| Clone Name | bast25f11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT016705.1| Zea mays clone Contig538 mRNA sequence Length = 1265 Score = 50.1 bits (25), Expect = 2e-04 Identities = 25/25 (100%) Strand = Plus / Plus Query: 9 ccctggtgggcacgatgcgcggcca 33 ||||||||||||||||||||||||| Sbjct: 92 ccctggtgggcacgatgcgcggcca 116
>gb|BT016269.1| Zea mays clone Contig102 mRNA sequence Length = 1254 Score = 48.1 bits (24), Expect = 8e-04 Identities = 24/24 (100%) Strand = Plus / Plus Query: 11 ctggtgggcacgatgcgcggccac 34 |||||||||||||||||||||||| Sbjct: 94 ctggtgggcacgatgcgcggccac 117
>gb|AY103919.1| Zea mays PCO099246 mRNA sequence Length = 1461 Score = 48.1 bits (24), Expect = 8e-04 Identities = 24/24 (100%) Strand = Plus / Plus Query: 11 ctggtgggcacgatgcgcggccac 34 |||||||||||||||||||||||| Sbjct: 251 ctggtgggcacgatgcgcggccac 274
>gb|BT017990.1| Zea mays clone EL01N0526B03.c mRNA sequence Length = 1281 Score = 40.1 bits (20), Expect = 0.20 Identities = 23/24 (95%) Strand = Plus / Plus Query: 11 ctggtgggcacgatgcgcggccac 34 ||||||||||||||| |||||||| Sbjct: 103 ctggtgggcacgatgtgcggccac 126
>emb|X02724.1|SSUPAR Porcine mRNA for plasminogen activator Length = 2375 Score = 40.1 bits (20), Expect = 0.20 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 gtcgctcaccctggtgggca 20 |||||||||||||||||||| Sbjct: 1596 gtcgctcaccctggtgggca 1577
>emb|X01648.1|SSUPAG Porcine gene for plasminogen activator Length = 7143 Score = 40.1 bits (20), Expect = 0.20 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 gtcgctcaccctggtgggca 20 |||||||||||||||||||| Sbjct: 6047 gtcgctcaccctggtgggca 6028
>ref|NM_213945.1| Sus scrofa plasminogen activator (PLAU), mRNA Length = 2375 Score = 40.1 bits (20), Expect = 0.20 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 gtcgctcaccctggtgggca 20 |||||||||||||||||||| Sbjct: 1596 gtcgctcaccctggtgggca 1577
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Minus Query: 13 ggtgggcacgatgcgcggc 31 ||||||||||||||||||| Sbjct: 3895996 ggtgggcacgatgcgcggc 3895978
>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence Length = 4074542 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Minus Query: 13 ggtgggcacgatgcgcggc 31 ||||||||||||||||||| Sbjct: 3637814 ggtgggcacgatgcgcggc 3637796
>emb|AL662916.8| Mouse DNA sequence from clone RP23-442C24 on chromosome 11, complete sequence Length = 25524 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Plus Query: 8 accctggtgggcacgatgc 26 ||||||||||||||||||| Sbjct: 19172 accctggtgggcacgatgc 19190
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Plus Query: 13 ggtgggcacgatgcgcggc 31 ||||||||||||||||||| Sbjct: 546054 ggtgggcacgatgcgcggc 546072 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 15 tgggcacgatgcgcggcc 32 |||||||||||||||||| Sbjct: 1896652 tgggcacgatgcgcggcc 1896635
>ref|NM_008873.2| Mus musculus plasminogen activator, urokinase (Plau), mRNA Length = 2299 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 cgctcaccctggtgggca 20 |||||||||||||||||| Sbjct: 1510 cgctcaccctggtgggca 1493
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 15 tgggcacgatgcgcggcc 32 |||||||||||||||||| Sbjct: 1031869 tgggcacgatgcgcggcc 1031852
>gb|AC121599.3| Mus musculus BAC clone RP23-300H21 from 14, complete sequence Length = 218747 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 cgctcaccctggtgggca 20 |||||||||||||||||| Sbjct: 213185 cgctcaccctggtgggca 213168
>emb|X02389.1|MMURKR Mouse mRNA for urokinase Length = 2299 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 cgctcaccctggtgggca 20 |||||||||||||||||| Sbjct: 1510 cgctcaccctggtgggca 1493
>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16 Length = 347137 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 15 tgggcacgatgcgcggcc 32 |||||||||||||||||| Sbjct: 59137 tgggcacgatgcgcggcc 59120
>emb|BX640432.1| Bordetella parapertussis strain 12822, complete genome; segment 10/14 Length = 346301 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 15 tgggcacgatgcgcggcc 32 |||||||||||||||||| Sbjct: 341897 tgggcacgatgcgcggcc 341880
>emb|BX640414.1| Bordetella pertussis strain Tohama I, complete genome; segment 4/12 Length = 343243 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 15 tgggcacgatgcgcggcc 32 |||||||||||||||||| Sbjct: 136794 tgggcacgatgcgcggcc 136811
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 15 tgggcacgatgcgcggcc 32 |||||||||||||||||| Sbjct: 2349397 tgggcacgatgcgcggcc 2349380
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 36.2 bits (18), Expect = 3.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 9 ccctggtgggcacgatgcgcgg 30 |||||||||||||| ||||||| Sbjct: 2004705 ccctggtgggcacggtgcgcgg 2004726
>gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome 14, complete sequence Length = 195596 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 3 cgctcaccctggtgggca 20 |||||||||||||||||| Sbjct: 99407 cgctcaccctggtgggca 99424
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 13 ggtgggcacgatgcgcgg 30 |||||||||||||||||| Sbjct: 1832801 ggtgggcacgatgcgcgg 1832784
>gb|U47738.1|STU47738 Solanum tuberosum chalcone synthase 2 mRNA, complete cds Length = 1404 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 2 tcgctcaccctggtgggc 19 |||||||||||||||||| Sbjct: 1004 tcgctcaccctggtgggc 1021
>gb|M17922.1|MUSUPAA Mouse Murine urokinase-type plasminogen activator protein gene, complete cds Length = 9950 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 3 cgctcaccctggtgggca 20 |||||||||||||||||| Sbjct: 8116 cgctcaccctggtgggca 8099 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 124,640 Number of Sequences: 3902068 Number of extensions: 124640 Number of successful extensions: 29467 Number of sequences better than 10.0: 24 Number of HSP's better than 10.0 without gapping: 24 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 28842 Number of HSP's gapped (non-prelim): 625 length of query: 34 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 14 effective length of database: 17,155,003,908 effective search space: 240170054712 effective search space used: 240170054712 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)