ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast23f11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL773560.9| Pig DNA sequence from clone XX-514B12, complete ... 38 1.3
2gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 36 5.3
3ref|XM_742921.1| Aspergillus fumigatus Af293 hypothetical protei... 36 5.3
4emb|AL512770.21| Human DNA sequence from clone RP11-186N15 on ch... 36 5.3
5gb|AC164113.3| Mus musculus BAC clone RP24-228K9 from chromosome... 36 5.3
6gb|AF242862.1|AF242862S1 Homo sapiens coxsackie virus and adenov... 36 5.3
7dbj|BS000035.1| Pan troglodytes chromosome 22 clone:PTB-089G12, ... 36 5.3
8gb|AF200465.1|AF200465 Homo sapiens coxsackievirus and adenoviru... 36 5.3
9dbj|AP001670.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 36 5.3
10dbj|AP000963.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 36 5.3

>emb|AL773560.9| Pig DNA sequence from clone XX-514B12, complete sequence
          Length = 107413

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     ccgcctccaccccccgaac 21
             |||||||||||||||||||
Sbjct: 11516 ccgcctccaccccccgaac 11498



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 11      accccccgaactccaaac 28
               ||||||||||||||||||
Sbjct: 2781574 accccccgaactccaaac 2781557



to top

>ref|XM_742921.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g03290) partial
            mRNA
          Length = 1701

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                  
Query: 8    tccaccccccgaactccaaacc 29
            |||||||||||||| |||||||
Sbjct: 1257 tccaccccccgaacaccaaacc 1278



to top

>emb|AL512770.21| Human DNA sequence from clone RP11-186N15 on chromosome 10 Contains the
              5' end of the NUDT5 gene for nudix (nucleoside diphosphate
              linked moiety X)-type motif 5, the gene for D123 gene
              product, a novel gene and a CpG island, complete sequence
          Length = 125146

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 1      ctccgcctccaccccccg 18
              ||||||||||||||||||
Sbjct: 121440 ctccgcctccaccccccg 121457



to top

>gb|AC164113.3| Mus musculus BAC clone RP24-228K9 from chromosome 15, complete sequence
          Length = 147934

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 23    ccaaaccctagtagctgc 40
             ||||||||||||||||||
Sbjct: 82444 ccaaaccctagtagctgc 82427



to top

>gb|AF242862.1|AF242862S1 Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene,
            exon 1
          Length = 10651

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 1    ctccgcctccaccccccg 18
            ||||||||||||||||||
Sbjct: 4314 ctccgcctccaccccccg 4297



to top

>dbj|BS000035.1| Pan troglodytes chromosome 22 clone:PTB-089G12, map 22, complete
              sequences
          Length = 225055

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      ctccgcctccaccccccg 18
              ||||||||||||||||||
Sbjct: 156297 ctccgcctccaccccccg 156280



to top

>gb|AF200465.1|AF200465 Homo sapiens coxsackievirus and adenovirus receptor (CXADR) gene,
             complete cds; and ANA gene, partial cds
          Length = 121798

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     ctccgcctccaccccccg 18
             ||||||||||||||||||
Sbjct: 30590 ctccgcctccaccccccg 30573



to top

>dbj|AP001670.1| Homo sapiens genomic DNA, chromosome 21q, section 14/105
          Length = 340000

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      ctccgcctccaccccccg 18
              ||||||||||||||||||
Sbjct: 143150 ctccgcctccaccccccg 143133



to top

>dbj|AP000963.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B827P19,
             LL56-APP region, complete sequence
          Length = 61926

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     ctccgcctccaccccccg 18
             ||||||||||||||||||
Sbjct: 51540 ctccgcctccaccccccg 51523


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 251,074
Number of Sequences: 3902068
Number of extensions: 251074
Number of successful extensions: 79396
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79322
Number of HSP's gapped (non-prelim): 74
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top