ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast17e10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_187323.1| Oryza sativa (japonica cultivar-group), mRNA 109 6e-21
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
3dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic D... 74 4e-10
4ref|XM_750315.1| Aspergillus fumigatus Af293 RNA helicase Dbp (A... 44 0.32
5dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 44 0.32
6ref|NM_022511.2| Rattus norvegicus profilin 1 (Pfn1), mRNA 42 1.3
7ref|XM_848667.1| PREDICTED: Canis familiaris similar to Urocorti... 42 1.3
8emb|Z98751.1|HS560B9 Human DNA sequence from clone RP4-560B9 on ... 42 1.3
9emb|CR933736.12| Mouse DNA sequence from clone DN-183N8 on chrom... 42 1.3
10emb|AL596117.19| Mouse DNA sequence from clone RP23-326P7 on chr... 42 1.3
11dbj|AK131636.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 42 1.3
12dbj|AK150780.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 42 1.3
13dbj|AK152491.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 42 1.3
14dbj|AK160191.1| Mus musculus ES cells cDNA, RIKEN full-length en... 42 1.3
15dbj|AK034932.1| Mus musculus 12 days embryo embryonic body betwe... 42 1.3
16dbj|AK028117.1| Mus musculus adult male small intestine cDNA, RI... 42 1.3
17dbj|AK011066.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 42 1.3
18gb|AC093766.3| Homo sapiens BAC clone RP11-98O2 from 4, complete... 42 1.3
19dbj|BS000130.1| Pan troglodytes chromosome 22 clone:CH251-010A09... 42 1.3
20gb|BC002080.1| Mus musculus profilin 1, mRNA (cDNA clone MGC:623... 42 1.3
21gb|BC062405.1| Rattus norvegicus profilin 1, mRNA (cDNA clone MG... 42 1.3
22dbj|AP001743.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 1.3
23ref|NM_011072.2| Mus musculus profilin 1 (Pfn1), mRNA 42 1.3
24dbj|AP001615.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 42 1.3
25dbj|AP001614.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 42 1.3
26gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, co... 40 5.0
27ref|NM_021114.1| Homo sapiens serine peptidase inhibitor, Kazal ... 40 5.0
28gb|BC022514.1| Homo sapiens serine peptidase inhibitor, Kazal ty... 40 5.0
29ref|XM_383918.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 40 5.0
30gb|AC118632.7| Mus musculus chromosome 18, clone RP24-94D24, com... 40 5.0
31emb|X68331.1|MFACTRYIN M.fascicularis mRNA for acrosin-trypsin i... 40 5.0
32emb|X57655.1|HSHUSIII H.sapiens RNA for acrosin-trypsin inhibito... 40 5.0
33emb|AL445065.1|TACID3 Thermoplasma acidophilum complete genome; ... 40 5.0
34gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome 40 5.0
35gb|AC022483.7| Homo sapiens BAC clone RP11-533F5 from 4, complet... 40 5.0
36emb|CR542135.1| Homo sapiens full open reading frame cDNA clone ... 40 5.0
37gb|AC154373.2| Mus musculus BAC clone RP23-79I18 from chromosome... 40 5.0
38emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chrom... 40 5.0
39gb|M91438.1|HUMHUSII Human kazal-type serine proteinase (HUSI-II... 40 5.0
40gb|M84967.1|HUMHUSIIIA Human acrosin-trypsin inhibitor (HUSI-II)... 40 5.0 
>ref|NM_187323.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 906

 Score =  109 bits (55), Expect = 6e-21
 Identities = 106/123 (86%)
 Strand = Plus / Plus

                                                                       
Query: 246 aacaagtggggcccgcagcaccagacggtctctggcgaccattcggccatcaccatctgg 305
           ||||||||||||||||||||||||||  |||| | |||||| ||  || |||||||||||
Sbjct: 154 aacaagtggggcccgcagcaccagaccctctccgccgaccagtcctccctcaccatctgg 213

                                                                       
Query: 306 ctcgacaggacctgcgggagtgggttcaagtcgaagcatgcgtacaggaacggctacttc 365
           |||||||  ||||||||||| ||||||||||| | | |  |||||||||| |||||||||
Sbjct: 214 ctcgacaaaacctgcgggagcgggttcaagtcaaggaagtcgtacaggaatggctacttc 273

              
Query: 366 gcc 368
           |||
Sbjct: 274 gcc 276



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                             
Query: 176 cgcgcagccttctcccggctactacccgagctcg 209
           |||||||||||| || || |||||||||||||||
Sbjct: 84  cgcgcagccttcgccggggtactacccgagctcg 117
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                            
Query: 246      aacaagtggggcccgcagcaccagacggtctctggcgaccattcggccatcaccatctgg 305
                ||||||||||||||||||||||||||  |||| | |||||| ||  || |||||||||||
Sbjct: 17437461 aacaagtggggcccgcagcaccagaccctctccgccgaccagtcctccctcaccatctgg 17437520

                                 
Query: 306      ctcgacaggacctgcgg 322
                |||||||  ||||||||
Sbjct: 17437521 ctcgacaaaacctgcgg 17437537



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 176      cgcgcagccttctcccggctactacccgagctcg 209
                |||||||||||| || || |||||||||||||||
Sbjct: 17437391 cgcgcagccttcgccggggtactacccgagctcg 17437424



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                                
Query: 321      gggagtgggttcaagtcgaagcatgcgtacaggaacggctacttcgcc 368
                ||||| ||||||||||| | | |  |||||||||| ||||||||||||
Sbjct: 17438048 gggagcgggttcaagtcaaggaagtcgtacaggaatggctacttcgcc 17438095
to top
>dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0434A03
          Length = 146505

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                          
Query: 246    aacaagtggggcccgcagcaccagacggtctctggcgaccattcggccatcaccatctgg 305
              ||||||||||||||||||||||||||  |||| | |||||| ||  || |||||||||||
Sbjct: 105685 aacaagtggggcccgcagcaccagaccctctccgccgaccagtcctccctcaccatctgg 105744

                               
Query: 306    ctcgacaggacctgcgg 322
              |||||||  ||||||||
Sbjct: 105745 ctcgacaaaacctgcgg 105761



 Score = 44.1 bits (22), Expect = 0.32
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 176    cgcgcagccttctcccggctactacccgagctcg 209
              |||||||||||| || || |||||||||||||||
Sbjct: 105615 cgcgcagccttcgccggggtactacccgagctcg 105648



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 321    gggagtgggttcaagtcgaagcatgcgtacaggaacggctacttcgcc 368
              ||||| ||||||||||| | | |  |||||||||| ||||||||||||
Sbjct: 106272 gggagcgggttcaagtcaaggaagtcgtacaggaatggctacttcgcc 106319
to top
>ref|XM_750315.1| Aspergillus fumigatus Af293 RNA helicase Dbp (Afu2g10750) partial
           mRNA
          Length = 1698

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 113 cagcctctccttgctcccggccatgg 138
           ||||||||||||||||||||| ||||
Sbjct: 556 cagcctctccttgctcccggcgatgg 581
to top
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 127     tcccggccatggcgctgctgctcctg 152
               ||||||||| ||||||||||||||||
Sbjct: 2152947 tcccggccacggcgctgctgctcctg 2152922
to top
>ref|NM_022511.2| Rattus norvegicus profilin 1 (Pfn1), mRNA
          Length = 862

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 126 cccggccatggcgctgctgct 106
to top
>ref|XM_848667.1| PREDICTED: Canis familiaris similar to Urocortin precursor
           (LOC611041), mRNA
          Length = 381

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 135 atggcgctgctgctcctggca 155
           |||||||||||||||||||||
Sbjct: 31  atggcgctgctgctcctggca 51
to top
>emb|Z98751.1|HS560B9 Human DNA sequence from clone RP4-560B9 on chromosome 1q24-25
            Contains three processed pseudogenes and the VAMP4 gene
            for vesicle-associated membrane protein 4, complete
            sequence
          Length = 99074

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 128  cccggccatggcgctgctgct 148
            |||||||||||||||||||||
Sbjct: 2157 cccggccatggcgctgctgct 2177
to top
>emb|CR933736.12| Mouse DNA sequence from clone DN-183N8 on chromosome 11, complete
              sequence
          Length = 194230

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 128    cccggccatggcgctgctgct 148
              |||||||||||||||||||||
Sbjct: 177425 cccggccatggcgctgctgct 177445
to top
>emb|AL596117.19| Mouse DNA sequence from clone RP23-326P7 on chromosome 11 Contains the
             Gp1ba gene for glycoprotein 1b alpha polypeptide, the
             Slc25a11 gene for solute carrier family 25 (mitochondrial
             carrier; oxoglutarate carrier) member 11, the gene for a
             novel PA domain and C3HC4 type zinc finger (RING finger)
             containing protein, the Pfn1 gene for profilin 1, five
             novel genes, the Eno3 gene for muscle enolase 3 beta, the
             Spag7 gene for sperm associated antigen 7, the Kif1c gene
             for kinesin family member 1C, a ribosomal protein 37A
             (Rpl37a) pseudogene, the gene for a novel zinc finger
             protein and six CpG islands, complete sequence
          Length = 207086

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 128   cccggccatggcgctgctgct 148
             |||||||||||||||||||||
Sbjct: 21836 cccggccatggcgctgctgct 21856
to top
>dbj|AK131636.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500038L17 product:unclassifiable, full
           insert sequence
          Length = 829

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 374 cccggccatggcgctgctgct 394
to top
>dbj|AK150780.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015F09 product:profilin 1,
           full insert sequence
          Length = 820

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 136 cccggccatggcgctgctgct 116
to top
>dbj|AK152491.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830076F02 product:profilin 1,
           full insert sequence
          Length = 851

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 165 cccggccatggcgctgctgct 145
to top
>dbj|AK160191.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410026M17 product:profilin 1, full insert
           sequence
          Length = 852

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 165 cccggccatggcgctgctgct 145
to top
>dbj|AK034932.1| Mus musculus 12 days embryo embryonic body between diaphragm region
           and neck cDNA, RIKEN full-length enriched library,
           clone:9430063L06 product:profilin 1, full insert
           sequence
          Length = 1999

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 138 cccggccatggcgctgctgct 118
to top
>dbj|AK028117.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
           enriched library, clone:2010010C10 product:profilin 1,
           full insert sequence
          Length = 807

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 130 cccggccatggcgctgctgct 110
to top
>dbj|AK011066.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510040G14 product:profilin 1, full
           insert sequence
          Length = 854

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 164 cccggccatggcgctgctgct 144
to top
>gb|AC093766.3| Homo sapiens BAC clone RP11-98O2 from 4, complete sequence
          Length = 168569

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 282    gaccattcggccatcaccatc 302
              |||||||||||||||||||||
Sbjct: 150067 gaccattcggccatcaccatc 150087
to top
>dbj|BS000130.1| Pan troglodytes chromosome 22 clone:CH251-010A09, map 22, complete
             sequences
          Length = 201997

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 140   gctgctgctcctggcaatggc 160
             |||||||||||||||||||||
Sbjct: 65487 gctgctgctcctggcaatggc 65507
to top
>gb|BC002080.1| Mus musculus profilin 1, mRNA (cDNA clone MGC:6236 IMAGE:3490976),
           complete cds
          Length = 885

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 152 cccggccatggcgctgctgct 132
to top
>gb|BC062405.1| Rattus norvegicus profilin 1, mRNA (cDNA clone MGC:72445
           IMAGE:5623232), complete cds
          Length = 862

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 126 cccggccatggcgctgctgct 106
to top
>dbj|AP001743.1| Homo sapiens genomic DNA, chromosome 21q, section 87/105
          Length = 219256

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 140   gctgctgctcctggcaatggc 160
             |||||||||||||||||||||
Sbjct: 65275 gctgctgctcctggcaatggc 65295
to top
>ref|NM_011072.2| Mus musculus profilin 1 (Pfn1), mRNA
          Length = 854

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 128 cccggccatggcgctgctgct 148
           |||||||||||||||||||||
Sbjct: 164 cccggccatggcgctgctgct 144
to top
>dbj|AP001615.1| Homo sapiens genomic DNA, chromosome 21, clone:KB657H6, MX1-D21S171
            region, complete sequence
          Length = 124516

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 140  gctgctgctcctggcaatggc 160
            |||||||||||||||||||||
Sbjct: 5392 gctgctgctcctggcaatggc 5412
to top
>dbj|AP001614.1| Homo sapiens genomic DNA, chromosome 21, clone:KB2042A8, MX1-D21S171
             region, complete sequence
          Length = 81896

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 140   gctgctgctcctggcaatggc 160
             |||||||||||||||||||||
Sbjct: 49616 gctgctgctcctggcaatggc 49636
to top
>gb|AC120859.12| Mus musculus chromosome 18, clone RP24-200D2, complete sequence
          Length = 184327

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    tccttgctcccggccatggc 139
              ||||||||||||||||||||
Sbjct: 160980 tccttgctcccggccatggc 160999
to top
>ref|NM_021114.1| Homo sapiens serine peptidase inhibitor, Kazal type 2
           (acrosin-trypsin inhibitor) (SPINK2), mRNA
          Length = 594

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcgctgctgctcctggca 155
           ||||||||||||||||||||
Sbjct: 91  tggcgctgctgctcctggca 110
to top
>gb|BC022514.1| Homo sapiens serine peptidase inhibitor, Kazal type 2
           (acrosin-trypsin inhibitor), mRNA (cDNA clone MGC:26562
           IMAGE:4812189), complete cds
          Length = 631

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcgctgctgctcctggca 155
           ||||||||||||||||||||
Sbjct: 92  tggcgctgctgctcctggca 111
to top
>ref|XM_383918.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03742.1)
           partial mRNA
          Length = 2415

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 135 atggcgctgctgctcctggc 154
           ||||||||||||||||||||
Sbjct: 617 atggcgctgctgctcctggc 636
to top
>gb|AC118632.7| Mus musculus chromosome 18, clone RP24-94D24, complete sequence
          Length = 198636

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    tccttgctcccggccatggc 139
              ||||||||||||||||||||
Sbjct: 187906 tccttgctcccggccatggc 187887
to top
>emb|X68331.1|MFACTRYIN M.fascicularis mRNA for acrosin-trypsin inhibitor
          Length = 535

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcgctgctgctcctggca 155
           ||||||||||||||||||||
Sbjct: 26  tggcgctgctgctcctggca 45
to top
>emb|X57655.1|HSHUSIII H.sapiens RNA for acrosin-trypsin inhibitor (HUSI-II)
          Length = 594

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcgctgctgctcctggca 155
           ||||||||||||||||||||
Sbjct: 91  tggcgctgctgctcctggca 110
to top
>emb|AL445065.1|TACID3 Thermoplasma acidophilum complete genome; segment 3/5
          Length = 316900

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 346    cgtacaggaacggctacttc 365
              ||||||||||||||||||||
Sbjct: 180332 cgtacaggaacggctacttc 180351
to top
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 136    tggcgctgctgctcctggcaatggcggt 163
              ||||||||||||||||||| ||| ||||
Sbjct: 790343 tggcgctgctgctcctggccatgtcggt 790370
to top
>gb|AC022483.7| Homo sapiens BAC clone RP11-533F5 from 4, complete sequence
          Length = 205640

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 136    tggcgctgctgctcctggca 155
              ||||||||||||||||||||
Sbjct: 139137 tggcgctgctgctcctggca 139118
to top
>emb|CR542135.1| Homo sapiens full open reading frame cDNA clone RZPDo834H0125D for
           gene SPINK2, serine protease inhibitor, Kazal type, 2
           (acrosin-trypsin inhibitor); complete cds, without
           stopcodon
          Length = 252

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcgctgctgctcctggca 155
           ||||||||||||||||||||
Sbjct: 23  tggcgctgctgctcctggca 42
to top
>gb|AC154373.2| Mus musculus BAC clone RP23-79I18 from chromosome 9, complete sequence
          Length = 225286

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 140   gctgctgctcctggcaatgg 159
             ||||||||||||||||||||
Sbjct: 60951 gctgctgctcctggcaatgg 60970
to top
>emb|CT030635.8| Mouse DNA sequence from clone RP23-94N7 on chromosome 9, complete
             sequence
          Length = 228508

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   gctgctgctcctggcaatgg 159
             ||||||||||||||||||||
Sbjct: 64136 gctgctgctcctggcaatgg 64117
to top
>gb|M91438.1|HUMHUSII Human kazal-type serine proteinase (HUSI-II) gene, complete cds
          Length = 597

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 136 tggcgctgctgctcctggca 155
           ||||||||||||||||||||
Sbjct: 88  tggcgctgctgctcctggca 107
to top
>gb|M84967.1|HUMHUSIIIA Human acrosin-trypsin inhibitor (HUSI-II) gene
          Length = 1780

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 136  tggcgctgctgctcctggca 155
            ||||||||||||||||||||
Sbjct: 1147 tggcgctgctgctcctggca 1166


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,686,957
Number of Sequences: 3902068
Number of extensions: 2686957
Number of successful extensions: 39429
Number of sequences better than 10.0: 40
Number of HSP's better than 10.0 without gapping: 40
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39283
Number of HSP's gapped (non-prelim): 145
length of query: 372
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 350
effective length of database: 17,147,199,772
effective search space: 6001519920200
effective search space used: 6001519920200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top