbj|AK102735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033106C12, full
           insert sequence
          Length = 1342

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 124 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 183

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 184 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 243

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 244 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 303

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 304 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 363

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 364 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 423

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 424 ggtacatttaccaaccagctgcagacctcattcagtgagcc 464



to top

>dbj|AK058308.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H07, full
           insert sequence
          Length = 1310

 Score =  295 bits (149), Expect = 6e-77
 Identities = 293/341 (85%)
 Strand = Plus / Plus

                                                                       
Query: 107 cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
           |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 123 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 182

                                                                       
Query: 167 ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggc 226
           ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||| 
Sbjct: 183 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgcactgacggt 242

                                                                       
Query: 227 atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
           |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 243 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 302

                                                                       
Query: 287 gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
           || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 303 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 362

                                                                       
Query: 347 gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
           || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 363 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 422

                                                    
Query: 407 ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 423 ggtacatttaccaaccagctgcagacctcattcagtgagcc 463



to top

>dbj|AK109430.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-307-H04, full
           insert sequence
          Length = 1264

 Score =  268 bits (135), Expect = 1e-68
 Identities = 294/347 (84%)
 Strand = Plus / Plus

                                                                       
Query: 101 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 160
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 115 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 174

                                                                       
Query: 161 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 220
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 175 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 234

                                                                       
Query: 221 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 280
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 235 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 294

                                                                       
Query: 281 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 340
           || || || ||||| |||||||| |||||||||||||| ||||| ||  | || || || 
Sbjct: 295 gtgattgttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggt 354

                                                                       
Query: 341 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 400
           ||| | || ||||||||||| || ||| ||||||| ||  | ||||| || || ||||||
Sbjct: 355 cagagggctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcac 414

                                                          
Query: 401 acccctggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           || |||||||| || ||||||||  |||| ||||| ||||| |||||
Sbjct: 415 actcctggtacatttaccaaccaactgcaaacctcattcagtgagcc 461



to top

>dbj|AK102347.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091C12, full
           insert sequence
          Length = 1176

 Score =  268 bits (135), Expect = 1e-68
 Identities = 294/347 (84%)
 Strand = Plus / Plus

                                                                       
Query: 101 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 160
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 118 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 177

                                                                       
Query: 161 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 220
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 178 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 237

                                                                       
Query: 221 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 280
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 238 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 297

                                                                       
Query: 281 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 340
           || || || ||||| |||||||| |||||||||||||| ||||| ||  | || || || 
Sbjct: 298 gtgattgttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggt 357

                                                                       
Query: 341 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 400
           ||| | || ||||||||||| || ||| ||||||| ||  | ||||| || || ||||||
Sbjct: 358 cagagggctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcac 417

                                                          
Query: 401 acccctggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           || |||||||| || ||||||||  |||| ||||| ||||| |||||
Sbjct: 418 actcctggtacatttaccaaccaactgcaaacctcattcagtgagcc 464



to top

>dbj|AK060322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-F12, full
           insert sequence
          Length = 1245

 Score =  268 bits (135), Expect = 1e-68
 Identities = 294/347 (84%)
 Strand = Plus / Plus

                                                                       
Query: 101 gccccgcgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtc 160
           |||||||||||||| ||||||  |||||||||| | |||||||||||||| || ||||||
Sbjct: 121 gccccgcgggcgctctcccagcgggagcaggacatccagatgatgctcgcggcggacgtc 180

                                                                       
Query: 161 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 220
           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||
Sbjct: 181 cacctcggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgatcc 240

                                                                       
Query: 221 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 280
           |||||||| | |||||| ||||| ||||| || ||||||||||| ||||| ||||| || 
Sbjct: 241 gacggcattttcatcattaaccttggcaaaacctgggagaagcttcagctggctgccaga 300

                                                                       
Query: 281 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 340
           || || || ||||| |||||||| |||||||||||||| ||||| ||  | || || || 
Sbjct: 301 gtgattgttgccattgagaacccacaggacatcatcgtgcagtctgctaggccttatggt 360

                                                                       
Query: 341 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 400
           ||| | || ||||||||||| || ||| ||||||| ||  | ||||| || || ||||||
Sbjct: 361 cagagggctgtcctcaagtttgcacagtacaccggagctcatgccattgctggcaggcac 420

                                                          
Query: 401 acccctggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           || |||||||| || ||||||||  |||| ||||| ||||| |||||
Sbjct: 421 actcctggtacatttaccaaccaactgcaaacctcattcagtgagcc 467



to top

>gb|AY105034.1| Zea mays PCO130341 mRNA sequence
          Length = 1213

 Score =  266 bits (134), Expect = 6e-68
 Identities = 284/334 (85%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacca 173
           ||||||||  |||||||||| | |||||||||||||||||||| ||||||||||||||||
Sbjct: 76  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 135

                                                                       
Query: 174 agaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctaca 233
           ||||||||||||||||| ||||||||||||  |||||||||||| | || || |||||||
Sbjct: 136 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctaca 195

                                                                       
Query: 234 tcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcca 293
           | || ||||| || ||||| ||||| ||||| ||| | || || ||||||||||| ||||
Sbjct: 196 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 255

                                                                       
Query: 294 tcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgccgtcc 353
           | ||||| ||||||||||| ||||| ||||| ||  | ||||| |||||| | || ||||
Sbjct: 256 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 315

                                                                       
Query: 354 tcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggtacct 413
           ||||||| |||||| |||| || ||| | ||||| || || |||||||| |||||||| |
Sbjct: 316 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 375

                                             
Query: 414 tcaccaaccagatgcagacctccttcagcgagcc 447
           ||||||||||| |||| ||||||||||| |||||
Sbjct: 376 tcaccaaccagttgcaaacctccttcagtgagcc 409



to top

>gb|BT016512.1| Zea mays clone Contig345 mRNA sequence
          Length = 1208

 Score =  258 bits (130), Expect = 1e-65
 Identities = 283/334 (84%)
 Strand = Plus / Plus

                                                                       
Query: 114 tgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctcggcacca 173
           ||||||||  |||||||||| | |||||||||||||||||||| ||||||||||||||||
Sbjct: 73  tgtcccagcgggagcaggacatccagatgatgctcgccgccgatgtccacctcggcacca 132

                                                                       
Query: 174 agaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatctaca 233
           ||||||||||||||||| ||||||||||||  |||||||||||| | || || ||||| |
Sbjct: 133 agaactgcgacttccaggtggagcgctacgtgtacaagcgccgcactgatggtatctata 192

                                                                       
Query: 234 tcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgcca 293
           | || ||||| || ||||| ||||| ||||| ||| | || || ||||||||||| ||||
Sbjct: 193 ttattaaccttggaaagacctgggacaagcttcagttggccgccagggtcatcgttgcca 252

                                                                       
Query: 294 tcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgccgtcc 353
           | ||||| ||||||||||| ||||| ||||| ||  | ||||| |||||| | || ||||
Sbjct: 253 ttgagaatccgcaggacattatcgtgcagtctgctaggccctatggccagagggctgtcc 312

                                                                       
Query: 354 tcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggtacct 413
           ||||||| |||||| |||| || ||| | ||||| || || |||||||| |||||||| |
Sbjct: 313 tcaagtttgcgcagtacactggtgcccatgccattgctggcaggcacactcctggtacat 372

                                             
Query: 414 tcaccaaccagatgcagacctccttcagcgagcc 447
           ||||||||||| |||| ||||||||||| |||||
Sbjct: 373 tcaccaaccagttgcaaacctccttcagtgagcc 406



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  244 bits (123), Expect = 2e-61
 Identities = 198/223 (88%)
 Strand = Plus / Minus

                                                                           
Query: 227     atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
               ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 4319936 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 4319877

                                                                           
Query: 287     gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
               || ||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| 
Sbjct: 4319876 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 4319817

                                                                           
Query: 347     gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
               ||||||||||||||||||||| |||| |||||  ||||||| || || ||||| || |||
Sbjct: 4319816 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 4319757

                                                          
Query: 407     ggtaccttcaccaaccagatgcagacctccttcagcgagcccc 449
               ||||| || ||||| ||| | ||||||||||||||||||||||
Sbjct: 4319756 ggtacatttaccaatcagctccagacctccttcagcgagcccc 4319714



 Score =  202 bits (102), Expect = 7e-49
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                           
Query: 77      accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
               ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 4320485 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 4320426

                                                                           
Query: 137     cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320425 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 4320366

                                         
Query: 197     cgctacgcctacaagcgccgctccga 222
               ||||||| ||||||||||||||||||
Sbjct: 4320365 cgctacgtctacaagcgccgctccga 4320340



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 144      tgctcgccgccgacgtccacctcg 167
                ||||||||||||||||| ||||||
Sbjct: 16618050 tgctcgccgccgacgtcgacctcg 16618027



to top

>gb|AC079633.9|AC079633 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0032G08, from Chromosome 3, complete sequence
          Length = 122052

 Score =  244 bits (123), Expect = 2e-61
 Identities = 198/223 (88%)
 Strand = Plus / Plus

                                                                          
Query: 227    atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
              ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 106561 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 106620

                                                                          
Query: 287    gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
              || ||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| 
Sbjct: 106621 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 106680

                                                                          
Query: 347    gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
              ||||||||||||||||||||| |||| |||||  ||||||| || || ||||| || |||
Sbjct: 106681 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 106740

                                                         
Query: 407    ggtaccttcaccaaccagatgcagacctccttcagcgagcccc 449
              ||||| || ||||| ||| | ||||||||||||||||||||||
Sbjct: 106741 ggtacatttaccaatcagctccagacctccttcagcgagcccc 106783



 Score =  202 bits (102), Expect = 7e-49
 Identities = 135/146 (92%)
 Strand = Plus / Plus

                                                                          
Query: 77     accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
              ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 106012 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 106071

                                                                          
Query: 137    cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106072 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 106131

                                        
Query: 197    cgctacgcctacaagcgccgctccga 222
              ||||||| ||||||||||||||||||
Sbjct: 106132 cgctacgtctacaagcgccgctccga 106157



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  244 bits (123), Expect = 2e-61
 Identities = 198/223 (88%)
 Strand = Plus / Minus

                                                                           
Query: 227     atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
               ||||||||||||||||| |||||||||||||||||||| |||||||| |||||||| || 
Sbjct: 4320051 atctacatcatcaacctcggcaagacatgggagaagctgcagctcgcggcgagggtgatt 4319992

                                                                           
Query: 287     gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
               || ||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||| 
Sbjct: 4319991 gttgccattgagaacccccaggacatcattgtccagtcggcccgcccctacggccagcgc 4319932

                                                                           
Query: 347     gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
               ||||||||||||||||||||| |||| |||||  ||||||| || || ||||| || |||
Sbjct: 4319931 gccgtcctcaagttcgcgcagtacactggcgcgcacgccattgctggaaggcatacgcct 4319872

                                                          
Query: 407     ggtaccttcaccaaccagatgcagacctccttcagcgagcccc 449
               ||||| || ||||| ||| | ||||||||||||||||||||||
Sbjct: 4319871 ggtacatttaccaatcagctccagacctccttcagcgagcccc 4319829



 Score =  202 bits (102), Expect = 7e-49
 Identities = 135/146 (92%)
 Strand = Plus / Minus

                                                                           
Query: 77      accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
               ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 4320600 accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 4320541

                                                                           
Query: 137     cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 4320540 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 4320481

                                         
Query: 197     cgctacgcctacaagcgccgctccga 222
               ||||||| ||||||||||||||||||
Sbjct: 4320480 cgctacgtctacaagcgccgctccga 4320455



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 144      tgctcgccgccgacgtccacctcg 167
                ||||||||||||||||| ||||||
Sbjct: 16611683 tgctcgccgccgacgtcgacctcg 16611660



to top

>dbj|AK061289.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A03, full
           insert sequence
          Length = 1144

 Score =  224 bits (113), Expect = 2e-55
 Identities = 155/169 (91%)
 Strand = Plus / Plus

                                                                       
Query: 199 ctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatggga 258
           ||||| |||||||||||||||||| || ||||||||||||||||| ||||||||||||||
Sbjct: 166 ctacgtctacaagcgccgctccgatggtatctacatcatcaacctcggcaagacatggga 225

                                                                       
Query: 259 gaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcatcgt 318
           |||||| |||||||| |||||||| || || ||||| |||||||| ||||||||||| ||
Sbjct: 226 gaagctgcagctcgcggcgagggtgattgttgccattgagaacccccaggacatcattgt 285

                                                            
Query: 319 ccagtccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcag 367
           |||||| |||||||||||||||||||| |||||||||||||||||||||
Sbjct: 286 ccagtcggcccgcccctacggccagcgcgccgtcctcaagttcgcgcag 334



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 77  accatggcggcagcggccggagaagccccgcgggcgctgtcccagaaggagcaggacgta 136
           ||||||||||||| ||| ||||  ||  ||||||||||||| |||  |||||||||||| 
Sbjct: 89  accatggcggcagtggcaggaggcgcagcgcgggcgctgtcgcaggcggagcaggacgtg 148

                                   
Query: 137 cagatgatgctcgccgccgacgtc 160
           |||||||||||||||||| |||||
Sbjct: 149 cagatgatgctcgccgcctacgtc 172



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 428 cagacctccttcagcgagcccc 449
           ||||||||||||||||||||||
Sbjct: 354 cagacctccttcagcgagcccc 375



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  172 bits (87), Expect = 6e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                            
Query: 107      cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
                |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 25361982 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 25361923

                                                                   
Query: 167      ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 217
                ||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 25361922 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 25361872



 Score =  129 bits (65), Expect = 8e-27
 Identities = 182/221 (82%)
 Strand = Plus / Minus

                                                                            
Query: 227      atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
                |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 25361294 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 25361235

                                                                            
Query: 287      gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
                || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 25361234 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 25361175

                                                                            
Query: 347      gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
                || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 25361174 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 25361115

                                                         
Query: 407      ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
                ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 25361114 ggtacatttaccaaccagctgcagacctcattcagtgagcc 25361074



to top

>dbj|AP004988.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:B1056G08
          Length = 168173

 Score =  172 bits (87), Expect = 6e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                         
Query: 107   cgggcgctgtcccagaaggagcaggacgtacagatgatgctcgccgccgacgtccacctc 166
             |||||||||||||||  |||||||||| | ||||||||||||||||| ||||||||||||
Sbjct: 55072 cgggcgctgtcccagcgggagcaggacatccagatgatgctcgccgcggacgtccacctc 55013

                                                                
Query: 167   ggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 217
             ||||||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 55012 ggcaccaagaactgcgacttccagatggagcgctacgtctacaagcgccgc 54962



 Score =  129 bits (65), Expect = 8e-27
 Identities = 182/221 (82%)
 Strand = Plus / Minus

                                                                         
Query: 227   atctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatc 286
             |||||||| || ||||| |||||||| ||||||||||||||| | |||||||||||||| 
Sbjct: 54384 atctacattattaaccttggcaagacctgggagaagctccagttggctgcgagggtcatt 54325

                                                                         
Query: 287   gtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgt 346
             || || || || ||||| ||||||||||| || ||||| ||  | ||||| |||||| | 
Sbjct: 54324 gttgcaattgaaaaccctcaggacatcattgtgcagtctgcgaggccctatggccagagg 54265

                                                                         
Query: 347   gccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccct 406
             || || |||||||| || ||| |||| || ||  ||||||| || || |||||||| |||
Sbjct: 54264 gctgttctcaagtttgctcagtacactggtgctcacgccattgctggtaggcacactcct 54205

                                                      
Query: 407   ggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
             ||||| || ||||||||| |||||||||| ||||| |||||
Sbjct: 54204 ggtacatttaccaaccagctgcagacctcattcagtgagcc 54164



to top

>gb|AF020553.1|AF020553 Glycine max ribosome-associated protein p40 mRNA, complete cds
          Length = 1141

 Score =  133 bits (67), Expect = 5e-28
 Identities = 151/179 (84%)
 Strand = Plus / Plus

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||| | ||||||||||||||||||||||||||||||||||||||||| ||||| 
Sbjct: 124 cagatgatgttggccgccgacgtccacctcggcaccaagaactgcgacttccaaatggaa 183

                                                                       
Query: 197 cgctacgcctacaagcgccgctccgacggcatctacatcatcaacctgggcaagacatgg 256
           || |||  || ||||||||||  |||||| || ||||| || ||||| || ||||| |||
Sbjct: 184 cgttacatcttcaagcgccgcaacgacgggatttacattattaaccttgggaagacgtgg 243

                                                                      
Query: 257 gagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacatcat 315
           |||||||| ||||| || || ||||| || || || || |||||||| ||||| |||||
Sbjct: 244 gagaagcttcagctagcagctagggttatagttgcaattgagaacccccaggatatcat 302



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 395 aggcacacccctggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           |||||||| ||||||||||||||||| ||| | || || ||||||||||||||
Sbjct: 382 aggcacactcctggtaccttcaccaatcagcttcaaacttccttcagcgagcc 434



to top

>ref|NM_001036190.1| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.2 mRNA,
           complete cds
          Length = 1173

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 416 accttcaccaatcagatgcagacatccttcag 447



to top

>ref|NM_105896.2| Arabidopsis thaliana P40; structural constituent of ribosome
           AT1G72370 (P40) transcript variant AT1G72370.1 mRNA,
           complete cds
          Length = 1185

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 416 accttcaccaatcagatgcagacatccttcag 447



to top

>gb|BT000421.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1032

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 331 accttcaccaatcagatgcagacatccttcag 362



to top

>emb|X69056.1|ATLRH A.thaliana mRNA for laminin receptor homologue
          Length = 1073

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 96  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 155

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 156 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 215

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 216 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 275

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 276 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 335

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 336 accttcaccaatcagatgcagacatccttcag 367



to top

>gb|AY136324.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1103

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 153 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 212

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 213 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 272

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 273 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 332

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 333 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 392

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 393 accttcaccaatcagatgcagacatccttcag 424



to top

>gb|AY114561.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370) mRNA, complete cds
          Length = 1042

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 331 accttcaccaatcagatgcagacatccttcag 362



to top

>gb|AY079041.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 897

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 91  accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 150

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 151 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 210

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 211 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 270

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 271 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 330

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 331 accttcaccaatcagatgcagacatccttcag 362



to top

>gb|AY065096.1| Arabidopsis thaliana putative 40S ribosomal protein SA (laminin
           receptor-like protein) (At1g72370; T10D10.16) mRNA,
           complete cds
          Length = 1151

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 413 accttcaccaatcagatgcagacatccttcag 444



to top

>gb|AY058885.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1182

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 176 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 235

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 236 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 295

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 296 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 355

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 356 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 415

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 416 accttcaccaatcagatgcagacatccttcag 447



to top

>gb|AY054211.1| Arabidopsis thaliana At1g72370/T10D10_16 mRNA, complete cds
          Length = 1168

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 156 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 215

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 216 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 275

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 276 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 335

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 336 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 395

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 396 accttcaccaatcagatgcagacatccttcag 427



to top

>emb|BX816779.1|CNS0AD9Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1096

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 160 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 219

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 220 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 279

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 280 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 339

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 340 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 399

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 400 accttcaccaatcagatgcagacatccttcag 431



to top

>emb|BX814998.1|CNS0AAO4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS23ZA01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1126

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 146 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 205

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 206 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 265

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 266 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 325

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 326 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 385

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 386 accttcaccaatcagatgcagacatccttcag 417



to top

>gb|AY087976.1| Arabidopsis thaliana clone 40091 mRNA, complete sequence
          Length = 1177

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 173 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 232

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 233 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 292

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 293 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 352

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 353 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 412

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 413 accttcaccaatcagatgcagacatccttcag 444



to top

>gb|U01955.1|ATU01955 Arabidopsis thaliana Columbia laminin receptor-like protein mRNA,
           complete cds
          Length = 1137

 Score =  127 bits (64), Expect = 3e-26
 Identities = 220/272 (80%)
 Strand = Plus / Plus

                                                                       
Query: 170 accaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgacggcatc 229
           |||||||| ||| | | |||||||||||| |||| || |||| | |||  ||| || || 
Sbjct: 145 accaagaattgcaattaccagatggagcgttacgtcttcaagagacgcaacgatggtatt 204

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 205 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 264

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 265 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 324

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 325 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 384

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 385 accttcaccaatcagatgcagacatccttcag 416



to top

>emb|Y10379.1|ATRPP40 A.thaliana gene encoding ribosomal protein P40
          Length = 3690

 Score =  119 bits (60), Expect = 8e-24
 Identities = 174/212 (82%)
 Strand = Plus / Plus

                                                                        
Query: 230  tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
            |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 2285 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 2344

                                                                        
Query: 290  gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
            ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 2345 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 2404

                                                                        
Query: 350  gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
            ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 2405 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 2464

                                            
Query: 410  accttcaccaaccagatgcagacctccttcag 441
            ||||||||||| ||||||||||| ||||||||
Sbjct: 2465 accttcaccaatcagatgcagacatccttcag 2496



to top

>emb|X89366.1|AT40KDAPR A.thaliana DNA for 40 kDa protein gene
          Length = 2049

 Score =  119 bits (60), Expect = 8e-24
 Identities = 174/212 (82%)
 Strand = Plus / Plus

                                                                       
Query: 230 tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
           |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 774 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 833

                                                                       
Query: 290 gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
           ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 834 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 893

                                                                       
Query: 350 gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
           ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 894 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 953

                                           
Query: 410 accttcaccaaccagatgcagacctccttcag 441
           ||||||||||| ||||||||||| ||||||||
Sbjct: 954 accttcaccaatcagatgcagacatccttcag 985



to top

>gb|AC016529.7|AC016529 Arabidopsis thaliana chromosome 1 BAC T10D10 genomic sequence, complete
             sequence
          Length = 87039

 Score =  119 bits (60), Expect = 8e-24
 Identities = 174/212 (82%)
 Strand = Plus / Plus

                                                                         
Query: 230   tacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtc 289
             |||||| ||||||| ||||| |||||||| ||||||||| | ||||| || || || || 
Sbjct: 69076 tacatcttcaaccttggcaaaacatgggaaaagctccagatggctgctagagttattgtt 69135

                                                                         
Query: 290   gccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggccagcgtgcc 349
             ||||| |||||||| |||||||||||||||||||| ||  | ||||| || ||| | || 
Sbjct: 69136 gccattgagaacccacaggacatcatcgtccagtcagctaggccctatggacagagagct 69195

                                                                         
Query: 350   gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
             ||  | ||||| || ||| |||| || ||||| ||||| || || || ||||| ||||||
Sbjct: 69196 gtgttgaagtttgctcagtacactggagccaatgccattgctggaagacacactcctggt 69255

                                             
Query: 410   accttcaccaaccagatgcagacctccttcag 441
             ||||||||||| ||||||||||| ||||||||
Sbjct: 69256 accttcaccaatcagatgcagacatccttcag 69287



to top

>gb|AF097522.1|AF097522 Brassica napus laminin receptor-like protein (LRP) mRNA, complete
           cds
          Length = 1138

 Score =  117 bits (59), Expect = 3e-23
 Identities = 230/287 (80%)
 Strand = Plus / Plus

                                                                       
Query: 161 cacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctcc 220
           |||||||| |||||||||||| ||| ||| |||||||| |||| || |||| | |||  |
Sbjct: 118 cacctcggaaccaagaactgcaactaccaaatggagcgttacgtcttcaagagacgcaac 177

                                                                       
Query: 221 gacggcatctacatcatcaacctgggcaagacatgggagaagctccagctcgctgcgagg 280
           ||||| || |||||| | ||||| || |||||||||||||||||   | | |||||  | 
Sbjct: 178 gacggtatttacatctttaaccttggaaagacatgggagaagctgatgatggctgcacga 237

                                                                       
Query: 281 gtcatcgtcgccatcgagaacccgcaggacatcatcgtccagtccgcccgcccctacggc 340
           |||||||| || ||||||||||| || |||||||| || ||||| ||  | ||||| || 
Sbjct: 238 gtcatcgttgctatcgagaacccacaagacatcattgtgcagtcagctaggccctatggt 297

                                                                       
Query: 341 cagcgtgccgtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcac 400
           ||| | || ||  | |||||||| ||| |||| || || || ||||| || || ||||||
Sbjct: 298 cagagagctgttttgaagttcgctcagtacactggagctaatgccattgctggaaggcac 357

                                                          
Query: 401 acccctggtaccttcaccaaccagatgcagacctccttcagcgagcc 447
           || |||||||| |||||||| ||||||||||| || |||||||||||
Sbjct: 358 actcctggtactttcaccaatcagatgcagacttcgttcagcgagcc 404



to top

>gb|AY664419.1| Zea mays cultivar Mo17 locus 9009, complete sequence
          Length = 405672

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                         
Query: 350   gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
             ||||||||||| ||| || |||| || ||  | ||||| ||||| |||||||| ||||||
Sbjct: 25842 gtcctcaagtttgcgtagtacactggtgctcatgccattgccggcaggcacactcctggt 25783

                                                   
Query: 410   accttcaccaaccagatgcagacctccttcagcgagcc 447
             || |||||||||||| |||| |||||||||||||||||
Sbjct: 25782 acattcaccaaccagttgcaaacctccttcagcgagcc 25745



to top

>gb|AY664415.1| Zea mays cultivar B73 locus 9009, complete sequence
          Length = 323584

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                        
Query: 350  gtcctcaagttcgcgcagcacaccggcgccaacgccatcgccgggaggcacacccctggt 409
            ||||||||||| ||| || |||| || ||  | ||||| ||||| |||||||| ||||||
Sbjct: 6016 gtcctcaagtttgcgtagtacactggtgctcatgccattgccggcaggcacactcctggt 5957

                                                  
Query: 410  accttcaccaaccagatgcagacctccttcagcgagcc 447
            || |||||||||||| |||| |||||||||||||||||
Sbjct: 5956 acattcaccaaccagttgcaaacctccttcagcgagcc 5919



to top

>gb|BT023910.1| Drosophila melanogaster GH07208 full insert cDNA
          Length = 2515

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                        
Query: 183  acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
            |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 1681 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 1740

                                                                        
Query: 243  tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
            |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 1741 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 1800

             
Query: 303  c 303
            |
Sbjct: 1801 c 1801



to top

>gb|AY232070.1| Drosophila yakuba clone yak-ad_sta mRNA sequence
          Length = 627

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 193

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 194 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 253

            
Query: 303 c 303
           |
Sbjct: 254 c 254



to top

>gb|AY231810.1| Drosophila yakuba clone yak-em_sta mRNA sequence
          Length = 579

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 59  acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 118

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 119 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 178

            
Query: 303 c 303
           |
Sbjct: 179 c 179



to top

>emb|AL031027.1|DMC80H7 Drosophila melanogaster cosmid clone 80H7
          Length = 45861

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 183   acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
             |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 16965 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 16906

                                                                         
Query: 243   tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
             |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 16905 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 16846

              
Query: 303   c 303
             |
Sbjct: 16845 c 16845



to top

>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                          
Query: 183    acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
              |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 159536 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 159477

                                                                          
Query: 243    tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
              |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 159476 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 159417

               
Query: 303    c 303
              |
Sbjct: 159416 c 159416



to top

>gb|AY118899.1| Drosophila melanogaster LD09376 full insert cDNA
          Length = 1104

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 272 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 331

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 332 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 391

            
Query: 303 c 303
           |
Sbjct: 392 c 392



to top

>gb|AY118848.1| Drosophila melanogaster GM15484 full insert cDNA
          Length = 964

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 761 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 702

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 701 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 642

            
Query: 303 c 303
           |
Sbjct: 641 c 641



to top

>ref|NM_166890.1| Drosophila melanogaster stubarista CG14792-RD, transcript variant D
           (sta), mRNA
          Length = 1041

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 221 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 280

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 281 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 340

            
Query: 303 c 303
           |
Sbjct: 341 c 341



to top

>ref|NM_166889.1| Drosophila melanogaster stubarista CG14792-RB, transcript variant B
           (sta), mRNA
          Length = 1089

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 272 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 331

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 332 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 391

            
Query: 303 c 303
           |
Sbjct: 392 c 392



to top

>gb|M90422.1|DROP40A D.melanogaster p40 (Stubarista) gene, 5' end
          Length = 1272

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 174 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 233

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 234 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 293

            
Query: 303 c 303
           |
Sbjct: 294 c 294



to top

>ref|NM_057402.3| Drosophila melanogaster stubarista CG14792-RA, transcript variant A
           (sta), mRNA
          Length = 1236

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 419 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 478

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 479 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 538

            
Query: 303 c 303
           |
Sbjct: 539 c 539



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
             sequence
          Length = 304204

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                         
Query: 183   acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
             |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 22120 acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 22061

                                                                         
Query: 243   tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
             |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 22060 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 22001

              
Query: 303   c 303
             |
Sbjct: 22000 c 22000



to top

>gb|M77133.1|DROLAMR Drosophila melanogaster laminin receptor (k14) mRNA, complete cds
          Length = 902

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | || ||| || ||||| ||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcgctgatggcgtcaacatcctcaacc 150

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 151 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 210

            
Query: 303 c 303
           |
Sbjct: 211 c 211



to top

>dbj|AB032437.1| Drosophila yakuba sta gene for stubarista, partial cds
          Length = 1545

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 101/121 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| |||| ||| |  ||||| ||||||
Sbjct: 721 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgttaacatcctcaacc 780

                                                                       
Query: 243 tgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacc 302
           |||||||||| ||||||||||| ||||| || ||  | | |||||| |||||||| ||||
Sbjct: 781 tgggcaagacctgggagaagctgcagctggcggcccgcgccatcgtggccatcgataacc 840

            
Query: 303 c 303
           |
Sbjct: 841 c 841



to top

>dbj|AB032438.1| Drosophila erecta sta gene for stubarista, partial cds
          Length = 1532

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 76/88 (86%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| |||| ||| || ||||| ||||||
Sbjct: 705 acttccagatggagcagtacgtgtacaagcgccgcgccgatggcgtcaacatcctcaacc 764

                                       
Query: 243 tgggcaagacatgggagaagctccagct 270
           |||||||||| ||||| ||||| |||||
Sbjct: 765 tgggcaagacctgggaaaagctgcagct 792



to top

>dbj|AB032439.1| Drosophila orena sta gene for stubarista, partial cds
          Length = 1371

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 75/88 (85%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           ||||||| |||||||  ||||  |||||||||||| |||| ||| || ||||| ||||||
Sbjct: 554 acttccaaatggagcagtacgtgtacaagcgccgcgccgatggcgtcaacatcctcaacc 613

                                       
Query: 243 tgggcaagacatgggagaagctccagct 270
           | |||||||| ||||||||||| |||||
Sbjct: 614 taggcaagacctgggagaagctgcagct 641



to top

>dbj|AB012702.1| Daucus carota mRNA for P40-like protein, complete cds
          Length = 1111

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 164 ctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgctccgac 223
           ||||||||||| ||||| || |||||||||||||| || | || |||||||||   ||| 
Sbjct: 153 ctcggcaccaaaaactgtgatttccagatggagcgttatgtcttcaagcgccgtaacgat 212

                                                    
Query: 224 ggcatctacatcatcaacctgggcaagacatgggagaagct 264
           || || || ||||||||  |||| |||||||||||||||||
Sbjct: 213 ggtatttatatcatcaatttgggaaagacatgggagaagct 253



to top

>emb|BX817196.1|CNS0AD2L Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH91ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1125

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Plus

                                                                       
Query: 240 acctgggcaagacatgggagaagctccagctcgctgcgagggtcatcgtcgccatcgaga 299
           |||| ||||||| |||||| ||||||||| | ||||| || || || || ||||| ||||
Sbjct: 232 accttggcaagagatgggaaaagctccagatggctgctagagttattgttgccattgaga 291

                                   
Query: 300 acccgcaggacatcatcgtccagt 323
           |||| ||| |||||||||||||||
Sbjct: 292 acccacagaacatcatcgtccagt 315



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 404 cctggtaccttcaccaaccagatgcagacctccttcag 441
           |||||||||||||| || ||||||||||| ||||||||
Sbjct: 396 cctggtaccttcacaaatcagatgcagacatccttcag 433



to top

>gb|DQ207864.1| Solanum tuberosum clone 081G01 ribosome-associated protein p40-like
           mRNA, complete cds
          Length = 1106

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 88/107 (82%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtccacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 217
           ||||||||||| || |||||||| |||||||| ||||| || |||| || |||||| |||
Sbjct: 114 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 173

                                                          
Query: 218 tccgacggcatctacatcatcaacctgggcaagacatgggagaagct 264
             |||||| |||||||| || |||   || ||||||||||| |||||
Sbjct: 174 aacgacggtatctacattattaacgctggaaagacatgggataagct 220



to top

>emb|AJ006759.1|CAR6759 Cicer arietinum mRNA for ribosome-associated protein p40
          Length = 1169

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 137 cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatggag 196
           ||||||||| | || ||||| || |||||||| |||||||||||  ||||||||||||||
Sbjct: 120 cagatgatgttggctgccgatgttcacctcggtaccaagaactgtaacttccagatggag 179

             
Query: 197 cg 198
           ||
Sbjct: 180 cg 181



to top

>gb|DQ235174.1| Solanum tuberosum clone 156A02 P40-like protein mRNA, complete cds
          Length = 1061

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 158 gtccacctcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgccgc 217
           ||||||||||| || |||||||| |||||||| ||||| || |||| || |||||| |||
Sbjct: 103 gtccacctcggtactaagaactgtgacttccaaatggaacgttacgtcttcaagcgtcgc 162

                                                          
Query: 218 tccgacggcatctacatcatcaacctgggcaagacatgggagaagct 264
             |||||| ||||| || || |||   || ||||||||||| |||||
Sbjct: 163 aacgacggtatctatattattaacgctggaaagacatgggataagct 209



to top

>ref|XM_749197.1| Aspergillus fumigatus Af293 40S ribosomal protein S0 (Afu3g13320)
           partial mRNA
          Length = 894

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                       
Query: 323 tccgcccgcccctacggccagcgtgccgtcctcaagttcgcgcagcacaccggcgccaac 382
           ||||| || ||||||||||||||||| ||||| ||||||||    |||||||| |||| |
Sbjct: 238 tccgctcgtccctacggccagcgtgctgtcctgaagttcgcttctcacaccggtgccacc 297

                      
Query: 383 gccatcgccgg 393
           ||||| |||||
Sbjct: 298 gccattgccgg 308



to top

>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 137   cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatgga 195
             ||||||||| | || || || ||||||||||| ||||||||||| |||||||| |||||
Sbjct: 42985 cagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaaatgga 42927



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 254   tgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacat 312
             |||||||| || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 42208 tgggagaaacttcaactagctgccagggtcatcgttgcaatcgagaacccccaggacat 42150



to top

>gb|AC139290.15| Medicago truncatula clone mth2-23f4, complete sequence
          Length = 127701

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 137  cagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgacttccagatgga 195
            ||||||||| | || || || ||||||||||| ||||||||||| |||||||| |||||
Sbjct: 8505 cagatgatgttggctgctgatgtccacctcggtaccaagaactgtgacttccaaatgga 8447



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 254  tgggagaagctccagctcgctgcgagggtcatcgtcgccatcgagaacccgcaggacat 312
            |||||||| || || || ||||| ||||||||||| || ||||||||||| ||||||||
Sbjct: 7728 tgggagaaacttcaactagctgccagggtcatcgttgcaatcgagaacccccaggacat 7670



to top

>gb|BC061298.1| Xenopus tropicalis ribosomal protein SA, mRNA (cDNA clone MGC:75768
           IMAGE:5381822), complete cds
          Length = 1095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 400 cacccctggtaccttcaccaaccagat 426
           |||||||||||||||||||||||||||
Sbjct: 364 cacccctggtaccttcaccaaccagat 390



to top

>ref|NM_203737.1| Xenopus tropicalis ribosomal protein SA (MGC75768), mRNA
          Length = 1095

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 400 cacccctggtaccttcaccaaccagat 426
           |||||||||||||||||||||||||||
Sbjct: 364 cacccctggtaccttcaccaaccagat 390



to top

>emb|CR942700.2| Xenopus tropicalis finished cDNA, clone TNeu119p20
          Length = 1052

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 400 cacccctggtaccttcaccaaccagat 426
           |||||||||||||||||||||||||||
Sbjct: 354 cacccctggtaccttcaccaaccagat 380



to top

>ref|XM_322650.1| Neurospora crassa OR74A hypothetical protein (NCU03393.1) partial
           mRNA
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 326 gcccgcccctacggccagcgtgccgtcctcaagttcgc 363
           ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 241 gcccgtccctacggtcagcgtgccgtcctgaagttcgc 278



to top

>ref|XM_951747.1| Neurospora crassa OR74A hypothetical protein (NCU03393.1) partial
           mRNA
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 326 gcccgcccctacggccagcgtgccgtcctcaagttcgc 363
           ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 241 gcccgtccctacggtcagcgtgccgtcctgaagttcgc 278



to top

>gb|DQ440314.1| Aedes aegypti clone AET-398 40S ribosomal protein SA mRNA, complete
           cds
          Length = 867

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 92  acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 151

                                             
Query: 243 tgggcaagacatgggagaagctccagctcgctgc 276
           |||||   || ||||| ||||| | |||||||||
Sbjct: 152 tgggccgcacctgggaaaagctgctgctcgctgc 185



to top

>ref|XM_391081.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG10905.1) partial mRNA
          Length = 885

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 326 gcccgcccctacggccagcgtgccgtcctcaagttcgc 363
           ||||| |||||||| |||||||| ||||||||||||||
Sbjct: 241 gcccgtccctacggtcagcgtgctgtcctcaagttcgc 278



to top

>ref|XM_500192.1| Yarrowia lipolytica CLIB122, YALI0A18205g predicted mRNA
          Length = 726

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 231 acatcatcaacctgggcaagacatgggagaagctccagctcgctgc 276
           ||||||||||| | |||||||| ||||||||| ||||||| |||||
Sbjct: 47  acatcatcaacgttggcaagacctgggagaagatccagctggctgc 92



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 323 tccgcccgcccctacggccagcgtgccgtcctcaagttcgc 363
           ||||||||  ||||||| ||||| ||||| |||||||||||
Sbjct: 139 tccgcccgaacctacggacagcgagccgttctcaagttcgc 179



to top

>emb|AL669992.1|NCB19C19 Neurospora crassa DNA linkage group II BAC clone B19C19
          Length = 61082

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 326  gcccgcccctacggccagcgtgccgtcctcaagttcgc 363
            ||||| |||||||| |||||||||||||| ||||||||
Sbjct: 8721 gcccgtccctacggtcagcgtgccgtcctgaagttcgc 8684



to top

>emb|CR938589.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YF18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 611

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 158 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 217

                                             
Query: 243 tgggcaagacatgggagaagctccagctcgctgc 276
           |||||   || ||||| ||||| | |||||||||
Sbjct: 218 tgggccgcacctgggaaaagctgctgctcgctgc 251



to top

>emb|CR938120.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 876

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 156 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 215

                                             
Query: 243 tgggcaagacatgggagaagctccagctcgctgc 276
           |||||   || ||||| ||||| | |||||||||
Sbjct: 216 tgggccgcacctgggaaaagctgctgctcgctgc 249



to top

>emb|CR938108.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YK07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 855

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 156 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 215

                                             
Query: 243 tgggcaagacatgggagaagctccagctcgctgc 276
           |||||   || ||||| ||||| | |||||||||
Sbjct: 216 tgggccgcacctgggaaaagctgctgctcgctgc 249



to top

>emb|CR937995.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YN23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           ||||||||||||||   ||||  |||||||||||| | |||||  || ||||||||||||
Sbjct: 162 acttccagatggagtcgtacgtgtacaagcgccgcccggacggagtccacatcatcaacc 221

                                             
Query: 243 tgggcaagacatgggagaagctccagctcgctgc 276
           |||||   || ||||| ||||| | |||||||||
Sbjct: 222 tgggccgcacctgggaaaagctgctgctcgctgc 255



to top

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                             
Query: 231     acatcatcaacctgggcaagacatgggagaagctccagctcgctgc 276
               ||||||||||| | |||||||| ||||||||| ||||||| |||||
Sbjct: 1902094 acatcatcaacgttggcaagacctgggagaagatccagctggctgc 1902139



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                        
Query: 323     tccgcccgcccctacggccagcgtgccgtcctcaagttcgc 363
               ||||||||  ||||||| ||||| ||||| |||||||||||
Sbjct: 1902186 tccgcccgaacctacggacagcgagccgttctcaagttcgc 1902226



to top

>emb|BX053432.1|CNS09DE4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 926

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 103 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 162

                
Query: 243 tgggc 247
           |||||
Sbjct: 163 tgggc 167



to top

>emb|BX053371.1|CNS09DCF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 222

                
Query: 243 tgggc 247
           |||||
Sbjct: 223 tgggc 227



to top

>emb|BX033376.1|CNS08XX0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 243 tgggc 247
           |||||
Sbjct: 198 tgggc 202



to top

>emb|BX071531.1|CNS09RCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX071203.1|CNS09R3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 194

                
Query: 243 tgggc 247
           |||||
Sbjct: 195 tgggc 199



to top

>emb|BX071128.1|CNS09R1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 133 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 192

                
Query: 243 tgggc 247
           |||||
Sbjct: 193 tgggc 197



to top

>emb|BX071053.1|CNS09QZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 243 tgggc 247
           |||||
Sbjct: 214 tgggc 218



to top

>emb|BX070753.1|CNS09QR9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 97  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 156

                
Query: 243 tgggc 247
           |||||
Sbjct: 157 tgggc 161



to top

>emb|BX070730.1|CNS09QQM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 137 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 196

                
Query: 243 tgggc 247
           |||||
Sbjct: 197 tgggc 201



to top

>emb|BX070261.1|CNS09QDL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 114 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 173

                
Query: 243 tgggc 247
           |||||
Sbjct: 174 tgggc 178



to top

>emb|BX070237.1|CNS09QCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX070167.1|CNS09QAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 243 tgggc 247
           |||||
Sbjct: 202 tgggc 206



to top

>emb|BX069755.1|CNS09PZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 582

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 243 tgggc 247
           |||||
Sbjct: 211 tgggc 215



to top

>emb|BX069633.1|CNS09PW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 206

                
Query: 243 tgggc 247
           |||||
Sbjct: 207 tgggc 211



to top

>emb|BX068547.1|CNS09P1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 243 tgggc 247
           |||||
Sbjct: 214 tgggc 218



to top

>emb|BX068381.1|CNS09OXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX068171.1|CNS09ORJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 121 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 180

                
Query: 243 tgggc 247
           |||||
Sbjct: 181 tgggc 185



to top

>emb|BX067522.1|CNS09O9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 572

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 243 tgggc 247
           |||||
Sbjct: 203 tgggc 207



to top

>emb|BX067353.1|CNS09O4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 964 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 905

                
Query: 243 tgggc 247
           |||||
Sbjct: 904 tgggc 900



to top

>emb|BX067352.1|CNS09O4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 243 tgggc 247
           |||||
Sbjct: 200 tgggc 204



to top

>emb|BX067347.1|CNS09O4N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 243 tgggc 247
           |||||
Sbjct: 204 tgggc 208



to top

>emb|BX067075.1|CNS09NX3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 160 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 219

                
Query: 243 tgggc 247
           |||||
Sbjct: 220 tgggc 224



to top

>emb|BX067214.1|CNS09O0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 898

                
Query: 243 tgggc 247
           |||||
Sbjct: 897 tgggc 893



to top

>emb|BX067213.1|CNS09O0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 243 tgggc 247
           |||||
Sbjct: 199 tgggc 203



to top

>emb|BX066172.1|CNS09N80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX065840.1|CNS09MYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 243 tgggc 247
           |||||
Sbjct: 211 tgggc 215



to top

>emb|BX065656.1|CNS09MTO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 243 tgggc 247
           |||||
Sbjct: 204 tgggc 208



to top

>emb|BX065484.1|CNS09MOW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

                
Query: 243 tgggc 247
           |||||
Sbjct: 194 tgggc 198



to top

>emb|BX065339.1|CNS09MKV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 197

                
Query: 243 tgggc 247
           |||||
Sbjct: 198 tgggc 202



to top

>emb|BX064723.1|CNS09M3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 155 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 214

                
Query: 243 tgggc 247
           |||||
Sbjct: 215 tgggc 219



to top

>emb|BX064630.1|CNS09M16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 243 tgggc 247
           |||||
Sbjct: 210 tgggc 214



to top

>emb|BX064621.1|CNS09M0X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 243 tgggc 247
           |||||
Sbjct: 204 tgggc 208



to top

>emb|BX064449.1|CNS09LW5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 243 tgggc 247
           |||||
Sbjct: 218 tgggc 222



to top

>emb|BX063186.1|CNS09KX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX063172.1|CNS09KWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 243 tgggc 247
           |||||
Sbjct: 212 tgggc 216



to top

>emb|BX062722.1|CNS09KK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 906

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 243 tgggc 247
           |||||
Sbjct: 199 tgggc 203



to top

>emb|BX062255.1|CNS09K77 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1038

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 962 acttccagatggagcagtacgtgtacaagcgccgcgcggacggtgtgaacatcatcaacc 903

                
Query: 243 tgggc 247
           |||||
Sbjct: 902 tgggc 898



to top

>emb|BX062254.1|CNS09K76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1044

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcgcggacggtgtgcacatcatcaacc 203

                
Query: 243 tgggc 247
           |||||
Sbjct: 204 tgggc 208



to top

>emb|BX062187.1|CNS09K5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 243 tgggc 247
           |||||
Sbjct: 204 tgggc 208



to top

>emb|BX061828.1|CNS09JVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 243 tgggc 247
           |||||
Sbjct: 201 tgggc 205



to top

>emb|BX061698.1|CNS09JRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 243 tgggc 247
           |||||
Sbjct: 201 tgggc 205



to top

>emb|BX061626.1|CNS09JPQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 136 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 195

                
Query: 243 tgggc 247
           |||||
Sbjct: 196 tgggc 200



to top

>emb|BX061413.1|CNS09JJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 167 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 226

                
Query: 243 tgggc 247
           |||||
Sbjct: 227 tgggc 231



to top

>emb|BX061395.1|CNS09JJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 243 tgggc 247
           |||||
Sbjct: 210 tgggc 214



to top

>emb|BX060764.1|CNS09J1S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 243 tgggc 247
           |||||
Sbjct: 213 tgggc 217



to top

>emb|BX060566.1|CNS09IWA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 243 tgggc 247
           |||||
Sbjct: 201 tgggc 205



to top

>emb|BX060291.1|CNS09ION Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX060009.1|CNS09IGT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX059650.1|CNS09I6U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 243 tgggc 247
           |||||
Sbjct: 219 tgggc 223



to top

>emb|BX059559.1|CNS09I4B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 94  acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 153

                
Query: 243 tgggc 247
           |||||
Sbjct: 154 tgggc 158



to top

>emb|BX059479.1|CNS09I23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 243 tgggc 247
           |||||
Sbjct: 203 tgggc 207



to top

>emb|BX059203.1|CNS09HUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgaacatcatcaacc 898

                
Query: 243 tgggc 247
           |||||
Sbjct: 897 tgggc 893



to top

>emb|BX059202.1|CNS09HUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX059194.1|CNS09HU6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 243 tgggc 247
           |||||
Sbjct: 211 tgggc 215



to top

>emb|BX058471.1|CNS09HA3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 732

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 243 tgggc 247
           |||||
Sbjct: 211 tgggc 215



to top

>emb|BX058368.1|CNS09H78 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX058299.1|CNS09H5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 243 tgggc 247
           |||||
Sbjct: 217 tgggc 221



to top

>emb|BX058273.1|CNS09H4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 684

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX058144.1|CNS09H10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 162 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 221

                
Query: 243 tgggc 247
           |||||
Sbjct: 222 tgggc 226



to top

>emb|BX058069.1|CNS09GYX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX056716.1|CNS09FXC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX057820.1|CNS09GS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 457

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 243 tgggc 247
           |||||
Sbjct: 198 tgggc 202



to top

>emb|BX057691.1|CNS09GOF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 243 tgggc 247
           |||||
Sbjct: 219 tgggc 223



to top

>emb|BX057689.1|CNS09GOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 243 tgggc 247
           |||||
Sbjct: 219 tgggc 223



to top

>emb|BX057642.1|CNS09GN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX057084.1|CNS09G7K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 144 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 203

                
Query: 243 tgggc 247
           |||||
Sbjct: 204 tgggc 208



to top

>emb|BX056920.1|CNS09G30 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 296

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 211

                
Query: 243 tgggc 247
           |||||
Sbjct: 212 tgggc 216



to top

>emb|BX056570.1|CNS09FTA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 136 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 195

                
Query: 243 tgggc 247
           |||||
Sbjct: 196 tgggc 200



to top

>emb|BX056337.1|CNS09FMT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 983 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 924

                
Query: 243 tgggc 247
           |||||
Sbjct: 923 tgggc 919



to top

>emb|BX056336.1|CNS09FMS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 222

                
Query: 243 tgggc 247
           |||||
Sbjct: 223 tgggc 227



to top

>emb|BX056269.1|CNS09FKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 243 tgggc 247
           |||||
Sbjct: 214 tgggc 218



to top

>emb|BX056116.1|CNS09FGO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX056090.1|CNS09FFY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 150

                
Query: 243 tgggc 247
           |||||
Sbjct: 151 tgggc 155



to top

>emb|BX055751.1|CNS09F6J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34CA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 218

                
Query: 243 tgggc 247
           |||||
Sbjct: 219 tgggc 223



to top

>emb|BX055412.1|CNS09EX4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 129 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 188

                
Query: 243 tgggc 247
           |||||
Sbjct: 189 tgggc 193



to top

>emb|BX054928.1|CNS09EJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 617

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 243 tgggc 247
           |||||
Sbjct: 202 tgggc 206



to top

>emb|BX054660.1|CNS09EC8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX053609.1|CNS09DJ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 193

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 95  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 154

                
Query: 243 tgggc 247
           |||||
Sbjct: 155 tgggc 159



to top

>emb|BX053590.1|CNS09DII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 151 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 210

                
Query: 243 tgggc 247
           |||||
Sbjct: 211 tgggc 215



to top

>emb|BX052800.1|CNS09CWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 218

                
Query: 243 tgggc 247
           |||||
Sbjct: 219 tgggc 223



to top

>emb|BX052798.1|CNS09CWI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 105 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 164

                
Query: 243 tgggc 247
           |||||
Sbjct: 165 tgggc 169



to top

>emb|BX052551.1|CNS09CPN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX052477.1|CNS09CNL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 979 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 920

                
Query: 243 tgggc 247
           |||||
Sbjct: 919 tgggc 915



to top

>emb|BX052476.1|CNS09CNK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX051837.1|CNS09C5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 794

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 127 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 186

                
Query: 243 tgggc 247
           |||||
Sbjct: 187 tgggc 191



to top

>emb|BX051209.1|CNS09BOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 56  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 115

                
Query: 243 tgggc 247
           |||||
Sbjct: 116 tgggc 120



to top

>emb|BX049918.1|CNS09AOI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 243 tgggc 247
           |||||
Sbjct: 213 tgggc 217



to top

>emb|BX049879.1|CNS09ANF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX049604.1|CNS09AFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 168 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 227

                
Query: 243 tgggc 247
           |||||
Sbjct: 228 tgggc 232



to top

>emb|BX049403.1|CNS09AA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 285

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 243 tgggc 247
           |||||
Sbjct: 212 tgggc 216



to top

>emb|BX049364.1|CNS09A94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25BB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 243 tgggc 247
           |||||
Sbjct: 213 tgggc 217



to top

>emb|BX049219.1|CNS09A53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 168 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 227

                
Query: 243 tgggc 247
           |||||
Sbjct: 228 tgggc 232



to top

>emb|BX049063.1|CNS09A0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 121 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 180

                
Query: 243 tgggc 247
           |||||
Sbjct: 181 tgggc 185



to top

>emb|BX048945.1|CNS099XH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 243 tgggc 247
           |||||
Sbjct: 218 tgggc 222



to top

>emb|BX048268.1|CNS099EO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX047396.1|CNS098QG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 103 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 162

                
Query: 243 tgggc 247
           |||||
Sbjct: 163 tgggc 167



to top

>emb|BX046740.1|CNS09888 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 425

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 119 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 178

                
Query: 243 tgggc 247
           |||||
Sbjct: 179 tgggc 183



to top

>emb|BX046217.1|CNS097TP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2DB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 243 tgggc 247
           |||||
Sbjct: 221 tgggc 225



to top

>emb|BX046120.1|CNS097R0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 816

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX045820.1|CNS097IO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 139 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 198

                
Query: 243 tgggc 247
           |||||
Sbjct: 199 tgggc 203



to top

>emb|BX045707.1|CNS097FJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX044948.1|CNS096UG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 243 tgggc 247
           |||||
Sbjct: 201 tgggc 205



to top

>emb|BX044495.1|CNS096HV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 243 tgggc 247
           |||||
Sbjct: 217 tgggc 221



to top

>emb|BX043740.1|CNS095WW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 338

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 126 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 185

                
Query: 243 tgggc 247
           |||||
Sbjct: 186 tgggc 190



to top

>emb|BX043445.1|CNS095OP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16AC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1010

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 155 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 214

                
Query: 243 tgggc 247
           |||||
Sbjct: 215 tgggc 219



to top

>emb|BX043330.1|CNS095LI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 164 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 223

                
Query: 243 tgggc 247
           |||||
Sbjct: 224 tgggc 228



to top

>emb|BX042876.1|CNS0958W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 194

                
Query: 243 tgggc 247
           |||||
Sbjct: 195 tgggc 199



to top

>emb|BX042850.1|CNS09586 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 126 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 185

                
Query: 243 tgggc 247
           |||||
Sbjct: 186 tgggc 190



to top

>emb|BX042652.1|CNS0952O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 243 tgggc 247
           |||||
Sbjct: 212 tgggc 216



to top

>emb|BX042358.1|CNS094UI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 243 tgggc 247
           |||||
Sbjct: 203 tgggc 207



to top

>emb|BX042337.1|CNS094TX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC14BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 243 tgggc 247
           |||||
Sbjct: 202 tgggc 206



to top

>emb|BX041420.1|CNS0944G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 509

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 243 tgggc 247
           |||||
Sbjct: 214 tgggc 218



to top

>emb|BX041297.1|CNS09411 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 863

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 243 tgggc 247
           |||||
Sbjct: 195 tgggc 199



to top

>emb|BX039405.1|CNS092KH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 120 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 179

                
Query: 243 tgggc 247
           |||||
Sbjct: 180 tgggc 184



to top

>emb|BX039319.1|CNS092I3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 166 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 225

                
Query: 243 tgggc 247
           |||||
Sbjct: 226 tgggc 230



to top

>emb|BX037243.1|CNS090WF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9CE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 343

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 133 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 192

                
Query: 243 tgggc 247
           |||||
Sbjct: 193 tgggc 197



to top

>emb|BX036479.1|CNS090B7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 81  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 140

                
Query: 243 tgggc 247
           |||||
Sbjct: 141 tgggc 145



to top

>emb|BX036426.1|CNS0909Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 243 tgggc 247
           |||||
Sbjct: 195 tgggc 199



to top

>emb|BX036415.1|CNS0909F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 940

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX036246.1|CNS0904Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 156 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 215

                
Query: 243 tgggc 247
           |||||
Sbjct: 216 tgggc 220



to top

>emb|BX035838.1|CNS08ZTE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 120 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 179

                
Query: 243 tgggc 247
           |||||
Sbjct: 180 tgggc 184



to top

>emb|BX035792.1|CNS08ZS4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 156 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 215

                
Query: 243 tgggc 247
           |||||
Sbjct: 216 tgggc 220



to top

>emb|BX035579.1|CNS08ZM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 80  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 139

                
Query: 243 tgggc 247
           |||||
Sbjct: 140 tgggc 144



to top

>emb|BX035436.1|CNS08ZI8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 127 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 186

                
Query: 243 tgggc 247
           |||||
Sbjct: 187 tgggc 191



to top

>emb|BX035412.1|CNS08ZHK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 206

                
Query: 243 tgggc 247
           |||||
Sbjct: 207 tgggc 211



to top

>emb|BX035254.1|CNS08ZD6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 147 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 206

                
Query: 243 tgggc 247
           |||||
Sbjct: 207 tgggc 211



to top

>emb|BX034628.1|CNS08YVS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 957 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 898

                
Query: 243 tgggc 247
           |||||
Sbjct: 897 tgggc 893



to top

>emb|BX034627.1|CNS08YVR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1079

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 243 tgggc 247
           |||||
Sbjct: 200 tgggc 204



to top

>emb|BX034339.1|CNS08YNR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 243 tgggc 247
           |||||
Sbjct: 201 tgggc 205



to top

>emb|BX034214.1|CNS08YKA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 159 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 218

                
Query: 243 tgggc 247
           |||||
Sbjct: 219 tgggc 223



to top

>emb|BX033483.1|CNS08XZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 141 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 200

                
Query: 243 tgggc 247
           |||||
Sbjct: 201 tgggc 205



to top

>emb|BX033175.1|CNS08XRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 650

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX032878.1|CNS08XJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 981 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 922

                
Query: 243 tgggc 247
           |||||
Sbjct: 921 tgggc 917



to top

>emb|BX032877.1|CNS08XJ5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 149 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 208

                
Query: 243 tgggc 247
           |||||
Sbjct: 209 tgggc 213



to top

>emb|BX032547.1|CNS08X9Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 243 tgggc 247
           |||||
Sbjct: 210 tgggc 214



to top

>emb|BX032290.1|CNS08X2U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1027

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 993 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 934

                
Query: 243 tgggc 247
           |||||
Sbjct: 933 tgggc 929



to top

>emb|BX032289.1|CNS08X2T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 163 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 222

                
Query: 243 tgggc 247
           |||||
Sbjct: 223 tgggc 227



to top

>emb|BX032041.1|CNS08WVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 140 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 199

                
Query: 243 tgggc 247
           |||||
Sbjct: 200 tgggc 204



to top

>emb|BX031899.1|CNS08WRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 986 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 927

                
Query: 243 tgggc 247
           |||||
Sbjct: 926 tgggc 922



to top

>emb|BX031898.1|CNS08WRY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 158 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 217

                
Query: 243 tgggc 247
           |||||
Sbjct: 218 tgggc 222



to top

>emb|BX031717.1|CNS08WMX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 145 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 204

                
Query: 243 tgggc 247
           |||||
Sbjct: 205 tgggc 209



to top

>emb|BX031509.1|CNS08WH5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 243 tgggc 247
           |||||
Sbjct: 213 tgggc 217



to top

>emb|BX031483.1|CNS08WGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 143 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 202

                
Query: 243 tgggc 247
           |||||
Sbjct: 203 tgggc 207



to top

>emb|BX031337.1|CNS08WCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 152 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 211

                
Query: 243 tgggc 247
           |||||
Sbjct: 212 tgggc 216



to top

>emb|BX031303.1|CNS08WBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 153 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 212

                
Query: 243 tgggc 247
           |||||
Sbjct: 213 tgggc 217



to top

>emb|BX030674.1|CNS08VTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 157 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 216

                
Query: 243 tgggc 247
           |||||
Sbjct: 217 tgggc 221



to top

>emb|BX031154.1|CNS08W7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX031118.1|CNS08W6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 404

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 243 tgggc 247
           |||||
Sbjct: 210 tgggc 214



to top

>emb|BX031106.1|CNS08W5Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX030504.1|CNS08VP8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 135 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 194

                
Query: 243 tgggc 247
           |||||
Sbjct: 195 tgggc 199



to top

>emb|BX030359.1|CNS08VL7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 134 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 193

                
Query: 243 tgggc 247
           |||||
Sbjct: 194 tgggc 198



to top

>emb|BX030067.1|CNS08VD3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 213

                
Query: 243 tgggc 247
           |||||
Sbjct: 214 tgggc 218



to top

>emb|BX029939.1|CNS08V9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 471

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 142 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 201

                
Query: 243 tgggc 247
           |||||
Sbjct: 202 tgggc 206



to top

>emb|BX029906.1|CNS08V8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 759

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 146 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 205

                
Query: 243 tgggc 247
           |||||
Sbjct: 206 tgggc 210



to top

>emb|BX029898.1|CNS08V8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 161 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 220

                
Query: 243 tgggc 247
           |||||
Sbjct: 221 tgggc 225



to top

>emb|BX029447.1|CNS08UVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 138 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 197

                
Query: 243 tgggc 247
           |||||
Sbjct: 198 tgggc 202



to top

>emb|BX029058.1|CNS08UL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 148 acttccagatggagcagtacgtgtacaagcgccgcactgacggtgtgcacatcatcaacc 207

                
Query: 243 tgggc 247
           |||||
Sbjct: 208 tgggc 212



to top

>emb|BX028713.1|CNS08UBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 154 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 213

                
Query: 243 tgggc 247
           |||||
Sbjct: 214 tgggc 218



to top

>emb|BX022451.1|CNS08PHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 91  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 150

                
Query: 243 tgggc 247
           |||||
Sbjct: 151 tgggc 155



to top

>emb|BX028388.1|CNS08U2G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 150 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 209

                
Query: 243 tgggc 247
           |||||
Sbjct: 210 tgggc 214



to top

>emb|BX028172.1|CNS08TWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 78  acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 137

                
Query: 243 tgggc 247
           |||||
Sbjct: 138 tgggc 142



to top

>emb|BX027823.1|CNS08TMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 183 acttccagatggagcgctacgcctacaagcgccgctccgacggcatctacatcatcaacc 242
           |||||||||||||||  ||||  |||||||||||| | |||||  |  ||||||||||||
Sbjct: 166 acttccagatggagcagtacgtgtacaagcgccgcacggacggtgtgcacatcatcaacc 225

                
Query: 243 tgggc 247
           |||||
Sbjct: 226 tgggc 230


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,080,897
Number of Sequences: 3902068
Number of extensions: 3080897
Number of successful extensions: 78844
Number of sequences better than 10.0: 473
Number of HSP's better than 10.0 without gapping: 456
Number of HSP's successfully gapped in prelim test: 25
Number of HSP's that attempted gapping in prelim test: 76540
Number of HSP's gapped (non-prelim): 2303
length of query: 449
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 427
effective length of database: 17,147,199,772
effective search space: 7321854302644
effective search space used: 7321854302644
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top