ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast18f12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_468448.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.061
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.061
3dbj|AP004020.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.061
4dbj|AP004878.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.061
5dbj|AK103477.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.061
6dbj|AK071291.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.061
7emb|AL121749.14|HSBA425A6 Human DNA sequence from clone RP11-425... 44 0.24
8emb|AL110115.38|HSJ324O17 Human DNA sequence from clone RP3-324O... 44 0.24
9emb|BX647112.1|HSM807256 Homo sapiens genomic DNA; cDNA DKFZp686... 44 0.24
10gb|AC091776.19| Chlamydomonas reinhardtii clone cr-4i21, complet... 44 0.24
11gb|AC087726.36| Chlamydomonas reinhardtii clone cr-40a20, comple... 44 0.24
12gb|AC084043.4|AC084043 Mus musculus 1 BAC RP23-265D16 (Roswell P... 44 0.24
13gb|AC124989.7| Mus musculus chromosome 1, clone RP24-404O8, comp... 44 0.24
14gb|AC115893.10| Mus musculus chromosome 1, clone RP24-442I13, co... 44 0.24
15ref|XM_468248.1| Oryza sativa (japonica cultivar-group), mRNA 42 0.95
16gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, compl... 42 0.95
17gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 0.95
18gb|AC163027.5| Mus musculus chromosome 5, clone RP23-396H22, com... 42 0.95
19gb|AY335946.1| Homo sapiens homeodomain protein IRXB3 (IRX6) gen... 42 0.95
20emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 0.95
21gb|AC136964.2| Sus scrofa domestica clone RP44-154L9, complete s... 42 0.95
22emb|AL672026.11| Mouse DNA sequence from clone RP23-403O11 on ch... 42 0.95
23gb|AC109462.2| Homo sapiens chromosome 16 clone RP11-26L20, comp... 42 0.95
24gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 0.95
25gb|AC092722.5| Homo sapiens chromosome 16 clone RP11-517M14, com... 42 0.95
26gb|AC104564.11| Homo sapiens chromosome 17, clone RP11-68I3, com... 42 0.95
27ref|XM_220754.3| PREDICTED: Rattus norvegicus proteasome (prosom... 42 0.95
28gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 0.95
29emb|BX649462.9| Mouse DNA sequence from clone RP23-324J22 on chr... 42 0.95
30dbj|AP004094.3| Oryza sativa (japonica cultivar-group) genomic D... 42 0.95
31gb|AF466203.1| Zea mays clone ZMBBb_0092E12, partial sequence 42 0.95
32gb|AY495827.1| Oryctolagus cuniculus clone 179L1 kappa 1 light c... 42 0.95
33gb|AC118599.24| Mus musculus chromosome 5, clone RP23-459G5, com... 42 0.95
34ref|XM_510740.1| PREDICTED: Pan troglodytes similar to RAB26, me... 40 3.7
35gb|BT016767.1| Zea mays clone Contig600 mRNA sequence 40 3.7
36gb|AC005346.1| Homo sapiens chromosome 16, cosmid clone 2H2 (LAN... 40 3.7
37gb|BC046830.1| Mus musculus mahogunin, ring finger 1, mRNA (cDNA... 40 3.7
38ref|XM_957415.1| Neurospora crassa OR74A hypothetical protein (N... 40 3.7
39ref|XM_329000.1| Neurospora crassa OR74A hypothetical protein (N... 40 3.7
40ref|NM_029657.2| Mus musculus mahogunin, ring finger 1 (Mgrn1), ... 40 3.7
41gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome ... 40 3.7
42ref|XM_916469.1| PREDICTED: Mus musculus similar to autoantigen ... 40 3.7
43ref|XM_805163.1| Trypanosoma cruzi strain CL Brener serine/threo... 40 3.7
44ref|XM_811978.1| Trypanosoma cruzi strain CL Brener serine/threo... 40 3.7
45emb|CT009506.5| Pig DNA sequence from clone CH242-216I3 on chrom... 40 3.7
46gb|AC165244.2| Mus musculus BAC clone RP24-498C9 from chromosome... 40 3.7
47emb|AL354919.16| Human DNA sequence from clone RP11-84A19 on chr... 40 3.7
48emb|AL160411.25| Human DNA sequence from clone RP4-726N1 on chro... 40 3.7
49emb|AL121776.19|HSJ1050K3 Human DNA sequence from clone RP5-1050... 40 3.7
50gb|AC139256.5| Homo sapiens chromosome 16 clone RP11-1186N24, co... 40 3.7
51gb|AC005013.3| Homo sapiens BAC clone GS1-165L15 from 7, complet... 40 3.7
52gb|BC026316.1| Homo sapiens cDNA clone IMAGE:4792261 40 3.7
53gb|AC091013.7| Homo sapiens chromosome 11, clone RP11-379P15, co... 40 3.7
54gb|L39891.1|HUMPKD1GEN Homo sapiens polycystic kidney disease-as... 40 3.7
55gb|U24498.1|HSU24498 Human autosomal dominant polycystic kidney ... 40 3.7
56gb|CP000249.1| Frankia sp. CcI3, complete genome 40 3.7
57gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 3.7
58gb|AC006549.28| Homo sapiens chromosome 22 clone p215k21 map 22q... 40 3.7
59gb|AC058790.14| Homo sapiens chromosome 22 clone b518b9 map 22q1... 40 3.7
60gb|AC007663.29| Homo sapiens chromosome 22 clone b444p24 map 22q... 40 3.7
61gb|AC009995.9|AC009995 Homo sapiens chromosome 8, clone RP11-373... 40 3.7
62ref|NG_002799.1| Homo sapiens polycystic kidney disease 1 (autos... 40 3.7
63gb|AC010616.5|AC010616 Homo sapiens chromosome 19 clone CTD-2575... 40 3.7
64dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
65gb|AC092137.3| Homo sapiens chromosome 16 clone RP11-344H15, com... 40 3.7
66dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
67gb|AC103831.4| Homo sapiens chromosome 8, clone RP11-1023P17, co... 40 3.7
68gb|AC009065.8| Homo sapiens chromosome 16 clone RP11-304L19, com... 40 3.7
69gb|AC093378.5| Homo sapiens BAC clone RP11-296O15 from 2, comple... 40 3.7
70gb|AC114771.3| Homo sapiens BAC clone RP11-425I13 from 4, comple... 40 3.7
71dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 3.7
72dbj|AP005128.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
73dbj|AP003575.2| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
74emb|AJ277661.1|HSA277661 Homo sapiens partial LMO1 gene for LIM ... 40 3.7
75emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 40 3.7
76gb|AY104032.1| Zea mays PCO099184 mRNA sequence 40 3.7
77emb|CT009654.2| Medicago truncatula chromosome 5 clone mth2-17c1... 40 3.7
78gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone ... 40 3.7
79gb|AC132228.3| Mus musculus BAC clone RP24-480G11 from 6, comple... 40 3.7
80gb|AC129323.6| Mus musculus BAC clone RP23-237M15 from 9, comple... 40 3.7
81gb|AF031542.1|AF031542 Fritillaria agrestis ribosomal protein L2... 40 3.7
82emb|CR974477.12| Pig DNA sequence from clone CH242-217L7 on chro... 40 3.7
83emb|AL663092.15| Mouse DNA sequence from clone RP23-91I20 on chr... 40 3.7
84gb|M77189.1|RHBCYTC Bradyrhizobium japonicum cytochrome c (cycM)... 40 3.7 
>ref|XM_468448.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 921

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 225 aggggccgtggcggcggcaggggtgggggaaggggtggc 263
           |||||||||||||||||| | ||||| || |||||||||
Sbjct: 145 aggggccgtggcggcggccgcggtggcgggaggggtggc 183
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 225      aggggccgtggcggcggcaggggtgggggaaggggtggc 263
                |||||||||||||||||| | ||||| || |||||||||
Sbjct: 35290420 aggggccgtggcggcggccgcggtggcgggaggggtggc 35290458



 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 232      gtggcggcggcaggggtgggg 252
                |||||||||||||||||||||
Sbjct: 33810472 gtggcggcggcaggggtgggg 33810492
to top
>dbj|AP004020.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1119_A01
          Length = 108727

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 225   aggggccgtggcggcggcaggggtgggggaaggggtggc 263
             |||||||||||||||||| | ||||| || |||||||||
Sbjct: 40754 aggggccgtggcggcggccgcggtggcgggaggggtggc 40792
to top
>dbj|AP004878.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0474F11
          Length = 139544

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                     
Query: 225    aggggccgtggcggcggcaggggtgggggaaggggtggc 263
              |||||||||||||||||| | ||||| || |||||||||
Sbjct: 102470 aggggccgtggcggcggccgcggtggcgggaggggtggc 102508
to top
>dbj|AK103477.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033130D23, full
           insert sequence
          Length = 1824

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 225 aggggccgtggcggcggcaggggtgggggaaggggtggc 263
           |||||||||||||||||| | ||||| || |||||||||
Sbjct: 237 aggggccgtggcggcggccgcggtggcgggaggggtggc 275
to top
>dbj|AK071291.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088O08, full
           insert sequence
          Length = 1077

 Score = 46.1 bits (23), Expect = 0.061
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 225 aggggccgtggcggcggcaggggtgggggaaggggtggc 263
           |||||||||||||||||| | ||||| || |||||||||
Sbjct: 123 aggggccgtggcggcggccgcggtggcgggaggggtggc 161
to top
>emb|AL121749.14|HSBA425A6 Human DNA sequence from clone RP11-425A6 on chromosome 10 Contains the 3'
              end of the gene for cyclin fold protein 1 (CFP1) (CBCP1),
              the gene for connexin40.1 (CX40.1) (FLJ90023), the FZD8
              gene for frizzled homolog 8 (Drosophila) and two CpG
              islands, complete sequence
          Length = 166007

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 212    ccgcagcggcggcaggggccgtggcggcgg 241
              |||| |||||||||||||| ||||||||||
Sbjct: 131027 ccgcggcggcggcaggggcggtggcggcgg 130998
to top
>emb|AL110115.38|HSJ324O17 Human DNA sequence from clone RP3-324O17 on chromosome 20 Contains the
             5' end of the ID1 gene for inhibitor of DNA binding 1,
             dominant negative helix-loop-helix protein, two novel
             genes, the 3' end of the HM13 gene for histocompatibility
             (minor) 13 an MCT-1 (multiple copies in a T-cell
             malignancies) pseudogene and five CpG islands, complete
             sequence
          Length = 79419

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 239   cggcaggggtgggggaaggggt 260
             ||||||||||||||||||||||
Sbjct: 23766 cggcaggggtgggggaaggggt 23745
to top
>emb|BX647112.1|HSM807256 Homo sapiens genomic DNA; cDNA DKFZp686O07111 (from clone
            DKFZp686O07111)
          Length = 5905

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 239  cggcaggggtgggggaaggggt 260
            ||||||||||||||||||||||
Sbjct: 2757 cggcaggggtgggggaaggggt 2736
to top
>gb|AC091776.19| Chlamydomonas reinhardtii clone cr-4i21, complete sequence
          Length = 48498

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 217 gcggcggcaggggccgtggcggcggcaggggtgggggaaggggtgg 262
           |||||||||||||| | ||||||||| | || ||||| ||||||||
Sbjct: 887 gcggcggcaggggcggcggcggcggcggtggcgggggcaggggtgg 842
to top
>gb|AC087726.36| Chlamydomonas reinhardtii clone cr-40a20, complete sequence
          Length = 168794

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 217    gcggcggcaggggccgtggcggcggcaggggtgggggaaggggtgg 262
              |||||||||||||| | ||||||||| | || ||||| ||||||||
Sbjct: 148400 gcggcggcaggggcggcggcggcggcggtggcgggggcaggggtgg 148355
to top
>gb|AC084043.4|AC084043 Mus musculus 1 BAC RP23-265D16 (Roswell Park Cancer Institute Mouse BAC
             Library) complete sequence
          Length = 63324

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 217   gcggcggcaggggccgtggcggcggcaggggtggggga 254
             |||||||||| ||| | ||||||||| |||||||||||
Sbjct: 39641 gcggcggcagcggcagcggcggcggcgggggtggggga 39604
to top
>gb|AC124989.7| Mus musculus chromosome 1, clone RP24-404O8, complete sequence
          Length = 184453

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 217    gcggcggcaggggccgtggcggcggcaggggtggggga 254
              |||||||||| ||| | ||||||||| |||||||||||
Sbjct: 121886 gcggcggcagcggcagcggcggcggcgggggtggggga 121923
to top
>gb|AC115893.10| Mus musculus chromosome 1, clone RP24-442I13, complete sequence
          Length = 153053

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 217   gcggcggcaggggccgtggcggcggcaggggtggggga 254
             |||||||||| ||| | ||||||||| |||||||||||
Sbjct: 19074 gcggcggcagcggcagcggcggcggcgggggtggggga 19111
to top
>ref|XM_468248.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4176

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 232  gtggcggcggcaggggtgggg 252
            |||||||||||||||||||||
Sbjct: 1978 gtggcggcggcaggggtgggg 1958
to top
>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome
          Length = 943016

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 217    gcggcggcaggggccgtggcg 237
              |||||||||||||||||||||
Sbjct: 497394 gcggcggcaggggccgtggcg 497374
to top
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 210   ggccgcagcggcggcaggggccgtggcggcggc 242
             |||||| |||||||||| ||| |||||||||||
Sbjct: 36139 ggccgcggcggcggcagcggcggtggcggcggc 36171
to top
>gb|AC163027.5| Mus musculus chromosome 5, clone RP23-396H22, complete sequence
          Length = 216377

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 9      ccaaaaccctaaaccctcccc 29
              |||||||||||||||||||||
Sbjct: 214150 ccaaaaccctaaaccctcccc 214130
to top
>gb|AY335946.1| Homo sapiens homeodomain protein IRXB3 (IRX6) gene, complete cds
          Length = 10821

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 234  ggcggcggcaggggtggggga 254
            |||||||||||||||||||||
Sbjct: 2266 ggcggcggcaggggtggggga 2246
to top
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 210     ggccgcagcggcggcaggggccgtggcggcggc 242
               |||||| |||||||||| ||| |||||||||||
Sbjct: 1395507 ggccgcggcggcggcagcggcggtggcggcggc 1395539
to top
>gb|AC136964.2| Sus scrofa domestica clone RP44-154L9, complete sequence
          Length = 164640

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 233    tggcggcggcaggggtggggg 253
              |||||||||||||||||||||
Sbjct: 139955 tggcggcggcaggggtggggg 139975
to top
>emb|AL672026.11| Mouse DNA sequence from clone RP23-403O11 on chromosome X, complete
              sequence
          Length = 200566

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 242    caggggtgggggaaggggtggcctc 266
              |||||||||||| ||||||||||||
Sbjct: 103067 caggggtgggggtaggggtggcctc 103091
to top
>gb|AC109462.2| Homo sapiens chromosome 16 clone RP11-26L20, complete sequence
          Length = 174191

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 234    ggcggcggcaggggtggggga 254
              |||||||||||||||||||||
Sbjct: 140477 ggcggcggcaggggtggggga 140457
to top
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 210     ggccgcagcggcggcaggggccgtggcggcggc 242
               |||||| |||||||||| ||| |||||||||||
Sbjct: 1238335 ggccgcggcggcggcagcggcggtggcggcggc 1238303
to top
>gb|AC092722.5| Homo sapiens chromosome 16 clone RP11-517M14, complete sequence
          Length = 189822

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 234   ggcggcggcaggggtggggga 254
             |||||||||||||||||||||
Sbjct: 92381 ggcggcggcaggggtggggga 92401
to top
>gb|AC104564.11| Homo sapiens chromosome 17, clone RP11-68I3, complete sequence
          Length = 173058

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 228   ggccgtggcggcggcaggggtgggggaaggggt 260
             ||||||||||| ||||||||||| ||| |||||
Sbjct: 99224 ggccgtggcgggggcaggggtggaggatggggt 99256
to top
>ref|XM_220754.3| PREDICTED: Rattus norvegicus proteasome (prosome, macropain) 26S
           subunit, non-ATPase, 11 (predicted) (Psmd11_predicted),
           mRNA
          Length = 1714

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 179 tggcggccgcagcggtggtag 199
           |||||||||||||||||||||
Sbjct: 191 tggcggccgcagcggtggtag 211
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 217     gcggcggcaggggccgtggcggcgg 241
               ||||||||||||||| |||||||||
Sbjct: 2170494 gcggcggcaggggccctggcggcgg 2170470
to top
>emb|BX649462.9| Mouse DNA sequence from clone RP23-324J22 on chromosome 7, complete
              sequence
          Length = 157941

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 240    ggcaggggtgggggaaggggt 260
              |||||||||||||||||||||
Sbjct: 150578 ggcaggggtgggggaaggggt 150558
to top
>dbj|AP004094.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1695_H09
          Length = 114721

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 232   gtggcggcggcaggggtgggg 252
             |||||||||||||||||||||
Sbjct: 27050 gtggcggcggcaggggtgggg 27070
to top
>gb|AF466203.1| Zea mays clone ZMBBb_0092E12, partial sequence
          Length = 147198

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 171   agcgacggtggcggccgcagc 191
             |||||||||||||||||||||
Sbjct: 19204 agcgacggtggcggccgcagc 19184
to top
>gb|AY495827.1| Oryctolagus cuniculus clone 179L1 kappa 1 light chain immunglobulin
             gene region
          Length = 205144

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 218   cggcggcaggggccgtggcggcggc 242
             ||||||| |||||||||||||||||
Sbjct: 19738 cggcggccggggccgtggcggcggc 19714
to top
>gb|AC118599.24| Mus musculus chromosome 5, clone RP23-459G5, complete sequence
          Length = 194003

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 9    ccaaaaccctaaaccctcccc 29
            |||||||||||||||||||||
Sbjct: 1197 ccaaaaccctaaaccctcccc 1177
to top
>ref|XM_510740.1| PREDICTED: Pan troglodytes similar to RAB26, member RAS oncogene
            family (LOC453829), mRNA
          Length = 2504

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 239  cggcaggggtgggggaaggg 258
            ||||||||||||||||||||
Sbjct: 1201 cggcaggggtgggggaaggg 1182
to top
>gb|BT016767.1| Zea mays clone Contig600 mRNA sequence
          Length = 1334

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 234 ggcggcggcaggggtggggg 253
           ||||||||||||||||||||
Sbjct: 148 ggcggcggcaggggtggggg 167
to top
>gb|AC005346.1| Homo sapiens chromosome 16, cosmid clone 2H2 (LANL), complete sequence
          Length = 38849

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 239   cggcaggggtgggggaaggg 258
             ||||||||||||||||||||
Sbjct: 38706 cggcaggggtgggggaaggg 38725
to top
>gb|BC046830.1| Mus musculus mahogunin, ring finger 1, mRNA (cDNA clone MGC:61217
           IMAGE:6811606), complete cds
          Length = 3165

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 210 ggccgcagcggcggcaggggccgtggcggcgg 241
           ||||||||||||||| | ||| ||||||||||
Sbjct: 6   ggccgcagcggcggcggcggcggtggcggcgg 37
to top
>ref|XM_957415.1| Neurospora crassa OR74A hypothetical protein (NCU08295.1) partial
           mRNA
          Length = 1131

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 178 gtggcggccgcagcggtggt 197
           ||||||||||||||||||||
Sbjct: 878 gtggcggccgcagcggtggt 897
to top
>ref|XM_329000.1| Neurospora crassa OR74A hypothetical protein (NCU08295.1) partial
           mRNA
          Length = 1131

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 178 gtggcggccgcagcggtggt 197
           ||||||||||||||||||||
Sbjct: 878 gtggcggccgcagcggtggt 897
to top
>ref|NM_029657.2| Mus musculus mahogunin, ring finger 1 (Mgrn1), mRNA
          Length = 3165

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 210 ggccgcagcggcggcaggggccgtggcggcgg 241
           ||||||||||||||| | ||| ||||||||||
Sbjct: 6   ggccgcagcggcggcggcggcggtggcggcgg 37
to top
>gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome 6, complete sequence
          Length = 264135

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      ccaaaaccctaaaccctccc 28
              ||||||||||||||||||||
Sbjct: 159549 ccaaaaccctaaaccctccc 159568
to top
>ref|XM_916469.1| PREDICTED: Mus musculus similar to autoantigen La (LOC639854), mRNA
          Length = 726

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 178 gtggcggccgcagcggtggt 197
           ||||||||||||||||||||
Sbjct: 569 gtggcggccgcagcggtggt 588
to top
>ref|XM_805163.1| Trypanosoma cruzi strain CL Brener serine/threonine protein kinase
           (Tc00.1047053506315.90) partial mRNA
          Length = 2037

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 209 aggccgcagcggcggcaggggccg 232
           |||||||||||||||||| |||||
Sbjct: 416 aggccgcagcggcggcagtggccg 439
to top
>ref|XM_811978.1| Trypanosoma cruzi strain CL Brener serine/threonine protein kinase
           (Tc00.1047053506739.190) partial mRNA
          Length = 2037

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 209 aggccgcagcggcggcaggggccg 232
           |||||||||||||||||| |||||
Sbjct: 416 aggccgcagcggcggcagtggccg 439
to top
>emb|CT009506.5| Pig DNA sequence from clone CH242-216I3 on chromosome 17, complete
             sequence
          Length = 108192

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 224   caggggccgtggcggcggcagggg 247
             ||||||| ||||||||||||||||
Sbjct: 78658 caggggcggtggcggcggcagggg 78635
to top
>gb|AC165244.2| Mus musculus BAC clone RP24-498C9 from chromosome 14, complete sequence
          Length = 191747

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 241    gcaggggtgggggaaggggt 260
              ||||||||||||||||||||
Sbjct: 120739 gcaggggtgggggaaggggt 120758
to top
>emb|AL354919.16| Human DNA sequence from clone RP11-84A19 on chromosome 1 Contains the
             5' end of the BAI2 gene for brain-specific angiogenesis
             inhibitor 2, the gene for a novel protein (FLJ33697,
             FLJ25348, FLJ39908, FLJ25348, FLJ38510, FLJ38873), a novel
             gene (FLJ46627) and three CpG islands, complete sequence
          Length = 124413

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 52101 aggggtgggggaaggggtgg 52082
to top
>emb|AL160411.25| Human DNA sequence from clone RP4-726N1 on chromosome 20 Contains the
             5' end of the ZNF339 gene for zinc finger protein 339, a
             novel gene, the RPL15P1 gene for ribosomal protein L15
             pseudogene 1 and a CpG island, complete sequence
          Length = 100834

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   ggggtgggggaaggggtggc 263
             ||||||||||||||||||||
Sbjct: 24278 ggggtgggggaaggggtggc 24259
to top
>emb|AL121776.19|HSJ1050K3 Human DNA sequence from clone RP5-1050K3 on chromosome 20 Contains part
             of the EYA2 gene for eyes absent homolog 2 (Drosophila), a
             glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
             pseudogene and an RPL27A (ribosomal protein L27A)
             pseudogene, complete sequence
          Length = 143981

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   ggcaggggtgggggaagggg 259
             ||||||||||||||||||||
Sbjct: 97013 ggcaggggtgggggaagggg 97032
to top
>gb|AC139256.5| Homo sapiens chromosome 16 clone RP11-1186N24, complete sequence
          Length = 143783

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  cggcaggggtgggggaaggg 258
            ||||||||||||||||||||
Sbjct: 5747 cggcaggggtgggggaaggg 5766
to top
>gb|AC005013.3| Homo sapiens BAC clone GS1-165L15 from 7, complete sequence
          Length = 195917

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 80     ggctcccatgagaggaggag 99
              ||||||||||||||||||||
Sbjct: 181586 ggctcccatgagaggaggag 181567
to top
>gb|BC026316.1| Homo sapiens cDNA clone IMAGE:4792261
          Length = 4448

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 243  aggggtgggggaaggggtgg 262
            ||||||||||||||||||||
Sbjct: 2280 aggggtgggggaaggggtgg 2261
to top
>gb|AC091013.7| Homo sapiens chromosome 11, clone RP11-379P15, complete sequence
          Length = 223741

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    cacacaccatgagggctccc 86
             ||||||||||||||||||||
Sbjct: 38387 cacacaccatgagggctccc 38368
to top
>gb|L39891.1|HUMPKD1GEN Homo sapiens polycystic kidney disease-associated protein (PKD1)
            gene, complete cds
          Length = 53522

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  cggcaggggtgggggaaggg 258
            ||||||||||||||||||||
Sbjct: 9292 cggcaggggtgggggaaggg 9311
to top
>gb|U24498.1|HSU24498 Human autosomal dominant polycystic kidney disease protein 1 (PKD1)
            gene
          Length = 47934

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  cggcaggggtgggggaaggg 258
            ||||||||||||||||||||
Sbjct: 6730 cggcaggggtgggggaaggg 6749
to top
>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 174    gacggtggcggccgcagcggtggt 197
              ||||||||||||||| ||||||||
Sbjct: 887574 gacggtggcggccgcggcggtggt 887551
to top
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 216     agcggcggcaggggccgtggcggc 239
               |||||||||| |||||||||||||
Sbjct: 2826925 agcggcggcatgggccgtggcggc 2826902
to top
>gb|AC006549.28| Homo sapiens chromosome 22 clone p215k21 map 22q11, complete sequence
          Length = 174840

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 234    ggcggcggcaggggtggggg 253
              ||||||||||||||||||||
Sbjct: 117292 ggcggcggcaggggtggggg 117273
to top
>gb|AC058790.14| Homo sapiens chromosome 22 clone b518b9 map 22q11, complete sequence
          Length = 184929

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 234   ggcggcggcaggggtggggg 253
             ||||||||||||||||||||
Sbjct: 96517 ggcggcggcaggggtggggg 96498
to top
>gb|AC007663.29| Homo sapiens chromosome 22 clone b444p24 map 22q11, complete sequence
          Length = 168239

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 234   ggcggcggcaggggtggggg 253
             ||||||||||||||||||||
Sbjct: 84631 ggcggcggcaggggtggggg 84612
to top
>gb|AC009995.9|AC009995 Homo sapiens chromosome 8, clone RP11-373H15, complete sequence
          Length = 174037

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 243    aggggtgggggaaggggtgg 262
              ||||||||||||||||||||
Sbjct: 116790 aggggtgggggaaggggtgg 116809
to top
>ref|NG_002799.1| Homo sapiens polycystic kidney disease 1 (autosomal dominant)
            pseudogene 6 (PKD1P6) on chromosome 16
          Length = 29487

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 239  cggcaggggtgggggaaggg 258
            ||||||||||||||||||||
Sbjct: 5747 cggcaggggtgggggaaggg 5766
to top
>gb|AC010616.5|AC010616 Homo sapiens chromosome 19 clone CTD-2575K13, complete sequence
          Length = 171849

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 74103 aggggtgggggaaggggtgg 74122
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 3       ccctctccaaaaccctaaac 22
               ||||||||||||||||||||
Sbjct: 9998797 ccctctccaaaaccctaaac 9998778
to top
>gb|AC092137.3| Homo sapiens chromosome 16 clone RP11-344H15, complete sequence
          Length = 184891

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 239    cggcaggggtgggggaaggg 258
              ||||||||||||||||||||
Sbjct: 110583 cggcaggggtgggggaaggg 110564
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 3       ccctctccaaaaccctaaac 22
               ||||||||||||||||||||
Sbjct: 8922729 ccctctccaaaaccctaaac 8922748
to top
>gb|AC103831.4| Homo sapiens chromosome 8, clone RP11-1023P17, complete sequence
          Length = 206357

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 15574 aggggtgggggaaggggtgg 15555
to top
>gb|AC009065.8| Homo sapiens chromosome 16 clone RP11-304L19, complete sequence
          Length = 199759

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 239    cggcaggggtgggggaaggg 258
              ||||||||||||||||||||
Sbjct: 147366 cggcaggggtgggggaaggg 147385
to top
>gb|AC093378.5| Homo sapiens BAC clone RP11-296O15 from 2, complete sequence
          Length = 63849

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 60278 aggggtgggggaaggggtgg 60259



 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 60242 aggggtgggggaaggggtgg 60223



 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 60230 aggggtgggggaaggggtgg 60211



 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 60194 aggggtgggggaaggggtgg 60175



 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aggggtgggggaaggggtgg 262
             ||||||||||||||||||||
Sbjct: 60146 aggggtgggggaaggggtgg 60127
to top
>gb|AC114771.3| Homo sapiens BAC clone RP11-425I13 from 4, complete sequence
          Length = 121946

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 234  ggcggcggcaggggtggggg 253
            ||||||||||||||||||||
Sbjct: 2326 ggcggcggcaggggtggggg 2345
to top
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 201     gggttcggaggccgcagcggcggc 224
               ||||||||| ||||||||||||||
Sbjct: 1552462 gggttcggaagccgcagcggcggc 1552439
to top
>dbj|AP005128.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0466E03
          Length = 138343

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     ccctctccaaaaccctaaac 22
             ||||||||||||||||||||
Sbjct: 28101 ccctctccaaaaccctaaac 28082
to top
>dbj|AP003575.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0528B02
          Length = 144495

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     ccctctccaaaaccctaaac 22
             ||||||||||||||||||||
Sbjct: 88358 ccctctccaaaaccctaaac 88377
to top
>emb|AJ277661.1|HSA277661 Homo sapiens partial LMO1 gene for LIM domain only 1 protein, exon 1
          Length = 131145

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     cacacaccatgagggctccc 86
              ||||||||||||||||||||
Sbjct: 106797 cacacaccatgagggctccc 106816
to top
>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 213     cgcagcggcggcaggggccgtggcggcggcag 244
               ||||||||||||||||||| |||  |||||||
Sbjct: 1900329 cgcagcggcggcaggggccatgggcgcggcag 1900298
to top
>gb|AY104032.1| Zea mays PCO099184 mRNA sequence
          Length = 1242

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 234 ggcggcggcaggggtggggg 253
           ||||||||||||||||||||
Sbjct: 156 ggcggcggcaggggtggggg 175
to top
>emb|CT009654.2| Medicago truncatula chromosome 5 clone mth2-17c15, COMPLETE SEQUENCE
          Length = 126536

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 6     tctccaaaaccctaaaccct 25
             ||||||||||||||||||||
Sbjct: 78910 tctccaaaaccctaaaccct 78929
to top
>gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone rp23-422n18, complete
             sequence
          Length = 188880

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 217   gcggcggcaggggccgtggcggcggcag 244
             |||||||| ||||| |||||||||||||
Sbjct: 78472 gcggcggcgggggcggtggcggcggcag 78445
to top
>gb|AC132228.3| Mus musculus BAC clone RP24-480G11 from 6, complete sequence
          Length = 180203

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      ccaaaaccctaaaccctccc 28
              ||||||||||||||||||||
Sbjct: 138448 ccaaaaccctaaaccctccc 138467
to top
>gb|AC129323.6| Mus musculus BAC clone RP23-237M15 from 9, complete sequence
          Length = 170293

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   gcaggggtgggggaaggggt 260
             ||||||||||||||||||||
Sbjct: 98236 gcaggggtgggggaaggggt 98217
to top
>gb|AF031542.1|AF031542 Fritillaria agrestis ribosomal protein L23a (rpl23a) mRNA, complete
           cds
          Length = 715

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 214 gcagcggcggcaggggccgtggcggcgg 241
           ||||||||||||||||| | ||||||||
Sbjct: 56  gcagcggcggcaggggctgcggcggcgg 29
to top
>emb|CR974477.12| Pig DNA sequence from clone CH242-217L7 on chromosome 17, complete
              sequence
          Length = 204661

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 244    ggggtgggggaaggggtggc 263
              ||||||||||||||||||||
Sbjct: 155673 ggggtgggggaaggggtggc 155654
to top
>emb|AL663092.15| Mouse DNA sequence from clone RP23-91I20 on chromosome 2, complete
             sequence
          Length = 207554

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    cacacaccatgagggctccc 86
             ||||||||||||||||||||
Sbjct: 27401 cacacaccatgagggctccc 27382
to top
>gb|M77189.1|RHBCYTC Bradyrhizobium japonicum cytochrome c (cycM) gene, complete cds
          Length = 745

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 201 gggttcggaggccgcagcggcggc 224
           ||||||||| ||||||||||||||
Sbjct: 309 gggttcggaagccgcagcggcggc 286


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,855,074
Number of Sequences: 3902068
Number of extensions: 1855074
Number of successful extensions: 55087
Number of sequences better than 10.0: 84
Number of HSP's better than 10.0 without gapping: 85
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54433
Number of HSP's gapped (non-prelim): 654
length of query: 286
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 264
effective length of database: 17,147,199,772
effective search space: 4526860739808
effective search space used: 4526860739808
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top