Clone Name	bast14f09
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein ...	672	0.0
2	ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0...	480	e-132
3	dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clon...	480	e-132
4	dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clon...	480	e-132
5	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	432	e-118
6	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	432	e-118
7	gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome...	432	e-118
8	gb|AY106013.1| Zea mays PCO066457 mRNA sequence	254	2e-64
9	ref|XM_479106.1| Oryza sativa (japonica cultivar-group), mRNA	248	1e-62
10	dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clon...	248	1e-62
11	gb|AY130450.1| Petromyzon marinus ribosomal protein S3 mRNA, par...	168	1e-38
12	gb|DQ122868.1| Chlamydomonas incerta 40S ribosomal protein S3 mR...	167	4e-38
13	dbj|AB246886.1| Lethenteron japonicum RPS3 mRNA for ribosomal pr...	163	6e-37
14	gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb002...	131	2e-27
15	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	131	2e-27
16	dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic D...	131	2e-27
17	dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic D...	131	2e-27
18	gb|AY107461.1| Zea mays PCO108959 mRNA sequence	129	8e-27
19	gb|AF429976.1| Spodoptera frugiperda ribosomal protein S3 mRNA, ...	103	5e-19
20	gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA	98	3e-17
21	gb|AY521669.1| Pseudopleuronectes americanus 40S ribosomal prote...	92	2e-15
22	gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence	90	7e-15
23	gb|U12708.1|MSU12708 Manduca sexta ribosomal protein S3 mRNA, co...	90	7e-15
24	gb|AY769316.1| Bombyx mori ribosomal protein S3 (RpS3) mRNA, com...	84	4e-13
25	emb|AM048962.1| Scarabaeus laticollis mRNA for ribosomal protein...	84	4e-13
26	emb|BX071951.1|CNS09ROJ Single read from an extremity of a full-...	84	4e-13
27	emb|BX071950.1|CNS09ROI Single read from an extremity of a full-...	84	4e-13
28	emb|BX071838.1|CNS09RLE Single read from an extremity of a full-...	84	4e-13
29	emb|BX071486.1|CNS09RBM Single read from an extremity of a full-...	84	4e-13
30	emb|BX060955.1|CNS09J73 Single read from an extremity of a full-...	84	4e-13
31	emb|BX069342.1|CNS09PO2 Single read from an extremity of a full-...	84	4e-13
32	emb|BX068384.1|CNS09OXG Single read from an extremity of a full-...	84	4e-13
33	emb|BX068060.1|CNS09OOG Single read from an extremity of a full-...	84	4e-13
34	emb|BX067052.1|CNS09NWG Single read from an extremity of a full-...	84	4e-13
35	emb|BX066892.1|CNS09NS0 Single read from an extremity of a full-...	84	4e-13
36	emb|BX066853.1|CNS09NQX Single read from an extremity of a full-...	84	4e-13
37	emb|BX065632.1|CNS09MT0 Single read from an extremity of a full-...	84	4e-13
38	emb|BX065002.1|CNS09MBI Single read from an extremity of a full-...	84	4e-13
39	emb|BX062894.1|CNS09KOY Single read from an extremity of a full-...	84	4e-13
40	emb|BX062466.1|CNS09KD2 Single read from an extremity of a full-...	84	4e-13
41	emb|BX062034.1|CNS09K12 Single read from an extremity of a full-...	84	4e-13
42	emb|BX061570.1|CNS09JO6 Single read from an extremity of a full-...	84	4e-13
43	emb|BX061429.1|CNS09JK9 Single read from an extremity of a full-...	84	4e-13
44	emb|BX061247.1|CNS09JF7 Single read from an extremity of a full-...	84	4e-13
45	emb|BX060666.1|CNS09IZ2 Single read from an extremity of a full-...	84	4e-13
46	emb|BX060145.1|CNS09IKL Single read from an extremity of a full-...	84	4e-13
47	emb|BX060064.1|CNS09IIC Single read from an extremity of a full-...	84	4e-13
48	emb|BX060018.1|CNS09IH2 Single read from an extremity of a full-...	84	4e-13
49	emb|BX056467.1|CNS09FQF Single read from an extremity of a full-...	84	4e-13
50	emb|BX054555.1|CNS09E9B Single read from an extremity of a full-...	84	4e-13
51	emb|BX054554.1|CNS09E9A Single read from an extremity of a full-...	84	4e-13
52	emb|BX054507.1|CNS09E7Z Single read from an extremity of a full-...	84	4e-13
53	emb|BX049946.1|CNS09APA Single read from an extremity of a full-...	84	4e-13
54	emb|BX049133.1|CNS09A2P Single read from an extremity of a full-...	84	4e-13
55	emb|BX048656.1|CNS099PG Single read from an extremity of a full-...	84	4e-13
56	emb|BX048195.1|CNS099CN Single read from an extremity of a full-...	84	4e-13
57	emb|BX044635.1|CNS096LR Single read from an extremity of a full-...	84	4e-13
58	emb|BX043729.1|CNS095WL Single read from an extremity of a full-...	84	4e-13
59	emb|BX043605.1|CNS095T5 Single read from an extremity of a full-...	84	4e-13
60	emb|BX043171.1|CNS095H3 Single read from an extremity of a full-...	84	4e-13
61	emb|BX042318.1|CNS094TE Single read from an extremity of a full-...	84	4e-13
62	emb|BX041935.1|CNS094IR Single read from an extremity of a full-...	84	4e-13
63	emb|BX041378.1|CNS0943A Single read from an extremity of a full-...	84	4e-13
64	emb|BX040880.1|CNS093PG Single read from an extremity of a full-...	84	4e-13
65	emb|BX040349.1|CNS093AP Single read from an extremity of a full-...	84	4e-13
66	emb|BX040104.1|CNS0933W Single read from an extremity of a full-...	84	4e-13
67	emb|BX039345.1|CNS092IT Single read from an extremity of a full-...	84	4e-13
68	emb|BX039168.1|CNS092DW Single read from an extremity of a full-...	84	4e-13
69	emb|BX038309.1|CNS091Q1 Single read from an extremity of a full-...	84	4e-13
70	emb|BX036899.1|CNS090MV Single read from an extremity of a full-...	84	4e-13
71	emb|BX036837.1|CNS090L5 Single read from an extremity of a full-...	84	4e-13
72	emb|BX034717.1|CNS08YY9 Single read from an extremity of a full-...	84	4e-13
73	emb|BX032839.1|CNS08XI3 Single read from an extremity of a full-...	84	4e-13
74	emb|BX030549.1|CNS08VQH Single read from an extremity of a full-...	84	4e-13
75	emb|BX022272.1|CNS08PCK Single read from an extremity of a full-...	84	4e-13
76	emb|BX027874.1|CNS08TO6 Single read from an extremity of a full-...	84	4e-13
77	emb|BX027294.1|CNS08T82 Single read from an extremity of a full-...	84	4e-13
78	emb|BX024682.1|CNS08R7I Single read from an extremity of a full-...	84	4e-13
79	emb|BX019560.1|CNS08N98 Single read from an extremity of a full-...	84	4e-13
80	emb|BX020703.1|CNS08O4Z Single read from an extremity of a full-...	84	4e-13
81	emb|BX018305.1|CNS08MAD Single read from an extremity of a full-...	84	4e-13
82	emb|BX012403.1|CNS08HQF Single read from an extremity of a full-...	84	4e-13
83	emb|BX006777.1|CNS08DE5 Single read from an extremity of a full-...	84	4e-13
84	ref|XM_321155.2| Anopheles gambiae str. PEST ENSANGP00000020844 ...	84	4e-13
85	emb|BX067207.1|CNS09O0R Single read from an extremity of a full-...	82	2e-12
86	emb|BX071776.1|CNS09RJO Single read from an extremity of a full-...	82	2e-12
87	emb|BX070615.1|CNS09QNF Single read from an extremity of a full-...	82	2e-12
88	emb|BX067880.1|CNS09OJG Single read from an extremity of a full-...	82	2e-12
89	emb|BX067051.1|CNS09NWF Single read from an extremity of a full-...	82	2e-12
90	emb|BX065756.1|CNS09MWG Single read from an extremity of a full-...	82	2e-12
91	emb|BX062033.1|CNS09K11 Single read from an extremity of a full-...	82	2e-12
92	emb|BX061592.1|CNS09JOS Single read from an extremity of a full-...	82	2e-12
93	emb|BX059556.1|CNS09I48 Single read from an extremity of a full-...	82	2e-12
94	emb|BX059139.1|CNS09HSN Single read from an extremity of a full-...	82	2e-12
95	emb|BX056167.1|CNS09FI3 Single read from an extremity of a full-...	82	2e-12
96	emb|BX054567.1|CNS09E9N Single read from an extremity of a full-...	82	2e-12
97	emb|BX049132.1|CNS09A2O Single read from an extremity of a full-...	82	2e-12
98	emb|BX047370.1|CNS098PQ Single read from an extremity of a full-...	82	2e-12
99	emb|BX046671.1|CNS0986B Single read from an extremity of a full-...	82	2e-12
100	emb|BX041377.1|CNS09439 Single read from an extremity of a full-...	82	2e-12
101	emb|BX040698.1|CNS093KE Single read from an extremity of a full-...	82	2e-12
102	emb|BX040183.1|CNS09363 Single read from an extremity of a full-...	82	2e-12
103	emb|BX040080.1|CNS09338 Single read from an extremity of a full-...	82	2e-12
104	emb|BX039936.1|CNS092Z8 Single read from an extremity of a full-...	82	2e-12
105	gb|DQ415986.1| Anopheles quadrimaculatus ribosomal protein S3 (R...	82	2e-12
106	emb|BX053436.1|CNS09DE8 Single read from an extremity of a full-...	80	7e-12
107	emb|BX071837.1|CNS09RLD Single read from an extremity of a full-...	80	7e-12
108	emb|BX071741.1|CNS09RIP Single read from an extremity of a full-...	80	7e-12
109	emb|BX071696.1|CNS09RHG Single read from an extremity of a full-...	80	7e-12
110	emb|BX071616.1|CNS09RF8 Single read from an extremity of a full-...	80	7e-12
111	emb|BX071485.1|CNS09RBL Single read from an extremity of a full-...	80	7e-12
112	emb|BX070633.1|CNS09QNX Single read from an extremity of a full-...	80	7e-12
113	emb|BX070555.1|CNS09QLR Single read from an extremity of a full-...	80	7e-12
114	emb|BX070506.1|CNS09QKE Single read from an extremity of a full-...	80	7e-12
115	emb|BX070477.1|CNS09QJL Single read from an extremity of a full-...	80	7e-12
116	emb|BX070421.1|CNS09QI1 Single read from an extremity of a full-...	80	7e-12
117	emb|BX070161.1|CNS09QAT Single read from an extremity of a full-...	80	7e-12
118	emb|BX069948.1|CNS09Q4W Single read from an extremity of a full-...	80	7e-12
119	emb|BX069682.1|CNS09PXI Single read from an extremity of a full-...	80	7e-12
120	emb|BX069666.1|CNS09PX2 Single read from an extremity of a full-...	80	7e-12
121	emb|BX061066.1|CNS09JA6 Single read from an extremity of a full-...	80	7e-12
122	emb|BX069429.1|CNS09PQH Single read from an extremity of a full-...	80	7e-12
123	emb|BX069304.1|CNS09PN0 Single read from an extremity of a full-...	80	7e-12
124	emb|BX069215.1|CNS09PKJ Single read from an extremity of a full-...	80	7e-12
125	emb|BX068963.1|CNS09PDJ Single read from an extremity of a full-...	80	7e-12
126	emb|BX068877.1|CNS09PB5 Single read from an extremity of a full-...	80	7e-12
127	emb|BX068410.1|CNS09OY6 Single read from an extremity of a full-...	80	7e-12
128	emb|BX068383.1|CNS09OXF Single read from an extremity of a full-...	80	7e-12
129	emb|BX068027.1|CNS09ONJ Single read from an extremity of a full-...	80	7e-12
130	emb|BX067933.1|CNS09OKX Single read from an extremity of a full-...	80	7e-12
131	emb|BX067909.1|CNS09OK9 Single read from an extremity of a full-...	80	7e-12
132	emb|BX067157.1|CNS09NZD Single read from an extremity of a full-...	80	7e-12
133	emb|BX066852.1|CNS09NQW Single read from an extremity of a full-...	80	7e-12
134	emb|BX066794.1|CNS09NPA Single read from an extremity of a full-...	80	7e-12
135	emb|BX066745.1|CNS09NNX Single read from an extremity of a full-...	80	7e-12
136	emb|BX066721.1|CNS09NN9 Single read from an extremity of a full-...	80	7e-12
137	emb|BX066470.1|CNS09NGA Single read from an extremity of a full-...	80	7e-12
138	emb|BX066232.1|CNS09N9O Single read from an extremity of a full-...	80	7e-12
139	emb|BX066176.1|CNS09N84 Single read from an extremity of a full-...	80	7e-12
140	emb|BX065879.1|CNS09MZV Single read from an extremity of a full-...	80	7e-12
141	emb|BX065812.1|CNS09MY0 Single read from an extremity of a full-...	80	7e-12
142	emb|BX065503.1|CNS09MPF Single read from an extremity of a full-...	80	7e-12
143	emb|BX065323.1|CNS09MKF Single read from an extremity of a full-...	80	7e-12
144	emb|BX065196.1|CNS09MGW Single read from an extremity of a full-...	80	7e-12
145	emb|BX065001.1|CNS09MBH Single read from an extremity of a full-...	80	7e-12
146	emb|BX064962.1|CNS09MAE Single read from an extremity of a full-...	80	7e-12
147	emb|BX064919.1|CNS09M97 Single read from an extremity of a full-...	80	7e-12
148	emb|BX064727.1|CNS09M3V Single read from an extremity of a full-...	80	7e-12
149	emb|BX064562.1|CNS09LZA Single read from an extremity of a full-...	80	7e-12
150	emb|BX064439.1|CNS09LVV Single read from an extremity of a full-...	80	7e-12
151	emb|BX064384.1|CNS09LUC Single read from an extremity of a full-...	80	7e-12
152	emb|BX064214.1|CNS09LPM Single read from an extremity of a full-...	80	7e-12
153	emb|BX064116.1|CNS09LMW Single read from an extremity of a full-...	80	7e-12
154	emb|BX064054.1|CNS09LL6 Single read from an extremity of a full-...	80	7e-12
155	emb|BX063320.1|CNS09L0S Single read from an extremity of a full-...	80	7e-12
156	emb|BX062932.1|CNS09KQ0 Single read from an extremity of a full-...	80	7e-12
157	emb|BX062893.1|CNS09KOX Single read from an extremity of a full-...	80	7e-12
158	emb|BX062127.1|CNS09K3N Single read from an extremity of a full-...	80	7e-12
159	emb|BX062120.1|CNS09K3G Single read from an extremity of a full-...	80	7e-12
160	emb|BX061743.1|CNS09JSZ Single read from an extremity of a full-...	80	7e-12
161	emb|BX061707.1|CNS09JRZ Single read from an extremity of a full-...	80	7e-12
162	emb|BX061620.1|CNS09JPK Single read from an extremity of a full-...	80	7e-12
163	emb|BX061569.1|CNS09JO5 Single read from an extremity of a full-...	80	7e-12
164	emb|BX061480.1|CNS09JLO Single read from an extremity of a full-...	80	7e-12
165	emb|BX061428.1|CNS09JK8 Single read from an extremity of a full-...	80	7e-12
166	emb|BX061229.1|CNS09JEP Single read from an extremity of a full-...	80	7e-12
167	emb|BX060846.1|CNS09J42 Single read from an extremity of a full-...	80	7e-12
168	emb|BX060810.1|CNS09J32 Single read from an extremity of a full-...	80	7e-12
169	emb|BX060665.1|CNS09IZ1 Single read from an extremity of a full-...	80	7e-12
170	emb|BX060607.1|CNS09IXF Single read from an extremity of a full-...	80	7e-12
171	emb|BX060402.1|CNS09IRQ Single read from an extremity of a full-...	80	7e-12
172	emb|BX060375.1|CNS09IQZ Single read from an extremity of a full-...	80	7e-12
173	emb|BX060144.1|CNS09IKK Single read from an extremity of a full-...	80	7e-12
174	emb|BX060066.1|CNS09IIE Single read from an extremity of a full-...	80	7e-12
175	emb|BX060017.1|CNS09IH1 Single read from an extremity of a full-...	80	7e-12
176	emb|BX059858.1|CNS09ICM Single read from an extremity of a full-...	80	7e-12
177	emb|BX059821.1|CNS09IBL Single read from an extremity of a full-...	80	7e-12
178	emb|BX059045.1|CNS09HQ1 Single read from an extremity of a full-...	80	7e-12
179	emb|BX059018.1|CNS09HPA Single read from an extremity of a full-...	80	7e-12
180	emb|BX058900.1|CNS09HM0 Single read from an extremity of a full-...	80	7e-12
181	emb|BX058711.1|CNS09HGR Single read from an extremity of a full-...	80	7e-12
182	emb|BX058653.1|CNS09HF5 Single read from an extremity of a full-...	80	7e-12
183	emb|BX058108.1|CNS09H00 Single read from an extremity of a full-...	80	7e-12
184	emb|BX058103.1|CNS09GZV Single read from an extremity of a full-...	80	7e-12
185	emb|BX056701.1|CNS09FWX Single read from an extremity of a full-...	80	7e-12
186	emb|BX056662.1|CNS09FVU Single read from an extremity of a full-...	80	7e-12
187	emb|BX057998.1|CNS09GWY Single read from an extremity of a full-...	80	7e-12
188	emb|BX057677.1|CNS09GO1 Single read from an extremity of a full-...	80	7e-12
189	emb|BX057652.1|CNS09GNC Single read from an extremity of a full-...	80	7e-12
190	emb|BX057544.1|CNS09GKC Single read from an extremity of a full-...	80	7e-12
191	emb|BX056968.1|CNS09G4C Single read from an extremity of a full-...	80	7e-12
192	emb|BX056933.1|CNS09G3D Single read from an extremity of a full-...	80	7e-12
193	emb|BX056922.1|CNS09G32 Single read from an extremity of a full-...	80	7e-12
194	emb|BX056881.1|CNS09G1X Single read from an extremity of a full-...	80	7e-12
195	emb|BX056500.1|CNS09FRC Single read from an extremity of a full-...	80	7e-12
196	emb|BX056452.1|CNS09FQ0 Single read from an extremity of a full-...	80	7e-12
197	emb|BX056428.1|CNS09FPC Single read from an extremity of a full-...	80	7e-12
198	emb|BX056307.1|CNS09FLZ Single read from an extremity of a full-...	80	7e-12
199	emb|BX056230.1|CNS09FJU Single read from an extremity of a full-...	80	7e-12
200	emb|BX056041.1|CNS09FEL Single read from an extremity of a full-...	80	7e-12
201	emb|BX055677.1|CNS09F4H Single read from an extremity of a full-...	80	7e-12
202	emb|BX055410.1|CNS09EX2 Single read from an extremity of a full-...	80	7e-12
203	emb|BX055261.1|CNS09ESX Single read from an extremity of a full-...	80	7e-12
204	emb|BX055241.1|CNS09ESD Single read from an extremity of a full-...	80	7e-12
205	emb|BX055192.1|CNS09ER0 Single read from an extremity of a full-...	80	7e-12
206	emb|BX053297.1|CNS09DAD Single read from an extremity of a full-...	80	7e-12
207	emb|BX053259.1|CNS09D9B Single read from an extremity of a full-...	80	7e-12
208	emb|BX053160.1|CNS09D6K Single read from an extremity of a full-...	80	7e-12
209	emb|BX053115.1|CNS09D5B Single read from an extremity of a full-...	80	7e-12
210	emb|BX055101.1|CNS09EOH Single read from an extremity of a full-...	80	7e-12
211	emb|BX054976.1|CNS09EL0 Single read from an extremity of a full-...	80	7e-12
212	emb|BX054840.1|CNS09EH8 Single read from an extremity of a full-...	80	7e-12
213	emb|BX054826.1|CNS09EGU Single read from an extremity of a full-...	80	7e-12
214	emb|BX054822.1|CNS09EGQ Single read from an extremity of a full-...	80	7e-12
215	emb|BX052983.1|CNS09D1N Single read from an extremity of a full-...	80	7e-12
216	emb|BX054566.1|CNS09E9M Single read from an extremity of a full-...	80	7e-12
217	emb|BX054506.1|CNS09E7Y Single read from an extremity of a full-...	80	7e-12
218	emb|BX054212.1|CNS09DZS Single read from an extremity of a full-...	80	7e-12
219	emb|BX054111.1|CNS09DWZ Single read from an extremity of a full-...	80	7e-12
220	emb|BX054075.1|CNS09DVZ Single read from an extremity of a full-...	80	7e-12
221	emb|BX054013.1|CNS09DU9 Single read from an extremity of a full-...	80	7e-12
222	emb|BX053925.1|CNS09DRT Single read from an extremity of a full-...	80	7e-12
223	emb|BX053867.1|CNS09DQ7 Single read from an extremity of a full-...	80	7e-12
224	emb|BX053857.1|CNS09DPX Single read from an extremity of a full-...	80	7e-12
225	emb|BX053809.1|CNS09DOL Single read from an extremity of a full-...	80	7e-12
226	emb|BX053792.1|CNS09DO4 Single read from an extremity of a full-...	80	7e-12
227	emb|BX053731.1|CNS09DMF Single read from an extremity of a full-...	80	7e-12
228	emb|BX053652.1|CNS09DK8 Single read from an extremity of a full-...	80	7e-12
229	emb|BX053641.1|CNS09DJX Single read from an extremity of a full-...	80	7e-12
230	emb|BX052756.1|CNS09CVC Single read from an extremity of a full-...	80	7e-12
231	emb|BX052547.1|CNS09CPJ Single read from an extremity of a full-...	80	7e-12
232	emb|BX052229.1|CNS09CGP Single read from an extremity of a full-...	80	7e-12
233	emb|BX052113.1|CNS09CDH Single read from an extremity of a full-...	80	7e-12
234	emb|BX052101.1|CNS09CD5 Single read from an extremity of a full-...	80	7e-12
235	emb|BX051814.1|CNS09C56 Single read from an extremity of a full-...	80	7e-12
236	emb|BX051793.1|CNS09C4L Single read from an extremity of a full-...	80	7e-12
237	emb|BX051525.1|CNS09BX5 Single read from an extremity of a full-...	80	7e-12
238	emb|BX051501.1|CNS09BWH Single read from an extremity of a full-...	80	7e-12
239	emb|BX050130.1|CNS09AUE Single read from an extremity of a full-...	80	7e-12
240	emb|BX050103.1|CNS09ATN Single read from an extremity of a full-...	80	7e-12
241	emb|BX051072.1|CNS09BKK Single read from an extremity of a full-...	80	7e-12
242	emb|BX050743.1|CNS09BBF Single read from an extremity of a full-...	80	7e-12
243	emb|BX050675.1|CNS09B9J Single read from an extremity of a full-...	80	7e-12
244	emb|BX050615.1|CNS09B7V Single read from an extremity of a full-...	80	7e-12
245	emb|BX050346.1|CNS09B0E Single read from an extremity of a full-...	80	7e-12
246	emb|BX050277.1|CNS09AYH Single read from an extremity of a full-...	80	7e-12
247	emb|BX049975.1|CNS09AQ3 Single read from an extremity of a full-...	80	7e-12
248	emb|BX049945.1|CNS09AP9 Single read from an extremity of a full-...	80	7e-12
249	emb|BX049331.1|CNS09A87 Single read from an extremity of a full-...	80	7e-12
250	emb|BX049176.1|CNS09A3W Single read from an extremity of a full-...	80	7e-12
251	emb|BX049093.1|CNS09A1L Single read from an extremity of a full-...	80	7e-12
252	emb|BX049082.1|CNS09A1A Single read from an extremity of a full-...	80	7e-12
253	emb|BX049080.1|CNS09A18 Single read from an extremity of a full-...	80	7e-12
254	emb|BX049069.1|CNS09A0X Single read from an extremity of a full-...	80	7e-12
255	emb|BX049050.1|CNS09A0E Single read from an extremity of a full-...	80	7e-12
256	emb|BX048831.1|CNS099UB Single read from an extremity of a full-...	80	7e-12
257	emb|BX048625.1|CNS099OL Single read from an extremity of a full-...	80	7e-12
258	emb|BX048581.1|CNS099ND Single read from an extremity of a full-...	80	7e-12
259	emb|BX048515.1|CNS099LJ Single read from an extremity of a full-...	80	7e-12
260	emb|BX046558.1|CNS09836 Single read from an extremity of a full-...	80	7e-12
261	emb|BX046517.1|CNS09821 Single read from an extremity of a full-...	80	7e-12
262	emb|BX046389.1|CNS097YH Single read from an extremity of a full-...	80	7e-12
263	emb|BX046379.1|CNS097Y7 Single read from an extremity of a full-...	80	7e-12
264	emb|BX048251.1|CNS099E7 Single read from an extremity of a full-...	80	7e-12
265	emb|BX048245.1|CNS099E1 Single read from an extremity of a full-...	80	7e-12
266	emb|BX047882.1|CNS0993Y Single read from an extremity of a full-...	80	7e-12
267	emb|BX047719.1|CNS098ZF Single read from an extremity of a full-...	80	7e-12
268	emb|BX047704.1|CNS098Z0 Single read from an extremity of a full-...	80	7e-12
269	emb|BX047545.1|CNS098UL Single read from an extremity of a full-...	80	7e-12
270	emb|BX047529.1|CNS098U5 Single read from an extremity of a full-...	80	7e-12
271	emb|BX047196.1|CNS098KW Single read from an extremity of a full-...	80	7e-12
272	emb|BX046877.1|CNS098C1 Single read from an extremity of a full-...	80	7e-12
273	emb|BX046853.1|CNS098BD Single read from an extremity of a full-...	80	7e-12
274	emb|BX046792.1|CNS0989O Single read from an extremity of a full-...	80	7e-12
275	emb|BX046147.1|CNS097RR Single read from an extremity of a full-...	80	7e-12
276	emb|BX045769.1|CNS097H9 Single read from an extremity of a full-...	80	7e-12
277	emb|BX045506.1|CNS0979Y Single read from an extremity of a full-...	80	7e-12
278	emb|BX045064.1|CNS096XO Single read from an extremity of a full-...	80	7e-12
279	emb|BX044921.1|CNS096TP Single read from an extremity of a full-...	80	7e-12
280	emb|BX044917.1|CNS096TL Single read from an extremity of a full-...	80	7e-12
281	emb|BX042903.1|CNS0959N Single read from an extremity of a full-...	80	7e-12
282	emb|BX044660.1|CNS096MG Single read from an extremity of a full-...	80	7e-12
283	emb|BX044577.1|CNS096K5 Single read from an extremity of a full-...	80	7e-12
284	emb|BX044157.1|CNS0968H Single read from an extremity of a full-...	80	7e-12
285	emb|BX044072.1|CNS09664 Single read from an extremity of a full-...	80	7e-12
286	emb|BX044027.1|CNS0964V Single read from an extremity of a full-...	80	7e-12
287	emb|BX043893.1|CNS09615 Single read from an extremity of a full-...	80	7e-12
288	emb|BX043373.1|CNS095MP Single read from an extremity of a full-...	80	7e-12
289	emb|BX043303.1|CNS095KR Single read from an extremity of a full-...	80	7e-12
290	emb|BX043170.1|CNS095H2 Single read from an extremity of a full-...	80	7e-12
291	emb|BX042818.1|CNS0957A Single read from an extremity of a full-...	80	7e-12
292	emb|BX042317.1|CNS094TD Single read from an extremity of a full-...	80	7e-12
293	emb|BX042258.1|CNS094RQ Single read from an extremity of a full-...	80	7e-12
294	emb|BX041818.1|CNS094FI Single read from an extremity of a full-...	80	7e-12
295	emb|BX042054.1|CNS094M2 Single read from an extremity of a full-...	80	7e-12
296	emb|BX041909.1|CNS094I1 Single read from an extremity of a full-...	80	7e-12
297	emb|BX041903.1|CNS094HV Single read from an extremity of a full-...	80	7e-12
298	emb|BX041451.1|CNS0945B Single read from an extremity of a full-...	80	7e-12
299	emb|BX041415.1|CNS0944B Single read from an extremity of a full-...	80	7e-12
300	emb|BX040911.1|CNS093QB Single read from an extremity of a full-...	80	7e-12
301	emb|BX040879.1|CNS093PF Single read from an extremity of a full-...	80	7e-12
302	emb|BX040582.1|CNS093H6 Single read from an extremity of a full-...	80	7e-12
303	emb|BX040455.1|CNS093DN Single read from an extremity of a full-...	80	7e-12
304	emb|BX040354.1|CNS093AU Single read from an extremity of a full-...	80	7e-12
305	emb|BX040267.1|CNS0938F Single read from an extremity of a full-...	80	7e-12
306	emb|BX039997.1|CNS0930X Single read from an extremity of a full-...	80	7e-12
307	emb|BX039888.1|CNS092XW Single read from an extremity of a full-...	80	7e-12
308	emb|BX039847.1|CNS092WR Single read from an extremity of a full-...	80	7e-12
309	emb|BX039705.1|CNS092ST Single read from an extremity of a full-...	80	7e-12
310	emb|BX039589.1|CNS092PL Single read from an extremity of a full-...	80	7e-12
311	emb|BX039361.1|CNS092J9 Single read from an extremity of a full-...	80	7e-12
312	emb|BX039290.1|CNS092HA Single read from an extremity of a full-...	80	7e-12
313	emb|BX039254.1|CNS092GA Single read from an extremity of a full-...	80	7e-12
314	emb|BX039252.1|CNS092G8 Single read from an extremity of a full-...	80	7e-12
315	emb|BX036898.1|CNS090MU Single read from an extremity of a full-...	80	7e-12
316	emb|BX035147.1|CNS08ZA7 Single read from an extremity of a full-...	80	7e-12
317	emb|BX032838.1|CNS08XI2 Single read from an extremity of a full-...	80	7e-12
318	emb|BX032753.1|CNS08XFP Single read from an extremity of a full-...	80	7e-12
319	emb|BX032302.1|CNS08X36 Single read from an extremity of a full-...	80	7e-12
320	emb|BX030071.1|CNS08VD7 Single read from an extremity of a full-...	80	7e-12
321	emb|BX028321.1|CNS08U0L Single read from an extremity of a full-...	80	7e-12
322	emb|BX027854.1|CNS08TNM Single read from an extremity of a full-...	80	7e-12
323	emb|BX027305.1|CNS08T8D Single read from an extremity of a full-...	80	7e-12
324	emb|BX027293.1|CNS08T81 Single read from an extremity of a full-...	80	7e-12
325	emb|BX027196.1|CNS08T5C Single read from an extremity of a full-...	80	7e-12
326	emb|BX025545.1|CNS08RVH Single read from an extremity of a full-...	80	7e-12
327	emb|BX025174.1|CNS08RL6 Single read from an extremity of a full-...	80	7e-12
328	emb|BX025112.1|CNS08RJG Single read from an extremity of a full-...	80	7e-12
329	emb|BX024647.1|CNS08R6J Single read from an extremity of a full-...	80	7e-12
330	emb|BX024402.1|CNS08QZQ Single read from an extremity of a full-...	80	7e-12
331	emb|BX023312.1|CNS08Q5G Single read from an extremity of a full-...	80	7e-12
332	emb|BX023307.1|CNS08Q5B Single read from an extremity of a full-...	80	7e-12
333	emb|BX022961.1|CNS08PVP Single read from an extremity of a full-...	80	7e-12
334	emb|BX021665.1|CNS08OVP Single read from an extremity of a full-...	80	7e-12
335	emb|BX021215.1|CNS08OJ7 Single read from an extremity of a full-...	80	7e-12
336	emb|BX021147.1|CNS08OHB Single read from an extremity of a full-...	80	7e-12
337	emb|BX020311.1|CNS08NU3 Single read from an extremity of a full-...	80	7e-12
338	emb|BX020007.1|CNS08NLN Single read from an extremity of a full-...	80	7e-12
339	emb|BX019943.1|CNS08NJV Single read from an extremity of a full-...	80	7e-12
340	emb|BX019836.1|CNS08NGW Single read from an extremity of a full-...	80	7e-12
341	emb|BX019132.1|CNS08MXC Single read from an extremity of a full-...	80	7e-12
342	emb|BX018448.1|CNS08MEC Single read from an extremity of a full-...	80	7e-12
343	emb|BX018314.1|CNS08MAM Single read from an extremity of a full-...	80	7e-12
344	emb|BX018304.1|CNS08MAC Single read from an extremity of a full-...	80	7e-12
345	emb|BX017579.1|CNS08LQ7 Single read from an extremity of a full-...	80	7e-12
346	emb|BX017500.1|CNS08LO0 Single read from an extremity of a full-...	80	7e-12
347	emb|BX017446.1|CNS08LMI Single read from an extremity of a full-...	80	7e-12
348	emb|BX017401.1|CNS08LL9 Single read from an extremity of a full-...	80	7e-12
349	emb|BX016969.1|CNS08L99 Single read from an extremity of a full-...	80	7e-12
350	emb|BX016747.1|CNS08L33 Single read from an extremity of a full-...	80	7e-12
351	emb|BX014374.1|CNS08J96 Single read from an extremity of a full-...	80	7e-12
352	emb|BX013765.1|CNS08IS9 Single read from an extremity of a full-...	80	7e-12
353	emb|BX013655.1|CNS08IP7 Single read from an extremity of a full-...	80	7e-12
354	emb|BX013483.1|CNS08IKF Single read from an extremity of a full-...	80	7e-12
355	emb|BX013471.1|CNS08IK3 Single read from an extremity of a full-...	80	7e-12
356	emb|BX013312.1|CNS08IFO Single read from an extremity of a full-...	80	7e-12
357	emb|BX012758.1|CNS08I0A Single read from an extremity of a full-...	80	7e-12
358	emb|BX012434.1|CNS08HRA Single read from an extremity of a full-...	80	7e-12
359	emb|BX012112.1|CNS08HIC Single read from an extremity of a full-...	80	7e-12
360	emb|BX012045.1|CNS08HGH Single read from an extremity of a full-...	80	7e-12
361	emb|BX011732.1|CNS08H7S Single read from an extremity of a full-...	80	7e-12
362	emb|BX011651.1|CNS08H5J Single read from an extremity of a full-...	80	7e-12
363	emb|BX011276.1|CNS08GV4 Single read from an extremity of a full-...	80	7e-12
364	emb|BX010219.1|CNS08G1R Single read from an extremity of a full-...	80	7e-12
365	emb|BX009683.1|CNS08FMV Single read from an extremity of a full-...	80	7e-12
366	emb|BX009634.1|CNS08FLI Single read from an extremity of a full-...	80	7e-12
367	emb|BX008574.1|CNS08ES2 Single read from an extremity of a full-...	80	7e-12
368	emb|BX008539.1|CNS08ER3 Single read from an extremity of a full-...	80	7e-12
369	emb|BX007834.1|CNS08E7I Single read from an extremity of a full-...	80	7e-12
370	emb|BX006486.1|CNS08D62 Single read from an extremity of a full-...	80	7e-12
371	emb|BX006484.1|CNS08D60 Single read from an extremity of a full-...	80	7e-12
372	emb|BX005659.1|CNS08CJ3 Single read from an extremity of a full-...	80	7e-12
373	emb|BX071404.1|CNS09R9C Single read from an extremity of a full-...	78	3e-11
374	emb|BX070556.1|CNS09QLS Single read from an extremity of a full-...	78	3e-11
375	emb|BX070162.1|CNS09QAU Single read from an extremity of a full-...	78	3e-11
376	emb|BX069949.1|CNS09Q4X Single read from an extremity of a full-...	78	3e-11
377	emb|BX068964.1|CNS09PDK Single read from an extremity of a full-...	78	3e-11
378	emb|BX067910.1|CNS09OKA Single read from an extremity of a full-...	78	3e-11
379	emb|BX067461.1|CNS09O7T Single read from an extremity of a full-...	78	3e-11
380	emb|BX067208.1|CNS09O0S Single read from an extremity of a full-...	78	3e-11
381	emb|BX066795.1|CNS09NPB Single read from an extremity of a full-...	78	3e-11
382	emb|BX066471.1|CNS09NGB Single read from an extremity of a full-...	78	3e-11
383	emb|BX065197.1|CNS09MGX Single read from an extremity of a full-...	78	3e-11
384	emb|BX064963.1|CNS09MAF Single read from an extremity of a full-...	78	3e-11
385	emb|BX064920.1|CNS09M98 Single read from an extremity of a full-...	78	3e-11
386	emb|BX064215.1|CNS09LPN Single read from an extremity of a full-...	78	3e-11
387	emb|BX064055.1|CNS09LL7 Single read from an extremity of a full-...	78	3e-11
388	emb|BX061621.1|CNS09JPL Single read from an extremity of a full-...	78	3e-11
389	emb|BX061593.1|CNS09JOT Single read from an extremity of a full-...	78	3e-11
390	emb|BX060376.1|CNS09IR0 Single read from an extremity of a full-...	78	3e-11
391	emb|BX058712.1|CNS09HGS Single read from an extremity of a full-...	78	3e-11
392	emb|BX058104.1|CNS09GZW Single read from an extremity of a full-...	78	3e-11
393	emb|BX057999.1|CNS09GWZ Single read from an extremity of a full-...	78	3e-11
394	emb|BX057678.1|CNS09GO2 Single read from an extremity of a full-...	78	3e-11
395	emb|BX056231.1|CNS09FJV Single read from an extremity of a full-...	78	3e-11
396	emb|BX055193.1|CNS09ER1 Single read from an extremity of a full-...	78	3e-11
397	emb|BX053926.1|CNS09DRU Single read from an extremity of a full-...	78	3e-11
398	emb|BX053868.1|CNS09DQ8 Single read from an extremity of a full-...	78	3e-11
399	emb|BX052205.1|CNS09CG1 Single read from an extremity of a full-...	78	3e-11
400	emb|BX052102.1|CNS09CD6 Single read from an extremity of a full-...	78	3e-11
401	emb|BX050347.1|CNS09B0F Single read from an extremity of a full-...	78	3e-11
402	emb|BX049083.1|CNS09A1B Single read from an extremity of a full-...	78	3e-11
403	emb|BX048582.1|CNS099NE Single read from an extremity of a full-...	78	3e-11
404	emb|BX047720.1|CNS098ZG Single read from an extremity of a full-...	78	3e-11
405	emb|BX047705.1|CNS098Z1 Single read from an extremity of a full-...	78	3e-11
406	emb|BX045065.1|CNS096XP Single read from an extremity of a full-...	78	3e-11
407	emb|BX045180.1|CNS0970W Single read from an extremity of a full-...	78	3e-11
408	emb|BX044918.1|CNS096TM Single read from an extremity of a full-...	78	3e-11
409	emb|BX044073.1|CNS09665 Single read from an extremity of a full-...	78	3e-11
410	emb|BX044071.1|CNS09663 Single read from an extremity of a full-...	78	3e-11
411	emb|BX042259.1|CNS094RR Single read from an extremity of a full-...	78	3e-11
412	emb|BX041750.1|CNS094DM Single read from an extremity of a full-...	78	3e-11
413	emb|BX041416.1|CNS0944C Single read from an extremity of a full-...	78	3e-11
414	emb|BX040081.1|CNS09339 Single read from an extremity of a full-...	78	3e-11
415	emb|BX039998.1|CNS0930Y Single read from an extremity of a full-...	78	3e-11
416	emb|BX039889.1|CNS092XX Single read from an extremity of a full-...	78	3e-11
417	emb|BX039706.1|CNS092SU Single read from an extremity of a full-...	78	3e-11
418	emb|BX030550.1|CNS08VQI Single read from an extremity of a full-...	78	3e-11
419	emb|BX028322.1|CNS08U0M Single read from an extremity of a full-...	78	3e-11
420	emb|BX027306.1|CNS08T8E Single read from an extremity of a full-...	78	3e-11
421	emb|BX025113.1|CNS08RJH Single read from an extremity of a full-...	78	3e-11
422	emb|BX023308.1|CNS08Q5C Single read from an extremity of a full-...	78	3e-11
423	emb|BX020008.1|CNS08NLO Single read from an extremity of a full-...	78	3e-11
424	emb|BX019837.1|CNS08NGX Single read from an extremity of a full-...	78	3e-11
425	emb|BX018937.1|CNS08MRX Single read from an extremity of a full-...	78	3e-11
426	emb|BX018449.1|CNS08MED Single read from an extremity of a full-...	78	3e-11
427	emb|BX013484.1|CNS08IKG Single read from an extremity of a full-...	78	3e-11
428	emb|BX009635.1|CNS08FLJ Single read from an extremity of a full-...	78	3e-11
429	emb|BX008540.1|CNS08ER4 Single read from an extremity of a full-...	78	3e-11
430	emb|BX006778.1|CNS08DE6 Single read from an extremity of a full-...	78	3e-11
431	emb|BX071304.1|CNS09R6K Single read from an extremity of a full-...	76	1e-10
432	emb|BX069576.1|CNS09PUK Single read from an extremity of a full-...	76	1e-10
433	emb|BX068647.1|CNS09P4R Single read from an extremity of a full-...	76	1e-10
434	emb|BX068028.1|CNS09ONK Single read from an extremity of a full-...	76	1e-10
435	emb|BX065504.1|CNS09MPG Single read from an extremity of a full-...	76	1e-10
436	emb|BX065257.1|CNS09MIL Single read from an extremity of a full-...	76	1e-10
437	emb|BX060234.1|CNS09IN2 Single read from an extremity of a full-...	76	1e-10
438	emb|BX059019.1|CNS09HPB Single read from an extremity of a full-...	76	1e-10
439	emb|BX058109.1|CNS09H01 Single read from an extremity of a full-...	76	1e-10
440	emb|BX053087.1|CNS09D4J Single read from an extremity of a full-...	76	1e-10
441	emb|BX050236.1|CNS09AXC Single read from an extremity of a full-...	76	1e-10
442	emb|BX049583.1|CNS09AF7 Single read from an extremity of a full-...	76	1e-10
443	emb|BX046148.1|CNS097RS Single read from an extremity of a full-...	76	1e-10
444	emb|BX044661.1|CNS096MH Single read from an extremity of a full-...	76	1e-10
445	emb|BX044093.1|CNS0966P Single read from an extremity of a full-...	76	1e-10
446	emb|BX030754.1|CNS08VW6 Single read from an extremity of a full-...	76	1e-10
447	emb|BX028568.1|CNS08U7G Single read from an extremity of a full-...	76	1e-10
448	emb|BX022064.1|CNS08P6S Single read from an extremity of a full-...	76	1e-10
449	emb|BX019936.1|CNS08NJO Single read from an extremity of a full-...	76	1e-10
450	emb|BX019935.1|CNS08NJN Single read from an extremity of a full-...	76	1e-10
451	emb|BX018315.1|CNS08MAN Single read from an extremity of a full-...	76	1e-10
452	emb|BX011534.1|CNS08H2A Single read from an extremity of a full-...	76	1e-10
453	gb|AY118971.1| Drosophila melanogaster LD47488 full insert cDNA	76	1e-10
454	ref|NM_057284.3| Drosophila melanogaster Ribosomal protein S3 CG...	76	1e-10
455	gb|AC010670.8|AC010670 Drosophila melanogaster, chromosome 3R, r...	76	1e-10
456	gb|AC008235.4|AC008235 Drosophila melanogaster, chromosome 3R, r...	76	1e-10
457	gb|BT003618.1| Drosophila melanogaster GH06471 full insert cDNA	76	1e-10
458	gb|BT024258.1| Drosophila melanogaster IP15838 full insert cDNA	76	1e-10
459	gb|AE003743.3| Drosophila melanogaster chromosome 3R, section 81...	76	1e-10
460	gb|L13690.1|DROS3APEN Drosophila melanogaster ribosomal protein ...	76	1e-10
461	gb|AY231995.1| Drosophila yakuba clone yak-ad_RpS3 mRNA sequence	74	4e-10
462	emb|BX066746.1|CNS09NNY Single read from an extremity of a full-...	74	4e-10
463	emb|BX061708.1|CNS09JS0 Single read from an extremity of a full-...	74	4e-10
464	emb|BX054841.1|CNS09EH9 Single read from an extremity of a full-...	74	4e-10
465	emb|BX047014.1|CNS098FU Single read from an extremity of a full-...	74	4e-10
466	emb|BX045179.1|CNS0970V Single read from an extremity of a full-...	74	4e-10
467	emb|BX033840.1|CNS08Y9W Single read from an extremity of a full-...	74	4e-10
468	emb|BX032111.1|CNS08WXV Single read from an extremity of a full-...	74	4e-10
469	emb|BX021549.1|CNS08OSH Single read from an extremity of a full-...	74	4e-10
470	emb|BX018109.1|CNS08M4X Single read from an extremity of a full-...	74	4e-10
471	gb|DQ294256.1| Solanum tuberosum clone 084G12 40S ribosomal prot...	74	4e-10
472	dbj|AP004944.1| Lotus japonicus genomic DNA, chromosome 1, clone...	74	4e-10
473	gb|DQ448864.1| Theobroma cacao 40S ribosomal protein S3 mRNA, pa...	72	2e-09
474	emb|BX071112.1|CNS09R18 Single read from an extremity of a full-...	72	2e-09
475	emb|BX069683.1|CNS09PXJ Single read from an extremity of a full-...	72	2e-09
476	emb|BX068942.1|CNS09PCY Single read from an extremity of a full-...	72	2e-09
477	emb|BX067951.1|CNS09OLF Single read from an extremity of a full-...	72	2e-09
478	emb|BX067899.1|CNS09OJZ Single read from an extremity of a full-...	72	2e-09
479	emb|BX067323.1|CNS09O3Z Single read from an extremity of a full-...	72	2e-09
480	emb|BX063534.1|CNS09L6Q Single read from an extremity of a full-...	72	2e-09
481	emb|BX055760.1|CNS09F6S Single read from an extremity of a full-...	72	2e-09
482	emb|BX056308.1|CNS09FM0 Single read from an extremity of a full-...	72	2e-09
483	emb|BX055367.1|CNS09EVV Single read from an extremity of a full-...	72	2e-09
484	emb|BX054770.1|CNS09EFA Single read from an extremity of a full-...	72	2e-09
485	emb|BX053810.1|CNS09DOM Single read from an extremity of a full-...	72	2e-09
486	emb|BX052548.1|CNS09CPK Single read from an extremity of a full-...	72	2e-09
487	emb|BX048040.1|CNS0998C Single read from an extremity of a full-...	72	2e-09
488	emb|BX046907.1|CNS098CV Single read from an extremity of a full-...	72	2e-09
489	emb|BX045507.1|CNS0979Z Single read from an extremity of a full-...	72	2e-09
490	emb|BX044679.1|CNS096MZ Single read from an extremity of a full-...	72	2e-09
491	emb|BX044222.1|CNS096AA Single read from an extremity of a full-...	72	2e-09
492	emb|BX039827.1|CNS092W7 Single read from an extremity of a full-...	72	2e-09
493	emb|BX030576.1|CNS08VR8 Single read from an extremity of a full-...	72	2e-09
494	emb|BX022517.1|CNS08PJD Single read from an extremity of a full-...	72	2e-09
495	gb|DQ111982.1| Aedes albopictus ribosomal protein S3 mRNA, compl...	72	2e-09
496	emb|BX071742.1|CNS09RIQ Single read from an extremity of a full-...	70	7e-09
497	emb|BX070507.1|CNS09QKF Single read from an extremity of a full-...	70	7e-09
498	emb|BX070422.1|CNS09QI2 Single read from an extremity of a full-...	70	7e-09
499	emb|BX069667.1|CNS09PX3 Single read from an extremity of a full-...	70	7e-09
500	emb|BX068648.1|CNS09P4S Single read from an extremity of a full-...	70	7e-09

---

>gb|AY123420.1| Triticum aestivum putative 40S ribosomal protein S3 mRNA, complete
           cds
          Length = 1004

 Score =  672 bits (339), Expect = 0.0
 Identities = 408/431 (94%)
 Strand = Plus / Plus

                                                                       
Query: 17  tcttctctcctctgcgcacaaaaccctagccgtcccctcacagctcgccgcgaacgcagc 76
           ||||||||||||||| |||||||||||||||||| ||||||||||||||||  |||||||
Sbjct: 3   tcttctctcctctgcccacaaaaccctagccgtcgcctcacagctcgccgccgacgcagc 62

                                                                       
Query: 77  gagctcttcgtccaccgcaccaacgatggccacccagatcagcaagaagaagaagtttgt 136
           ||||||| | ||||||||  |||| ||||| |||||||||||||||||||||||||||||
Sbjct: 63  gagctctccctccaccgccgcaaccatggcgacccagatcagcaagaagaagaagtttgt 122

                                                                       
Query: 137 gagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggagga 196
           ||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 123 gagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagcttgccgagga 182

                                                                       
Query: 197 cggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggc 256
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 183 cggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggc 242

                                                                       
Query: 257 cacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctcacatccgt 316
           |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 243 cacgcggacgcagaacgtgcttggtgagaagggccgcaggatcagggagctcacctccgt 302

                                                                       
Query: 317 cgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgagaaggtcgt 376
           ||| |||||||||||||| |||| ||||||||||||||| ||||| ||||||||||||||
Sbjct: 303 cgtccagaagcgcttcaacttcctggagaacggcgttgagctttacgccgagaaggtcgt 362

                                                                       
Query: 377 caaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggagg 436
           |||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 363 caaccgtggcctctgcgccatcgcccaggccgagtcactccgctacaagctcctcggagg 422

                      
Query: 437 ccttgctgtcc 447
           |||||| ||||
Sbjct: 423 ccttgccgtcc 433

---

>ref|XM_463024.1| Oryza sativa (japonica cultivar-group), OSJNBa0008D12.4 mRNA
          Length = 1112

 Score =  480 bits (242), Expect = e-132
 Identities = 314/338 (92%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 161
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 114 atggcgacccagatcagcaagaagaagaagttcgtgagcgatggcgtgttctacgcggag 173

                                                                       
Query: 162 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 221
           ||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 174 ctgaacgagatgctgacgcgggagctggccgaggacggctactccggcgtggaggtgcgc 233

                                                                       
Query: 222 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 281
           |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||
Sbjct: 234 gtgacgccgatgcgcacggagatcatcatccgggccacgaggacgcagaacgtgctcggc 293

                                                                       
Query: 282 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 341
           |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 294 gagaaggggcgcaggatcagggagctcacctccgtcgtgcagaagcgcttcaacttcccc 353

                                                                       
Query: 342 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 401
           ||||||||||| || || || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 354 gagaacggcgtcgagctctacgccgagaaggtcgtcaaccgcggcctctgcgccatcgcc 413

                                                 
Query: 402 caggcagagtcactccgatacaagctccttggaggcct 439
           ||||| ||||| ||||| |||||||| |||||||||||
Sbjct: 414 caggccgagtccctccgctacaagcttcttggaggcct 451

---

>dbj|AK099146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061B16, full
           insert sequence
          Length = 1054

 Score =  480 bits (242), Expect = e-132
 Identities = 314/338 (92%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 161
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 124 atggcgacccagatcagcaagaagaagaagttcgtgagcgatggcgtgttctacgcggag 183

                                                                       
Query: 162 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 221
           ||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 184 ctgaacgagatgctgacgcgggagctggccgaggacggctactccggcgtggaggtgcgc 243

                                                                       
Query: 222 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 281
           |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||
Sbjct: 244 gtgacgccgatgcgcacggagatcatcatccgggccacgaggacgcagaacgtgctcggc 303

                                                                       
Query: 282 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 341
           |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 304 gagaaggggcgcaggatcagggagctcacctccgtcgtgcagaagcgcttcaacttcccc 363

                                                                       
Query: 342 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 401
           ||||||||||| || || || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 364 gagaacggcgtcgagctctacgccgagaaggtcgtcaaccgcggcctctgcgccatcgcc 423

                                                 
Query: 402 caggcagagtcactccgatacaagctccttggaggcct 439
           ||||| ||||| ||||| |||||||| |||||||||||
Sbjct: 424 caggccgagtccctccgctacaagcttcttggaggcct 461

---

>dbj|AK061051.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G04, full
           insert sequence
          Length = 1084

 Score =  480 bits (242), Expect = e-132
 Identities = 314/338 (92%)
 Strand = Plus / Plus

                                                                       
Query: 102 atggccacccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgag 161
           ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||| |||
Sbjct: 126 atggcgacccagatcagcaagaagaagaagttcgtgagcgatggcgtgttctacgcggag 185

                                                                       
Query: 162 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 221
           ||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 186 ctgaacgagatgctgacgcgggagctggccgaggacggctactccggcgtggaggtgcgc 245

                                                                       
Query: 222 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 281
           |||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||
Sbjct: 246 gtgacgccgatgcgcacggagatcatcatccgggccacgaggacgcagaacgtgctcggc 305

                                                                       
Query: 282 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 341
           |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||| 
Sbjct: 306 gagaaggggcgcaggatcagggagctcacctccgtcgtgcagaagcgcttcaacttcccc 365

                                                                       
Query: 342 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 401
           ||||||||||| || || || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 366 gagaacggcgtcgagctctacgccgagaaggtcgtcaaccgcggcctctgcgccatcgcc 425

                                                 
Query: 402 caggcagagtcactccgatacaagctccttggaggcct 439
           ||||| ||||| ||||| |||||||| |||||||||||
Sbjct: 426 caggccgagtccctccgctacaagcttcttggaggcct 463

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Minus

                                                                            
Query: 130      agtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcg 189
                |||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
Sbjct: 20907649 agttcgtgagcgatggcgtgttctacgcggagctgaacgagatgctgacgcgggagctgg 20907590

                                                                            
Query: 190      cggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 249
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20907589 ccgaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 20907530

                                                                            
Query: 250      tcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctca 309
                || |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 20907529 tccgggccacgaggacgcagaacgtgctcggcgagaaggggcgcaggatcagggagctca 20907470

                                                                            
Query: 310      catccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgaga 369
                | |||||||| |||||||||||||| ||||| ||||||||||| || || || |||||||
Sbjct: 20907469 cctccgtcgtgcagaagcgcttcaacttccccgagaacggcgtcgagctctacgccgaga 20907410

                                                                            
Query: 370      aggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcc 429
                ||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 20907409 aggtcgtcaaccgcggcctctgcgccatcgcccaggccgagtccctccgctacaagcttc 20907350

                          
Query: 430      ttggaggcct 439
                ||||||||||
Sbjct: 20907349 ttggaggcct 20907340



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 102      atggccacccagatcagcaagaagaagaag 131
                ||||| ||||||||||||||||||||||||
Sbjct: 20907755 atggcgacccagatcagcaagaagaagaag 20907726

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Minus

                                                                            
Query: 130      agtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcg 189
                |||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
Sbjct: 20900678 agttcgtgagcgatggcgtgttctacgcggagctgaacgagatgctgacgcgggagctgg 20900619

                                                                            
Query: 190      cggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 249
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20900618 ccgaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 20900559

                                                                            
Query: 250      tcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctca 309
                || |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 20900558 tccgggccacgaggacgcagaacgtgctcggcgagaaggggcgcaggatcagggagctca 20900499

                                                                            
Query: 310      catccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgaga 369
                | |||||||| |||||||||||||| ||||| ||||||||||| || || || |||||||
Sbjct: 20900498 cctccgtcgtgcagaagcgcttcaacttccccgagaacggcgtcgagctctacgccgaga 20900439

                                                                            
Query: 370      aggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcc 429
                ||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 20900438 aggtcgtcaaccgcggcctctgcgccatcgcccaggccgagtccctccgctacaagcttc 20900379

                          
Query: 430      ttggaggcct 439
                ||||||||||
Sbjct: 20900378 ttggaggcct 20900369



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                              
Query: 102      atggccacccagatcagcaagaagaagaag 131
                ||||| ||||||||||||||||||||||||
Sbjct: 20900784 atggcgacccagatcagcaagaagaagaag 20900755

---

>gb|AC146468.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0008D12
             map MAP_LOC, complete sequence
          Length = 167323

 Score =  432 bits (218), Expect = e-118
 Identities = 287/310 (92%)
 Strand = Plus / Plus

                                                                         
Query: 130   agtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgacccgggagctcg 189
             |||| |||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
Sbjct: 15274 agttcgtgagcgatggcgtgttctacgcggagctgaacgagatgctgacgcgggagctgg 15333

                                                                         
Query: 190   cggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 249
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 15334 ccgaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatca 15393

                                                                         
Query: 250   tcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagggagctca 309
             || |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||
Sbjct: 15394 tccgggccacgaggacgcagaacgtgctcggcgagaaggggcgcaggatcagggagctca 15453

                                                                         
Query: 310   catccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgaga 369
             | |||||||| |||||||||||||| ||||| ||||||||||| || || || |||||||
Sbjct: 15454 cctccgtcgtgcagaagcgcttcaacttccccgagaacggcgtcgagctctacgccgaga 15513

                                                                         
Query: 370   aggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcc 429
             ||||||||||||| ||||||||||||||||||||||| ||||| ||||| |||||||| |
Sbjct: 15514 aggtcgtcaaccgcggcctctgcgccatcgcccaggccgagtccctccgctacaagcttc 15573

                       
Query: 430   ttggaggcct 439
             ||||||||||
Sbjct: 15574 ttggaggcct 15583



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 102   atggccacccagatcagcaagaagaagaag 131
             ||||| ||||||||||||||||||||||||
Sbjct: 15168 atggcgacccagatcagcaagaagaagaag 15197

---

>gb|AY106013.1| Zea mays PCO066457 mRNA sequence
          Length = 819

 Score =  254 bits (128), Expect = 2e-64
 Identities = 272/320 (85%)
 Strand = Plus / Plus

                                                                       
Query: 114 atcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgagatg 173
           ||||||||||||  |||||| |||   |||||||| |||| ||| |||||||| ||||||
Sbjct: 66  atcagcaagaagcggaagttcgtggcggatggcgtgttcttcgcggagctgaatgagatg 125

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           |||||||| |||||||||||||| |||||||||||||| ||||| ||||| || || |||
Sbjct: 126 ctgacccgcgagctcgcggaggatggctactccggcgtcgaggtccgcgtcacccccatg 185

                                                                       
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgc 293
           ||||| |||||||||||| | ||||| || || |||||||| || |||||||||||||| 
Sbjct: 186 cgcaccgagatcatcatccgtgccacccgcactcagaacgttctcggcgagaagggccgg 245

                                                                       
Query: 294 aggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgtt 353
           |||||||||||||| || || || ||||||||||||||||| |||||||||   || |||
Sbjct: 246 aggatcagggagctgacttctgtggttcagaagcgcttcaacttcccggagggtggtgtt 305

                                                                       
Query: 354 gaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtca 413
           || || || || ||||||||   ||||||||||||||||||||| |||||||| ||||| 
Sbjct: 306 gagctctacgcagagaaggtgaacaaccgtggcctctgcgccattgcccaggccgagtcg 365

                               
Query: 414 ctccgatacaagctccttgg 433
           || || |||||||| |||||
Sbjct: 366 ctacgctacaagcttcttgg 385

---

>ref|XM_479106.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 926

 Score =  248 bits (125), Expect = 1e-62
 Identities = 278/329 (84%)
 Strand = Plus / Plus

                                                                       
Query: 111 cagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgag 170
           |||||||||||||||   ||||| |||   ||||| || |||| ||| ||||||||||||
Sbjct: 98  cagatcagcaagaagcgcaagttcgtggcggatggggtgttcttcgcggagctgaacgag 157

                                                                       
Query: 171 atgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccg 230
           |||||||| || ||||||||||||||||||||||||||||| ||||| ||||| || || 
Sbjct: 158 atgctgacgcgcgagctcgcggaggacggctactccggcgtcgaggtccgcgtcaccccc 217

                                                                       
Query: 231 atgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggc 290
           |||||||| |||||||||||| | ||||| || || |||||||| || ||||||||||| 
Sbjct: 218 atgcgcaccgagatcatcatccgcgccacccgcacccagaacgtcctcggcgagaagggg 277

                                                                       
Query: 291 cgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggc 350
            | |||||| | ||||| || ||||| || |||||||| ||||| ||||||||||| |||
Sbjct: 278 aggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttcccggagaatggc 337

                                                                       
Query: 351 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 410
           || || || || |||||||||||   |||||| ||||||||||||||||||||||| |||
Sbjct: 338 gtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatcgcccaggccgag 397

                                        
Query: 411 tcactccgatacaagctccttggaggcct 439
           || ||||| ||||||||||| || |||||
Sbjct: 398 tcgctccgctacaagctcctcggtggcct 426

---

>dbj|AK066905.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O21, full
           insert sequence
          Length = 926

 Score =  248 bits (125), Expect = 1e-62
 Identities = 278/329 (84%)
 Strand = Plus / Plus

                                                                       
Query: 111 cagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgag 170
           |||||||||||||||   ||||| |||   ||||| || |||| ||| ||||||||||||
Sbjct: 98  cagatcagcaagaagcgcaagttcgtggcggatggggtgttcttcgcggagctgaacgag 157

                                                                       
Query: 171 atgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccg 230
           |||||||| || ||||||||||||||||||||||||||||| ||||| ||||| || || 
Sbjct: 158 atgctgacgcgcgagctcgcggaggacggctactccggcgtcgaggtccgcgtcaccccc 217

                                                                       
Query: 231 atgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggc 290
           |||||||| |||||||||||| | ||||| || || |||||||| || ||||||||||| 
Sbjct: 218 atgcgcaccgagatcatcatccgcgccacccgcacccagaacgtcctcggcgagaagggg 277

                                                                       
Query: 291 cgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggc 350
            | |||||| | ||||| || ||||| || |||||||| ||||| ||||||||||| |||
Sbjct: 278 aggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttcccggagaatggc 337

                                                                       
Query: 351 gttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagag 410
           || || || || |||||||||||   |||||| ||||||||||||||||||||||| |||
Sbjct: 338 gtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatcgcccaggccgag 397

                                        
Query: 411 tcactccgatacaagctccttggaggcct 439
           || ||||| ||||||||||| || |||||
Sbjct: 398 tcgctccgctacaagctcctcggtggcct 426

---

>gb|AY130450.1| Petromyzon marinus ribosomal protein S3 mRNA, partial cds
          Length = 617

 Score =  168 bits (85), Expect = 1e-38
 Identities = 268/329 (81%)
 Strand = Plus / Plus

                                                                       
Query: 119 caagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgac 178
           |||||||||||||||||||  |||||| || ||| | |||||| |||||||| | |||||
Sbjct: 18  caagaagaagaagtttgtggccgatggagtcttcaaggccgagatgaacgagttcctgac 77

                                                                       
Query: 179 ccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcac 238
            ||||| ||||| || || ||||||  |||||||||||||||||| |||||||  |||||
Sbjct: 78  tcgggaactcgctgaagatggctacagcggcgtggaggtgcgcgtcacgccgacccgcac 137

                                                                       
Query: 239 ggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggat 298
           |||||||||||||   |||||  |||| ||||| ||||| || |||||||| ||  | ||
Sbjct: 138 ggagatcatcatcctcgccaccaggacccagaatgtgctgggagagaagggacgtcgcat 197

                                                                       
Query: 299 cagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaact 358
           | | |||||||| |||||| | |||||||| ||||| ||||| |||  | ||||||| ||
Sbjct: 198 ccgcgagctcacgtccgtcatccagaagcgattcaacttccctgagggcagcgttgagct 257

                                                                       
Query: 359 ttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccg 418
            || || |||||||| |  ||||||||||| |||||||||||||||   ||||| || ||
Sbjct: 258 gtacgcggagaaggtggcgaaccgtggcctatgcgccatcgcccagtgcgagtcgctgcg 317

                                        
Query: 419 atacaagctccttggaggccttgctgtcc 447
            |||||||| || ||||| || |||||||
Sbjct: 318 ctacaagctgctcggagggctcgctgtcc 346

---

>gb|DQ122868.1| Chlamydomonas incerta 40S ribosomal protein S3 mRNA, complete cds
          Length = 886

 Score =  167 bits (84), Expect = 4e-38
 Identities = 273/336 (81%)
 Strand = Plus / Plus

                                                                       
Query: 110 ccagatcagcaagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacga 169
           ||||||||||||||||  |||||| ||    || ||||| ||||||||||||||||||||
Sbjct: 24  ccagatcagcaagaagcggaagttcgtcgcggacggcgtgttctacgccgagctgaacga 83

                                                                       
Query: 170 gatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgcc 229
           | | |||||||| ||||| || ||||| ||||||||||| |||||||| |||||||| ||
Sbjct: 84  gctcctgacccgcgagctggccgaggatggctactccggtgtggaggtccgcgtgacccc 143

                                                                       
Query: 230 gatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
            |||||||| ||||| |||||| | || || || || ||||||||||| |||||||||||
Sbjct: 144 catgcgcactgagattatcatccgcgctacccgcacccagaacgtgctgggcgagaaggg 203

                                                                       
Query: 290 ccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacgg 349
           |||| | ||  | ||||| || || || || |||||||||||||| |||||     || |
Sbjct: 204 ccgccgcattcgcgagctgacctcggttgtgcagaagcgcttcaacttcccccctgacag 263

                                                                       
Query: 350 cgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcaga 409
           |||||| || || || |||||||||  | |||| || || ||||||||||||||||| ||
Sbjct: 264 cgttgagctgtacgctgagaaggtcagcgaccgcggtctgtgcgccatcgcccaggccga 323

                                               
Query: 410 gtcactccgatacaagctccttggaggccttgctgt 445
           ||| || || |||||||| || || ||||| |||||
Sbjct: 324 gtcgctgcgctacaagctgctgggtggcctggctgt 359

---

>dbj|AB246886.1| Lethenteron japonicum RPS3 mRNA for ribosomal protein S3, partial
           cds
          Length = 726

 Score =  163 bits (82), Expect = 6e-37
 Identities = 232/282 (82%)
 Strand = Plus / Plus

                                                                       
Query: 119 caagaagaagaagtttgtgagcgatggcgttttctacgccgagctgaacgagatgctgac 178
           |||||||||||||||||||  |||||| || ||| | |||||| |||||||| | |||||
Sbjct: 24  caagaagaagaagtttgtggccgatggagtcttcaaggccgagatgaacgagttcctgac 83

                                                                       
Query: 179 ccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcac 238
            ||||| ||||| || || ||||||  |||||||||||||||||| |||||||  |||||
Sbjct: 84  tcgggaactcgccgaagatggctacagcggcgtggaggtgcgcgtcacgccgacccgcac 143

                                                                       
Query: 239 ggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggat 298
           |||||||||||||   |||||  |||| ||||||||||| || |||||||| ||  | ||
Sbjct: 144 ggagatcatcatcctcgccaccaggacccagaacgtgctgggagagaagggacgtcgcat 203

                                                                       
Query: 299 cagggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaact 358
           | | |||||||| |||||| | |||||||| ||||| ||||| |||  | ||||||| ||
Sbjct: 204 ccgcgagctcacgtccgtcatccagaagcgattcaacttccctgagggcagcgttgagct 263

                                                     
Query: 359 ttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgc 400
            || || |||||||| |  ||||||||||| |||||||||||
Sbjct: 264 gtacgcggagaaggtggcgaaccgtggcctgtgcgccatcgc 305

---

>gb|AC079038.3|AC079038 Oryza sativa chromosome 7 clone OSJNBb0024A20, complete sequence
          Length = 129838

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Plus

                                                                          
Query: 141    gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 200
              ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 121244 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 121303

                                                                          
Query: 201    tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 260
              ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 121304 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 121363

                            
Query: 261    cggacgcagaacgt 274
              || || ||||||||
Sbjct: 121364 cgcacccagaacgt 121377



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Plus

                                                                          
Query: 279    ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 338
              |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 121485 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 121544

                                                                          
Query: 339    ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 398
              |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 121545 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 121604

                                                       
Query: 399    gcccaggcagagtcactccgatacaagctccttggaggcct 439
              |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 121605 gcccaggccgagtcgctccgctacaagctcctcggtggcct 121645

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                            
Query: 141      gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 200
                ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 24967909 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 24967850

                                                                            
Query: 201      tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 260
                ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 24967849 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 24967790

                              
Query: 261      cggacgcagaacgt 274
                || || ||||||||
Sbjct: 24967789 cgcacccagaacgt 24967776



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Minus

                                                                            
Query: 279      ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 338
                |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 24967668 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 24967609

                                                                            
Query: 339      ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 398
                |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 24967608 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 24967549

                                                         
Query: 399      gcccaggcagagtcactccgatacaagctccttggaggcct 439
                |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 24967548 gcccaggccgagtcgctccgctacaagctcctcggtggcct 24967508

---

>dbj|AP006458.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0072I06
          Length = 162411

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                          
Query: 141    gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 200
              ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 151541 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 151482

                                                                          
Query: 201    tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 260
              ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 151481 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 151422

                            
Query: 261    cggacgcagaacgt 274
              || || ||||||||
Sbjct: 151421 cgcacccagaacgt 151408



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Minus

                                                                          
Query: 279    ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 338
              |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 151300 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 151241

                                                                          
Query: 339    ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 398
              |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 151240 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 151181

                                                       
Query: 399    gcccaggcagagtcactccgatacaagctccttggaggcct 439
              |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 151180 gcccaggccgagtcgctccgctacaagctcctcggtggcct 151140

---

>dbj|AP005895.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
            clone:OSJNBb0018L13
          Length = 131155

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Minus

                                                                        
Query: 141  gatggcgttttctacgccgagctgaacgagatgctgacccgggagctcgcggaggacggc 200
            ||||| || |||| ||| |||||||||||||||||||| || ||||||||||||||||||
Sbjct: 8589 gatggggtgttcttcgcggagctgaacgagatgctgacgcgcgagctcgcggaggacggc 8530

                                                                        
Query: 201  tactccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacg 260
            ||||||||||| ||||| ||||| || || |||||||| |||||||||||| | ||||| 
Sbjct: 8529 tactccggcgtcgaggtccgcgtcacccccatgcgcaccgagatcatcatccgcgccacc 8470

                          
Query: 261  cggacgcagaacgt 274
            || || ||||||||
Sbjct: 8469 cgcacccagaacgt 8456



 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Minus

                                                                        
Query: 279  ggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttc 338
            |||||||||||  | |||||| | ||||| || ||||| || |||||||| ||||| |||
Sbjct: 8348 ggcgagaaggggaggaggatccgcgagctgacgtccgtggtgcagaagcggttcaacttc 8289

                                                                        
Query: 339  ccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatc 398
            |||||||| ||||| || || || |||||||||||   |||||| |||||||||||||||
Sbjct: 8288 ccggagaatggcgtcgagctctacgccgagaaggtgaacaaccgcggcctctgcgccatc 8229

                                                     
Query: 399  gcccaggcagagtcactccgatacaagctccttggaggcct 439
            |||||||| ||||| ||||| ||||||||||| || |||||
Sbjct: 8228 gcccaggccgagtcgctccgctacaagctcctcggtggcct 8188

---

>gb|AY107461.1| Zea mays PCO108959 mRNA sequence
          Length = 794

 Score =  129 bits (65), Expect = 8e-27
 Identities = 118/136 (86%)
 Strand = Plus / Plus

                                                                       
Query: 312 tccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttatgccgagaag 371
           |||||||| |||||| | ||||  ||||| ||||| ||||| || ||||| |||||||||
Sbjct: 22  tccgtcgtccagaagaggttcancttccctgagaatggcgtcgagctttacgccgagaag 81

                                                                       
Query: 372 gtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctcctt 431
           |||||||||||||| ||||| |||||||| ||||| ||||| ||||| ||||||||||| 
Sbjct: 82  gtcgtcaaccgtgggctctgtgccatcgcgcaggccgagtccctccgttacaagctcctc 141

                           
Query: 432 ggaggccttgctgtcc 447
           ||||||||||| ||||
Sbjct: 142 ggaggccttgccgtcc 157

---

>gb|AF429976.1| Spodoptera frugiperda ribosomal protein S3 mRNA, complete cds
          Length = 855

 Score =  103 bits (52), Expect = 5e-19
 Identities = 127/152 (83%)
 Strand = Plus / Plus

                                                                       
Query: 175 tgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgc 234
           ||||| ||||||| || ||||| ||||||||||| ||||||||||| || || ||||  |
Sbjct: 131 tgaccagggagcttgctgaggatggctactccggtgtggaggtgcgtgtcaccccgactc 190

                                                                       
Query: 235 gcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgca 294
           || ||||||||||||| | ||| ||| |||| ||||  ||||| || |||||||||||||
Sbjct: 191 gctcggagatcatcattatggctacgaggacacagagtgtgctcggagagaagggccgca 250

                                           
Query: 295 ggatcagggagctcacatccgtcgttcagaag 326
           | ||| | ||||| || |||||||||||||||
Sbjct: 251 gaatccgtgagctgacttccgtcgttcagaag 282



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                       
Query: 381 cgtggcctctgcgccatcgcccaggcagagtcactccgatacaagctccttggaggcctt 440
           ||||| || ||||||||||||||||| ||||| ||| ||||||| ||| ||||||| |||
Sbjct: 337 cgtggtctgtgcgccatcgcccaggccgagtctctcagatacaaactcattggaggtctt 396

             
Query: 441 gc 442
           ||
Sbjct: 397 gc 398

---

>gb|DQ241842.1| Solanum tuberosum clone 182H03 unknown mRNA
          Length = 938

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 166/205 (80%)
 Strand = Plus / Plus

                                                                       
Query: 243 atcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagg 302
           |||||||| || ||||| || || |||||||| ||||| ||||| ||  | |||||||||
Sbjct: 178 atcatcattagagccactcgtactcagaacgttcttggtgagaaaggtaggaggatcagg 237

                                                                       
Query: 303 gagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttat 362
           ||||| || || || ||||||||||| || ||||||  ||| ||| | ||||| || |||
Sbjct: 238 gagctgacttcagttgttcagaagcgttttaatttcaaggaaaacagtgttgagctctat 297

                                                                       
Query: 363 gccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatac 422
           || ||||| |||  |||  | || ||||| ||||| || |||||||||||||| ||||||
Sbjct: 298 gcagagaaagtcaacaataggggtctctgtgccattgctcaggcagagtcactgcgatac 357

                                    
Query: 423 aagctccttggaggccttgctgtcc 447
           ||| | |||||||| ||||||||||
Sbjct: 358 aagttacttggaggacttgctgtcc 382

---

>gb|AY521669.1| Pseudopleuronectes americanus 40S ribosomal protein S3 (RPS3) mRNA,
           complete cds
          Length = 804

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 229/290 (78%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||||||||||||| | ||||| |||||||| || ||||| || |||||||| ||||||
Sbjct: 66  gccgagctgaacgagttcctgactcgggagctggccgaggatggttactccggtgtggag 125

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           ||||| ||||| ||||   | || ||||||||||||  ||| ||  |||| |||| ||| 
Sbjct: 126 gtgcgagtgactccgaccaggaccgagatcatcatcctggctacaaggacccagagcgtc 185

                                                                       
Query: 276 cttggcgagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaat 335
           || || |||||||| ||  ||||||| ||||| ||  | || || |||||| | |||   
Sbjct: 186 ctgggagagaaggggcgtcggatcagagagctgaccgctgtggtccagaagaggttcggc 245

                                                                       
Query: 336 ttcccggagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgcc 395
           ||||| |||  | |||| || || ||||| |||||||||| || ||||||  | || |||
Sbjct: 246 ttccctgagggcagcgtggagctgtatgctgagaaggtcgccacccgtggtttgtgtgcc 305

                                                             
Query: 396 atcgcccaggcagagtcactccgatacaagctccttggaggccttgctgt 445
           ||||| ||||||||||| || || |||||||| || |||||||| |||||
Sbjct: 306 atcgctcaggcagagtctctgcgctacaagctgctcggaggcctggctgt 355

---

>gb|BT012908.1| Lycopersicon esculentum clone 114026F, mRNA sequence
          Length = 999

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 165/205 (80%)
 Strand = Plus / Plus

                                                                       
Query: 243 atcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatcagg 302
           |||||||| || ||||| || || |||||||| ||||| ||||| ||  | |||||||||
Sbjct: 228 atcatcattagagccactcgtactcagaacgttcttggtgagaaaggtaggaggatcagg 287

                                                                       
Query: 303 gagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactttat 362
           ||||| || || || ||||||||||| || ||||||  ||| |||   ||||| || |||
Sbjct: 288 gagctgacttcagttgttcagaagcgttttaatttcaaggaaaacactgttgagctctat 347

                                                                       
Query: 363 gccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtcactccgatac 422
           || ||||| |||  |||  | || ||||| ||||| || |||||||||||||| ||||||
Sbjct: 348 gctgagaaagtcaacaataggggtctctgtgccattgctcaggcagagtcactgcgatac 407

                                    
Query: 423 aagctccttggaggccttgctgtcc 447
           ||| | |||||||| ||||||||||
Sbjct: 408 aagttacttggaggacttgctgtcc 432

---

>gb|U12708.1|MSU12708 Manduca sexta ribosomal protein S3 mRNA, complete cds
          Length = 778

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 186/233 (79%)
 Strand = Plus / Plus

                                                                       
Query: 180 cgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacg 239
           |||||||| || ||||| ||||||||||||||||||||||| || || || |  ||  ||
Sbjct: 101 cgggagctggctgaggatggctactccggcgtggaggtgcgtgtcacccctacccgatcg 160

                                                                       
Query: 240 gagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatc 299
           ||||||||||||| ||||||  |||| |||| |||||| || |||||||||||| | |||
Sbjct: 161 gagatcatcatcatggccaccaggacacagagcgtgctcggagagaagggccgccgcatc 220

                                                                       
Query: 300 agggagctcacatccgtcgttcagaagcgcttcaatttcccggagaacggcgttgaactt 359
            | ||| | || || ||||| |||||||| |||||  |||||||  |   ||| || || 
Sbjct: 221 cgcgagttgacttcggtcgtgcagaagcggttcaacatcccggaacagtccgtggagctg 280

                                                                
Query: 360 tatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggcagagtc 412
           || || ||||| || | || |||||| |||||||||||||| ||||| |||||
Sbjct: 281 tacgctgagaaagttgccacccgtggtctctgcgccatcgctcaggccgagtc 333

---

>gb|AY769316.1| Bombyx mori ribosomal protein S3 (RpS3) mRNA, complete cds
          Length = 805

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 126/154 (81%)
 Strand = Plus / Plus

                                                                       
Query: 181 gggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatgcgcacgg 240
           ||||||| || ||||||||||||||||||||||| ||||| || || || || ||| |||
Sbjct: 107 gggagctggccgaggacggctactccggcgtggaagtgcgggtcactcccatccgctcgg 166

                                                                       
Query: 241 agatcatcatcagggccacgcggacgcagaacgtgcttggcgagaagggccgcaggatca 300
           ||||||| || | ||||||  |||| ||||  ||||| || ||||| || ||||| ||| 
Sbjct: 167 agatcattattatggccaccaggacacagagtgtgctcggagagaaaggacgcagaatcc 226

                                             
Query: 301 gggagctcacatccgtcgttcagaagcgcttcaa 334
           | |||||||| ||||| || |||||||| |||||
Sbjct: 227 gtgagctcacttccgtagtacagaagcgattcaa 260

---

>emb|AM048962.1| Scarabaeus laticollis mRNA for ribosomal protein S3e (rpS3e gene)
          Length = 726

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 210/266 (78%)
 Strand = Plus / Plus

                                                                       
Query: 162 ctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgc 221
           ||||||||| | || ||| ||||||| || ||||| || |||||||| || |||||  | 
Sbjct: 61  ctgaacgagttcctcaccagggagctggctgaggatggatactccggggttgaggttagg 120

                                                                       
Query: 222 gtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggc 281
           || || ||||  ||||| ||||||||||||| ||| || || |||||||||||||| || 
Sbjct: 121 gtcaccccgactcgcaccgagatcatcatcatggcgacccgcacgcagaacgtgctggga 180

                                                                       
Query: 282 gagaagggccgcaggatcagggagctcacatccgtcgttcagaagcgcttcaatttcccg 341
           |||||||| ||| | ||| | ||||| || || ||||| |||||||| ||||| || || 
Sbjct: 181 gagaaggggcgccgcatccgagagctgacgtcggtcgtccagaagcgtttcaactttccc 240

                                                                       
Query: 342 gagaacggcgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcc 401
           ||| ||   || || || || || || ||||| | || | | || |||||||||||||||
Sbjct: 241 gagcactctgtcgagctgtacgcggaaaaggtggccaccaggggtctctgcgccatcgcc 300

                                     
Query: 402 caggcagagtcactccgatacaagct 427
           ||||| ||||| ||||| ||||||||
Sbjct: 301 caggcggagtctctccgctacaagct 326

---

>emb|BX071951.1|CNS09ROJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 841 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 782

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 781 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 722

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 721 ctgggtgagaaggg 708

---

>emb|BX071950.1|CNS09ROI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 155 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 214

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 215 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 274

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 275 ctgggtgagaaggg 288

---

>emb|BX071838.1|CNS09RLE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 995

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 879 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 820

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 819 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 760

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 759 ctgggtgagaaggg 746

---

>emb|BX071486.1|CNS09RBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 879 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 820

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 819 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 760

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 759 ctgggtgagaaggg 746

---

>emb|BX060955.1|CNS09J73 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 77  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 136

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 137 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 196

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 197 ctgggtgagaaggg 210

---

>emb|BX069342.1|CNS09PO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 111 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 170

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 171 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 230

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 231 ctgggtgagaaggg 244

---

>emb|BX068384.1|CNS09OXG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 894 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 835

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 834 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 775

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 774 ctgggtgagaaggg 761

---

>emb|BX068060.1|CNS09OOG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 110 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 169

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 170 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 229

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 230 ctgggtgagaaggg 243

---

>emb|BX067052.1|CNS09NWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 891 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 832

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 831 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 772

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 771 ctgggtgagaaggg 758

---

>emb|BX066892.1|CNS09NS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 99  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 158

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 159 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 218

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 219 ctgggtgagaaggg 232

---

>emb|BX066853.1|CNS09NQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 878 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 819

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 818 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 759

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 758 ctgggtgagaaggg 745

---

>emb|BX065632.1|CNS09MT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 74  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 133

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 134 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 193

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 194 ctgggtgagaaggg 207

---

>emb|BX065002.1|CNS09MBI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 874 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 815

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 814 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 755

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 754 ctgggtgagaaggg 741

---

>emb|BX062894.1|CNS09KOY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 881 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 822

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 821 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 762

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 761 ctgggtgagaaggg 748

---

>emb|BX062466.1|CNS09KD2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 104 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 163

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 164 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 223

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 224 ctgggtgagaaggg 237

---

>emb|BX062034.1|CNS09K12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 882 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 823

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 822 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 763

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 762 ctgggtgagaaggg 749

---

>emb|BX061570.1|CNS09JO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 881 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 822

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 821 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 762

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 761 ctgggtgagaaggg 748

---

>emb|BX061429.1|CNS09JK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 873 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 814

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 813 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 754

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 753 ctgggtgagaaggg 740

---

>emb|BX061247.1|CNS09JF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 96  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 155

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 156 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 215

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 216 ctgggtgagaaggg 229

---

>emb|BX060666.1|CNS09IZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 870 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 811

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 810 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 751

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 750 ctgggtgagaaggg 737

---

>emb|BX060145.1|CNS09IKL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 872 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 813

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 812 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 753

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 752 ctgggtgagaaggg 739

---

>emb|BX060064.1|CNS09IIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 89  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 148

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 149 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 208

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 209 ctgggtgagaaggg 222

---

>emb|BX060018.1|CNS09IH2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 885 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 826

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 825 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 766

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 765 ctgggtgagaaggg 752

---

>emb|BX056467.1|CNS09FQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 97  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 156

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 157 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 216

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 217 ctgggtgagaaggg 230

---

>emb|BX054555.1|CNS09E9B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 873 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 814

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 813 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 754

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 753 ctgggtgagaaggg 740

---

>emb|BX054554.1|CNS09E9A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 550 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 609

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 610 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 669

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 670 ctgggtgagaaggg 683

---

>emb|BX054507.1|CNS09E7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 892 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 833

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 832 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 773

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 772 ctgggtgagaaggg 759

---

>emb|BX049946.1|CNS09APA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 886 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 827

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 826 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 767

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 766 ctgggtgagaaggg 753

---

>emb|BX049133.1|CNS09A2P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 879 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 820

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 819 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 760

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 759 ctgggtgagaaggg 746

---

>emb|BX048656.1|CNS099PG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23DG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 83  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 142

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 143 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 202

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 203 ctgggtgagaaggg 216

---

>emb|BX048195.1|CNS099CN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC23BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 115 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 174

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 175 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 234

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 235 ctgggtgagaaggg 248

---

>emb|BX044635.1|CNS096LR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 558

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 110 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 169

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 170 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 229

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 230 ctgggtgagaaggg 243

---

>emb|BX043729.1|CNS095WL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 311

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 89  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 148

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 149 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 208

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 209 ctgggtgagaaggg 222

---

>emb|BX043605.1|CNS095T5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC16BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 111 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 170

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 171 gtccgtgtcacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 230

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 231 ctgggtgagaaggg 244

---

>emb|BX043171.1|CNS095H3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 884 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 825

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 824 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 765

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 764 ctgggtgagaaggg 751

---

>emb|BX042318.1|CNS094TE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC14BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 888 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 829

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 828 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 769

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 768 ctgggtgagaaggg 755

---

>emb|BX041935.1|CNS094IR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 113 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 172

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 173 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 232

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 233 ctgggtgagaaggg 246

---

>emb|BX041378.1|CNS0943A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 700 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 641

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 640 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 581

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 580 ctgggtgagaaggg 567

---

>emb|BX040880.1|CNS093PG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 973

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 906 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 847

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 846 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 787

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 786 ctgggtgagaaggg 773

---

>emb|BX040349.1|CNS093AP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 129 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 188

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 189 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 248

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 249 ctgggtgagaaggg 262

---

>emb|BX040104.1|CNS0933W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 108 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 167

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 168 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 227

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 228 ctgggtgagaaggg 241

---

>emb|BX039345.1|CNS092IT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 94  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 153

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 154 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 213

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 214 ctgggtgagaaggg 227

---

>emb|BX039168.1|CNS092DW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 638

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 132 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 191

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 192 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 251

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 252 ctgggtgagaaggg 265

---

>emb|BX038309.1|CNS091Q1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 117 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 176

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 177 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 236

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 237 ctgggtgagaaggg 250

---

>emb|BX036899.1|CNS090MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 892 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 833

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 832 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 773

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 772 ctgggtgagaaggg 759

---

>emb|BX036837.1|CNS090L5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 382

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 86  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 145

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 146 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 205

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 206 ctgggtgagaaggg 219

---

>emb|BX034717.1|CNS08YY9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 100 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 159

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 160 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 219

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 220 ctgggtgagaaggg 233

---

>emb|BX032839.1|CNS08XI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 883 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 824

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 823 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 764

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 763 ctgggtgagaaggg 750

---

>emb|BX030549.1|CNS08VQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 147 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 206

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 207 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 266

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 267 ctgggtgagaaggg 280

---

>emb|BX022272.1|CNS08PCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34AE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 169 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 228

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 229 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 288

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 289 ctgggtgagaaggg 302

---

>emb|BX027874.1|CNS08TO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 849

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 166 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 225

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 226 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 285

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 286 ctgggtgagaaggg 299

---

>emb|BX027294.1|CNS08T82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 893 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 834

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 833 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 774

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 773 ctgggtgagaaggg 760

---

>emb|BX024682.1|CNS08R7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 93  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 152

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 153 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 212

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 213 ctgggtgagaaggg 226

---

>emb|BX019560.1|CNS08N98 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 256

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 23  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 82

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 83  gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 142

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 143 ctgggtgagaaggg 156

---

>emb|BX020703.1|CNS08O4Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 169 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 228

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 229 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 288

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 289 ctgggtgagaaggg 302

---

>emb|BX018305.1|CNS08MAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 902

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 875 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 816

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 815 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 756

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 755 ctgggtgagaaggg 742

---

>emb|BX012403.1|CNS08HQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 160 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 219

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 220 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 279

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 280 ctgggtgagaaggg 293

---

>emb|BX006777.1|CNS08DE5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 156 gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 215

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 216 gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 275

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 276 ctgggtgagaaggg 289

---

>ref|XM_321155.2| Anopheles gambiae str. PEST ENSANGP00000020844
           (ENSANGG00000018355), partial mRNA
          Length = 702

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 156 gccgagctgaacgagatgctgacccgggagctcgcggaggacggctactccggcgtggag 215
           ||||| || |||||| | ||||| || ||||| || ||||| || |||||||||||||||
Sbjct: 28  gccgaactcaacgagttcctgactcgtgagctggccgaggatggatactccggcgtggag 87

                                                                       
Query: 216 gtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtg 275
           || || || |||||||  ||||| || |||||||||| |||||| || || |||||||||
Sbjct: 88  gtccgtgttacgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtg 147

                         
Query: 276 cttggcgagaaggg 289
           || || ||||||||
Sbjct: 148 ctgggtgagaaggg 161

---

>emb|BX067207.1|CNS09O0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 89  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 148

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 149 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 208

                
Query: 285 aaggg 289
           |||||
Sbjct: 209 aaggg 213

---

>emb|BX071776.1|CNS09RJO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 112 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 171

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 172 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 231

                
Query: 285 aaggg 289
           |||||
Sbjct: 232 aaggg 236

---

>emb|BX070615.1|CNS09QNF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 570

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 95  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 154

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 155 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 214

                
Query: 285 aaggg 289
           |||||
Sbjct: 215 aaggg 219

---

>emb|BX067880.1|CNS09OJG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 114 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 173

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 174 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 233

                
Query: 285 aaggg 289
           |||||
Sbjct: 234 aaggg 238

---

>emb|BX067051.1|CNS09NWF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 108 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 167

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 168 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 227

                
Query: 285 aaggg 289
           |||||
Sbjct: 228 aaggg 232

---

>emb|BX065756.1|CNS09MWG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 172

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 8   aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 67

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 68  acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 127

                
Query: 285 aaggg 289
           |||||
Sbjct: 128 aaggg 132

---

>emb|BX062033.1|CNS09K11 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 83  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 142

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 143 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 202

                
Query: 285 aaggg 289
           |||||
Sbjct: 203 aaggg 207

---

>emb|BX061592.1|CNS09JOS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 102 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 161

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 162 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 221

                
Query: 285 aaggg 289
           |||||
Sbjct: 222 aaggg 226

---

>emb|BX059556.1|CNS09I48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 602

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 7   aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 66

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 67  acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 126

                
Query: 285 aaggg 289
           |||||
Sbjct: 127 aaggg 131

---

>emb|BX059139.1|CNS09HSN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 100 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 159

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 160 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 219

                
Query: 285 aaggg 289
           |||||
Sbjct: 220 aaggg 224

---

>emb|BX056167.1|CNS09FI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 110 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 169

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 170 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 229

                
Query: 285 aaggg 289
           |||||
Sbjct: 230 aaggg 234

---

>emb|BX054567.1|CNS09E9N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 862 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 803

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 802 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 743

                
Query: 285 aaggg 289
           |||||
Sbjct: 742 aaggg 738

---

>emb|BX049132.1|CNS09A2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 104 aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 163

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 164 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 223

                
Query: 285 aaggg 289
           |||||
Sbjct: 224 aaggg 228

---

>emb|BX047370.1|CNS098PQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC21CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 71  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 130

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 131 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 190

                
Query: 285 aaggg 289
           |||||
Sbjct: 191 aaggg 195

---

>emb|BX046671.1|CNS0986B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC20BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 52  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 111

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 112 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 171

                
Query: 285 aaggg 289
           |||||
Sbjct: 172 aaggg 176

---

>emb|BX041377.1|CNS09439 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC12CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 4   aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 63

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 64  acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 123

                
Query: 285 aaggg 289
           |||||
Sbjct: 124 aaggg 128

---

>emb|BX040698.1|CNS093KE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 603

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 89  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 148

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 149 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 208

                
Query: 285 aaggg 289
           |||||
Sbjct: 209 aaggg 213

---

>emb|BX040183.1|CNS09363 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 448

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 57  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 116

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 117 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 176

                
Query: 285 aaggg 289
           |||||
Sbjct: 177 aaggg 181

---

>emb|BX040080.1|CNS09338 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 98  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 157

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 158 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 217

                
Query: 285 aaggg 289
           |||||
Sbjct: 218 aaggg 222

---

>emb|BX039936.1|CNS092Z8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10BH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 104/125 (83%)
 Strand = Plus / Plus

                                                                       
Query: 165 aacgagatgctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtg 224
           |||||| | ||||| || ||||| || ||||| || ||||||||||||||||| || || 
Sbjct: 91  aacgagttcctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgtt 150

                                                                       
Query: 225 acgccgatgcgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgag 284
           |||||||  ||||| || |||||||||| |||||| || || ||||||||||| || |||
Sbjct: 151 acgccgacccgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgag 210

                
Query: 285 aaggg 289
           |||||
Sbjct: 211 aaggg 215

---

>gb|DQ415986.1| Anopheles quadrimaculatus ribosomal protein S3 (RPS3) mRNA, partial
           cds
          Length = 336

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 205 ccggcgtggaggtgcgcgtgacgccgatgcgcacggagatcatcatcagggccacgcgga 264
           |||| |||||||| |||||||| ||||  |||||||| |||||||||| |||||| || |
Sbjct: 1   ccggtgtggaggtccgcgtgaccccgacccgcacggaaatcatcatcatggccacccgca 60

                                    
Query: 265 cgcagaacgtgcttggcgagaaggg 289
           | ||||||||||| |||||||||||
Sbjct: 61  cccagaacgtgctgggcgagaaggg 85



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Plus

                                                                    
Query: 350 cgttgaactttatgccgagaaggtcgtcaaccgtggcctctgcgccatcgcccaggc 406
           |||||| || || ||||||||||| | || |||||| || |||||||| ||||||||
Sbjct: 146 cgttgagctgtacgccgagaaggtggccacccgtggtctgtgcgccattgcccaggc 202

---

>emb|BX053436.1|CNS09DE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 551

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX071837.1|CNS09RLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX071741.1|CNS09RIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX071696.1|CNS09RHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX071616.1|CNS09RF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX071485.1|CNS09RBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 887

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX070633.1|CNS09QNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX070555.1|CNS09QLR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 908

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX070506.1|CNS09QKE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX070477.1|CNS09QJL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX070421.1|CNS09QI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX070161.1|CNS09QAT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 761

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX069948.1|CNS09Q4W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX069682.1|CNS09PXI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 337

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX069666.1|CNS09PX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061066.1|CNS09JA6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 450

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX069429.1|CNS09PQH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX069304.1|CNS09PN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX069215.1|CNS09PKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 492

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX068963.1|CNS09PDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX068877.1|CNS09PB5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX068410.1|CNS09OY6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX068383.1|CNS09OXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX068027.1|CNS09ONJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX067933.1|CNS09OKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX067909.1|CNS09OK9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX067157.1|CNS09NZD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066852.1|CNS09NQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 498

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066794.1|CNS09NPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066745.1|CNS09NNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066721.1|CNS09NN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 496

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066470.1|CNS09NGA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066232.1|CNS09N9O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX066176.1|CNS09N84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX065879.1|CNS09MZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX065812.1|CNS09MY0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggttcgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX065503.1|CNS09MPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX065323.1|CNS09MKF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX065196.1|CNS09MGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX065001.1|CNS09MBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064962.1|CNS09MAE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064919.1|CNS09M97 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064727.1|CNS09M3V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064562.1|CNS09LZA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 255

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064439.1|CNS09LVV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 779

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064384.1|CNS09LUC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064214.1|CNS09LPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064116.1|CNS09LMW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX064054.1|CNS09LL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX063320.1|CNS09L0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX062932.1|CNS09KQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 364

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX062893.1|CNS09KOX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 842

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX062127.1|CNS09K3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 602

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX062120.1|CNS09K3G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061743.1|CNS09JSZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061707.1|CNS09JRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061620.1|CNS09JPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061569.1|CNS09JO5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061480.1|CNS09JLO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061428.1|CNS09JK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX061229.1|CNS09JEP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060846.1|CNS09J42 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060810.1|CNS09J32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 418

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060665.1|CNS09IZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060607.1|CNS09IXF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 880

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060402.1|CNS09IRQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060375.1|CNS09IQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060144.1|CNS09IKK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060066.1|CNS09IIE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX060017.1|CNS09IH1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX059858.1|CNS09ICM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX059821.1|CNS09IBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX059045.1|CNS09HQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX059018.1|CNS09HPA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX058900.1|CNS09HM0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX058711.1|CNS09HGR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 674

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX058653.1|CNS09HF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 423

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX058108.1|CNS09H00 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX058103.1|CNS09GZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056701.1|CNS09FWX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcacggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056662.1|CNS09FVU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX057998.1|CNS09GWY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX057677.1|CNS09GO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX057652.1|CNS09GNC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX057544.1|CNS09GKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 501

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056968.1|CNS09G4C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 427

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056933.1|CNS09G3D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 192

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056922.1|CNS09G32 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056881.1|CNS09G1X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056500.1|CNS09FRC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 401

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056452.1|CNS09FQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 111 ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 170

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 171 cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 226

---

>emb|BX056428.1|CNS09FPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056307.1|CNS09FLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056230.1|CNS09FJU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX056041.1|CNS09FEL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 26  ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 85

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 86  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 141

---

>emb|BX055677.1|CNS09F4H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 154

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX055410.1|CNS09EX2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX055261.1|CNS09ESX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 226

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX055241.1|CNS09ESD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 553

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX055192.1|CNS09ER0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 825

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053297.1|CNS09DAD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053259.1|CNS09D9B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 752

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053160.1|CNS09D6K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 319

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053115.1|CNS09D5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30CE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX055101.1|CNS09EOH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054976.1|CNS09EL0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 603

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054840.1|CNS09EH8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054826.1|CNS09EGU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 505

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054822.1|CNS09EGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX052983.1|CNS09D1N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054566.1|CNS09E9M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054506.1|CNS09E7Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054212.1|CNS09DZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 685

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054111.1|CNS09DWZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054075.1|CNS09DVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 621

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX054013.1|CNS09DU9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 448

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053925.1|CNS09DRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053867.1|CNS09DQ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053857.1|CNS09DPX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053809.1|CNS09DOL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 688

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053792.1|CNS09DO4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 387

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053731.1|CNS09DMF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31CC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 368

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053652.1|CNS09DK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 546

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX053641.1|CNS09DJX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 273

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX052756.1|CNS09CVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 781

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX052547.1|CNS09CPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 796

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX052229.1|CNS09CGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 681

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX052113.1|CNS09CDH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX052101.1|CNS09CD5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX051814.1|CNS09C56 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 357

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX051793.1|CNS09C4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX051525.1|CNS09BX5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX051501.1|CNS09BWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28DE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050130.1|CNS09AUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 670

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050103.1|CNS09ATN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 607

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX051072.1|CNS09BKK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 424

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050743.1|CNS09BBF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050675.1|CNS09B9J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050615.1|CNS09B7V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 583

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050346.1|CNS09B0E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX050277.1|CNS09AYH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX049975.1|CNS09AQ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX049945.1|CNS09AP9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC26AE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX049331.1|CNS09A87 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 302

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119

---

>emb|BX049176.1|CNS09A3W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 174 ctgacccgggagctcgcggaggacggctactccggcgtggaggtgcgcgtgacgccgatg 233
           ||||| || ||||| || ||||| || ||||||||||||||||| || || |||||||  
Sbjct: 4   ctgactcgtgagctggccgaggatggatactccggcgtggaggtccgtgttacgccgacc 63

                                                                   
Query: 234 cgcacggagatcatcatcagggccacgcggacgcagaacgtgcttggcgagaaggg 289
           ||||| || |||||||||| |||||| || || ||||||||||| || ||||||||
Sbjct: 64  cgcacagaaatcatcatcatggccacccgcacccagaacgtgctgggtgagaaggg 119


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,629,313
Number of Sequences: 3902068
Number of extensions: 3629313
Number of successful extensions: 66596
Number of sequences better than 10.0: 870
Number of HSP's better than 10.0 without gapping: 867
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 64722
Number of HSP's gapped (non-prelim): 1833
length of query: 447
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 425
effective length of database: 17,147,199,772
effective search space: 7287559903100
effective search space used: 7287559903100
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---