ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bast25g04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF026538.1|AF026538 Hordeum vulgare ABA-responsive protein mRNA, complete cds Length = 1326 Score = 682 bits (344), Expect = 0.0 Identities = 364/373 (97%) Strand = Plus / Plus Query: 8 caccacaccgccaaccgcgcctgcgccacaggccgaggcaggagcgcctcacttctatcc 67 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 100 caccacaccgccgaccgcgcctgcgccacaggccgaggcaggagcgcctcacttctatcc 159 Query: 68 cccgacggagcacggcaccgcgccacagccgggatcgcaggtctcctatcccccgatgcc 127 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 160 cccgacggagcacggcaccgcgccacagccgggatcgcaggtctcctatcccccgatgcc 219 Query: 128 aaaggccatggatggccaggacgccgccgcgccacagccgggagcgccgccgcacccgtc 187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220 aaaggccatggatggccaggacgccgccgcgccacagccgggagcgccgccgcacccgtc 279 Query: 188 ctccccactcacgcagcaggccatggagctagagggcaagtacgccgccccacagccggg 247 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 280 ctccccactcacgcagcaggccatggagctggagggcaagtacgccgccccacagccggg 339 Query: 248 cactggagctacgccgtnnnnnnngacgcagcaagccgtggacggcaaggacgccgcccc 307 ||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 340 cactggagctacgccgtcccccctgacgcagcaagccgtggacggcaaggacgccgcccc 399 Query: 308 gacaccgcccgccgagtcggcgcggtggggtacgaggcagatgggtccgccagcggcgcc 367 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 400 gacaccgcccgccgagtcggcgcggtggggtacgaggcagatgggtccgccagcggcgcc 459 Query: 368 gggggcgcatccc 380 ||||||||||||| Sbjct: 460 gggggcgcatccc 472
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 332 gtggggtacgaggcagatgggtccgccagcggcgccgggggcgca 376 |||||| |||||||||||||| ||||| |||||||| |||||||| Sbjct: 17506004 gtgggggacgaggcagatgggcccgccggcggcgcccggggcgca 17505960
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Minus Query: 332 gtggggtacgaggcagatgggtccgccagcggcgccgggggcgca 376 |||||| |||||||||||||| ||||| |||||||| |||||||| Sbjct: 17460375 gtgggggacgaggcagatgggcccgccggcggcgcccggggcgca 17460331
>emb|AL731763.1|CNS07YQA Oryza sativa chromosome 12, . BAC OSJNBa0090O14 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 129619 Score = 58.0 bits (29), Expect = 2e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 332 gtggggtacgaggcagatgggtccgccagcggcgccgggggcgca 376 |||||| |||||||||||||| ||||| |||||||| |||||||| Sbjct: 26402 gtgggggacgaggcagatgggcccgccggcggcgcccggggcgca 26446
>emb|AJ965256.1| Dehalococcoides sp. CBDB1 complete genome Length = 1395502 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 173 gccgccgcacccgtcctccccactc 197 ||||||||||||| ||||||||||| Sbjct: 235720 gccgccgcacccggcctccccactc 235696
>gb|CP000264.1| Jannaschia sp. CCS1, complete genome Length = 4317977 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 cgccaaccgcgcctgcgccac 36 ||||||||||||||||||||| Sbjct: 2482029 cgccaaccgcgcctgcgccac 2482009
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 312 ccgcccgccgagtcggcgcgg 332 ||||||||||||||||||||| Sbjct: 1862931 ccgcccgccgagtcggcgcgg 1862951
>gb|BC060636.1| Mus musculus DiGeorge syndrome critical region gene 2, mRNA (cDNA clone MGC:79172 IMAGE:6849298), complete cds Length = 4040 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1316 cgccagcggcgccgggagcgcatc 1339
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 190 ccccactcacgcagcaggccatgg 213 |||||||||||| ||||||||||| Sbjct: 3489223 ccccactcacgcggcaggccatgg 3489246
>ref|NM_005137.1| Homo sapiens DiGeorge syndrome critical region gene 2 (DGCR2), mRNA Length = 4436 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1299 cgccagcggcgccgggagcgcatc 1322
>gb|BC031506.1| Mus musculus DiGeorge syndrome critical region gene 2, mRNA (cDNA clone IMAGE:2609402), complete cds Length = 2809 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 85 cgccagcggcgccgggagcgcatc 108
>emb|AL954664.17| Human DNA sequence from clone LL0YNC03-56G10 on chromosome X Contains the 3' end of the gene for protein phosphatase 2A 48 kDa regulatory subunit (PR48), a novel gene and five CpG islands, complete sequence Length = 39200 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 21315 cacccgtcctccccactcac 21296 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 21266 cacccgtcctccccactcac 21247
>emb|X84076.1|HSDGCR2 H.sapiens mRNA for DGCR2 Length = 4398 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1260 cgccagcggcgccgggagcgcatc 1283
>emb|X83545.1|HSIDD H.sapiens mRNA for a cell surface protein Length = 4399 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1263 cgccagcggcgccgggagcgcatc 1286
>emb|CR936871.1| Homo sapiens mRNA; cDNA DKFZp686I1730 (from clone DKFZp686I1730) Length = 4832 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1697 cgccagcggcgccgggagcgcatc 1720
>gb|BC040500.1| Homo sapiens DiGeorge syndrome critical region gene 2, mRNA (cDNA clone MGC:33836 IMAGE:5272271), complete cds Length = 4489 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1357 cgccagcggcgccgggagcgcatc 1380
>dbj|AP008931.1| Rhodococcus erythropolis PR4 plasmid pREL1, complete sequence Length = 271577 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 314 gcccgccgagtcggcgcggt 333 |||||||||||||||||||| Sbjct: 237821 gcccgccgagtcggcgcggt 237802
>gb|AC135611.25| Pan troglodytes clone rp43-14h17, complete sequence Length = 215721 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 cccacagccgggcactggag 255 |||||||||||||||||||| Sbjct: 134261 cccacagccgggcactggag 134280
>emb|CR602533.1| full-length cDNA clone CS0DL006YH15 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 2459 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 380 cgccagcggcgccgggagcgcatc 403
>dbj|AK145495.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0007A05 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 3991 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1292 cgccagcggcgccgggagcgcatc 1315
>dbj|AK141594.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched library, clone:C630037J07 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 2672 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1341 cgccagcggcgccgggagcgcatc 1364
>dbj|AK133880.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730481K15 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 3364 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 664 cgccagcggcgccgggagcgcatc 687
>dbj|AK153026.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830119F19 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 3863 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1162 cgccagcggcgccgggagcgcatc 1185
>gb|AC003063.7| Mus musculus Chromosome 16 BAC Clone b40-o20 Syntenic To Homo sapiens 22q11.2 DGCR Region, complete sequence Length = 128143 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 13643 cgccagcggcgccgggagcgcatc 13620
>dbj|AK161359.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930465P06 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 1798 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1091 cgccagcggcgccgggagcgcatc 1114
>gb|AF418189.1|AF418189 Desulfonatronum lacustre DSM 10312 dissimilatory sulfite reductase alpha subunit (dsrA) and dissimilatory sulfite reductase beta subunit (dsrB) genes, partial cds Length = 1905 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 196 tcacgcagcaggccatggag 215 |||||||||||||||||||| Sbjct: 1693 tcacgcagcaggccatggag 1674
>dbj|AK164263.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length enriched library, clone:D030048P08 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 2775 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 75 cgccagcggcgccgggagcgcatc 98
>dbj|AK161022.1| Mus musculus 14 days embryo liver cDNA, RIKEN full-length enriched library, clone:4430402G13 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 5705 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 2126 cgccagcggcgccgggagcgcatc 2149
>dbj|AK163903.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230038L18 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 4004 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1304 cgccagcggcgccgggagcgcatc 1327
>dbj|AK163872.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230001A07 product:DiGeorge syndrome critical region gene 2, full insert sequence Length = 4009 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1328 cgccagcggcgccgggagcgcatc 1351
>emb|BX649323.12| Human DNA sequence from clone WI2-81109H8 on chromosome X, complete sequence Length = 37892 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 16162 cacccgtcctccccactcac 16143 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 16113 cacccgtcctccccactcac 16094
>dbj|AK088131.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430004L05 product:DiGeorge syndrome gene c, full insert sequence Length = 3791 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1092 cgccagcggcgccgggagcgcatc 1115
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 149 cgccgccgcgccacagccgg 168 |||||||||||||||||||| Sbjct: 2358409 cgccgccgcgccacagccgg 2358390
>gb|AC000095.5| Homo sapiens Chromosome 22q11.2 Fosmid Clone f41c7 In DGCR Region, complete sequence Length = 43728 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 40569 cgccagcggcgccgggagcgcatc 40546
>gb|AC016830.5| Homo sapiens chromosome 22 clone b81b3 map 22q11, complete sequence Length = 192720 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 cccacagccgggcactggag 255 |||||||||||||||||||| Sbjct: 47438 cccacagccgggcactggag 47457
>gb|AC016027.15| Homo sapiens chromosome 22 clone b476c20 map 22q11, complete sequence Length = 174991 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 236 cccacagccgggcactggag 255 |||||||||||||||||||| Sbjct: 42735 cccacagccgggcactggag 42754
>gb|AC002522.2| Homo sapiens Chromosome 22 Cosmid Clone 46a9 In DGCR Region, complete sequence Length = 39857 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 25324 cgccagcggcgccgggagcgcatc 25301
>gb|AC004461.3| Homo sapiens Chromosome 22q11.2 Cosmid Clone 119f4 In DGCR Region, complete sequence Length = 44873 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 12525 cgccagcggcgccgggagcgcatc 12502
>dbj|AK037000.1| Mus musculus adult female vagina cDNA, RIKEN full-length enriched library, clone:9930034O06 product:DiGeorge syndrome gene c, full insert sequence Length = 3814 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1320 cgccagcggcgccgggagcgcatc 1343
>emb|BX511099.12| Human DNA sequence from clone XX-82516H2 on chromosome X, complete sequence Length = 25946 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 11406 cacccgtcctccccactcac 11425 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 11357 cacccgtcctccccactcac 11376
>gb|AF215840.1|AF215840 Homo sapiens chromosome Y clone PPP2R3LY, complete sequence Length = 27918 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 19743 cacccgtcctccccactcac 19724 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 19694 cacccgtcctccccactcac 19675
>gb|AF215839.1|AF215839 Homo sapiens chromosome X clone PPP2R3LX map Xp22, complete sequence Length = 42584 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 40950 cacccgtcctccccactcac 40931
>gb|AC010093.8| Homo sapiens BAC clone RP11-323O5 from 2, complete sequence Length = 160930 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 150 gccgccgcgccacagccgggagcgccgc 177 |||||||||||| |||||||||| |||| Sbjct: 12722 gccgccgcgccaaagccgggagccccgc 12695
>ref|XM_573327.1| PREDICTED: Rattus norvegicus DiGeorge syndrome critical region gene 2 (predicted) (Dgcr2_predicted), mRNA Length = 3977 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1304 cgccagcggcgccgggagcgcatc 1327
>gb|AC000096.17| Mus musculus Chromosome 16 BAC Clone bd3-6 Syntenic To Homo sapiens 22q11.2 DGCR Region, complete sequence Length = 127343 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 102515 cgccagcggcgccgggagcgcatc 102492
>dbj|AK129070.1| Mus musculus mRNA for mKIAA0163 protein Length = 3925 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1225 cgccagcggcgccgggagcgcatc 1248
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 137 ggatggccaggacgccgccg 156 |||||||||||||||||||| Sbjct: 403773 ggatggccaggacgccgccg 403792
>gb|BC032430.1| Homo sapiens DiGeorge syndrome critical region gene 2, mRNA (cDNA clone MGC:40330 IMAGE:5243412), complete cds Length = 2857 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1298 cgccagcggcgccgggagcgcatc 1321
>emb|CR456433.1| Homo sapiens DGCR2 full length open reading frame (ORF) cDNA clone (cDNA clone C22ORF:pGEM.DGCR2.V2) Length = 1818 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1134 cgccagcggcgccgggagcgcatc 1157
>gb|BC081905.1| Rattus norvegicus DiGeorge syndrome critical region gene 2, mRNA (cDNA clone MGC:93833 IMAGE:7111034), complete cds Length = 2030 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1382 cgccagcggcgccgggagcgcatc 1405
>dbj|D79985.1| Homo sapiens KIAA0163 mRNA, complete cds Length = 4436 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1299 cgccagcggcgccgggagcgcatc 1322
>gb|L77560.1|HUMLAN Homo sapiens LAN mRNA, 3' end Length = 4399 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1263 cgccagcggcgccgggagcgcatc 1286
>gb|L77570.1|HUMDGCRCEN Homo sapiens DiGeorge syndrome critical region, centromeric end Length = 108400 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 5625 cgccagcggcgccgggagcgcatc 5602
>ref|NM_010048.2| Mus musculus DiGeorge syndrome critical region gene 2 (Dgcr2), mRNA Length = 4040 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1316 cgccagcggcgccgggagcgcatc 1339
>ref|NM_001012146.1| Rattus norvegicus DiGeorge syndrome critical region gene 2 (Dgcr2), mRNA Length = 2030 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1382 cgccagcggcgccgggagcgcatc 1405
>gb|BC035425.1| Homo sapiens DiGeorge syndrome critical region gene 2, mRNA (cDNA clone IMAGE:4184290) Length = 2876 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1309 cgccagcggcgccgggagcgcatc 1332
>gb|BC020339.1| Homo sapiens DiGeorge syndrome critical region gene 2, mRNA (cDNA clone IMAGE:4180979) Length = 2876 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1309 cgccagcggcgccgggagcgcatc 1332
>gb|BC062978.1| Mus musculus DiGeorge syndrome critical region gene 2, mRNA (cDNA clone MGC:86148 IMAGE:30356000), complete cds Length = 3985 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1270 cgccagcggcgccgggagcgcatc 1293
>gb|AC078895.34| Mus musculus strain C57BL/6J chromosome 16 clone rp23-372h6, complete sequence Length = 211256 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 142001 cgccagcggcgccgggagcgcatc 142024
>dbj|AB209137.1| Homo sapiens mRNA for NY-REN-8 antigen variant protein Length = 5814 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 1516 cacccgtcctccccactcac 1497 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 180 cacccgtcctccccactcac 199 |||||||||||||||||||| Sbjct: 1467 cacccgtcctccccactcac 1448
>dbj|D78641.1|MUSMEGL Mouse mRNA for membrane glycoprotein, complete cds Length = 3999 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 355 cgccagcggcgccgggggcgcatc 378 |||||||||||||||| ||||||| Sbjct: 1300 cgccagcggcgccgggagcgcatc 1323 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,177,665 Number of Sequences: 3902068 Number of extensions: 2177665 Number of successful extensions: 61899 Number of sequences better than 10.0: 61 Number of HSP's better than 10.0 without gapping: 61 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 61360 Number of HSP's gapped (non-prelim): 534 length of query: 380 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 358 effective length of database: 17,147,199,772 effective search space: 6138697518376 effective search space used: 6138697518376 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
