>emb|Z93942.1|HS230I19 Human DNA sequence from clone RP1-230I19 on chromosome 20q12-13.12
             Contains part of the PTPRT gene for protein tyrosine
             phosphatase receptor type T,  genomic marker D20S858, a ca
             repeat polymorphism, ESTs, STS and GSSs, complete sequence
          Length = 144201

 Score = 40.1 bits (20), Expect = 0.72
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     atccattgcatccatctctc 23
             ||||||||||||||||||||
Sbjct: 38477 atccattgcatccatctctc 38496

>emb|BX284700.13| Zebrafish DNA sequence from clone CH211-269O12 in linkage group 13,
              complete sequence
          Length = 183756

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 21     ctcgagtgagcagcaatgg 39
              |||||||||||||||||||
Sbjct: 144175 ctcgagtgagcagcaatgg 144157

>emb|CR788252.4| Zebrafish DNA sequence from clone DKEY-45J10 in linkage group 13,
             complete sequence
          Length = 73390

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ctcgagtgagcagcaatgg 39
             |||||||||||||||||||
Sbjct: 36252 ctcgagtgagcagcaatgg 36234

>emb|CR386881.1| Gallus gallus finished cDNA, clone ChEST40d9
          Length = 980

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 51  aagggtggggtttggtggt 69
           |||||||||||||||||||
Sbjct: 166 aagggtggggtttggtggt 184

>dbj|AK050840.1| Mus musculus 9 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:D030024J10
           product:unclassifiable, full insert sequence
          Length = 2690

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 25  agtgagcagcaatgggttc 43
           |||||||||||||||||||
Sbjct: 950 agtgagcagcaatgggttc 932

>gb|AC091248.6| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-93D12, complete
              sequence
          Length = 220602

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 51     aagggtggggtttggtggt 69
              |||||||||||||||||||
Sbjct: 140290 aagggtggggtttggtggt 140308

>emb|AL805950.11| Mouse DNA sequence from clone RP23-134I15 on chromosome 2, complete
              sequence
          Length = 237337

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 25     agtgagcagcaatgggttc 43
              |||||||||||||||||||
Sbjct: 192998 agtgagcagcaatgggttc 192980


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 518,884
Number of Sequences: 3902068
Number of extensions: 518884
Number of successful extensions: 42676
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42667
Number of HSP's gapped (non-prelim): 9
length of query: 72
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 51
effective length of database: 17,151,101,840
effective search space: 874706193840
effective search space used: 874706193840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)