ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name bast09d07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK071066.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 2e-94
2dbj|AK058994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 353 2e-94
3gb|AY104216.1| Zea mays PCO109946 mRNA sequence 329 2e-87
4dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 268 8e-69
5gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 268 8e-69
6emb|AL731756.4|CNS08C85 Oryza sativa chromosome 12, . BAC OJ1220... 268 8e-69
7ref|NM_118616.3| Arabidopsis thaliana ATP binding / argininosucc... 123 3e-25
8gb|AY091319.1| Arabidopsis thaliana putative argininosuccinate s... 123 3e-25
9gb|AY065252.1| Arabidopsis thaliana putative argininosuccinate s... 123 3e-25
10emb|BX826988.1|CNS0A2FT Arabidopsis thaliana Full-length cDNA Co... 123 3e-25
11emb|BX827386.1|CNS0A2HY Arabidopsis thaliana Full-length cDNA Co... 94 2e-16
12emb|AL161562.2|ATCHRIV62 Arabidopsis thaliana DNA chromosome 4, ... 84 2e-13
13emb|AL049657.1|ATF6I7 Arabidopsis thaliana DNA chromosome 4, BAC... 84 2e-13
14gb|AC126782.23| Medicago truncatula clone mth2-14p11, complete s... 60 3e-06
15gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete ge... 60 3e-06
16gb|BC081578.1| Danio rerio argininosuccinate synthetase, mRNA (c... 54 2e-04
17ref|NM_001004603.1| Danio rerio argininosuccinate synthetase (as... 54 2e-04
18dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete ge... 54 2e-04
19gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1... 54 2e-04
20gb|AE010147.1| Pyrococcus furiosus DSM 3638, section 22 of 173 o... 52 8e-04
21gb|BC046941.1| Xenopus laevis arginosuccinate synthetase 1, mRNA... 48 0.013
22emb|AL935254.1| Lactobacillus plantarum strain WCFS1 complete ge... 48 0.013
23gb|AE014133.1| Streptococcus mutans UA159, complete genome 44 0.20
24gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 44 0.20
25gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 44 0.20
26emb|AL590438.12| Human DNA sequence from clone RP11-22L13 on chr... 42 0.81
27gb|AC136987.11| Mus musculus chromosome 16, clone RP24-129J16, c... 40 3.2
28gb|AC107700.12| Mus musculus chromosome 3, clone RP23-288N9, com... 40 3.2
29gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome 40 3.2
30gb|AC127417.3| Mus musculus BAC clone RP23-459M2 from chromosome... 40 3.2
31ref|XR_004489.1| PREDICTED: Mus musculus argininosuccinate synth... 40 3.2
32ref|XR_001542.1| PREDICTED: Mus musculus argininosuccinate synth... 40 3.2
33ref|XR_001541.1| PREDICTED: Mus musculus argininosuccinate synth... 40 3.2
34gb|AC123553.4| Mus musculus BAC clone RP24-566O21 from chromosom... 40 3.2
35gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosom... 40 3.2
36emb|AL772392.4| Human DNA sequence from clone RP11-450P7 on chro... 40 3.2
37emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chr... 40 3.2
38emb|AL353717.13| Human DNA sequence from clone RP11-562M8 on chr... 40 3.2
39emb|AL031054.1|HS48G12 Human DNA sequence from clone RP1-48G12 o... 40 3.2
40dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 40 3.2
41dbj|AK149489.1| Mus musculus adult male liver tumor cDNA, RIKEN ... 40 3.2
42ref|NG_005207.1| Homo sapiens argininosuccinate synthetase pseud... 40 3.2
43dbj|AK146635.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 40 3.2
44gb|AC092814.2| Homo sapiens chromosome 1 clone RP11-565J7, compl... 40 3.2
45ref|NG_000847.1| Homo sapiens argininosuccinate synthetase pseud... 40 3.2
46gb|AC012325.9| Homo sapiens chromosome 16 clone RP11-93H5, compl... 40 3.2
47gb|AC132186.3| Homo sapiens chromosome 16 clone CTD-2258A20, com... 40 3.2
48gb|AC005000.2|AC005000 Homo sapiens clone RP1-241P17, complete s... 40 3.2
49gb|BC087556.1| Mus musculus argininosuccinate synthetase 1, mRNA... 40 3.2
50gb|BC002074.1| Mus musculus argininosuccinate synthetase 1, mRNA... 40 3.2
51emb|CR936278.9| Zebrafish DNA sequence from clone CH211-46O5 in ... 40 3.2
52ref|NR_002687.1| Mus musculus argininosuccinate synthase-like (L... 40 3.2
53emb|AL929062.10| Mouse DNA sequence from clone RP23-342J9 on chr... 40 3.2
54ref|NM_007494.2| Mus musculus argininosuccinate synthetase 1 (As... 40 3.2
55gb|M31690.1|MUSASSB Mouse argininosuccinate synthetase (Ass) mRN... 40 3.2 
>dbj|AK071066.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081B09, full
           insert sequence
          Length = 1752

 Score =  353 bits (178), Expect = 2e-94
 Identities = 229/246 (93%)
 Strand = Plus / Plus

                                                                       
Query: 3   atgttgccaaggaagttggcgcagatgcagttgctcatgggtgcactggaaagggaaatg 62
           ||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||||
Sbjct: 603 atgttgcaaaggaagttggtgcagatgcagttgctcatggatgcactggaaaaggcaatg 662

                                                                       
Query: 63  atcaggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcac 122
           |||||||||| |||||||||||||| ||||| ||||| || || ||||||||||||||||
Sbjct: 663 atcaggttcgttttgagcttacattctatgctttaaaccctgagcttaaagtggtggcac 722

                                                                       
Query: 123 cctggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacaca 182
           | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 723 cttggagggagtgggatatcacaggacgtgaagatgctattgagtatgcaaagaaacaca 782

                                                                       
Query: 183 atgtgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacc 242
           ||||||||||||| ||| |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 783 atgtgccaattcctgttacaaagaaatcaatatacagccgtgatcgaaatttgtggcacc 842

                 
Query: 243 ttagcc 248
           ||||||
Sbjct: 843 ttagcc 848
to top
>dbj|AK058994.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-020-F12, full
           insert sequence
          Length = 1290

 Score =  353 bits (178), Expect = 2e-94
 Identities = 229/246 (93%)
 Strand = Plus / Plus

                                                                       
Query: 3   atgttgccaaggaagttggcgcagatgcagttgctcatgggtgcactggaaagggaaatg 62
           ||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||||
Sbjct: 162 atgttgcaaaggaagttggtgcagatgcagttgctcatggatgcactggaaaaggcaatg 221

                                                                       
Query: 63  atcaggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcac 122
           |||||||||| |||||||||||||| ||||| ||||| || || ||||||||||||||||
Sbjct: 222 atcaggttcgttttgagcttacattctatgctttaaaccctgagcttaaagtggtggcac 281

                                                                       
Query: 123 cctggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacaca 182
           | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 282 cttggagggagtgggatatcacaggacgtgaagatgctattgagtatgcaaagaaacaca 341

                                                                       
Query: 183 atgtgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacc 242
           ||||||||||||| ||| |||||||||||||||||||||| ||| |||||||||||||||
Sbjct: 342 atgtgccaattcctgttacaaagaaatcaatatacagccgtgatcgaaatttgtggcacc 401

                 
Query: 243 ttagcc 248
           ||||||
Sbjct: 402 ttagcc 407
to top
>gb|AY104216.1| Zea mays PCO109946 mRNA sequence
          Length = 1750

 Score =  329 bits (166), Expect = 2e-87
 Identities = 226/246 (91%)
 Strand = Plus / Plus

                                                                       
Query: 3   atgttgccaaggaagttggcgcagatgcagttgctcatgggtgcactggaaagggaaatg 62
           ||||||||||||||||||| || ||||||||||| ||||| ||||||||||| || ||||
Sbjct: 648 atgttgccaaggaagttggtgcggatgcagttgcccatggttgcactggaaaaggcaatg 707

                                                                       
Query: 63  atcaggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcac 122
           ||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||
Sbjct: 708 atcaggttcgctttgagcttacattctatgctttaaatcctgaacttaaagtggtggcac 767

                                                                       
Query: 123 cctggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacaca 182
           | ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
Sbjct: 768 cttggagggagtgggatatcacaggacgtgaagatgctattgaatatgcaaagaaacata 827

                                                                       
Query: 183 atgtgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacc 242
           |||| ||  |||| |||||||||||||||||||||||||||||  |||| ||||||||||
Sbjct: 828 atgtacctgttccagtttcaaagaaatcaatatacagccgagaccgaaacttgtggcacc 887

                 
Query: 243 ttagcc 248
           ||||||
Sbjct: 888 ttagcc 893
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  268 bits (135), Expect = 8e-69
 Identities = 171/183 (93%)
 Strand = Plus / Plus

                                                                           
Query: 66      aggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcaccct 125
               ||||||| |||||||||||||| ||||| ||||| || || ||||||||||||||||| |
Sbjct: 7431961 aggttcgttttgagcttacattctatgctttaaaccctgagcttaaagtggtggcacctt 7432020

                                                                           
Query: 126     ggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatg 185
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 7432021 ggagggagtgggatatcacaggacgtgaagatgctattgagtatgcaaagaaacacaatg 7432080

                                                                           
Query: 186     tgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacctta 245
               |||||||||| ||| |||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 7432081 tgccaattcctgttacaaagaaatcaatatacagccgtgatcgaaatttgtggcacctta 7432140

                  
Query: 246     gcc 248
               |||
Sbjct: 7432141 gcc 7432143



 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 62/67 (92%)
 Strand = Plus / Plus

                                                                           
Query: 3       atgttgccaaggaagttggcgcagatgcagttgctcatgggtgcactggaaagggaaatg 62
               ||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||||
Sbjct: 7431834 atgttgcaaaggaagttggtgcagatgcagttgctcatggatgcactggaaaaggcaatg 7431893

                      
Query: 63      atcaggt 69
               |||||||
Sbjct: 7431894 atcaggt 7431900
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  268 bits (135), Expect = 8e-69
 Identities = 171/183 (93%)
 Strand = Plus / Plus

                                                                           
Query: 66      aggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcaccct 125
               ||||||| |||||||||||||| ||||| ||||| || || ||||||||||||||||| |
Sbjct: 7431840 aggttcgttttgagcttacattctatgctttaaaccctgagcttaaagtggtggcacctt 7431899

                                                                           
Query: 126     ggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatg 185
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 7431900 ggagggagtgggatatcacaggacgtgaagatgctattgagtatgcaaagaaacacaatg 7431959

                                                                           
Query: 186     tgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacctta 245
               |||||||||| ||| |||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 7431960 tgccaattcctgttacaaagaaatcaatatacagccgtgatcgaaatttgtggcacctta 7432019

                  
Query: 246     gcc 248
               |||
Sbjct: 7432020 gcc 7432022



 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 62/67 (92%)
 Strand = Plus / Plus

                                                                           
Query: 3       atgttgccaaggaagttggcgcagatgcagttgctcatgggtgcactggaaagggaaatg 62
               ||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||||
Sbjct: 7431713 atgttgcaaaggaagttggtgcagatgcagttgctcatggatgcactggaaaaggcaatg 7431772

                      
Query: 63      atcaggt 69
               |||||||
Sbjct: 7431773 atcaggt 7431779
to top
>emb|AL731756.4|CNS08C85 Oryza sativa chromosome 12, . BAC OJ1220_D01 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 98782

 Score =  268 bits (135), Expect = 8e-69
 Identities = 171/183 (93%)
 Strand = Plus / Plus

                                                                         
Query: 66    aggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcaccct 125
             ||||||| |||||||||||||| ||||| ||||| || || ||||||||||||||||| |
Sbjct: 21637 aggttcgttttgagcttacattctatgctttaaaccctgagcttaaagtggtggcacctt 21696

                                                                         
Query: 126   ggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatg 185
             |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 21697 ggagggagtgggatatcacaggacgtgaagatgctattgagtatgcaaagaaacacaatg 21756

                                                                         
Query: 186   tgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacctta 245
             |||||||||| ||| |||||||||||||||||||||| ||| ||||||||||||||||||
Sbjct: 21757 tgccaattcctgttacaaagaaatcaatatacagccgtgatcgaaatttgtggcacctta 21816

                
Query: 246   gcc 248
             |||
Sbjct: 21817 gcc 21819



 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 62/67 (92%)
 Strand = Plus / Plus

                                                                         
Query: 3     atgttgccaaggaagttggcgcagatgcagttgctcatgggtgcactggaaagggaaatg 62
             ||||||| ||||||||||| |||||||||||||||||||| ||||||||||| || ||||
Sbjct: 21510 atgttgcaaaggaagttggtgcagatgcagttgctcatggatgcactggaaaaggcaatg 21569

                    
Query: 63    atcaggt 69
             |||||||
Sbjct: 21570 atcaggt 21576
to top
>ref|NM_118616.3| Arabidopsis thaliana ATP binding / argininosuccinate synthase
           AT4G24830 mRNA, complete cds
          Length = 1750

 Score =  123 bits (62), Expect = 3e-25
 Identities = 188/230 (81%)
 Strand = Plus / Plus

                                                                       
Query: 17  gttggcgcagatgcagttgctcatgggtgcactggaaagggaaatgatcaggttcgcttt 76
           ||||| || ||||| ||||| |||||||| |||||||| |||||||| |||||||| |||
Sbjct: 660 gttggagctgatgccgttgcacatgggtgtactggaaaaggaaatgaccaggttcggttt 719

                                                                       
Query: 77  gagcttacattttatgccttaaatccggaacttaaagtggtggcaccctggagggagtgg 136
           ||||| || || | | | ||||| || ||||||||||| |||||||| ||||| || |||
Sbjct: 720 gagctcaccttcttttcattaaaccctgaacttaaagttgtggcaccatggagagaatgg 779

                                                                       
Query: 137 gatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatgtgccaattccg 196
           || |||  ||| || |||||||| ||||||||||||||||| || ||||| ||  | || 
Sbjct: 780 gaaatccaaggccgagaagatgctattgagtatgcaaagaagcataatgttcccgtccca 839

                                                             
Query: 197 gtttcaaagaaatcaatatacagccgagatagaaatttgtggcaccttag 246
           ||  ||||||| || || |||||||| || |||||  |||||||||||||
Sbjct: 840 gtgacaaagaagtccatttacagccgggacagaaacctgtggcaccttag 889
to top
>gb|AY091319.1| Arabidopsis thaliana putative argininosuccinate synthase
           (At4g24830) mRNA, complete cds
          Length = 1516

 Score =  123 bits (62), Expect = 3e-25
 Identities = 188/230 (81%)
 Strand = Plus / Plus

                                                                       
Query: 17  gttggcgcagatgcagttgctcatgggtgcactggaaagggaaatgatcaggttcgcttt 76
           ||||| || ||||| ||||| |||||||| |||||||| |||||||| |||||||| |||
Sbjct: 607 gttggagctgatgccgttgcacatgggtgtactggaaaaggaaatgaccaggttcggttt 666

                                                                       
Query: 77  gagcttacattttatgccttaaatccggaacttaaagtggtggcaccctggagggagtgg 136
           ||||| || || | | | ||||| || ||||||||||| |||||||| ||||| || |||
Sbjct: 667 gagctcaccttcttttcattaaaccctgaacttaaagttgtggcaccatggagagaatgg 726

                                                                       
Query: 137 gatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatgtgccaattccg 196
           || |||  ||| || |||||||| ||||||||||||||||| || ||||| ||  | || 
Sbjct: 727 gaaatccaaggccgagaagatgctattgagtatgcaaagaagcataatgttcccgtccca 786

                                                             
Query: 197 gtttcaaagaaatcaatatacagccgagatagaaatttgtggcaccttag 246
           ||  ||||||| || || |||||||| || |||||  |||||||||||||
Sbjct: 787 gtgacaaagaagtccatttacagccgggacagaaacctgtggcaccttag 836
to top
>gb|AY065252.1| Arabidopsis thaliana putative argininosuccinate synthase
           (At4g24830) mRNA, complete cds
          Length = 1718

 Score =  123 bits (62), Expect = 3e-25
 Identities = 188/230 (81%)
 Strand = Plus / Plus

                                                                       
Query: 17  gttggcgcagatgcagttgctcatgggtgcactggaaagggaaatgatcaggttcgcttt 76
           ||||| || ||||| ||||| |||||||| |||||||| |||||||| |||||||| |||
Sbjct: 660 gttggagctgatgccgttgcacatgggtgtactggaaaaggaaatgaccaggttcggttt 719

                                                                       
Query: 77  gagcttacattttatgccttaaatccggaacttaaagtggtggcaccctggagggagtgg 136
           ||||| || || | | | ||||| || ||||||||||| |||||||| ||||| || |||
Sbjct: 720 gagctcaccttcttttcattaaaccctgaacttaaagttgtggcaccatggagagaatgg 779

                                                                       
Query: 137 gatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatgtgccaattccg 196
           || |||  ||| || |||||||| ||||||||||||||||| || ||||| ||  | || 
Sbjct: 780 gaaatccaaggccgagaagatgctattgagtatgcaaagaagcataatgttcccgtccca 839

                                                             
Query: 197 gtttcaaagaaatcaatatacagccgagatagaaatttgtggcaccttag 246
           ||  ||||||| || || |||||||| || |||||  |||||||||||||
Sbjct: 840 gtgacaaagaagtccatttacagccgggacagaaacctgtggcaccttag 889
to top
>emb|BX826988.1|CNS0A2FT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB83ZH11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score =  123 bits (62), Expect = 3e-25
 Identities = 188/230 (81%)
 Strand = Plus / Plus

                                                                       
Query: 17  gttggcgcagatgcagttgctcatgggtgcactggaaagggaaatgatcaggttcgcttt 76
           ||||| || ||||| ||||| |||||||| |||||||| |||||||| |||||||| |||
Sbjct: 27  gttggagctgatgccgttgcacatgggtgtactggaaaaggaaatgaccaggttcggttt 86

                                                                       
Query: 77  gagcttacattttatgccttaaatccggaacttaaagtggtggcaccctggagggagtgg 136
           ||||| || || | | | ||||| || ||||||||||| |||||||| ||||| || |||
Sbjct: 87  gagctcaccttcttttcattaaaccctgaacttaaagttgtggcaccatggagagaatgg 146

                                                                       
Query: 137 gatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaatgtgccaattccg 196
           || |||  ||| || |||||||| ||||||||||||||||| || ||||| ||  | || 
Sbjct: 147 gaaatccaaggccgagaagatgctattgagtatgcaaagaagcataatgttcccgtccca 206

                                                             
Query: 197 gtttcaaagaaatcaatatacagccgagatagaaatttgtggcaccttag 246
           ||  ||||||| || || |||||||| || |||||  |||||||||||||
Sbjct: 207 gtgacaaagaagtccatttacagccgggacagaaacctgtggcaccttag 256
to top
>emb|BX827386.1|CNS0A2HY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS48ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1721

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 132/159 (83%), Gaps = 1/159 (0%)
 Strand = Plus / Plus

                                                                       
Query: 17  gttggcgcagatgcagttgctcatgggtgcactggaaagggaaatgatcaggttcgcttt 76
           ||||| || ||||| ||||| |||||||| |||||||| |||||||| |||||||| || 
Sbjct: 642 gttggagctgatgccgttgcacatgggtgtactggaaaaggaaatgaccaggttcggtt- 700

                                                                       
Query: 77  gagcttacattttatgccttaaatccggaacttaaagtggtggcaccctggagggagtgg 136
           ||||| || || | | | ||||| || ||||||||||| |||||||| ||||| || |||
Sbjct: 701 gagctcaccttcttttcattaaaccctgaacttaaagttgtggcaccatggagagaatgg 760

                                                  
Query: 137 gatatcacaggacgtgaagatgcaattgagtatgcaaag 175
           || |||  ||| || |||||||| |||||||||||||||
Sbjct: 761 gaaatccaaggccgagaagatgctattgagtatgcaaag 799
to top
>emb|AL161562.2|ATCHRIV62 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 62
          Length = 197070

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 147/182 (80%)
 Strand = Plus / Minus

                                                                         
Query: 65    caggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcaccc 124
             |||||||| |||||||| || || | | | ||||| || ||||||||||| |||||||| 
Sbjct: 68677 caggttcggtttgagctcaccttcttttcattaaaccctgaacttaaagttgtggcacca 68618

                                                                         
Query: 125   tggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaat 184
             ||||| || ||||| |||  ||| || |||||||| ||||||||||||||||| || |||
Sbjct: 68617 tggagagaatgggaaatccaaggccgagaagatgctattgagtatgcaaagaagcataat 68558

                                                                         
Query: 185   gtgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacctt 244
             || ||  | || ||  ||||||| || || |||||||| || |||||  |||||||||||
Sbjct: 68557 gttcccgtcccagtgacaaagaagtccatttacagccgggacagaaacctgtggcacctt 68498

               
Query: 245   ag 246
             ||
Sbjct: 68497 ag 68496
to top
>emb|AL049657.1|ATF6I7 Arabidopsis thaliana DNA chromosome 4, BAC clone  F6I7 (ESSA project)
          Length = 95185

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 147/182 (80%)
 Strand = Plus / Minus

                                                                         
Query: 65    caggttcgctttgagcttacattttatgccttaaatccggaacttaaagtggtggcaccc 124
             |||||||| |||||||| || || | | | ||||| || ||||||||||| |||||||| 
Sbjct: 39253 caggttcggtttgagctcaccttcttttcattaaaccctgaacttaaagttgtggcacca 39194

                                                                         
Query: 125   tggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaaacacaat 184
             ||||| || ||||| |||  ||| || |||||||| ||||||||||||||||| || |||
Sbjct: 39193 tggagagaatgggaaatccaaggccgagaagatgctattgagtatgcaaagaagcataat 39134

                                                                         
Query: 185   gtgccaattccggtttcaaagaaatcaatatacagccgagatagaaatttgtggcacctt 244
             || ||  | || ||  ||||||| || || |||||||| || |||||  |||||||||||
Sbjct: 39133 gttcccgtcccagtgacaaagaagtccatttacagccgggacagaaacctgtggcacctt 39074

               
Query: 245   ag 246
             ||
Sbjct: 39073 ag 39072
to top
>gb|AC126782.23| Medicago truncatula clone mth2-14p11, complete sequence
          Length = 135659

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 116   gtggcaccctggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaag 175
             ||||| || ||||||||||||||||| |||||  | |||||||| ||||||||||| |||
Sbjct: 24403 gtggctccatggagggagtgggatattacagggagagaagatgctattgagtatgctaag 24344

               
Query: 176   aa 177
             ||
Sbjct: 24343 aa 24342



 Score = 42.1 bits (21), Expect = 0.81
 Identities = 46/53 (86%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                  
Query: 125   tggagggagtgggatatcacaggacgtgaagatgcaattgagtatgcaaagaa 177
             |||||||||||| |||| |||||  | |||||||| ||||||||||| |||||
Sbjct: 17541 tggagggagtgg-atattacagggagagaagatgctattgagtatgccaagaa 17490
to top
>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome
          Length = 1664970

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                            
Query: 12     aggaagttggcgcagatgcagttgctcatgggtgcactggaaaggg 57
              |||||||||| || || |||||||||||||| ||||||||||||||
Sbjct: 385467 aggaagttggagctgaggcagttgctcatggatgcactggaaaggg 385512
to top
>gb|BC081578.1| Danio rerio argininosuccinate synthetase, mRNA (cDNA clone
           MGC:92051 IMAGE:7045778), complete cds
          Length = 3567

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 47  actggaaagggaaatgatcaggttcgctttgagct 81
           ||||| ||||||||||| |||||||||||||||||
Sbjct: 429 actgggaagggaaatgaccaggttcgctttgagct 463
to top
>ref|NM_001004603.1| Danio rerio argininosuccinate synthetase (ass), mRNA
          Length = 3567

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 47  actggaaagggaaatgatcaggttcgctttgagct 81
           ||||| ||||||||||| |||||||||||||||||
Sbjct: 429 actgggaagggaaatgaccaggttcgctttgagct 463
to top
>dbj|BA000028.3| Oceanobacillus iheyensis HTE831 DNA, complete genome
          Length = 3630528

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                              
Query: 32      gttgctcatgggtgcactggaaagggaaatgatcaggttcgctttga 78
               ||||| ||||| ||||||||||| ||||||||||| || ||||||||
Sbjct: 3263414 gttgcacatggctgcactggaaaaggaaatgatcaagtgcgctttga 3263368
to top
>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                              
Query: 32      gttgctcatgggtgcactggaaagggaaatgatcaggttcgctttga 78
               ||||||||||| || |||||||| || |||||||| |||||||||||
Sbjct: 1738757 gttgctcatggttgtactggaaaaggcaatgatcaagttcgctttga 1738711
to top
>gb|AE010147.1| Pyrococcus furiosus DSM 3638, section 22 of 173 of the complete
           genome
          Length = 11842

 Score = 52.0 bits (26), Expect = 8e-04
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 35  gctcatgggtgcactggaaagggaaatgatcaggttcgcttt 76
           |||||||| || || |||||||||||||||||||| ||||||
Sbjct: 408 gctcatggttgtacaggaaagggaaatgatcaggtgcgcttt 449
to top
>gb|BC046941.1| Xenopus laevis arginosuccinate synthetase 1, mRNA (cDNA clone
           MGC:53519 IMAGE:5572657), complete cds
          Length = 1733

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 46  cactggaaagggaaatgatcaggttcgctttgagct 81
           |||||||||||| ||||||||| |||| ||||||||
Sbjct: 437 cactggaaagggtaatgatcagattcgttttgagct 472
to top
>emb|AL935254.1| Lactobacillus plantarum strain WCFS1 complete genome; segment 3/11
          Length = 317050

 Score = 48.1 bits (24), Expect = 0.013
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                 
Query: 28    tgcagttgctcatgggtgcactggaaagggaaatgatcaggttcgctttgag 79
             |||| |||| ||||| || ||||| ||||| |||||||||||||| ||||||
Sbjct: 44280 tgcaattgcccatggttgtactgggaagggtaatgatcaggttcggtttgag 44331
to top
>gb|AE014133.1| Streptococcus mutans UA159, complete genome
          Length = 2030921

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                            
Query: 33     ttgctcatgggtgcactggaaagggaaatgatcaggttcgctttga 78
              |||||||||| || || || |||||||||||||| ||||| |||||
Sbjct: 316203 ttgctcatggctgtaccggtaagggaaatgatcaagttcggtttga 316248
to top
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 157     tgcaattgagtatgcaaagaaa 178
               ||||||||||||||||||||||
Sbjct: 2968509 tgcaattgagtatgcaaagaaa 2968488
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 44.1 bits (22), Expect = 0.20
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 157     tgcaattgagtatgcaaagaaa 178
               ||||||||||||||||||||||
Sbjct: 2868542 tgcaattgagtatgcaaagaaa 2868521
to top
>emb|AL590438.12| Human DNA sequence from clone RP11-22L13 on chromosome 1 Contains part
             of the PRDM16 gene for PR domain containing 16, complete
             sequence
          Length = 99477

 Score = 42.1 bits (21), Expect = 0.81
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 117   tggcaccctggagggagtggg 137
             |||||||||||||||||||||
Sbjct: 79299 tggcaccctggagggagtggg 79279
to top
>gb|AC136987.11| Mus musculus chromosome 16, clone RP24-129J16, complete sequence
          Length = 155372

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   ctggagggagtgggatatca 143
             ||||||||||||||||||||
Sbjct: 85057 ctggagggagtgggatatca 85076
to top
>gb|AC107700.12| Mus musculus chromosome 3, clone RP23-288N9, complete sequence
          Length = 194390

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    gcttacattttatgccttaa 98
             ||||||||||||||||||||
Sbjct: 16902 gcttacattttatgccttaa 16883
to top
>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome
          Length = 1545895

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 46     cactggaaagggaaatgatcaggt 69
              |||||||||||||||||| |||||
Sbjct: 553803 cactggaaagggaaatgaccaggt 553826
to top
>gb|AC127417.3| Mus musculus BAC clone RP23-459M2 from chromosome 10, complete
            sequence
          Length = 192814

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 50   ggaaagggaaatgatcaggttcgctttgagct 81
            |||||||| ||||| ||||| |||||||||||
Sbjct: 6647 ggaaaggggaatgaccaggtccgctttgagct 6678
to top
>ref|XR_004489.1| PREDICTED: Mus musculus argininosuccinate synthase-like, transcript
           variant 1 (LOC432466), misc RNA
          Length = 1415

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 468 ggaaaggggaatgaccaggtccgctttgagct 499
to top
>ref|XR_001542.1| PREDICTED: Mus musculus argininosuccinate synthase-like
           (LOC432466), misc RNA
          Length = 1616

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 468 ggaaaggggaatgaccaggtccgctttgagct 499
to top
>ref|XR_001541.1| PREDICTED: Mus musculus argininosuccinate synthase-like
           (LOC432466), misc RNA
          Length = 1616

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 468 ggaaaggggaatgaccaggtccgctttgagct 499
to top
>gb|AC123553.4| Mus musculus BAC clone RP24-566O21 from chromosome 3, complete sequence
          Length = 138553

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    gcttacattttatgccttaa 98
             ||||||||||||||||||||
Sbjct: 81425 gcttacattttatgccttaa 81406
to top
>gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosome 10, complete sequence
          Length = 208221

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 50     ggaaagggaaatgatcaggttcgctttgagct 81
              |||||||| ||||| ||||| |||||||||||
Sbjct: 205435 ggaaaggggaatgaccaggtccgctttgagct 205466
to top
>emb|AL772392.4| Human DNA sequence from clone RP11-450P7 on chromosome X Contains the
             3' end of the CNK2 gene for connector enhancer of KSR2
             (KIAA0902), gene FLJ34960, 3' end of the SMPX gene for
             X-linked small muscle protein and a CpG island, complete
             sequence
          Length = 124186

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   tcacaggacgtgaagatgca 160
             ||||||||||||||||||||
Sbjct: 56474 tcacaggacgtgaagatgca 56455
to top
>emb|AL627317.7| Human DNA sequence from clone RP11-316C12 on chromosome 1 Contains the
             3' end of the NEGR1 gene for neuronal growth regulator 1
             and a novel gene, complete sequence
          Length = 93633

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    ttacattttatgccttaaat 100
             ||||||||||||||||||||
Sbjct: 49031 ttacattttatgccttaaat 49012
to top
>emb|AL353717.13| Human DNA sequence from clone RP11-562M8 on chromosome 9 Contains a
             novel pseudogene, a argininosuccinate synthetase (ASS)
             (CTLN1) pseudogene, the APTX gene for aprataxin, a
             transcription elongation factor A (SII), 1 pseudogene
             (GTF2SP) (TCEA1P) and 2 CpG islands, complete sequence
          Length = 120533

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 50    ggaaagggaaatgatcaggttcgctttgagct 81
             ||||| |||||||||||||| || ||||||||
Sbjct: 64808 ggaaaaggaaatgatcaggtccggtttgagct 64839
to top
>emb|AL031054.1|HS48G12 Human DNA sequence from clone RP1-48G12 on chromosome Xq27.1-27.3
              Contains a CpG island, complete sequence
          Length = 199016

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     tgcactggaaagggaaatgatcag 67
              |||| |||||||||||||||||||
Sbjct: 136424 tgcattggaaagggaaatgatcag 136447
to top
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome
          Length = 5727534

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 50     ggaaagggaaatgatcaggttcgctttgagct 81
              ||||| ||||| || |||||||||||||||||
Sbjct: 946065 ggaaaaggaaacgaccaggttcgctttgagct 946096
to top
>dbj|AK149489.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length
           enriched library, clone:C730025D03
           product:argininosuccinate synthetase 1, full insert
           sequence
          Length = 1581

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 469 ggaaaggggaatgaccaggtccgctttgagct 500
to top
>ref|NG_005207.1| Homo sapiens argininosuccinate synthetase pseudogene 12 (ASSP12) on
           chromosome 9
          Length = 1427

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           ||||| |||||||||||||| || ||||||||
Sbjct: 458 ggaaaaggaaatgatcaggtccggtttgagct 489
to top
>dbj|AK146635.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920036P21 product:argininosuccinate
           synthetase 1, full insert sequence
          Length = 1597

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 466 ggaaaggggaatgaccaggtccgctttgagct 497
to top
>gb|AC092814.2| Homo sapiens chromosome 1 clone RP11-565J7, complete sequence
          Length = 170245

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    gagggagtgggatatcacag 146
              ||||||||||||||||||||
Sbjct: 162156 gagggagtgggatatcacag 162137
to top
>ref|NG_000847.1| Homo sapiens argininosuccinate synthetase pseudogene 5 (ASSP5) on
           chromosome X
          Length = 1698

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 50  ggaaagggaaatgatcaggt 69
           ||||||||||||||||||||
Sbjct: 530 ggaaagggaaatgatcaggt 549
to top
>gb|AC012325.9| Homo sapiens chromosome 16 clone RP11-93H5, complete sequence
          Length = 204524

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 112    agtggtggcaccctggagggagtgggat 139
              ||||||||||||| | ||||||||||||
Sbjct: 152871 agtggtggcacccagcagggagtgggat 152844
to top
>gb|AC132186.3| Homo sapiens chromosome 16 clone CTD-2258A20, complete sequence
          Length = 157833

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 112   agtggtggcaccctggagggagtgggat 139
             ||||||||||||| | ||||||||||||
Sbjct: 62163 agtggtggcacccagcagggagtgggat 62136
to top
>gb|AC005000.2|AC005000 Homo sapiens clone RP1-241P17, complete sequence
          Length = 107314

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    ggaaagggaaatgatcaggt 69
             ||||||||||||||||||||
Sbjct: 33617 ggaaagggaaatgatcaggt 33636
to top
>gb|BC087556.1| Mus musculus argininosuccinate synthetase 1, mRNA (cDNA clone
           MGC:103151 IMAGE:6478590), complete cds
          Length = 1594

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 426 ggaaaggggaatgaccaggtccgctttgagct 457
to top
>gb|BC002074.1| Mus musculus argininosuccinate synthetase 1, mRNA (cDNA clone
           MGC:6218 IMAGE:3491910), complete cds
          Length = 1645

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 497 ggaaaggggaatgaccaggtccgctttgagct 528
to top
>emb|CR936278.9| Zebrafish DNA sequence from clone CH211-46O5 in linkage group 19,
             complete sequence
          Length = 146216

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 156   atgcaattgagtatgcaaag 175
             ||||||||||||||||||||
Sbjct: 67764 atgcaattgagtatgcaaag 67783
to top
>ref|NR_002687.1| Mus musculus argininosuccinate synthase-like (LOC432466) on
           chromosome 10
          Length = 1550

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 459 ggaaaggggaatgaccaggtccgctttgagct 490
to top
>emb|AL929062.10| Mouse DNA sequence from clone RP23-342J9 on chromosome X, complete
             sequence
          Length = 212856

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 47    actggaaagggaaatgatcaggtt 70
             ||||||||||||||| ||||||||
Sbjct: 42569 actggaaagggaaatcatcaggtt 42592
to top
>ref|NM_007494.2| Mus musculus argininosuccinate synthetase 1 (Ass1), mRNA
          Length = 1645

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 497 ggaaaggggaatgaccaggtccgctttgagct 528
to top
>gb|M31690.1|MUSASSB Mouse argininosuccinate synthetase (Ass) mRNA, complete cds
          Length = 1561

 Score = 40.1 bits (20), Expect = 3.2
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 50  ggaaagggaaatgatcaggttcgctttgagct 81
           |||||||| ||||| ||||| |||||||||||
Sbjct: 467 ggaaaggggaatgaccaggtccgctttgagct 498


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,477,860
Number of Sequences: 3902068
Number of extensions: 2477860
Number of successful extensions: 55208
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 55
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54989
Number of HSP's gapped (non-prelim): 213
length of query: 248
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 226
effective length of database: 17,147,199,772
effective search space: 3875267148472
effective search space used: 3875267148472
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top