>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 269     atctgtattggtgcatttaacg 290
               ||||||||||||||||||||||
Sbjct: 1415084 atctgtattggtgcatttaacg 1415063

>ref|XM_538237.2| PREDICTED: Canis familiaris similar to Bromodomain adjacent to zinc
            finger domain 2A (Transcription termination factor-I
            interacting protein 5) (TTF-I interacting protein 5)
            (Tip5) (hWALp3), transcript variant 1 (LOC481116), mRNA
          Length = 6023

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 193  ccctccccggagcagccgctc 213
            |||||||||||||||||||||
Sbjct: 5614 ccctccccggagcagccgctc 5594

>ref|XM_843950.1| PREDICTED: Canis familiaris similar to Bromodomain adjacent to zinc
            finger domain 2A (Transcription termination factor-I
            interacting protein 5) (TTF-I interacting protein 5)
            (Tip5) (hWALp3), transcript variant 2 (LOC481116), mRNA
          Length = 5259

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 193  ccctccccggagcagccgctc 213
            |||||||||||||||||||||
Sbjct: 4843 ccctccccggagcagccgctc 4823

>ref|XM_222315.3| PREDICTED: Rattus norvegicus bromodomain adjacent to zinc finger
            domain, 2A (predicted) (Baz2a_predicted), mRNA
          Length = 5430

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 193  ccctccccggagcagccgctctcgc 217
            |||||||||||||||||| ||||||
Sbjct: 5265 ccctccccggagcagccgttctcgc 5241

>gb|AC008742.9| Homo sapiens chromosome 19 clone CTD-2553C6, complete sequence
          Length = 194624

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 144    cccagcagtgcctccctccg 163
              ||||||||||||||||||||
Sbjct: 173461 cccagcagtgcctccctccg 173480

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 197     ccccggagcagccgctctcg 216
               ||||||||||||||||||||
Sbjct: 1010025 ccccggagcagccgctctcg 1010044

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 217    cccagcaactccgccgcccg 236
              ||||||||||||||||||||
Sbjct: 583783 cccagcaactccgccgcccg 583764

>dbj|AB070956.1| Streptomyces avermitilis peptide-7 biosynthetic gene cluster
          Length = 54101

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 197   ccccggagcagccgctctcg 216
             ||||||||||||||||||||
Sbjct: 21857 ccccggagcagccgctctcg 21876


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,432,839
Number of Sequences: 3902068
Number of extensions: 2432839
Number of successful extensions: 42537
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42394
Number of HSP's gapped (non-prelim): 143
length of query: 374
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 352
effective length of database: 17,147,199,772
effective search space: 6035814319744
effective search space used: 6035814319744
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)