| Clone Name | bast23f11 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL773560.9| Pig DNA sequence from clone XX-514B12, complete sequence Length = 107413 Score = 38.2 bits (19), Expect = 1.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 3 ccgcctccaccccccgaac 21 ||||||||||||||||||| Sbjct: 11516 ccgcctccaccccccgaac 11498
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 11 accccccgaactccaaac 28 |||||||||||||||||| Sbjct: 2781574 accccccgaactccaaac 2781557
>ref|XM_742921.1| Aspergillus fumigatus Af293 hypothetical protein (Afu5g03290) partial mRNA Length = 1701 Score = 36.2 bits (18), Expect = 5.3 Identities = 21/22 (95%) Strand = Plus / Plus Query: 8 tccaccccccgaactccaaacc 29 |||||||||||||| ||||||| Sbjct: 1257 tccaccccccgaacaccaaacc 1278
>emb|AL512770.21| Human DNA sequence from clone RP11-186N15 on chromosome 10 Contains the 5' end of the NUDT5 gene for nudix (nucleoside diphosphate linked moiety X)-type motif 5, the gene for D123 gene product, a novel gene and a CpG island, complete sequence Length = 125146 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 ctccgcctccaccccccg 18 |||||||||||||||||| Sbjct: 121440 ctccgcctccaccccccg 121457
>gb|AC164113.3| Mus musculus BAC clone RP24-228K9 from chromosome 15, complete sequence Length = 147934 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 23 ccaaaccctagtagctgc 40 |||||||||||||||||| Sbjct: 82444 ccaaaccctagtagctgc 82427
>gb|AF242862.1|AF242862S1 Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exon 1 Length = 10651 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 ctccgcctccaccccccg 18 |||||||||||||||||| Sbjct: 4314 ctccgcctccaccccccg 4297
>dbj|BS000035.1| Pan troglodytes chromosome 22 clone:PTB-089G12, map 22, complete sequences Length = 225055 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 ctccgcctccaccccccg 18 |||||||||||||||||| Sbjct: 156297 ctccgcctccaccccccg 156280
>gb|AF200465.1|AF200465 Homo sapiens coxsackievirus and adenovirus receptor (CXADR) gene, complete cds; and ANA gene, partial cds Length = 121798 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 ctccgcctccaccccccg 18 |||||||||||||||||| Sbjct: 30590 ctccgcctccaccccccg 30573
>dbj|AP001670.1| Homo sapiens genomic DNA, chromosome 21q, section 14/105 Length = 340000 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 ctccgcctccaccccccg 18 |||||||||||||||||| Sbjct: 143150 ctccgcctccaccccccg 143133
>dbj|AP000963.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B827P19, LL56-APP region, complete sequence Length = 61926 Score = 36.2 bits (18), Expect = 5.3 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 ctccgcctccaccccccg 18 |||||||||||||||||| Sbjct: 51540 ctccgcctccaccccccg 51523 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 251,074 Number of Sequences: 3902068 Number of extensions: 251074 Number of successful extensions: 79396 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 79322 Number of HSP's gapped (non-prelim): 74 length of query: 44 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 24 effective length of database: 17,155,003,908 effective search space: 411720093792 effective search space used: 411720093792 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)