ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast24e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT016328.1| Zea mays clone Contig161 mRNA sequence 76 7e-12
2emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-l... 76 7e-12
3gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial... 76 7e-12
4gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, part... 76 7e-12
5gb|AY189038.1| Arracacia aegopodioides 26S large subunit ribosom... 68 2e-09
6gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA g... 68 2e-09
7gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial ... 68 2e-09
8gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial s... 68 2e-09
9gb|AY727943.1| Cantua buxifolia 26S ribosomal RNA gene, partial ... 68 2e-09
10gb|AY727942.1| Acanthogilia gloriosa 26S ribosomal RNA gene, par... 68 2e-09
11gb|AY260041.1| Fendlera rupicola 26S ribosomal RNA gene, complet... 68 2e-09
12gb|AY260014.1| Diplopanax stachyanthus 26S ribosomal RNA gene, c... 68 2e-09
13gb|AY128176.1| Ruta graveolens 26S ribosomal RNA gene, partial s... 68 2e-09
14gb|AY128175.1| Harpullia arborea 26S ribosomal RNA gene, partial... 68 2e-09
15gb|AY128172.1| Turraea sericea 26S ribosomal RNA gene, partial s... 68 2e-09
16gb|AY128170.1| Toona sp. Chase 664 26S ribosomal RNA gene, parti... 68 2e-09
17gb|AY128167.1| Nymania capensis 26S ribosomal RNA gene, partial ... 68 2e-09
18gb|AY128162.1| Khaya anthotheca 26S ribosomal RNA gene, partial ... 68 2e-09
19gb|AY128161.1| Heckeldora staudtii 26S ribosomal RNA gene, parti... 68 2e-09
20gb|AY128160.1| Guarea glabra 26S ribosomal RNA gene, partial seq... 68 2e-09
21gb|AF497856.1| Echinochloa crus-galli var. formosensis 26S ribos... 68 2e-09
22gb|DQ008618.1| Lardizabala biternata 26S ribosomal RNA gene, par... 68 2e-09
23gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete s... 68 2e-09
24gb|AF479151.1| Clavija eggersiana 26S ribosomal RNA gene, partia... 68 2e-09
25gb|AF479135.1| Ochroma pyramidale 26S ribosomal RNA gene, comple... 68 2e-09
26gb|AF479112.1| Brexia madagascariensis 26S ribosomal RNA gene, c... 68 2e-09
27gb|AF479102.1| Ceanothus sanguineus 26S ribosomal RNA gene, comp... 68 2e-09
28gb|AF479088.1| Mollugo verticillata 26S ribosomal RNA gene, comp... 68 2e-09
29gb|AF479085.1| Polygonum sachalinense 26S ribosomal RNA gene, co... 68 2e-09
30gb|AF479083.1| Tamarix pentandra 26S ribosomal RNA gene, complet... 68 2e-09
31gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA ... 68 2e-09
32gb|AY755722.1| Ephedra nevadensis voucher (UC) 66-1033 26S ribos... 64 3e-08
33gb|AY755720.1| Ephedra trifurca voucher (Mo) 04630447 26S riboso... 64 3e-08
34gb|AF479150.1| Androsace spinulifera 26S ribosomal RNA gene, com... 64 3e-08
35gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 62 1e-07
36gb|AF479220.1| Pteridophyllum racemosum 26S ribosomal RNA gene, ... 62 1e-07
37gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial se... 60 4e-07
38gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, part... 60 4e-07
39gb|AF389269.1| Ranunculus keniensis 26S ribosomal RNA gene, part... 60 4e-07
40gb|AF389263.1| Hypecoum imberbe 26S ribosomal RNA gene, partial ... 60 4e-07
41gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, ... 60 4e-07
42gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 60 4e-07
43gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partia... 60 4e-07
44gb|AY189113.1| Torricellia tiliifolia 26S large subunit ribosoma... 60 4e-07
45gb|AY189104.1| Pseudosciadium balansae 26S large subunit ribosom... 60 4e-07
46gb|AY189100.1| Pimpinella saxifraga 26S large subunit ribosomal ... 60 4e-07
47gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosoma... 60 4e-07
48gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal R... 60 4e-07
49gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA... 60 4e-07
50gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal R... 60 4e-07
51gb|AY189066.1| Endressia castellana 26S large subunit ribosomal ... 60 4e-07
52gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RN... 60 4e-07
53gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA ... 60 4e-07
54gb|AY189030.1| Aegopodium podagraria 26S large subunit ribosomal... 60 4e-07
55gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal R... 60 4e-07
56gb|AY727986.1| Diapensia lapponica 26S ribosomal RNA gene, parti... 60 4e-07
57gb|AY727985.1| Shortia uniflora 26S ribosomal RNA gene, partial ... 60 4e-07
58gb|AY727984.1| Shortia soldanelloides 26S ribosomal RNA gene, pa... 60 4e-07
59gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, par... 60 4e-07
60gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, part... 60 4e-07
61gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA ... 60 4e-07
62gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, parti... 60 4e-07
63gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partia... 60 4e-07
64gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial s... 60 4e-07
65gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial ... 60 4e-07
66gb|AY727929.1| Hydrangea sp. JS-2005 26S ribosomal RNA gene, par... 60 4e-07
67gb|AY095468.1| Saururus cernuus 26S ribosomal RNA gene, partial ... 60 4e-07
68gb|AY095467.1| Piper betle 26S ribosomal RNA gene, partial sequence 60 4e-07
69gb|AY095464.1| Liriodendron chinense 26S ribosomal RNA gene, par... 60 4e-07
70gb|AY095460.1| Gomortega keule 26S ribosomal RNA gene, partial s... 60 4e-07
71gb|AY095459.1| Galbulimima belgraveana 26S ribosomal RNA gene, p... 60 4e-07
72gb|AY095457.1| Chloranthus multistachys 26S ribosomal RNA gene, ... 60 4e-07
73gb|AY095450.1| Aristolochia macrophylla 26S ribosomal RNA gene, ... 60 4e-07
74gb|AY260045.1| Shortia galacifolia 26S ribosomal RNA gene, compl... 60 4e-07
75gb|AY260042.1| Jamesia americana 26S ribosomal RNA gene, complet... 60 4e-07
76gb|AY260035.1| Fendlerella utahensis 26S ribosomal RNA gene, com... 60 4e-07
77gb|AY260034.1| Deutzia rubens 26S ribosomal RNA gene, complete s... 60 4e-07
78gb|AY260032.1| Hydrangea arborescens 26S ribosomal RNA gene, com... 60 4e-07
79gb|AY260020.1| Grubbia tomentosa 26S ribosomal RNA gene, complet... 60 4e-07
80gb|AY260019.1| Grubbia rosmarinifolia 26S ribosomal RNA gene, pa... 60 4e-07
81gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete... 60 4e-07
82gb|AY260010.1| Camptotheca acuminata 26S ribosomal RNA gene, com... 60 4e-07
83gb|AY292910.1| Sabia sp. YLQ-2003 26S ribosomal RNA gene, partia... 60 4e-07
84gb|AY292899.1| Aristolochia sp. YLQ-2003 26S ribosomal RNA gene,... 60 4e-07
85gb|AY292897.1| Saururus sp. YLQ-2003 26S ribosomal RNA gene, par... 60 4e-07
86gb|AY292896.1| Piper sp. YLQ-2003 26S ribosomal RNA gene, partia... 60 4e-07
87gb|AY292888.1| Chloranthus sp. YLQ-2003 26S ribosomal RNA gene, ... 60 4e-07
88gb|AY292880.1| Galbulimima sp. YLQ-2003 26S ribosomal RNA gene, ... 60 4e-07
89gb|AY292879.1| Liriodendron sp. YLQ-2003 26S ribosomal RNA gene,... 60 4e-07
90gb|AY128174.1| Allophylus cobbe 26S ribosomal RNA gene, partial ... 60 4e-07
91gb|AY128171.1| Trichilia emetica 26S ribosomal RNA gene, partial... 60 4e-07
92gb|AY128169.1| Swietenia macrophylla 26S ribosomal RNA gene, par... 60 4e-07
93gb|AY128168.1| Schmardaea microphylla 26S ribosomal RNA gene, pa... 60 4e-07
94gb|AY128165.1| Melia dubia 26S ribosomal RNA gene, partial sequence 60 4e-07
95gb|AY128164.1| Melia azedarach 26S ribosomal RNA gene, partial s... 60 4e-07
96gb|AY128158.1| Dysoxylum gaudichaudianum 26S ribosomal RNA gene,... 60 4e-07
97gb|AY128157.1| Dysoxylum sp. Chase 1311 26S ribosomal RNA gene, ... 60 4e-07
98gb|AY128156.1| Cipadessa baccifera specimen-voucher Samuel7 26S ... 60 4e-07
99gb|AY128154.1| Chukrasia tabularis 26S ribosomal RNA gene, parti... 60 4e-07
100gb|AY128153.1| Chisocheton macrophyllus 26S ribosomal RNA gene, ... 60 4e-07
101gb|AY128152.1| Cedrela odorata 26S ribosomal RNA gene, partial s... 60 4e-07
102gb|AY128151.1| Carapa guianensis 26S ribosomal RNA gene, partial... 60 4e-07
103gb|AY128150.1| Azadirachta indica specimen-voucher Samuel5 26S r... 60 4e-07
104gb|AY128149.1| Azadirachta indica specimen-voucher Chase1307 26S... 60 4e-07
105gb|AY954474.1| Ranunculus cantoniensis 26S ribosomal RNA gene, p... 60 4e-07
106dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic D... 60 4e-07
107gb|AY056517.1| Lysimachia thyrsiflora 26S ribosomal RNA gene, pa... 60 4e-07
108gb|AY056491.1| Ephedra sp. CR33 26S ribosomal RNA gene, partial ... 60 4e-07
109gb|AY056488.1| Ephedra sinica 26S ribosomal RNA gene, partial se... 60 4e-07
110gb|AF274670.1| Tetracentron sinense 26S ribosomal RNA gene, comp... 60 4e-07
111gb|AF274652.1| Lambertia inermis 26S ribosomal RNA gene, complet... 60 4e-07
112gb|DQ008659.1| Illicium floridanum 26S ribosomal RNA gene, parti... 60 4e-07
113gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial seq... 60 4e-07
114gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial ... 60 4e-07
115gb|DQ008640.1| Houttuynia cordata 26S ribosomal RNA gene, partia... 60 4e-07
116gb|DQ008616.1| Cissampelos pareira 26S ribosomal RNA gene, parti... 60 4e-07
117gb|DQ008612.1| Grevillea banksii 26S ribosomal RNA gene, partial... 60 4e-07
118gb|DQ008608.1| Didymeles perrieri 26S ribosomal RNA gene, partia... 60 4e-07
119gb|AF479245.1| Chloranthus japonicus 26S ribosomal RNA gene, com... 60 4e-07
120gb|AF479241.1| Swietenia macrophylla 26S ribosomal RNA gene, com... 60 4e-07
121gb|AF479206.1| Lambertia inermis 26S ribosomal RNA gene, complet... 60 4e-07
122gb|AF479205.1| Trochodendron aralioides 26S ribosomal RNA gene, ... 60 4e-07
123gb|AF479197.1| Griselinia lucida 26S ribosomal RNA gene, complet... 60 4e-07
124gb|AF479195.1| Apium graveolens 26S ribosomal RNA gene, complete... 60 4e-07
125gb|AF479190.1| Codonopsis pilosula 26S ribosomal RNA gene, compl... 60 4e-07
126gb|AF479187.1| Corokia cotoneaster 26S ribosomal RNA gene, compl... 60 4e-07
127gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, compl... 60 4e-07
128gb|AF479181.1| Garrya elliptica 26S ribosomal RNA gene, complete... 60 4e-07
129gb|AF479160.1| Manilkara zapota 26S ribosomal RNA gene, complete... 60 4e-07
130gb|AF479149.1| Anagallis tenella 26S ribosomal RNA gene, complet... 60 4e-07
131gb|AF479141.1| Byblis gigantea 26S ribosomal RNA gene, complete ... 60 4e-07
132gb|AF479139.1| Cupaniopsis anacardioides 26S ribosomal RNA gene,... 60 4e-07
133gb|AF479138.1| Aesculus pavia 26S ribosomal RNA gene, complete s... 60 4e-07
134gb|AF479137.1| Sterculia apetala 26S ribosomal RNA gene, complet... 60 4e-07
135gb|AF479129.1| Geranium sanguineum 26S ribosomal RNA gene, compl... 60 4e-07
136gb|AF479128.1| Elaeocarpus sphaericus 26S ribosomal RNA gene, pa... 60 4e-07
137gb|AF479127.1| Averrhoa carambola 26S ribosomal RNA gene, comple... 60 4e-07
138gb|AF479126.1| Sloanea berteriana 26S ribosomal RNA gene, comple... 60 4e-07
139gb|AF479123.1| Androstachys johnsonii 26S ribosomal RNA gene, pa... 60 4e-07
140gb|AF479120.1| Medusagyne oppositifolia 26S ribosomal RNA gene, ... 60 4e-07
141gb|AF479119.1| Chrysobalanus icaco 26S ribosomal RNA gene, parti... 60 4e-07
142gb|AF479117.1| Idesia polycarpa 26S ribosomal RNA gene, complete... 60 4e-07
143gb|AF479115.1| Afrostyrax sp. Cheek 5007 26S ribosomal RNA gene,... 60 4e-07
144gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete ... 60 4e-07
145gb|AF479111.1| Hippocratea barbata 26S ribosomal RNA gene, compl... 60 4e-07
146gb|AF479109.1| Begonia metallica x Begonia sanguinea 26S ribosom... 60 4e-07
147gb|AF479103.1| Spiraea betulifolia 26S ribosomal RNA gene, compl... 60 4e-07
148gb|AF479101.1| Photinia fraseri 26S ribosomal RNA gene, complete... 60 4e-07
149gb|AF479098.1| Celtis yunnanensis 26S ribosomal RNA gene, comple... 60 4e-07
150gb|AF479095.1| Opilia amentacea 26S ribosomal RNA gene, complete... 60 4e-07
151dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic D... 60 4e-07
152gb|AY177422.1| Elaeocarpus sphaericus 26S ribosomal RNA gene, co... 60 4e-07
153gb|AY177421.1| Bursera inaguensis 26S ribosomal RNA gene, comple... 60 4e-07
154dbj|D17770.1|RIC49306 Oryza sativa gene for 25S ribosomal RNA, p... 60 4e-07
155dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
156dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
157dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
158dbj|AK119442.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
159dbj|AK111206.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
160dbj|AK111153.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
161dbj|AK110422.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
162dbj|AK110354.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
163dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
164dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
165dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
166dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
167dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
168dbj|AK110001.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
169dbj|AK109970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
170dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
171dbj|AK107288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
172dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
173dbj|AK106032.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
174dbj|AK105535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
175dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
176dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
177dbj|AK105251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
178dbj|AK063958.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
179dbj|AK063948.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
180dbj|AK063480.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
181dbj|AK063372.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
182dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
183dbj|AK060671.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
184dbj|AK060366.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
185dbj|AK059583.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 4e-07
186gb|AF036492.1|AF036492 Plumbago auriculata large subunit 26S rib... 60 4e-07
187gb|U52619.1|AQU52619 Anemone quinquefolia nuclear 26S ribosomal ... 60 4e-07
188gb|U52618.1|ATU52618 Anemone trifolia nuclear 26S ribosomal RNA ... 60 4e-07
189gb|U52602.1|VHU52602 Vancouveria hexandra nuclear 26S ribosomal ... 60 4e-07
190gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene 60 4e-07
191gb|AY755717.1| Ephedra torreyana voucher (S) 04-487 26S ribosoma... 58 2e-06
192gb|AY189058.1| Daucus carota 26S large subunit ribosomal RNA gen... 58 2e-06
193gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA g... 58 2e-06
194gb|AF479180.1| Exacum affine 26S ribosomal RNA gene, complete se... 58 2e-06
195gb|AY755726.1| Ephedra tweediana voucher (UC) 66-0742 26S riboso... 56 6e-06
196gb|AY755725.1| Ephedra chilensis voucher (UC) 49-0542 26S riboso... 56 6e-06
197gb|AY755723.1| Ephedra rupestris voucher (UC) 87-1368 26S riboso... 56 6e-06
198gb|AY755715.1| Ephedra antisyphilitica voucher (S) 04-488 26S ri... 56 6e-06
199gb|AY755712.1| Ephedra chilensis voucher (E) E00130260 26S ribos... 56 6e-06
200gb|AY755708.1| Ephedra californica voucher (O) 68-154 26S riboso... 56 6e-06
201gb|AY755707.1| Ephedra andina voucher (K) 10140 26S ribosomal RN... 56 6e-06
202gb|AY755706.1| Ephedra frustillata voucher (S) 04-482 26S riboso... 56 6e-06
203gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial se... 56 6e-06
204gb|AY056490.1| Ephedra frustillata 26S ribosomal RNA gene, parti... 56 6e-06
205gb|AY755738.1| Ephedra pachyclada voucher (S) C-7844 26S ribosom... 52 1e-04
206gb|AY755736.1| Ephedra campylopoda voucher (S) C-7605 26S riboso... 52 1e-04
207gb|AY755735.1| Ephedra ciliata voucher (S) C-591 26S ribosomal R... 52 1e-04
208gb|AY755734.1| Ephedra foliata voucher (S) C-7808 26S ribosomal ... 52 1e-04
209gb|AY755732.1| Ephedra alata voucher (S) C-303 26S ribosomal RNA... 52 1e-04
210gb|AY755731.1| Ephedra altissima voucher (S) C-7688 26S ribosoma... 52 1e-04
211gb|AY755730.1| Ephedra altissima voucher (S) C-628 26S ribosomal... 52 1e-04
212gb|AY755728.1| Ephedra equisetina voucher (S) C-465-2 26S riboso... 52 1e-04
213gb|AY755727.1| Ephedra distachya voucher (S) 03-684 26S ribosoma... 52 1e-04
214gb|AY755724.1| Ephedra likiangensis voucher (UC) 94-0389 26S rib... 52 1e-04
215gb|AY755721.1| Ephedra procera voucher (Mo) 01903487 26S ribosom... 52 1e-04
216gb|AY755719.1| Ephedra distachya voucher (S) 04-481 26S ribosoma... 52 1e-04
217gb|AY755718.1| Ephedra gerardiana voucher (O) 74-460 26S ribosom... 52 1e-04
218gb|AY755714.1| Ephedra minuta voucher (S) 04-486 26S ribosomal R... 52 1e-04
219gb|AY755713.1| Ephedra minuta voucher (S) 04-485 26S ribosomal R... 52 1e-04
220gb|AY755711.1| Ephedra gerardiana voucher (E) E00130259 26S ribo... 52 1e-04
221gb|AY755710.1| Ephedra fragilis voucher (E) E00130258 26S riboso... 52 1e-04
222gb|AY755709.1| Ephedra equisetina voucher (O) 90-536 26S ribosom... 52 1e-04
223gb|AY755705.1| Ephedra equisetina voucher (S) 03-926 26S ribosom... 52 1e-04
224gb|AY423083.1| Calceolaria arachnoidea isolate DNA-CW6 26S ribos... 52 1e-04
225gb|AY423082.1| Peltanthera floribunda isolate DNA-CW9 26S riboso... 52 1e-04
226gb|AY423079.1| Paulownia tomentosa isolate DNA-CW1 26S ribosomal... 52 1e-04
227gb|AY423078.1| Tetranema mexicanum isolate DNA-CW5 26S ribosomal... 52 1e-04
228gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete... 52 1e-04
229gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, parti... 52 1e-04
230gb|AF389270.1| Xanthorhiza simplicissima 26S ribosomal RNA gene,... 52 1e-04
231gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, parti... 52 1e-04
232gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial s... 52 1e-04
233gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, parti... 52 1e-04
234gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial s... 52 1e-04
235gb|AF389261.1| Schoepfia schreberi 26S ribosomal RNA gene, parti... 52 1e-04
236gb|AF389260.1| Nepenthes sp. Nickrent 3056 26S ribosomal RNA gen... 52 1e-04
237gb|AF389257.1| Menispermum canadense 26S ribosomal RNA gene, par... 52 1e-04
238gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial... 52 1e-04
239gb|AF389254.1| Decaisnea fargesii 26S ribosomal RNA gene, partia... 52 1e-04
240gb|AF389253.1| Akebia quinata 26S ribosomal RNA gene, partial se... 52 1e-04
241gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, part... 52 1e-04
242gb|AF389248.1| Drosera capensis 26S ribosomal RNA gene, partial ... 52 1e-04
243gb|AF389245.1| Kingdonia uniflora 26S ribosomal RNA gene, partia... 52 1e-04
244gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partia... 52 1e-04
245gb|AF389241.1| Nandina domestica 26S ribosomal RNA gene, partial... 52 1e-04
246gb|AF389240.1| Caulophyllum thalictroides 26S ribosomal RNA gene... 52 1e-04
247gb|AY189150.1| Petroselinum crispum 26S large subunit ribosomal ... 52 1e-04
248gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosom... 52 1e-04
249gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal... 52 1e-04
250gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RN... 52 1e-04
251gb|AY189054.1| Centella erecta 26S large subunit ribosomal RNA g... 52 1e-04
252gb|AY189040.1| Astrantia major 26S large subunit ribosomal RNA g... 52 1e-04
253gb|AY189032.1| Anginon rugosum 26S large subunit ribosomal RNA g... 52 1e-04
254gb|AY727983.1| Galax urceolata 26S ribosomal RNA gene, partial s... 52 1e-04
255gb|AY727982.1| Bruinsmia styracoides 26S ribosomal RNA gene, par... 52 1e-04
256gb|AY727981.1| Halesia carolina 26S ribosomal RNA gene, partial ... 52 1e-04
257gb|AY727980.1| Styrax japonicus 26S ribosomal RNA gene, partial ... 52 1e-04
258gb|AY727975.1| Camellia sinensis 26S ribosomal RNA gene, partial... 52 1e-04
259gb|AY727973.1| Rhododendron impeditum 26S ribosomal RNA gene, pa... 52 1e-04
260gb|AY727970.1| Enkianthus campanulatus 26S ribosomal RNA gene, p... 52 1e-04
261gb|AY727969.1| Cyrilla racemiflora 26S ribosomal RNA gene, parti... 52 1e-04
262gb|AY727965.1| Roridula gorgonias 26S ribosomal RNA gene, partia... 52 1e-04
263gb|AY727964.1| Actinidia arguta 26S ribosomal RNA gene, partial ... 52 1e-04
264gb|AY727958.1| Samolus valerandi 26S ribosomal RNA gene, partial... 52 1e-04
265gb|AY727956.1| Lissocarpa benthamii 26S ribosomal RNA gene, part... 52 1e-04
266gb|AY727954.1| Pentaphylax euryoides 26S ribosomal RNA gene, par... 52 1e-04
267gb|AY727950.1| Couroupita guianensis 26S ribosomal RNA gene, par... 52 1e-04
268gb|AY727949.1| Barringtonia asiatica 26S ribosomal RNA gene, par... 52 1e-04
269gb|AY727945.1| Palaquium ferox 26S ribosomal RNA gene, partial s... 52 1e-04
270gb|AY727944.1| Cobaea scandens 26S ribosomal RNA gene, partial s... 52 1e-04
271gb|AY727940.1| Fouquieria fasciculata 26S ribosomal RNA gene, pa... 52 1e-04
272gb|AY727939.1| Fouquieria columnaris 26S ribosomal RNA gene, par... 52 1e-04
273gb|AY727938.1| Norantea guianensis 26S ribosomal RNA gene, parti... 52 1e-04
274gb|AY727937.1| Marcgravia rectiflora 26S ribosomal RNA gene, par... 52 1e-04
275gb|AY727933.1| Pelliciera rhizophorae 26S ribosomal RNA gene, pa... 52 1e-04
276gb|AY727930.1| Cornus sericea 26S ribosomal RNA gene, partial se... 52 1e-04
277gb|AY428812.1| Quercus suber 26S large subunit ribosomal RNA gen... 52 1e-04
278gb|AY095472.1| Pleea tenuifolia 26S ribosomal RNA gene, partial ... 52 1e-04
279gb|AY095471.1| Bulbine succulenta 26S ribosomal RNA gene, partia... 52 1e-04
280gb|AY095469.1| Tasmannia insipida 26S ribosomal RNA gene, partia... 52 1e-04
281gb|AY095466.1| Peumus boldus 26S ribosomal RNA gene, partial seq... 52 1e-04
282gb|AY095462.1| Hernandia nymphaeifolia 26S ribosomal RNA gene, p... 52 1e-04
283gb|AY095458.1| Cinnamodendron sp. MJZ-2002 26S ribosomal RNA gen... 52 1e-04
284gb|AY095451.1| Asimina triloba 26S ribosomal RNA gene, partial s... 52 1e-04
285gb|AY260043.1| Decumaria sp. Chase et al. 1993 26S ribosomal RNA... 52 1e-04
286gb|AY260040.1| Cardiandra alternifolia 26S ribosomal RNA gene, c... 52 1e-04
287gb|AY260039.1| Broussaisia arguta 26S ribosomal RNA gene, comple... 52 1e-04
288gb|AY260038.1| Pileostegia sp. Qiu 1992 26S ribosomal RNA gene, ... 52 1e-04
289gb|AY260037.1| Philadelphus caucasicus 26S ribosomal RNA gene, c... 52 1e-04
290gb|AY260036.1| Philadelphus hirsutus 26S ribosomal RNA gene, com... 52 1e-04
291gb|AY260033.1| Platycrater arguta 26S ribosomal RNA gene, comple... 52 1e-04
292gb|AY260031.1| Eucnide urens 26S ribosomal RNA gene, complete se... 52 1e-04
293gb|AY260030.1| Mentzelia decapetala 26S ribosomal RNA gene, comp... 52 1e-04
294gb|AY260029.1| Petalonyx parryi 26S ribosomal RNA gene, complete... 52 1e-04
295gb|AY260028.1| Petalonyx nitidus 26S ribosomal RNA gene, complet... 52 1e-04
296gb|AY260018.1| Nyssa sylvatica 26S ribosomal RNA gene, complete ... 52 1e-04
297gb|AY260017.1| Mastixia eugenioides 26S ribosomal RNA gene, comp... 52 1e-04
298gb|AY260016.1| Mastixia pentandra 26S ribosomal RNA gene, comple... 52 1e-04
299gb|AY260015.1| Mastixia caudatilimba 26S ribosomal RNA gene, com... 52 1e-04
300gb|AY260011.1| Cornus disciflora 26S ribosomal RNA gene, complet... 52 1e-04
301gb|AY260009.1| Alangium chinense 26S ribosomal RNA gene, complet... 52 1e-04
302gb|AY260008.1| Alangium chinense 26S ribosomal RNA gene, complet... 52 1e-04
303gb|AY260007.1| Alangium kurzii 26S ribosomal RNA gene, complete ... 52 1e-04
304gb|AY292912.1| Pleea tenuifolia 26S ribosomal RNA gene, partial ... 52 1e-04
305gb|AY292911.1| Buxus sp. YLQ-2003 26S ribosomal RNA gene, partia... 52 1e-04
306gb|AY292906.1| Dicentra sp. YLQ-2003 26S ribosomal RNA gene, par... 52 1e-04
307gb|AY292895.1| Peperomia sp. YLQ-2003 26S ribosomal RNA gene, pa... 52 1e-04
308gb|AY292894.1| Hernandia sp. YLQ-2003 26S ribosomal RNA gene, pa... 52 1e-04
309gb|AY292893.1| Atherosperma moschatum 26S ribosomal RNA gene, pa... 52 1e-04
310gb|AY292892.1| Peumus boldus 26S ribosomal RNA gene, partial seq... 52 1e-04
311gb|AY292885.1| Cinnamodendron sp. YLQ-2003 26S ribosomal RNA gen... 52 1e-04
312gb|AY292883.1| Tasmannia sp. YLQ-2003 26S ribosomal RNA gene, pa... 52 1e-04
313gb|AY292882.1| Drimys sp. YLQ-2003 26S ribosomal RNA gene, parti... 52 1e-04
314gb|AY292881.1| Asimina sp. YLQ-2003 26S ribosomal RNA gene, part... 52 1e-04
315gb|AY292878.1| Magnolia sp. YLQ-2003 26S ribosomal RNA gene, par... 52 1e-04
316gb|AY128173.1| Walsura tubulata 26S ribosomal RNA gene, partial ... 52 1e-04
317gb|AY128166.1| Munronia pinnata 26S ribosomal RNA gene, partial ... 52 1e-04
318gb|AY128163.1| Lansium domesticum 26S ribosomal RNA gene, partia... 52 1e-04
319gb|AY128155.1| Cipadessa baccifera specimen-voucher Chase1310 26... 52 1e-04
320gb|AY128148.1| Aphanamixis polystachya 26S ribosomal RNA gene, p... 52 1e-04
321gb|AY128147.1| Aglaia sp. Samuel 2 26S ribosomal RNA gene, parti... 52 1e-04
322gb|AY128146.1| Aglaia sp. Samuel 1 26S ribosomal RNA gene, parti... 52 1e-04
323gb|AY128145.1| Aglaia elliptica 26S ribosomal RNA gene, partial ... 52 1e-04
324gb|AY128144.1| Aglaia elaeagnoidea 26S ribosomal RNA gene, parti... 52 1e-04
325gb|AY954482.1| Coptis chinensis 26S ribosomal RNA gene, partial ... 52 1e-04
326gb|AY954480.1| Thalictrum javanicum 26S ribosomal RNA gene, part... 52 1e-04
327gb|AY954479.1| Dichocarpum sutchuenense 26S ribosomal RNA gene, ... 52 1e-04
328gb|AY954477.1| Pulsatilla cernua 26S ribosomal RNA gene, partial... 52 1e-04
329gb|AY954476.1| Clematis ganpiniana 26S ribosomal RNA gene, parti... 52 1e-04
330gb|AY954475.1| Halerpestes cymbalaria 26S ribosomal RNA gene, pa... 52 1e-04
331gb|AY954467.1| Eranthis stellata 26S ribosomal RNA gene, partial... 52 1e-04
332gb|U52620.1|PSU52620 Pulsatilla sp. PSU 94983 nuclear 26S riboso... 52 1e-04
333gb|AY056516.1| Polemonium caeruleum 26S ribosomal RNA gene, part... 52 1e-04
334gb|AY056515.1| Impatiens noli-tangere 26S ribosomal RNA gene, pa... 52 1e-04
335gb|AY056494.1| Ephedra fragilis 26S ribosomal RNA gene, partial ... 52 1e-04
336gb|AY056493.1| Ephedra minuta 26S ribosomal RNA gene, partial se... 52 1e-04
337gb|AY056486.1| Ephedra gerardiana 26S ribosomal RNA gene, partia... 52 1e-04
338gb|AY056485.1| Ephedra americana 26S ribosomal RNA gene, partial... 52 1e-04
339gb|AF274671.1| Trochodendron aralioides 26S ribosomal RNA gene, ... 52 1e-04
340gb|AF274667.1| Sedum nudum 26S ribosomal RNA gene, complete sequ... 52 1e-04
341gb|AF274653.1| Leea guineensis 26S ribosomal RNA gene, complete ... 52 1e-04
342gb|AF205514.1|AF205514 Corsia sp. Neyland 1834 26S ribosomal RNA... 52 1e-04
343gb|AF297545.1|AF297545 Nyssa ogeche 26S ribosomal RNA gene, part... 52 1e-04
344gb|AF297544.1|AF297544 Alangium platanifolium 26S ribosomal RNA ... 52 1e-04
345gb|AF297543.1|AF297543 Schizophragma hydrangeoides 26S ribosomal... 52 1e-04
346gb|AF297542.1|AF297542 Cornus volkensii 26S ribosomal RNA gene, ... 52 1e-04
347gb|AF297541.1|AF297541 Cornus controversa 26S ribosomal RNA gene... 52 1e-04
348gb|AF297539.1|AF297539 Cornus oblonga 26S ribosomal RNA gene, pa... 52 1e-04
349gb|AF297537.1|AF297537 Cornus sessilis 26S ribosomal RNA gene, p... 52 1e-04
350gb|AF297536.1|AF297536 Cornus officinalis 26S ribosomal RNA gene... 52 1e-04
351gb|AF297535.1|AF297535 Cornus mas 26S ribosomal RNA gene, partia... 52 1e-04
352gb|AF297534.1|AF297534 Cornus unalaschkensis 26S ribosomal RNA g... 52 1e-04
353gb|AF297533.1|AF297533 Cornus kousa 26S ribosomal RNA gene, part... 52 1e-04
354gb|AF297532.1|AF297532 Cornus florida 26S ribosomal RNA gene, pa... 52 1e-04
355gb|AF297531.1|AF297531 Cornus suecica 26S ribosomal RNA gene, pa... 52 1e-04
356gb|DQ008658.1| Schisandra sphenanthera 26S ribosomal RNA gene, p... 52 1e-04
357gb|DQ008657.1| Kadsura japonica 26S ribosomal RNA gene, partial ... 52 1e-04
358gb|DQ008654.1| Acorus calamus 26S ribosomal RNA gene, partial se... 52 1e-04
359gb|DQ008647.1| Croomia pauciflora 26S ribosomal RNA gene, partia... 52 1e-04
360gb|DQ008646.1| Asparagus officinalis 26S ribosomal RNA gene, par... 52 1e-04
361gb|DQ008639.1| Anemopsis californica 26S ribosomal RNA gene, par... 52 1e-04
362gb|DQ008634.1| Annona muricata 26S ribosomal RNA gene, partial s... 52 1e-04
363gb|DQ008631.1| Siparuna decipiens 26S ribosomal RNA gene, partia... 52 1e-04
364gb|DQ008629.1| Daphnandra micrantha 26S ribosomal RNA gene, part... 52 1e-04
365gb|DQ008627.1| Cryptocarya meissneriana 26S ribosomal RNA gene, ... 52 1e-04
366gb|DQ008626.1| Laurus nobilis 26S ribosomal RNA gene, partial se... 52 1e-04
367gb|DQ008625.1| Cinnamomum camphora 26S ribosomal RNA gene, parti... 52 1e-04
368gb|DQ008620.1| Sargentodoxa cuneata 26S ribosomal RNA gene, part... 52 1e-04
369gb|DQ008619.1| Akebia quinata 26S ribosomal RNA gene, partial se... 52 1e-04
370gb|DQ008617.1| Cocculus trilobus 26S ribosomal RNA gene, partial... 52 1e-04
371gb|DQ008615.1| Xanthorhiza simplicissima 26S ribosomal RNA gene,... 52 1e-04
372gb|DQ008614.1| Podophyllum peltatum 26S ribosomal RNA gene, part... 52 1e-04
373gb|DQ008610.1| Petrophile canescens 26S ribosomal RNA gene, part... 52 1e-04
374gb|AF479246.1| Barnadesia caryophylla 26S ribosomal RNA gene, co... 52 1e-04
375gb|AF479244.1| Magnolia denudata 26S ribosomal RNA gene, complet... 52 1e-04
376gb|AF479242.1| Symphoricarpos albus 26S ribosomal RNA gene, comp... 52 1e-04
377gb|AF479237.1| Petroselinum crispum 26S ribosomal RNA gene, comp... 52 1e-04
378gb|AF479232.1| Morus nigra 26S ribosomal RNA gene, partial sequence 52 1e-04
379gb|AF479231.1| Dipsacus sativus 26S ribosomal RNA gene, complete... 52 1e-04
380gb|AF479229.1| Bixa orellana 26S ribosomal RNA gene, complete se... 52 1e-04
381gb|AF479202.1| Irvingbaileya sp. Plunkett 1510 26S ribosomal RNA... 52 1e-04
382gb|AF479200.1| Abelia triflora 26S ribosomal RNA gene, complete ... 52 1e-04
383gb|AF479196.1| Delarbrea michieana 26S ribosomal RNA gene, compl... 52 1e-04
384gb|AF479191.1| Campanula trachelium 26S ribosomal RNA gene, comp... 52 1e-04
385gb|AF479189.1| Donatia sp. Morgan 2142 26S ribosomal RNA gene, c... 52 1e-04
386gb|AF479185.1| Menyanthes trifoliata 26S ribosomal RNA gene, com... 52 1e-04
387gb|AF479182.1| Vahlia capensis 26S ribosomal RNA gene, complete ... 52 1e-04
388gb|AF479168.1| Verbascum thapsus 26S ribosomal RNA gene, partial... 52 1e-04
389gb|AF479163.1| Cornus officinalis 26S ribosomal RNA gene, comple... 52 1e-04
390gb|AF479162.1| Alangium sp. Chase 2541 26S ribosomal RNA gene, c... 52 1e-04
391gb|AF479161.1| Petalonyx nitidus 26S ribosomal RNA gene, complet... 52 1e-04
392gb|AF479159.1| Fouquieria columnaris 26S ribosomal RNA gene, com... 52 1e-04
393gb|AF479158.1| Galax urceolata 26S ribosomal RNA gene, partial s... 52 1e-04
394gb|AF479157.1| Halesia diptera 26S ribosomal RNA gene, complete ... 52 1e-04
395gb|AF479154.1| Impatiens repens 26S ribosomal RNA gene, complete... 52 1e-04
396gb|AF479136.1| Durio zibethinus 26S ribosomal RNA gene, complete... 52 1e-04
397gb|AF479134.1| Bombax ceiba 26S ribosomal RNA gene, complete seq... 52 1e-04
398gb|AF479118.1| Populus tremuloides 26S ribosomal RNA gene, compl... 52 1e-04
399gb|AF479110.1| Corynocarpus laevigatus 26S ribosomal RNA gene, c... 52 1e-04
400gb|AF479099.1| Zelkova serrata 26S ribosomal RNA gene, complete ... 52 1e-04
401gb|AF479096.1| Dillenia retusa 26S ribosomal RNA gene, partial s... 52 1e-04
402gb|AF479093.1| Portulaca grandiflora 26S ribosomal RNA gene, com... 52 1e-04
403gb|AF479092.1| Pereskia aculeata 26S ribosomal RNA gene, complet... 52 1e-04
404gb|AF479086.1| Mirabilis jalapa 26S ribosomal RNA gene, complete... 52 1e-04
405gb|AY177420.1| Citrus aurantium 26S ribosomal RNA gene, complete... 52 1e-04
406emb|X05910.1|CLRRN26 Citrus limon cistron for 26S ribosomal RNA 52 1e-04
407gb|AF036494.1|AF036494 Eucryphia lucida large subunit 26S riboso... 52 1e-04
408gb|AF036491.1|AF036491 Drimys winteri large subunit 26S ribosoma... 52 1e-04
409gb|AF036489.1|AF036489 Ephedra distachya large subunit 26S ribos... 52 1e-04
410gb|AY248757.1| Cornus eydeana 26S ribosomal RNA gene, partial se... 52 1e-04
411gb|U52630.1|TCU52630 Trautvetteria carolinensis nuclear 26S ribo... 52 1e-04
412gb|U52622.1|CAU52622 Clematis albicoma nuclear 26S ribosomal RNA... 52 1e-04
413gb|U52621.1|HAU52621 Hepatica americana nuclear 26S ribosomal RN... 52 1e-04
414gb|U52617.1|CTU52617 Coptis trifolia nuclear 26S ribosomal RNA g... 52 1e-04
415gb|U52611.1|TDU52611 Thalictrum dioicum nuclear 26S ribosomal RN... 52 1e-04
416gb|U52610.1|TTU52610 Thalictrum thalictroides nuclear 26S riboso... 52 1e-04
417gb|U52605.1|CTU52605 Caulophyllum thalictroides nuclear 26S ribo... 52 1e-04
418gb|U52604.1|JDU52604 Jeffersonia diphylla nuclear 26S ribosomal ... 52 1e-04
419emb|X13557.1|LE25SRIB Tomato 25S ribosomal RNA gene 50 4e-04
420gb|AF479124.1| Reinwardtia indica 26S ribosomal RNA gene, partia... 50 4e-04
421gb|AY755737.1| Ephedra major voucher (S) 03-164 26S ribosomal RN... 48 0.002
422gb|AY755729.1| Ephedra aphylla voucher (S) C-7791 26S ribosomal ... 48 0.002
423gb|AY755716.1| Ephedra intermedia voucher (S) 04-483 26S ribosom... 48 0.002
424gb|AY189109.1| Sollya heterophylla 26S large subunit ribosomal R... 48 0.002
425gb|AY189106.1| Rhytidosporum alpinum 26S large subunit ribosomal... 48 0.002
426gb|AY189105.1| Reynoldsia sandwicensis 26S large subunit ribosom... 48 0.002
427gb|AY189079.1| Hymenosporum flavum 26S large subunit ribosomal R... 48 0.002
428gb|AY189070.1| Gastonia rodriguesiana 26S large subunit ribosoma... 48 0.002
429gb|AY189036.1| Aralidium pinnatifidum 26S large subunit ribosoma... 48 0.002
430gb|AY292909.1| Platanus sp. YLQ-2003 26S ribosomal RNA gene, par... 48 0.002
431gb|AY056492.1| Ephedra intermedia 26S ribosomal RNA gene, partia... 48 0.002
432gb|AY056487.1| Ephedra monosperma 26S ribosomal RNA gene, partia... 48 0.002
433gb|AF297538.1|AF297538 Cornus racemosa 26S ribosomal RNA gene, p... 48 0.002
434gb|AF297530.1|AF297530 Cornus canadensis 26S ribosomal RNA gene,... 48 0.002
435gb|AF479199.1| Valeriana officinalis 26S ribosomal RNA gene, com... 48 0.002
436gb|AF479198.1| Scabiosa sp. Albach 39 26S ribosomal RNA gene, co... 48 0.002
437gb|AF479152.1| Maesa myrsinoides 26S ribosomal RNA gene, partial... 48 0.002
438gb|AF479125.1| Euphorbia polychroma 26S ribosomal RNA gene, comp... 48 0.002
439gb|AF389259.1| Nelumbo lutea 26S ribosomal RNA gene, partial seq... 46 0.006
440gb|AY292908.1| Nelumbo sp. YLQ-2003 26S ribosomal RNA gene, part... 46 0.006
441gb|AF274662.1| Platanus occidentalis 26S ribosomal RNA gene, com... 46 0.006
442gb|AF297540.1|AF297540 Cornus walteri 26S ribosomal RNA gene, pa... 46 0.006
443gb|U52623.1|CFU52623 Clematis fremontii nuclear 26S ribosomal RN... 46 0.006
444gb|U52603.1|PPU52603 Podophyllum peltatum nuclear 26S ribosomal ... 46 0.006
445gb|AY847628.1| Vitis vinifera cultivar Riesling 26S ribosomal RN... 44 0.024
446gb|AY423087.1| Napeanthus reitzii isolate DNA-SI.101 26S ribosom... 44 0.024
447gb|AY530924.1| Cornus capitata 26S ribosomal RNA gene, complete ... 44 0.024
448gb|AF389268.1| Hydrastis canadensis 26S ribosomal RNA gene, part... 44 0.024
449gb|AF389250.1| Gunnera manicata 26S ribosomal RNA gene, partial ... 44 0.024
450gb|AF389249.1| Euptelea polyandra 26S ribosomal RNA gene, partia... 44 0.024
451gb|AF389242.1| Berberidopsis corallina 26S ribosomal RNA gene, p... 44 0.024
452gb|AF389239.1| Aextoxicon punctatum 26S ribosomal RNA gene, part... 44 0.024
453gb|AY189107.1| Sanicula gregari 26S large subunit ribosomal RNA ... 44 0.024
454gb|AY189096.1| Neogoezia minor 26S large subunit ribosomal RNA g... 44 0.024
455gb|AY189084.1| Marianthus ringens 26S large subunit ribosomal RN... 44 0.024
456gb|AY189082.1| Mackinlaya confusa 26S large subunit ribosomal RN... 44 0.024
457gb|AY189072.1| Gymnophyton polycephalum 26S large subunit riboso... 44 0.024
458gb|AY189064.1| Donnellsmithia cordata 26S large subunit ribosoma... 44 0.024
459gb|AY727979.1| Symplocos pendula 26S ribosomal RNA gene, partial... 44 0.024
460gb|AY727977.1| Gordonia lasianthus 26S ribosomal RNA gene, parti... 44 0.024
461gb|AY727976.1| Schima sp. JS-2005 26S ribosomal RNA gene, partia... 44 0.024
462gb|AY727974.1| Vaccinium myrtillus 26S ribosomal RNA gene, parti... 44 0.024
463gb|AY727972.1| Empetrum hermaphroditum 26S ribosomal RNA gene, p... 44 0.024
464gb|AY727955.1| Ternstroemia stahlii 26S ribosomal RNA gene, part... 44 0.024
465gb|AY727948.1| Pouteria campechiana 26S ribosomal RNA gene, part... 44 0.024
466gb|AY727947.1| Madhuca microphylla 26S ribosomal RNA gene, parti... 44 0.024
467gb|AY727941.1| Polemonium pauciflorum 26S ribosomal RNA gene, pa... 44 0.024
468gb|AY727936.1| Impatiens auricoma 26S ribosomal RNA gene, partia... 44 0.024
469gb|AY727932.1| Ilex repanda 26S ribosomal RNA gene, partial sequ... 44 0.024
470gb|AY095470.1| Trimenia moorei 26S ribosomal RNA gene, partial s... 44 0.024
471gb|AY260013.1| Davidia involucrata 26S ribosomal RNA gene, compl... 44 0.024
472gb|AY292905.1| Euptelea sp. YLQ-2003 26S ribosomal RNA gene, par... 44 0.024
473gb|AY128159.1| Ekebergia capensis 26S ribosomal RNA gene, partia... 44 0.024
474gb|AY954481.1| Aquilegia ecalcarata 26S ribosomal RNA gene, part... 44 0.024
475gb|AY954473.1| Aconitum racemulosum 26S ribosomal RNA gene, part... 44 0.024
476gb|AY954470.1| Helleborus thibetanus 26S ribosomal RNA gene, par... 44 0.024
477gb|AY954469.1| Cimicifuga simplex 26S ribosomal RNA gene, partia... 44 0.024
478gb|AY056514.1| Gunnera magellanica 26S ribosomal RNA gene, parti... 44 0.024
479gb|AY056479.1| Encephalartos villosus 26S ribosomal RNA gene, pa... 44 0.024
480gb|AF274672.1| Vitis aestivalis 26S ribosomal RNA gene, complete... 44 0.024
481gb|AF274659.1| Paeonia suffruticosa 26S ribosomal RNA gene, comp... 44 0.024
482gb|AF274654.1| Liquidambar styraciflua 26S ribosomal RNA gene, c... 44 0.024
483gb|AF274646.1| Dudleya viscida 26S ribosomal RNA gene, complete ... 44 0.024
484gb|AF274644.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, ... 44 0.024
485gb|DQ400571.1| Peridiscus lucidus voucher Soares 205 26S ribosom... 44 0.024
486gb|DQ008656.1| Ascarina rubricaulis 26S ribosomal RNA gene, part... 44 0.024
487gb|DQ008630.1| Doryphora sassafras 26S ribosomal RNA gene, parti... 44 0.024
488gb|DQ008628.1| Atherosperma moschatum 26S ribosomal RNA gene, pa... 44 0.024
489gb|DQ008624.1| Gyrocarpus americanus 26S ribosomal RNA gene, par... 44 0.024
490gb|DQ008607.1| Pachysandra procumbens 26S ribosomal RNA gene, pa... 44 0.024
491gb|AF479243.1| Roussea simplex 26S ribosomal RNA gene, complete ... 44 0.024
492gb|AF479235.1| Elaeagnus sp. Chase 2414 26S ribosomal RNA gene, ... 44 0.024
493gb|AF479234.1| Thymelaea hirsuta 26S ribosomal RNA gene, complet... 44 0.024
494gb|AF479225.1| Neurada procumbens 26S ribosomal RNA gene, comple... 44 0.024
495gb|AF479223.1| Myrothamnus flabellifolius 26S ribosomal RNA gene... 44 0.024
496gb|AF479217.1| Liquidambar styraciflua 26S ribosomal RNA gene, c... 44 0.024
497gb|AF479215.1| Daphniphyllum sp. 205-82 26S ribosomal RNA gene, ... 44 0.024
498gb|AF479207.1| Vitis aestivalis 26S ribosomal RNA gene, complete... 44 0.024
499gb|AF479204.1| Gunnera hamiltonii 26S ribosomal RNA gene, comple... 44 0.024
500gb|AF479155.1| Gilia capitata 26S ribosomal RNA gene, complete s... 44 0.024

>gb|BT016328.1| Zea mays clone Contig161 mRNA sequence
          Length = 1055

 Score = 75.8 bits (38), Expect = 7e-12
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||||||||||||||||||||||||
Sbjct: 633 taggtaggacggcgcggctgcttcggtgagccgtgccacggaatcg 678



to top

>emb|AJ309824.2|ZMA309824 Zea mays 25S rRNA gene and transposon-like sequence
          Length = 10658

 Score = 75.8 bits (38), Expect = 7e-12
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||||||||||||||||||||||||
Sbjct: 1795 taggtaggacggcgcggctgcttcggtgagccgtgccacggaatcg 1840



to top

>gb|AY049041.1| Triticum aestivum 28S ribosomal RNA gene, partial sequence
          Length = 3341

 Score = 75.8 bits (38), Expect = 7e-12
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||| |||||||||||||||||||||||| |||||||
Sbjct: 1056 taggtaggatggcgcggctgcttcggtgagccgtgccatggaatcg 1101



to top

>gb|DQ008653.1| Tofieldia calyculata 26S ribosomal RNA gene, partial sequence
          Length = 3081

 Score = 75.8 bits (38), Expect = 7e-12
 Identities = 44/46 (95%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||||||| | ||||||||||||||||||||
Sbjct: 1033 taggtaggatggctcggctgctttgttgagccgtgccacggaatcg 1078



to top

>gb|AY189038.1| Arracacia aegopodioides 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3291

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1031 taggtaggacggcacggctgcttcgttgagccgtgccacggaatcg 1076



to top

>gb|AY189031.1| Angelica lucida 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3275

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1030 taggtaggacggcacggctgcttcgttgagccgtgccacggaatcg 1075



to top

>gb|AY727961.1| Myrsine africana 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1096



to top

>gb|AY727960.1| Primula elatior 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1096



to top

>gb|AY727943.1| Cantua buxifolia 26S ribosomal RNA gene, partial sequence
          Length = 3260

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 982  taggtaggacggcgcggctgcttcgctgagccgtgccacggaatcg 1027



to top

>gb|AY727942.1| Acanthogilia gloriosa 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1096



to top

>gb|AY260041.1| Fendlera rupicola 26S ribosomal RNA gene, complete sequence
          Length = 3342

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1037 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1082



to top

>gb|AY260014.1| Diplopanax stachyanthus 26S ribosomal RNA gene, complete sequence
          Length = 3366

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1067 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1112



to top

>gb|AY128176.1| Ruta graveolens 26S ribosomal RNA gene, partial sequence
          Length = 872

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 756 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 801



to top

>gb|AY128175.1| Harpullia arborea 26S ribosomal RNA gene, partial sequence
          Length = 875

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 759 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 804



to top

>gb|AY128172.1| Turraea sericea 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 802



to top

>gb|AY128170.1| Toona sp. Chase 664 26S ribosomal RNA gene, partial sequence
          Length = 874

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||||||||||| ||||||||||||
Sbjct: 758 taggtaggacggcgcggctgcttcggtgagccgcgccacggaatcg 803



to top

>gb|AY128167.1| Nymania capensis 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 802



to top

>gb|AY128162.1| Khaya anthotheca 26S ribosomal RNA gene, partial sequence
          Length = 876

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||||||||||| ||||||||||||
Sbjct: 760 taggtaggacggcgcggctgcttcggtgagccgcgccacggaatcg 805



to top

>gb|AY128161.1| Heckeldora staudtii 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 802



to top

>gb|AY128160.1| Guarea glabra 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 802



to top

>gb|AF497856.1| Echinochloa crus-galli var. formosensis 26S ribosomal RNA gene,
           partial sequence
          Length = 558

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||||||||||||||||||| |||||||
Sbjct: 246 taggtaggacggcacggctgcttcggtgagccgtgccatggaatcg 201



to top

>gb|DQ008618.1| Lardizabala biternata 26S ribosomal RNA gene, partial sequence
          Length = 3057

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1004 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1049



to top

>gb|AF479177.1| Hydrolea ovata 26S ribosomal RNA gene, complete sequence
          Length = 3331

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||| ||||||||||| ||||||||||| ||||||||
Sbjct: 1030 taggtaggatggcgcggctgcttcgttgagccgtgccgcggaatcg 1075



to top

>gb|AF479151.1| Clavija eggersiana 26S ribosomal RNA gene, partial sequence
          Length = 1826

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1049 taggtaggacggcacggctgcttcgttgagccgtgccacggaatcg 1094



to top

>gb|AF479135.1| Ochroma pyramidale 26S ribosomal RNA gene, complete sequence
          Length = 3349

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1045 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1090



to top

>gb|AF479112.1| Brexia madagascariensis 26S ribosomal RNA gene, complete sequence
          Length = 3337

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1034 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1079



to top

>gb|AF479102.1| Ceanothus sanguineus 26S ribosomal RNA gene, complete sequence
          Length = 3365

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1061 taggtaggacggcacggctgcttcgttgagccgtgccacggaatcg 1106



to top

>gb|AF479088.1| Mollugo verticillata 26S ribosomal RNA gene, complete sequence
          Length = 3354

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1054 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1099



to top

>gb|AF479085.1| Polygonum sachalinense 26S ribosomal RNA gene, complete sequence
          Length = 3347

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1052 taggtaggacggcgcggctgcttcgttgagccgtgccacggaatcg 1097



to top

>gb|AF479083.1| Tamarix pentandra 26S ribosomal RNA gene, complete sequence
          Length = 3348

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1049 taggtaggacggcgcggctgcttcgatgagccgtgccacggaatcg 1094



to top

>gb|AF036490.1| Acorus gramineus large subunit 26S ribosomal RNA gene, partial
            sequence
          Length = 3213

 Score = 67.9 bits (34), Expect = 2e-09
 Identities = 43/46 (93%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||||||||||||
Sbjct: 1073 taggtaggacggcgcggctgcttcgctgagccgtgccacggaatcg 1118



to top

>gb|AY755722.1| Ephedra nevadensis voucher (UC) 66-1033 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||||||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgtgccacggaatcg 1106



to top

>gb|AY755720.1| Ephedra trifurca voucher (Mo) 04630447 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||||||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgtgccacggaatcg 1106



to top

>gb|AF479150.1| Androsace spinulifera 26S ribosomal RNA gene, complete sequence
          Length = 3349

 Score = 63.9 bits (32), Expect = 3e-08
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||| |||||||||  ||||||| |||||||||||||
Sbjct: 1046 taggtaggatggcrcggctgcttaagtgagccrtgccacggaatcg 1091



to top

>gb|AF389264.1| Pteridophyllum racemosum 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||||| ||||||||||||||||||||
Sbjct: 1054 taggtaggacggngcggctgcttcgttgagccgtgccacggaatcg 1099



to top

>gb|AF479220.1| Pteridophyllum racemosum 26S ribosomal RNA gene, complete sequence
          Length = 3342

 Score = 61.9 bits (31), Expect = 1e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||||| ||||||||||||||||||||
Sbjct: 1054 taggtaggacggngcggctgcttcgttgagccgtgccacggaatcg 1099



to top

>gb|AF389272.1| Sabia swinhoei 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1057 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1102



to top

>gb|AF389271.1| Meliosma veitchiorum 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||||| ||||||||||||||||||||
Sbjct: 1057 taggtaggacggtgcggctgcttcgttgagccgtgccacggaatcg 1102



to top

>gb|AF389269.1| Ranunculus keniensis 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||| ||||| ||||||||||||||||||||
Sbjct: 1051 taggtaggacggcgcggctacttcgttgagccgtgccacggaatcg 1096



to top

>gb|AF389263.1| Hypecoum imberbe 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1052 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1097



to top

>gb|AF389255.1| Sinofranchetia chinensis 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1053 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 1098



to top

>gb|AF389251.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence
          Length = 3349

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 1059 taggtaggacggcgcggctgcttcgctgagccgtgcctcggaatcg 1104



to top

>gb|AF389247.1| Didymeles perrieri 26S ribosomal RNA gene, partial sequence
          Length = 3326

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1046 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 1091



to top

>gb|AY189113.1| Torricellia tiliifolia 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3265

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1031 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1076



to top

>gb|AY189104.1| Pseudosciadium balansae 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||  ||||||||||||||||||||
Sbjct: 1032 taggtaggacggcgcggctgcttcattgagccgtgccacggaatcg 1077



to top

>gb|AY189100.1| Pimpinella saxifraga 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1031 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1076



to top

>gb|AY189085.1| Melanophylla alnifolia 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3260

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1031 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1076



to top

>gb|AY189081.1| Lagoecia cuminoides 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1032 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1077



to top

>gb|AY189071.1| Griselinia lucida 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3312

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1032 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1077



to top

>gb|AY189068.1| Eryngium bourgattii 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3285

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1031 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1076



to top

>gb|AY189066.1| Endressia castellana 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1030 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1075



to top

>gb|AY189053.1| Bupleurum falcatum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3309

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1031 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1076



to top

>gb|AY189034.1| Apium graveolens 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1031 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1076



to top

>gb|AY189030.1| Aegopodium podagraria 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3288

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1032 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1077



to top

>gb|AY189029.1| Actinotus helianthi 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1030 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1075



to top

>gb|AY727986.1| Diapensia lapponica 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1049 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1094



to top

>gb|AY727985.1| Shortia uniflora 26S ribosomal RNA gene, partial sequence
          Length = 3327

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1047 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1092



to top

>gb|AY727984.1| Shortia soldanelloides 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1049 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1094



to top

>gb|AY727978.1| Symplocos zizyphoides 26S ribosomal RNA gene, partial sequence
          Length = 3304

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1024 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1069



to top

>gb|AY727971.1| Chimaphila umbellata 26S ribosomal RNA gene, partial sequence
          Length = 3331

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 1096



to top

>gb|AY727968.1| Clethra cf. ferruginea JS-2005 26S ribosomal RNA gene, partial
            sequence
          Length = 3330

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1048 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1093



to top

>gb|AY727963.1| Lysimachia vulgaris 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1096



to top

>gb|AY727962.1| Clavija lancifolia 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1052 taggtaggacggcacggctgcttcgttgagccgcgccacggaatcg 1097



to top

>gb|AY727957.1| Diospyros lotus 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1050 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 1095



to top

>gb|AY727946.1| Manilkara zapota 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1050 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1095



to top

>gb|AY727929.1| Hydrangea sp. JS-2005 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||  ||||||||||||||||||||
Sbjct: 1052 taggtaggacggcgcggctgcttcattgagccgtgccacggaatcg 1097



to top

>gb|AY095468.1| Saururus cernuus 26S ribosomal RNA gene, partial sequence
          Length = 3296

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1047 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1092



to top

>gb|AY095467.1| Piper betle 26S ribosomal RNA gene, partial sequence
          Length = 2930

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1044 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1089



to top

>gb|AY095464.1| Liriodendron chinense 26S ribosomal RNA gene, partial sequence
          Length = 3310

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1047 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1092



to top

>gb|AY095460.1| Gomortega keule 26S ribosomal RNA gene, partial sequence
          Length = 3041

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1050 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 1095



to top

>gb|AY095459.1| Galbulimima belgraveana 26S ribosomal RNA gene, partial sequence
          Length = 3315

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 1053 taggtaggacggcgcggctgcttcgctgagccgtgcctcggaatcg 1098



to top

>gb|AY095457.1| Chloranthus multistachys 26S ribosomal RNA gene, partial sequence
          Length = 3314

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||| |||||||| || ||||||| ||||||||||||
Sbjct: 1050 taggtaggatggcgcggctgctccgttgagccgcgccacggaatcg 1095



to top

>gb|AY095450.1| Aristolochia macrophylla 26S ribosomal RNA gene, partial sequence
          Length = 3154

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 894 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 939



to top

>gb|AY260045.1| Shortia galacifolia 26S ribosomal RNA gene, complete sequence
          Length = 3351

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1049 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1094



to top

>gb|AY260042.1| Jamesia americana 26S ribosomal RNA gene, complete sequence
          Length = 3317

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1012 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1057



to top

>gb|AY260035.1| Fendlerella utahensis 26S ribosomal RNA gene, complete sequence
          Length = 3351

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1067 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1112



to top

>gb|AY260034.1| Deutzia rubens 26S ribosomal RNA gene, complete sequence
          Length = 3367

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1067 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1112



to top

>gb|AY260032.1| Hydrangea arborescens 26S ribosomal RNA gene, complete sequence
          Length = 3341

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||  ||||||||||||||||||||
Sbjct: 1034 taggtaggacggcgcggctgcttcattgagccgtgccacggaatcg 1079



to top

>gb|AY260020.1| Grubbia tomentosa 26S ribosomal RNA gene, complete sequence
          Length = 3252

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1069 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1114



to top

>gb|AY260019.1| Grubbia rosmarinifolia 26S ribosomal RNA gene, partial sequence
          Length = 1458

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 782 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 827



to top

>gb|AY260012.1| Curtisia dentata 26S ribosomal RNA gene, complete sequence
          Length = 3372

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1069 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 1114



to top

>gb|AY260010.1| Camptotheca acuminata 26S ribosomal RNA gene, complete sequence
          Length = 3357

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1060 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 1105



to top

>gb|AY292910.1| Sabia sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3325

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1050 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1095



to top

>gb|AY292899.1| Aristolochia sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3169

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 894 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 939



to top

>gb|AY292897.1| Saururus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3311

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1047 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1092



to top

>gb|AY292896.1| Piper sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 2945

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1044 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1089



to top

>gb|AY292888.1| Chloranthus sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||| |||||||| || ||||||| ||||||||||||
Sbjct: 1050 taggtaggatggcgcggctgctccgttgagccgcgccacggaatcg 1095



to top

>gb|AY292880.1| Galbulimima sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3329

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||||||| ||||||||
Sbjct: 1053 taggtaggacggcgcggctgcttcgctgagccgtgcctcggaatcg 1098



to top

>gb|AY292879.1| Liriodendron sp. YLQ-2003 26S ribosomal RNA gene, partial sequence
          Length = 3325

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1047 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1092



to top

>gb|AY128174.1| Allophylus cobbe 26S ribosomal RNA gene, partial sequence
          Length = 878

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 762 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 807



to top

>gb|AY128171.1| Trichilia emetica 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 802



to top

>gb|AY128169.1| Swietenia macrophylla 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 802



to top

>gb|AY128168.1| Schmardaea microphylla 26S ribosomal RNA gene, partial sequence
          Length = 874

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 758 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 803



to top

>gb|AY128165.1| Melia dubia 26S ribosomal RNA gene, partial sequence
          Length = 875

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 759 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 804



to top

>gb|AY128164.1| Melia azedarach 26S ribosomal RNA gene, partial sequence
          Length = 875

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 759 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 804



to top

>gb|AY128158.1| Dysoxylum gaudichaudianum 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 802



to top

>gb|AY128157.1| Dysoxylum sp. Chase 1311 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 802



to top

>gb|AY128156.1| Cipadessa baccifera specimen-voucher Samuel7 26S ribosomal RNA
           gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 802



to top

>gb|AY128154.1| Chukrasia tabularis 26S ribosomal RNA gene, partial sequence
          Length = 875

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 759 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 804



to top

>gb|AY128153.1| Chisocheton macrophyllus 26S ribosomal RNA gene, partial sequence
          Length = 830

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 714 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 759



to top

>gb|AY128152.1| Cedrela odorata 26S ribosomal RNA gene, partial sequence
          Length = 874

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 758 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 803



to top

>gb|AY128151.1| Carapa guianensis 26S ribosomal RNA gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 802



to top

>gb|AY128150.1| Azadirachta indica specimen-voucher Samuel5 26S ribosomal RNA gene,
           partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 802



to top

>gb|AY128149.1| Azadirachta indica specimen-voucher Chase1307 26S ribosomal RNA
           gene, partial sequence
          Length = 873

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 757 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 802



to top

>gb|AY954474.1| Ranunculus cantoniensis 26S ribosomal RNA gene, partial sequence
          Length = 1322

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||| ||||| ||||||||||||||||||||
Sbjct: 996  taggtaggacggcgcggctacttcgctgagccgtgccacggaatcg 1041



to top

>dbj|AP008225.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
             fosmid clone:OSJNOa109J19
          Length = 30481

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 1     taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
             ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 30138 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 30183



 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 1     taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
             ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 22210 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 22255



 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 1     taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
             ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 14282 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 14327



 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 6354 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 6399



to top

>gb|AY056517.1| Lysimachia thyrsiflora 26S ribosomal RNA gene, partial sequence
          Length = 1178

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||||| ||||||||||||||||||||
Sbjct: 1024 taggtaggacggtgcggctgcttcgttgagccgtgccacggaatcg 1069



to top

>gb|AY056491.1| Ephedra sp. CR33 26S ribosomal RNA gene, partial sequence
          Length = 1153

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| |||||||||||||||||||||||| |||||||
Sbjct: 1000 taggtaagacggcgcggctgcttcggtgagccgtgccatggaatcg 1045



to top

>gb|AY056488.1| Ephedra sinica 26S ribosomal RNA gene, partial sequence
          Length = 1226

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| |||||||||||||||||||||||| |||||||
Sbjct: 1072 taggtaagacggcgcggctgcttcggtgagccgtgccatggaatcg 1117



to top

>gb|AF274670.1| Tetracentron sinense 26S ribosomal RNA gene, complete sequence
          Length = 3369

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1069 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1114



to top

>gb|AF274652.1| Lambertia inermis 26S ribosomal RNA gene, complete sequence
          Length = 3375

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1072 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1117



to top

>gb|DQ008659.1| Illicium floridanum 26S ribosomal RNA gene, partial sequence
          Length = 2067

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||||||  |||||||| || ||||||||||||||||||||
Sbjct: 419 taggtaggatggtgcggctgctccgttgagccgtgccacggaatcg 464



to top

>gb|DQ008644.1| Saruma henryi 26S ribosomal RNA gene, partial sequence
          Length = 3260

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1018 taggtaggacggcacggctgctccgttgagccgtgccacggaatcg 1063



to top

>gb|DQ008643.1| Asarum canadense 26S ribosomal RNA gene, partial sequence
          Length = 2247

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 918 taggtaggacggcacggctgctccgttgagccgtgccacggaatcg 963



to top

>gb|DQ008640.1| Houttuynia cordata 26S ribosomal RNA gene, partial sequence
          Length = 2922

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 995  taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1040



to top

>gb|DQ008616.1| Cissampelos pareira 26S ribosomal RNA gene, partial sequence
          Length = 2486

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 416 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 461



to top

>gb|DQ008612.1| Grevillea banksii 26S ribosomal RNA gene, partial sequence
          Length = 2458

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 388 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 433



to top

>gb|DQ008608.1| Didymeles perrieri 26S ribosomal RNA gene, partial sequence
          Length = 2056

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 413 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 458



to top

>gb|AF479245.1| Chloranthus japonicus 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||| |||||||| || ||||||| ||||||||||||
Sbjct: 1050 taggtaggatggcgcggctgctccgttgagccgcgccacggaatcg 1095



to top

>gb|AF479241.1| Swietenia macrophylla 26S ribosomal RNA gene, complete sequence
          Length = 3091

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1034 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 1079



to top

>gb|AF479206.1| Lambertia inermis 26S ribosomal RNA gene, complete sequence
          Length = 3361

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1058 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1103



to top

>gb|AF479205.1| Trochodendron aralioides 26S ribosomal RNA gene, complete sequence
          Length = 3355

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1055 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1100



to top

>gb|AF479197.1| Griselinia lucida 26S ribosomal RNA gene, complete sequence
          Length = 3354

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1051 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1096



to top

>gb|AF479195.1| Apium graveolens 26S ribosomal RNA gene, complete sequence
          Length = 3364

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1066 taggtaggacggcacggctgctttgttgagccgtgccacggaatcg 1111



to top

>gb|AF479190.1| Codonopsis pilosula 26S ribosomal RNA gene, complete sequence
          Length = 3327

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||  ||||||||||||||||||||
Sbjct: 1030 taggtaggacggcgcggctgcttcattgagccgtgccacggaatcg 1075



to top

>gb|AF479187.1| Corokia cotoneaster 26S ribosomal RNA gene, complete sequence
          Length = 3369

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||||||||||||||||
Sbjct: 1067 taggtaggacggcgcggctgctccgttgagccgtgccacggaatcg 1112



to top

>gb|AF479186.1| Nymphoides geminata 26S ribosomal RNA gene, complete sequence
          Length = 3200

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 896 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 941



to top

>gb|AF479181.1| Garrya elliptica 26S ribosomal RNA gene, complete sequence
          Length = 3358

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1055 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1100



to top

>gb|AF479160.1| Manilkara zapota 26S ribosomal RNA gene, complete sequence
          Length = 3349

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1046 taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1091



to top

>gb|AF479149.1| Anagallis tenella 26S ribosomal RNA gene, complete sequence
          Length = 3343

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1045 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1090



to top

>gb|AF479141.1| Byblis gigantea 26S ribosomal RNA gene, complete sequence
          Length = 3371

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1065 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1110



to top

>gb|AF479139.1| Cupaniopsis anacardioides 26S ribosomal RNA gene, partial sequence
          Length = 2990

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1054 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1099



to top

>gb|AF479138.1| Aesculus pavia 26S ribosomal RNA gene, complete sequence
          Length = 3365

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1060 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1105



to top

>gb|AF479137.1| Sterculia apetala 26S ribosomal RNA gene, complete sequence
          Length = 3366

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1063 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1108



to top

>gb|AF479129.1| Geranium sanguineum 26S ribosomal RNA gene, complete sequence
          Length = 3352

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||  ||||||||||||||||||||
Sbjct: 1048 taggtaggacggcacggctgcttcactgagccgtgccacggaatcg 1093



to top

>gb|AF479128.1| Elaeocarpus sphaericus 26S ribosomal RNA gene, partial sequence
          Length = 2883

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1050 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1095



to top

>gb|AF479127.1| Averrhoa carambola 26S ribosomal RNA gene, complete sequence
          Length = 3358

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1056 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1101



to top

>gb|AF479126.1| Sloanea berteriana 26S ribosomal RNA gene, complete sequence
          Length = 3345

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1041 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1086



to top

>gb|AF479123.1| Androstachys johnsonii 26S ribosomal RNA gene, partial sequence
          Length = 2881

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||||| ||||||||||||||||||||
Sbjct: 1047 taggtaggacggtgcggctgcttcgttgagccgtgccacggaatcg 1092



to top

>gb|AF479120.1| Medusagyne oppositifolia 26S ribosomal RNA gene, complete sequence
          Length = 3344

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1047 taggtaggacggcgcggctgcttcgatgagccgcgccacggaatcg 1092



to top

>gb|AF479119.1| Chrysobalanus icaco 26S ribosomal RNA gene, partial sequence
          Length = 1550

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1046 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1091



to top

>gb|AF479117.1| Idesia polycarpa 26S ribosomal RNA gene, complete sequence
          Length = 3341

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1043 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1088



to top

>gb|AF479115.1| Afrostyrax sp. Cheek 5007 26S ribosomal RNA gene, complete sequence
          Length = 3374

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1067 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1112



to top

>gb|AF479113.1| Euonymus alatus 26S ribosomal RNA gene, complete sequence
          Length = 3357

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1096



to top

>gb|AF479111.1| Hippocratea barbata 26S ribosomal RNA gene, complete sequence
          Length = 3371

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1065 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1110



to top

>gb|AF479109.1| Begonia metallica x Begonia sanguinea 26S ribosomal RNA gene,
            complete sequence
          Length = 3168

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1061 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1106



to top

>gb|AF479103.1| Spiraea betulifolia 26S ribosomal RNA gene, complete sequence
          Length = 3371

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1070 taggtaggacggcgcggctgcttcgctgagccgcgccacggaatcg 1115



to top

>gb|AF479101.1| Photinia fraseri 26S ribosomal RNA gene, complete sequence
          Length = 3371

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1067 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1112



to top

>gb|AF479098.1| Celtis yunnanensis 26S ribosomal RNA gene, complete sequence
          Length = 3344

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1062 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1107



to top

>gb|AF479095.1| Opilia amentacea 26S ribosomal RNA gene, complete sequence
          Length = 3351

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 1049 taggtaggacggcgcggctgctttgctgagccgtgccacggaatcg 1094



to top

>dbj|AP008245.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0013K10
          Length = 129118

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 1     taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
             ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 29866 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 29911



 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 1     taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
             ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 21938 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 21983



 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                           
Query: 1     taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
             ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 14010 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 14055



 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 6082 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 6127



to top

>gb|AY177422.1| Elaeocarpus sphaericus 26S ribosomal RNA gene, complete sequence
          Length = 2801

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1050 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1095



to top

>gb|AY177421.1| Bursera inaguensis 26S ribosomal RNA gene, complete sequence
          Length = 3317

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1057 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1102



to top

>dbj|D17770.1|RIC49306 Oryza sativa gene for 25S ribosomal RNA, partial sequence
          Length = 359

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 154 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 199



to top

>dbj|AK119812.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-177-A02, full
           insert sequence
          Length = 2780

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 179 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 224



to top

>dbj|AK119809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-H02, full
           insert sequence
          Length = 3078

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 292 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 337



to top

>dbj|AK119884.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-179-G12, full
           insert sequence
          Length = 2472

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 292 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 337



to top

>dbj|AK119442.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-133-C06, full
           insert sequence
          Length = 3234

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 542 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 587



to top

>dbj|AK111206.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-178-F11, full
           insert sequence
          Length = 2430

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 293 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 338



to top

>dbj|AK111153.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-176-F12, full
           insert sequence
          Length = 2816

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 294 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 339



to top

>dbj|AK110422.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A07,
          full insert sequence
          Length = 3130

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                        
Query: 1  taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
          ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 53 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 98



to top

>dbj|AK110354.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-H10,
          full insert sequence
          Length = 2515

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                        
Query: 1  taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
          ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 5  taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 50



to top

>dbj|AK110338.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-F03, full
           insert sequence
          Length = 2885

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 158 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 203



to top

>dbj|AK110317.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-164-C07, full
           insert sequence
          Length = 2440

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 274 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 319



to top

>dbj|AK110187.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-162-A01, full
           insert sequence
          Length = 3553

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 173 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 218



to top

>dbj|AK110009.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G06, full
           insert sequence
          Length = 2893

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 506 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 551



to top

>dbj|AK110007.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-G04, full
           insert sequence
          Length = 3066

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 908 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 953



to top

>dbj|AK110001.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-F08, full
           insert sequence
          Length = 3069

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 637 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 682



to top

>dbj|AK109970.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-159-C05, full
           insert sequence
          Length = 3259

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 299 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 344



to top

>dbj|AK109482.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-E11, full
            insert sequence
          Length = 1835

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 966  taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 1011



to top

>dbj|AK107288.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-B08, full
           insert sequence
          Length = 1407

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 239 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 284



to top

>dbj|AK106912.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-A08,
          full insert sequence
          Length = 1640

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                        
Query: 1  taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
          ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 5  taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 50



to top

>dbj|AK106032.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-D04, full
           insert sequence
          Length = 1376

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 294 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 339



to top

>dbj|AK105535.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-H02, full
           insert sequence
          Length = 1576

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 368 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 413



to top

>dbj|AK105407.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-F01, full
           insert sequence
          Length = 2644

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 239 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 284



to top

>dbj|AK105300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H11, full
           insert sequence
          Length = 1765

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 177 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 222



to top

>dbj|AK105251.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-C11, full
           insert sequence
          Length = 1965

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 404 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 449



to top

>dbj|AK063958.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-G03, full
           insert sequence
          Length = 1737

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 291 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 336



to top

>dbj|AK063948.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-F02,
          full insert sequence
          Length = 1697

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                        
Query: 1  taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
          ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 5  taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 50



to top

>dbj|AK063480.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-B09, full
           insert sequence
          Length = 1382

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 159 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 204



to top

>dbj|AK063372.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-114-E06, full
           insert sequence
          Length = 1529

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 690 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 735



to top

>dbj|AK063268.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-113-B06,
          full insert sequence
          Length = 1742

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                        
Query: 1  taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
          ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 5  taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 50



to top

>dbj|AK060671.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-028-G06, full
           insert sequence
          Length = 1505

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 193 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 238



to top

>dbj|AK060366.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A05, full
           insert sequence
          Length = 1394

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 189 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 234



to top

>dbj|AK059583.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-B07, full
           insert sequence
          Length = 1018

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                         
Query: 1   taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
           ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 351 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 396



to top

>gb|AF036492.1|AF036492 Plumbago auriculata large subunit 26S ribosomal RNA gene, partial
            sequence
          Length = 3354

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1062 taggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1107



to top

>gb|U52619.1|AQU52619 Anemone quinquefolia nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1047

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||| ||||| ||||||||||||||||||||
Sbjct: 995  taggtaggacggcgcggctacttcgctgagccgtgccacggaatcg 1040



to top

>gb|U52618.1|ATU52618 Anemone trifolia nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1048

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||| ||||| ||||||||||||||||||||
Sbjct: 996  taggtaggacggcgcggctacttcgctgagccgtgccacggaatcg 1041



to top

>gb|U52602.1|VHU52602 Vancouveria hexandra nuclear 26S ribosomal RNA gene, partial sequence
          Length = 1047

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||||||||||||||||
Sbjct: 995  taggtaggacggcgcggctgctttgttgagccgtgccacggaatcg 1040



to top

>gb|M11585.1|RICRGHA Rice 25S ribosomal RNA gene
          Length = 3377

 Score = 60.0 bits (30), Expect = 4e-07
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| |||||||||| ||||||||||||
Sbjct: 1057 taggtaggacggcgcggctgctccggtgagccgcgccacggaatcg 1102



to top

>gb|AY755717.1| Ephedra torreyana voucher (S) 04-487 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            |||||||||||||||||||||||| |||||||
Sbjct: 1075 cggctgcttcggtgagccgtgccanggaatcg 1106



to top

>gb|AY189058.1| Daucus carota 26S large subunit ribosomal RNA gene, partial sequence
          Length = 3308

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatc 45
            ||||||||| ||| ||||||||||  |||||||||||||||||||
Sbjct: 1031 taggtaggacggcgcggctgcttcattgagccgtgccacggaatc 1075



to top

>gb|AY189028.1| Aciphylla aurea 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3308

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatc 45
            ||||||||| ||| ||||||||||  |||||||||||||||||||
Sbjct: 1031 taggtaggacggcgcggctgcttcattgagccgtgccacggaatc 1075



to top

>gb|AF479180.1| Exacum affine 26S ribosomal RNA gene, complete sequence
          Length = 3352

 Score = 58.0 bits (29), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                         
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatc 45
            ||||||||| ||| |||||||| || |||||||||||||||||||
Sbjct: 1054 taggtaggacggcgcggctgctccgttgagccgtgccacggaatc 1098



to top

>gb|AY755726.1| Ephedra tweediana voucher (UC) 66-0742 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgcgccacggaatcg 1106



to top

>gb|AY755725.1| Ephedra chilensis voucher (UC) 49-0542 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgcgccacggaatcg 1106



to top

>gb|AY755723.1| Ephedra rupestris voucher (UC) 87-1368 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgcgccacggaatcg 1106



to top

>gb|AY755715.1| Ephedra antisyphilitica voucher (S) 04-488 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||||| ||||||||||
Sbjct: 1075 cggctgcttcggtgagccgtgtcacggaatcg 1106



to top

>gb|AY755712.1| Ephedra chilensis voucher (E) E00130260 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgcgccacggaatcg 1106



to top

>gb|AY755708.1| Ephedra californica voucher (O) 68-154 26S ribosomal RNA gene,
            partial sequence
          Length = 1216

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1076 cggctgcttcggtgagccgcgccacggaatcg 1107



to top

>gb|AY755707.1| Ephedra andina voucher (K) 10140 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgcgccacggaatcg 1106



to top

>gb|AY755706.1| Ephedra frustillata voucher (S) 04-482 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1075 cggctgcttcggtgagccgcgccacggaatcg 1106



to top

>gb|AY727959.1| Maesa japonica 26S ribosomal RNA gene, partial sequence
          Length = 3333

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 3    ggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||| ||| ||||||||||| ||||||| ||||||||||||
Sbjct: 1053 ggtaggacggcgcggctgcttcgttgagccgcgccacggaatcg 1096



to top

>gb|AY056490.1| Ephedra frustillata 26S ribosomal RNA gene, partial sequence
          Length = 1225

 Score = 56.0 bits (28), Expect = 6e-06
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                            
Query: 15   cggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||||||||||||| ||||||||||||
Sbjct: 1085 cggctgcttcggtgagccgcgccacggaatcg 1116



to top

>gb|AY755738.1| Ephedra pachyclada voucher (S) C-7844 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755736.1| Ephedra campylopoda voucher (S) C-7605 26S ribosomal RNA gene,
            partial sequence
          Length = 1216

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1062 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1107



to top

>gb|AY755735.1| Ephedra ciliata voucher (S) C-591 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755734.1| Ephedra foliata voucher (S) C-7808 26S ribosomal RNA gene, partial
            sequence
          Length = 1206

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755732.1| Ephedra alata voucher (S) C-303 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcacggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755731.1| Ephedra altissima voucher (S) C-7688 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755730.1| Ephedra altissima voucher (S) C-628 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755728.1| Ephedra equisetina voucher (S) C-465-2 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755727.1| Ephedra distachya voucher (S) 03-684 26S ribosomal RNA gene, partial
            sequence
          Length = 1211

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755724.1| Ephedra likiangensis voucher (UC) 94-0389 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755721.1| Ephedra procera voucher (Mo) 01903487 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755719.1| Ephedra distachya voucher (S) 04-481 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755718.1| Ephedra gerardiana voucher (O) 74-460 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755714.1| Ephedra minuta voucher (S) 04-486 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755713.1| Ephedra minuta voucher (S) 04-485 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755711.1| Ephedra gerardiana voucher (E) E00130259 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755710.1| Ephedra fragilis voucher (E) E00130258 26S ribosomal RNA gene,
            partial sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755709.1| Ephedra equisetina voucher (O) 90-536 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY755705.1| Ephedra equisetina voucher (S) 03-926 26S ribosomal RNA gene, partial
            sequence
          Length = 1215

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            |||||| || ||| ||||||||||||||||||| |||| |||||||
Sbjct: 1061 taggtaagacggcgcggctgcttcggtgagccgcgccatggaatcg 1106



to top

>gb|AY423083.1| Calceolaria arachnoidea isolate DNA-CW6 26S ribosomal RNA gene,
            partial sequence
          Length = 1190

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| |||| |||||||
Sbjct: 1066 taggtaggacggcgcggctgcttcgttgagccgcgccagggaatcg 1111



to top

>gb|AY423082.1| Peltanthera floribunda isolate DNA-CW9 26S ribosomal RNA gene,
            partial sequence
          Length = 1190

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || |||||||||||| |||||||
Sbjct: 1066 taggtaggacggcgcggctgctccgttgagccgtgccaaggaatcg 1111



to top

>gb|AY423079.1| Paulownia tomentosa isolate DNA-CW1 26S ribosomal RNA gene, partial
            sequence
          Length = 1190

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| |||| |||||||
Sbjct: 1066 taggtaggacggcgcggctgcttcgttgagccgcgccagggaatcg 1111



to top

>gb|AY423078.1| Tetranema mexicanum isolate DNA-CW5 26S ribosomal RNA gene, partial
            sequence
          Length = 1190

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | |||||||||||| |||||||
Sbjct: 1066 taggtaggacggcgcggctgctttgttgagccgtgccagggaatcg 1111



to top

>gb|AY530925.1| Cornus chinensis 26S ribosomal RNA gene, complete sequence
          Length = 3329

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1031 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1076



to top

>gb|AF389273.1| Eubrachion ambiguum 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| |||| |||||||
Sbjct: 1054 taggtaggacggcgcggctgcttcgttgagccgggccatggaatcg 1099



to top

>gb|AF389270.1| Xanthorhiza simplicissima 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1096



to top

>gb|AF389267.1| Glaucidium palmatum 26S ribosomal RNA gene, partial sequence
          Length = 3337

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  |||||||| || ||||||||||||||||||||
Sbjct: 1052 taggtaggacggtgcggctgctccgttgagccgtgccacggaatcg 1097



to top

>gb|AF389266.1| Coptis trifolia 26S ribosomal RNA gene, partial sequence
          Length = 3338

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||| ||||||||||||
Sbjct: 1051 taggtaggacggcacggctgctttgttgagccgcgccacggaatcg 1096



to top

>gb|AF389265.1| Roupala macrophylla 26S ribosomal RNA gene, partial sequence
          Length = 3344

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| |||  |||||||||| ||||||| ||||||||||||
Sbjct: 1058 taggtaggacggcgtggctgcttcgttgagccgcgccacggaatcg 1103



to top

>gb|AF389262.1| Dicentra eximia 26S ribosomal RNA gene, partial sequence
          Length = 3341

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1054 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1099



to top

>gb|AF389261.1| Schoepfia schreberi 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||| | ||||||||||||||||||||
Sbjct: 1052 taggtaggacggtgcggctgctttgttgagccgtgccacggaatcg 1097



to top

>gb|AF389260.1| Nepenthes sp. Nickrent 3056 26S ribosomal RNA gene, partial sequence
          Length = 3325

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| | ||||||||||
Sbjct: 1050 taggtaggacggcgcggctgcttcgttgagccgcggcacggaatcg 1095



to top

>gb|AF389257.1| Menispermum canadense 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| |||  |||||||||| |||||| |||||||||||||
Sbjct: 1054 taggtaggacggcgtggctgcttcgttgagccatgccacggaatcg 1099



to top

>gb|AF389256.1| Magnolia denudata 26S ribosomal RNA gene, partial sequence
          Length = 3340

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||| ||||||||
Sbjct: 1053 taggtaggacggcgcggctgcttcgctgagccgcgcctcggaatcg 1098



to top

>gb|AF389254.1| Decaisnea fargesii 26S ribosomal RNA gene, partial sequence
          Length = 3342

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1053 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1098



to top

>gb|AF389253.1| Akebia quinata 26S ribosomal RNA gene, partial sequence
          Length = 3341

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  |||||||| || ||||||||||||||||||||
Sbjct: 1053 taggtaggacggtgcggctgctccgttgagccgtgccacggaatcg 1098



to top

>gb|AF389252.1| Philadelphus lewisii 26S ribosomal RNA gene, partial sequence
          Length = 3332

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||| ||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgctttgttgagccgcgccacggaatcg 1096



to top

>gb|AF389248.1| Drosera capensis 26S ribosomal RNA gene, partial sequence
          Length = 3334

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| |||||||||||| || |||||||||||  |||||||
Sbjct: 1056 taggtaggacggctcggctgctccgttgagccgtgccgtggaatcg 1101



to top

>gb|AF389245.1| Kingdonia uniflora 26S ribosomal RNA gene, partial sequence
          Length = 3336

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||| ||||||| ||| ||||||||
Sbjct: 1049 taggtaggacggcgcggctgcttcgatgagccgcgccgcggaatcg 1094



to top

>gb|AF389243.1| Buxus sempervirens 26S ribosomal RNA gene, partial sequence
          Length = 3319

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1034 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1079



to top

>gb|AF389241.1| Nandina domestica 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1053 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1098



to top

>gb|AF389240.1| Caulophyllum thalictroides 26S ribosomal RNA gene, partial sequence
          Length = 3339

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||||| || ||||||| ||||||||||||
Sbjct: 1051 taggtaggacggcgcggctgctccgttgagccgcgccacggaatcg 1096



to top

>gb|AY189150.1| Petroselinum crispum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3283

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||||  ||||| ||||||||||||||
Sbjct: 1031 taggtaggacggcacggctgcttcattgagctgtgccacggaatcg 1076



to top

>gb|AY189074.1| Heteromorpha trifoliata 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3295

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| |||||| |||| ||||||| ||||||||||||
Sbjct: 1032 taggtaggacggcgcggctggttcgctgagccgcgccacggaatcg 1077



to top

>gb|AY189067.1| Eremocharis fruticosa 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3285

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||| ||||||||| | ||||||| ||||||||||||
Sbjct: 1032 taggtaggacggcgcggctgctttgttgagccgcgccacggaatcg 1077



to top

>gb|AY189056.1| Coriandrum sativum 26S large subunit ribosomal RNA gene, partial
            sequence
          Length = 3310

 Score = 52.0 bits (26), Expect = 1e-04
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 1    taggtaggatggctcggctgcttcggtgagccgtgccacggaatcg 46
            ||||||||| ||  ||||||||||| ||||||| ||||||||||||
Sbjct: 1031 taggtaggacggtgcggctgcttcgttgagccgcgccacggaatcg 1076


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 130,411
Number of Sequences: 3902068
Number of extensions: 130411
Number of successful extensions: 33548
Number of sequences better than 10.0: 644
Number of HSP's better than 10.0 without gapping: 630
Number of HSP's successfully gapped in prelim test: 14
Number of HSP's that attempted gapping in prelim test: 32893
Number of HSP's gapped (non-prelim): 669
length of query: 46
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 26
effective length of database: 17,155,003,908
effective search space: 446030101608
effective search space used: 446030101608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top