| Clone Name | bast10h06 |
|---|---|
| Clone Library Name | barley_pub |
| No. | Definition | Score (bits) |
E Value |
1 | gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome | 40 | 3.5 | 2 | dbj|AB053455.1| Burkholderia glumae gene for putative HrpO, comp... | 40 | 3.5 |
|---|
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome Length = 2932766 Score = 40.1 bits (20), Expect = 3.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 197 ggcgcagctccggccagagggatc 220 ||||||||||||||||| |||||| Sbjct: 2058527 ggcgcagctccggccagcgggatc 2058550
>dbj|AB053455.1| Burkholderia glumae gene for putative HrpO, complete cds Length = 2920 Score = 40.1 bits (20), Expect = 3.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 acagagcatggcggcgcgag 43 |||||||||||||||||||| Sbjct: 1442 acagagcatggcggcgcgag 1461 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,288,196 Number of Sequences: 3902068 Number of extensions: 1288196 Number of successful extensions: 24149 Number of sequences better than 10.0: 2 Number of HSP's better than 10.0 without gapping: 2 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24135 Number of HSP's gapped (non-prelim): 14 length of query: 269 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 247 effective length of database: 17,147,199,772 effective search space: 4235358343684 effective search space used: 4235358343684 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)