Clone Name	bast04c08
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AP003707.4| Oryza sativa (japonica cultivar-group) genomic D...	220	3e-54
2	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	220	3e-54
3	dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic D...	220	3e-54
4	dbj|AP006165.2| Oryza sativa (japonica cultivar-group) genomic D...	220	3e-54
5	dbj|AK099844.1| Oryza sativa (japonica cultivar-group) cDNA clon...	220	3e-54
6	ref|XM_472246.1| Oryza sativa (japonica cultivar-group), predic...	145	1e-31
7	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	145	1e-31
8	emb|AL662977.3|OSJN00176 Oryza sativa genomic DNA, chromosome 4,...	145	1e-31
9	dbj|AK103564.1| Oryza sativa (japonica cultivar-group) cDNA clon...	145	1e-31
10	ref|XM_465879.1| Oryza sativa (japonica cultivar-group), mRNA	131	2e-27
11	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	131	2e-27
12	dbj|AP005285.2| Oryza sativa (japonica cultivar-group) genomic D...	131	2e-27
13	dbj|AK120466.1| Oryza sativa (japonica cultivar-group) cDNA clon...	131	2e-27
14	dbj|AK102812.1| Oryza sativa (japonica cultivar-group) cDNA clon...	131	2e-27
15	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	76	1e-10
16	gb|AC107619.1| Genomic sequence for Oryza sativa, Nipponbare str...	76	1e-10
17	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	76	1e-10
18	gb|AC145383.3| Oryza sativa chromosome 3 BAC OSJNBa0038E17 genom...	44	0.39
19	gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...	44	0.39
20	gb|AC130598.2| Oryza sativa (japonica cultivar-group) chromosome...	44	0.39
21	gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...	44	0.39
22	ref|XM_390509.1| Gibberella zeae PH-1 chromosome 1 hypothetical ...	44	0.39
23	emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...	44	0.39
24	emb|AL732379.5|CNS08C92 Oryza sativa chromosome 3, . BAC OSJNBa0...	44	0.39
25	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.39
26	dbj|AP002482.1| Oryza sativa (japonica cultivar-group) genomic D...	44	0.39
27	gb|AC134239.2| Oryza sativa (japonica cultivar-group) chromosome...	44	0.39
28	gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome	44	0.39
29	dbj|AK108683.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.39
30	dbj|AK070443.1| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.39
31	dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp...	44	0.39
32	gb|AC125495.4| Oryza sativa (japonica cultivar-group) chromosome...	42	1.6
33	ref|XM_462658.1| Oryza sativa (japonica cultivar-group), predic...	42	1.6
34	ref|XM_471465.1| Oryza sativa (japonica cultivar-group), predic...	42	1.6
35	ref|XM_958092.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.6
36	ref|XM_329470.1| Neurospora crassa OR74A hypothetical protein (N...	42	1.6
37	ref|XM_844924.1| PREDICTED: Canis familiaris similar to purine r...	42	1.6
38	ref|NM_013022.1| Rattus norvegicus Rho-associated coiled-coil fo...	42	1.6
39	emb|BX072038.1|CNS09RQY Single read from an extremity of a full-...	42	1.6
40	emb|BX072037.1|CNS09RQX Single read from an extremity of a full-...	42	1.6
41	emb|BX071074.1|CNS09R06 Single read from an extremity of a full-...	42	1.6
42	emb|BX071073.1|CNS09R05 Single read from an extremity of a full-...	42	1.6
43	emb|BX069043.1|CNS09PFR Single read from an extremity of a full-...	42	1.6
44	emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-...	42	1.6
45	emb|BX065976.1|CNS09N2K Single read from an extremity of a full-...	42	1.6
46	emb|BX065975.1|CNS09N2J Single read from an extremity of a full-...	42	1.6
47	emb|BX064684.1|CNS09M2O Single read from an extremity of a full-...	42	1.6
48	emb|BX063673.1|CNS09LAL Single read from an extremity of a full-...	42	1.6
49	emb|BX061993.1|CNS09JZX Single read from an extremity of a full-...	42	1.6
50	emb|BX061992.1|CNS09JZW Single read from an extremity of a full-...	42	1.6
51	emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-...	42	1.6
52	emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-...	42	1.6
53	emb|BX054844.1|CNS09EHC Single read from an extremity of a full-...	42	1.6
54	emb|BX054383.1|CNS09E4J Single read from an extremity of a full-...	42	1.6
55	emb|BX054382.1|CNS09E4I Single read from an extremity of a full-...	42	1.6
56	emb|BX052598.1|CNS09CQY Single read from an extremity of a full-...	42	1.6
57	emb|BX052597.1|CNS09CQX Single read from an extremity of a full-...	42	1.6
58	emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-...	42	1.6
59	emb|BX051766.1|CNS09C3U Single read from an extremity of a full-...	42	1.6
60	emb|BX051765.1|CNS09C3T Single read from an extremity of a full-...	42	1.6
61	emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-...	42	1.6
62	emb|BX050825.1|CNS09BDP Single read from an extremity of a full-...	42	1.6
63	emb|BX049822.1|CNS09ALU Single read from an extremity of a full-...	42	1.6
64	emb|BX049821.1|CNS09ALT Single read from an extremity of a full-...	42	1.6
65	emb|BX030920.1|CNS08W0S Single read from an extremity of a full-...	42	1.6
66	emb|BX030919.1|CNS08W0R Single read from an extremity of a full-...	42	1.6
67	emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-...	42	1.6
68	emb|BX045807.1|CNS097IB Single read from an extremity of a full-...	42	1.6
69	emb|BX045806.1|CNS097IA Single read from an extremity of a full-...	42	1.6
70	emb|BX042049.1|CNS094LX Single read from an extremity of a full-...	42	1.6
71	emb|BX042048.1|CNS094LW Single read from an extremity of a full-...	42	1.6
72	emb|BX040221.1|CNS09375 Single read from an extremity of a full-...	42	1.6
73	emb|BX040220.1|CNS09374 Single read from an extremity of a full-...	42	1.6
74	emb|BX037502.1|CNS0913M Single read from an extremity of a full-...	42	1.6
75	emb|BX037471.1|CNS0912R Single read from an extremity of a full-...	42	1.6
76	emb|BX036960.1|CNS090OK Single read from an extremity of a full-...	42	1.6
77	emb|BX036959.1|CNS090OJ Single read from an extremity of a full-...	42	1.6
78	emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-...	42	1.6
79	emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-...	42	1.6
80	emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-...	42	1.6
81	emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-...	42	1.6
82	emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-...	42	1.6
83	emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-...	42	1.6
84	emb|BX034217.1|CNS08YKD Single read from an extremity of a full-...	42	1.6
85	emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-...	42	1.6
86	emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-...	42	1.6
87	emb|BX033034.1|CNS08XNI Single read from an extremity of a full-...	42	1.6
88	emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-...	42	1.6
89	emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-...	42	1.6
90	emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-...	42	1.6
91	emb|BX028005.1|CNS08TRT Single read from an extremity of a full-...	42	1.6
92	emb|BX028004.1|CNS08TRS Single read from an extremity of a full-...	42	1.6
93	emb|BX027756.1|CNS08TKW Single read from an extremity of a full-...	42	1.6
94	emb|BX024640.1|CNS08R6C Single read from an extremity of a full-...	42	1.6
95	emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-...	42	1.6
96	emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-...	42	1.6
97	emb|BX022052.1|CNS08P6G Single read from an extremity of a full-...	42	1.6
98	emb|BX022051.1|CNS08P6F Single read from an extremity of a full-...	42	1.6
99	emb|BX019569.1|CNS08N9H Single read from an extremity of a full-...	42	1.6
100	emb|BX019568.1|CNS08N9G Single read from an extremity of a full-...	42	1.6
101	emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-...	42	1.6
102	emb|BX019149.1|CNS08MXT Single read from an extremity of a full-...	42	1.6
103	emb|BX018722.1|CNS08MLY Single read from an extremity of a full-...	42	1.6
104	emb|BX018239.1|CNS08M8J Single read from an extremity of a full-...	42	1.6
105	emb|BX018238.1|CNS08M8I Single read from an extremity of a full-...	42	1.6
106	emb|BX017233.1|CNS08LGL Single read from an extremity of a full-...	42	1.6
107	emb|BX017232.1|CNS08LGK Single read from an extremity of a full-...	42	1.6
108	emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-...	42	1.6
109	emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-...	42	1.6
110	emb|BX016618.1|CNS08KZI Single read from an extremity of a full-...	42	1.6
111	emb|BX016202.1|CNS08KNY Single read from an extremity of a full-...	42	1.6
112	emb|BX016201.1|CNS08KNX Single read from an extremity of a full-...	42	1.6
113	emb|BX016072.1|CNS08KKC Single read from an extremity of a full-...	42	1.6
114	emb|BX016071.1|CNS08KKB Single read from an extremity of a full-...	42	1.6
115	emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-...	42	1.6
116	emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-...	42	1.6
117	emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-...	42	1.6
118	emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-...	42	1.6
119	emb|BX014834.1|CNS08JLY Single read from an extremity of a full-...	42	1.6
120	emb|BX014823.1|CNS08JLN Single read from an extremity of a full-...	42	1.6
121	emb|BX012788.1|CNS08I14 Single read from an extremity of a full-...	42	1.6
122	emb|BX011620.1|CNS08H4O Single read from an extremity of a full-...	42	1.6
123	emb|BX009503.1|CNS08FHV Single read from an extremity of a full-...	42	1.6
124	emb|BX009502.1|CNS08FHU Single read from an extremity of a full-...	42	1.6
125	emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-...	42	1.6
126	emb|BX009475.1|CNS08FH3 Single read from an extremity of a full-...	42	1.6
127	emb|BX007868.1|CNS08E8G Single read from an extremity of a full-...	42	1.6
128	emb|BX007867.1|CNS08E8F Single read from an extremity of a full-...	42	1.6
129	emb|BX007827.1|CNS08E7B Single read from an extremity of a full-...	42	1.6
130	emb|BX007826.1|CNS08E7A Single read from an extremity of a full-...	42	1.6
131	emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-...	42	1.6
132	emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-...	42	1.6
133	emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-...	42	1.6
134	emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-...	42	1.6
135	emb|BX284762.1|NCB13B3 Neurospora crassa DNA linkage group II BA...	42	1.6
136	dbj|AB219074.1| Sorghum bicolor SbPCL1 mRNA, partial cds	42	1.6
137	gb|AF169823.1| Spodoptera exigua nucleopolyhedrovirus complete g...	42	1.6
138	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
139	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
140	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	42	1.6
141	dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
142	dbj|AP004279.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
143	dbj|AK121181.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
144	dbj|AK120786.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
145	ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147 ...	42	1.6
146	dbj|AK109494.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
147	ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323 ...	42	1.6
148	dbj|AK104440.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
149	dbj|AK067034.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
150	dbj|AK061418.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
151	dbj|AK060717.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.6
152	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	42	1.6
153	emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4,...	42	1.6
154	emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4,...	42	1.6
155	emb|BX000456.3|CNS08CDD Oryza sativa chromosome 12, . BAC OSJNBa...	42	1.6
156	gb|AF010496.1|AF010496 Rhodobacter capsulatus strain SB1003, par...	42	1.6
157	gb|U38481.1|RNU38481 Rattus norvegicus ROK-alpha mRNA, complete cds	42	1.6
158	gb|M80237.1|STMDNRI S.peucetius DnrI and DnrJ genes, complete cds	42	1.6
159	dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic...	42	1.6
160	ref|NM_122273.2| Arabidopsis thaliana unknown protein AT5G23680 ...	40	6.1
161	gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome	40	6.1
162	ref|XM_462793.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
163	ref|NM_188436.1| Oryza sativa (japonica cultivar-group), predic...	40	6.1
164	ref|XM_476317.1| Oryza sativa (japonica cultivar-group), predic...	40	6.1
165	gb|AC007441.9| Drosophila melanogaster clone BACR10E03, complete...	40	6.1
166	ref|XM_480995.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
167	ref|XM_475411.1| Oryza sativa (japonica cultivar-group), predic...	40	6.1
168	ref|XM_521691.1| PREDICTED: Pan troglodytes LOC466291 (LOC466291...	40	6.1
169	ref|XM_470048.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
170	ref|XM_519705.1| PREDICTED: Pan troglodytes similar to FLJ14299 ...	40	6.1
171	ref|XM_466263.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
172	ref|XM_450503.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
173	ref|XM_506646.1| PREDICTED Oryza sativa (japonica cultivar-group...	40	6.1
174	ref|NM_190483.1| Oryza sativa (japonica cultivar-group), predic...	40	6.1
175	ref|XM_468758.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
176	ref|XM_479391.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
177	ref|NM_188838.2| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
178	ref|NM_194130.1| Oryza sativa (japonica cultivar-group), mRNA	40	6.1
179	ref|XM_472858.1| Oryza sativa (japonica cultivar-group), predic...	40	6.1
180	gb|AC105259.2| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
181	gb|AY137656.1| Brevicoryne brassicae microsatellite Bb68 sequence	40	6.1
182	gb|AY023466.1| Oryza sativa microsatellite MRG5791 containing (T...	40	6.1
183	gb|AY023325.1| Oryza sativa microsatellite MRG5650 containing (G...	40	6.1
184	gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...	40	6.1
185	gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
186	gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
187	gb|AY644643.1| Oryza sativa (indica cultivar-group) hypothetical...	40	6.1
188	gb|AC027133.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
189	gb|AC010919.11| Drosophila melanogaster clone BACR32K23, complet...	40	6.1
190	ref|XM_368973.1| Magnaporthe grisea 70-15 chromosome VI hypothet...	40	6.1
191	ref|XM_363785.1| Magnaporthe grisea 70-15 hypothetical protein (...	40	6.1
192	ref|XM_596366.2| PREDICTED: Bos taurus similar to v-crk sarcoma ...	40	6.1
193	ref|XM_960503.1| Neurospora crassa OR74A hypothetical protein (N...	40	6.1
194	ref|XM_603547.2| PREDICTED: Bos taurus similar to zinc finger pr...	40	6.1
195	ref|XM_959450.1| Neurospora crassa OR74A hypothetical protein (N...	40	6.1
196	ref|XM_324888.1| Neurospora crassa OR74A hypothetical protein (N...	40	6.1
197	gb|AC112159.2| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
198	ref|XM_330101.1| Neurospora crassa OR74A hypothetical protein (N...	40	6.1
199	gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co...	40	6.1
200	ref|NM_033212.2| Homo sapiens coiled-coil domain containing 102A...	40	6.1
201	gb|BC032534.1| Homo sapiens zinc finger protein 703, mRNA (cDNA ...	40	6.1
202	gb|BC009941.2| Homo sapiens coiled-coil domain containing 102A, ...	40	6.1
203	gb|BC008285.1| Homo sapiens coiled-coil domain containing 102A, ...	40	6.1
204	gb|AC004382.1|HUAC004382 Homo sapiens Chromosome 16 BAC clone CI...	40	6.1
205	gb|AC125085.4| Mus musculus BAC clone RP24-135G18 from chromosom...	40	6.1
206	ref|XM_848401.1| PREDICTED: Canis familiaris similar to Prostagl...	40	6.1
207	emb|CR729832.2|CNS0GQ32 Tetraodon nigroviridis full-length cDNA	40	6.1
208	emb|CR727009.2|CNS0GNWN Tetraodon nigroviridis full-length cDNA	40	6.1
209	emb|CR726703.1|CNS0GNO5 Tetraodon nigroviridis full-length cDNA	40	6.1
210	emb|CR726496.2|CNS0GNIE Tetraodon nigroviridis full-length cDNA	40	6.1
211	emb|CR723983.1|CNS0GLKL Tetraodon nigroviridis full-length cDNA	40	6.1
212	emb|CR721090.2|CNS0GJC8 Tetraodon nigroviridis full-length cDNA	40	6.1
213	emb|CR693296.2|CNS0FXWC Tetraodon nigroviridis full-length cDNA	40	6.1
214	emb|CR684960.2|CNS0FRGS Tetraodon nigroviridis full-length cDNA	40	6.1
215	emb|CR675506.2|CNS0FK6W Tetraodon nigroviridis full-length cDNA	40	6.1
216	emb|CR673642.1|CNS0FIR4 Tetraodon nigroviridis full-length cDNA	40	6.1
217	emb|CR672092.2|CNS0FHK2 Tetraodon nigroviridis full-length cDNA	40	6.1
218	emb|CR671889.2|CNS0FHEF Tetraodon nigroviridis full-length cDNA	40	6.1
219	emb|CR660398.2|CNS0F8J8 Tetraodon nigroviridis full-length cDNA	40	6.1
220	emb|CR659860.2|CNS0F84A Tetraodon nigroviridis full-length cDNA	40	6.1
221	ref|XM_852439.1| PREDICTED: Canis familiaris hypothetical LOC576...	40	6.1
222	ref|XM_533386.2| PREDICTED: Canis familiaris hypothetical LOC576...	40	6.1
223	emb|CR646529.2|CNS0EXTZ Tetraodon nigroviridis full-length cDNA	40	6.1
224	emb|AL163249.2|HS21C049 Homo sapiens chromosome 21 segment HS21C049	40	6.1
225	gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome	40	6.1
226	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	6.1
227	emb|AL162397.14| Human DNA sequence from clone RP11-86C4 on chro...	40	6.1
228	gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ...	40	6.1
229	emb|AL158035.14| Human DNA sequence from clone RP1-97J1 on chrom...	40	6.1
230	gb|AC137507.3| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genom...	40	6.1
231	emb|BX640452.1| Bordetella bronchiseptica strain RB50, complete ...	40	6.1
232	emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete ...	40	6.1
233	emb|BX640436.1| Bordetella parapertussis strain 12822, complete ...	40	6.1
234	emb|BX640427.1| Bordetella parapertussis strain 12822, complete ...	40	6.1
235	emb|BX640411.1| Bordetella pertussis strain Tohama I, complete g...	40	6.1
236	emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos...	40	6.1
237	emb|AL939118.1|SCO939118 Streptomyces coelicolor A3(2) complete ...	40	6.1
238	emb|AL731582.2|OSJN00232 Oryza sativa genomic DNA, chromosome 4,...	40	6.1
239	emb|AL606631.2|OSJN00069 Oryza sativa genomic DNA, chromosome 4,...	40	6.1
240	emb|AJ720094.1| Gallus gallus mRNA for hypothetical protein, clo...	40	6.1
241	gb|AC097633.2| Homo sapiens chromosome 3 clone RP11-96F15, compl...	40	6.1
242	gb|AC124043.2| Homo sapiens chromosome 3 clone RP11-143A18, comp...	40	6.1
243	gb|AY118524.1| Drosophila melanogaster LD22609 full insert cDNA	40	6.1
244	gb|AE005811.1| Caulobacter crescentus CB15 section 137 of 359 of...	40	6.1
245	dbj|AK024361.1| Homo sapiens cDNA FLJ14299 fis, clone PLACE10103...	40	6.1
246	dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g...	40	6.1
247	gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 geno...	40	6.1
248	ref|NM_132858.2| Drosophila melanogaster CG9056-RA (CG9056), mRNA	40	6.1
249	ref|NM_025069.1| Homo sapiens zinc finger protein 703 (ZNF703), ...	40	6.1
250	gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Canc...	40	6.1
251	ref|NM_001012864.1| Gallus gallus cisplatin resistance related p...	40	6.1
252	dbj|AK221484.1| Arabidopsis thaliana mRNA for hypothetical prote...	40	6.1
253	emb|CR407287.1| Gallus gallus finished cDNA, clone ChEST641a18	40	6.1
254	gb|AC090054.2|AC090054 Oryza sativa chromosome 9 clone PAC0645D0...	40	6.1
255	gb|AC013431.9|AC013431 Drosophila melanogaster, chromosome X, re...	40	6.1
256	gb|AF169377.1|AF169377 Dina lineata dinarica 5.8S ribosomal RNA,...	40	6.1
257	gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp...	40	6.1
258	gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...	40	6.1
259	gb|AE006470.1| Chlorobium tepidum TLS, complete genome	40	6.1
260	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
261	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
262	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
263	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
264	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
265	gb|AF377338.1| Myxococcus xanthus putative sensory histidine kin...	40	6.1
266	gb|AC138356.3| Homo sapiens chromosome 8, clone RP11-863K10, com...	40	6.1
267	dbj|AP002872.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
268	gb|AE004556.1| Pseudomonas aeruginosa PAO1, section 117 of 529 o...	40	6.1
269	gb|AC137579.3| Homo sapiens chromosome 8, clone RP11-346L1, comp...	40	6.1
270	gb|AY085468.1| Arabidopsis thaliana clone 152842 mRNA, complete ...	40	6.1
271	dbj|AP003450.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
272	gb|AC137674.2| Homo sapiens chromosome 3 clone RP11-348I13, comp...	40	6.1
273	dbj|AP005182.5| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
274	dbj|AP005495.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
275	dbj|AP006528.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
276	dbj|AP003271.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
277	dbj|AP003104.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
278	dbj|AP001633.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
279	dbj|AP002854.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
280	dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
281	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	40	6.1
282	dbj|AP002540.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
283	dbj|AP006727.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
284	dbj|AP005386.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
285	dbj|AP003523.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
286	dbj|AP003765.5| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
287	dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
288	dbj|BS000172.1| Pan troglodytes chromosome 22 clone:PTB-016G04, ...	40	6.1
289	dbj|AP005883.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
290	dbj|AP000366.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
291	dbj|AK109392.2| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
292	dbj|AP005799.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.1
293	dbj|AB025633.2| Arabidopsis thaliana genomic DNA, chromosome 5, ...	40	6.1
294	dbj|AK111130.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
295	dbj|AK109941.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
296	dbj|AK109004.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
297	dbj|AK104141.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
298	dbj|AK103645.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
299	dbj|AK102908.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
300	gb|DQ338976.1| Nesoxenica leprea elongation factor-1 alpha (EF1-...	40	6.1
301	dbj|AK073395.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
302	dbj|AK073250.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
303	dbj|AK072565.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
304	dbj|AK072307.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
305	dbj|AK067059.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
306	dbj|AK064858.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
307	gb|AC134622.3| Mus musculus BAC clone RP23-13I7 from 6, complete...	40	6.1
308	emb|CR628394.17| Zebrafish DNA sequence from clone DKEY-204A24 i...	40	6.1
309	dbj|AK059788.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.1
310	gb|AF124731.2|AF124731 Homo sapiens chromosome 21q22.1 PAC A2029...	40	6.1
311	emb|AL732341.3| Oryza sativa genomic DNA, chromosome 4, BAC clon...	40	6.1
312	emb|AL732354.2| Oryza sativa genomic DNA, chromosome 4, BAC clon...	40	6.1
313	gb|AE003703.3| Drosophila melanogaster chromosome 3R, section 41...	40	6.1
314	gb|AE003500.4| Drosophila melanogaster chromosome X, section 52 ...	40	6.1
315	gb|U85668.1|SSU85668 Schizura ipomeae elongation factor-1 alpha ...	40	6.1
316	gb|AC109163.16| Mus musculus chromosome 8, clone RP24-174F12, co...	40	6.1
317	dbj|AP006291.2| Homo sapiens genomic DNA, chromosome 8 clone:RP1...	40	6.1
318	dbj|AP000241.2| Homo sapiens genomic DNA, chromosome 21q, clone:...	40	6.1
319	gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome	40	6.1
320	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
321	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	40	6.1
322	emb|AL954364.5|CNS08CCZ Oryza sativa chromosome 12, . BAC OSJNBa...	40	6.1
323	emb|AL662974.3|OSJN00171 Oryza sativa genomic DNA, chromosome 4,...	40	6.1
324	emb|AL831803.4|CNS08CAG Oryza sativa chromosome 12, . BAC OSJNBb...	40	6.1
325	emb|AL831812.5|CNS08CAP Oryza sativa chromosome 12, . BAC OSJNBa...	40	6.1
326	emb|AL713948.4|CNS07YPR Oryza sativa chromosome 12, . BAC OJ1008...	40	6.1
327	emb|AL731786.3|CNS08C8A Oryza sativa chromosome 12, . BAC OSJNBa...	40	6.1
328	dbj|AP006146.1| Lotus japonicus genomic DNA, chromosome 3, clone...	40	6.1
329	gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome	40	6.1
330	dbj|AP000202.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2...	40	6.1
331	dbj|AP000097.1| Homo sapiens genomic DNA of 21q22.1, GART and AM...	40	6.1
332	dbj|AP000066.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen...	40	6.1

---

>dbj|AP003707.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1485_B09
          Length = 66599

 Score =  220 bits (111), Expect = 3e-54
 Identities = 147/159 (92%)
 Strand = Plus / Plus

                                                                         
Query: 128   aggatggcggcggcgccgcccgacgggcaggagaaggtgatcgcggcggcgcagcagatc 187
             |||||||||||||||||||| |  |||||||||||||||||||||||||||||||| |||
Sbjct: 27457 aggatggcggcggcgccgccgggagggcaggagaaggtgatcgcggcggcgcagcacatc 27516

                                                                         
Query: 188   gtcaagtcgctcgccaactccaagaacgccgcggacgacatgatccgcatcctctccggc 247
             |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||| 
Sbjct: 27517 gtcaagtcgctcgccaactccaagaacgccgccgacgacatgatccggatactctccggg 27576

                                                    
Query: 248   ttcgacaaccgcttctccctcatgtccgacctcttcccg 286
             |||||| ||||| || || ||||||||||||||||||||
Sbjct: 27577 ttcgacgaccgcctcaccttcatgtccgacctcttcccg 27615

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  220 bits (111), Expect = 3e-54
 Identities = 147/159 (92%)
 Strand = Plus / Plus

                                                                            
Query: 128      aggatggcggcggcgccgcccgacgggcaggagaaggtgatcgcggcggcgcagcagatc 187
                |||||||||||||||||||| |  |||||||||||||||||||||||||||||||| |||
Sbjct: 40228505 aggatggcggcggcgccgccgggagggcaggagaaggtgatcgcggcggcgcagcacatc 40228564

                                                                            
Query: 188      gtcaagtcgctcgccaactccaagaacgccgcggacgacatgatccgcatcctctccggc 247
                |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||| 
Sbjct: 40228565 gtcaagtcgctcgccaactccaagaacgccgccgacgacatgatccggatactctccggg 40228624

                                                       
Query: 248      ttcgacaaccgcttctccctcatgtccgacctcttcccg 286
                |||||| ||||| || || ||||||||||||||||||||
Sbjct: 40228625 ttcgacgaccgcctcaccttcatgtccgacctcttcccg 40228663



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 372      ccggctacggcggcgacgacgacgac 397
                ||||| ||||||||||||||||||||
Sbjct: 10563361 ccggcgacggcggcgacgacgacgac 10563336



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 35821775 acggcggcgacgacgacgac 35821794



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 331      gggggacgaggaggaggtgg 350
                ||||||||||||||||||||
Sbjct: 28595076 gggggacgaggaggaggtgg 28595095



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 6266597 acggcggcgacgacgacgac 6266578



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 2573092 acggcggcgacgacgacgac 2573073

---

>dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1793G04
          Length = 156714

 Score =  220 bits (111), Expect = 3e-54
 Identities = 147/159 (92%)
 Strand = Plus / Plus

                                                                         
Query: 128   aggatggcggcggcgccgcccgacgggcaggagaaggtgatcgcggcggcgcagcagatc 187
             |||||||||||||||||||| |  |||||||||||||||||||||||||||||||| |||
Sbjct: 94283 aggatggcggcggcgccgccgggagggcaggagaaggtgatcgcggcggcgcagcacatc 94342

                                                                         
Query: 188   gtcaagtcgctcgccaactccaagaacgccgcggacgacatgatccgcatcctctccggc 247
             |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||| 
Sbjct: 94343 gtcaagtcgctcgccaactccaagaacgccgccgacgacatgatccggatactctccggg 94402

                                                    
Query: 248   ttcgacaaccgcttctccctcatgtccgacctcttcccg 286
             |||||| ||||| || || ||||||||||||||||||||
Sbjct: 94403 ttcgacgaccgcctcaccttcatgtccgacctcttcccg 94441

---

>dbj|AP006165.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1425D05, complete sequence
          Length = 66450

 Score =  220 bits (111), Expect = 3e-54
 Identities = 147/159 (92%)
 Strand = Plus / Plus

                                                                         
Query: 128   aggatggcggcggcgccgcccgacgggcaggagaaggtgatcgcggcggcgcagcagatc 187
             |||||||||||||||||||| |  |||||||||||||||||||||||||||||||| |||
Sbjct: 19855 aggatggcggcggcgccgccgggagggcaggagaaggtgatcgcggcggcgcagcacatc 19914

                                                                         
Query: 188   gtcaagtcgctcgccaactccaagaacgccgcggacgacatgatccgcatcctctccggc 247
             |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||| 
Sbjct: 19915 gtcaagtcgctcgccaactccaagaacgccgccgacgacatgatccggatactctccggg 19974

                                                    
Query: 248   ttcgacaaccgcttctccctcatgtccgacctcttcccg 286
             |||||| ||||| || || ||||||||||||||||||||
Sbjct: 19975 ttcgacgaccgcctcaccttcatgtccgacctcttcccg 20013

---

>dbj|AK099844.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013109B06, full
           insert sequence
          Length = 2342

 Score =  220 bits (111), Expect = 3e-54
 Identities = 147/159 (92%)
 Strand = Plus / Plus

                                                                       
Query: 128 aggatggcggcggcgccgcccgacgggcaggagaaggtgatcgcggcggcgcagcagatc 187
           |||||||||||||||||||| |  |||||||||||||||||||||||||||||||| |||
Sbjct: 58  aggatggcggcggcgccgccgggagggcaggagaaggtgatcgcggcggcgcagcacatc 117

                                                                       
Query: 188 gtcaagtcgctcgccaactccaagaacgccgcggacgacatgatccgcatcctctccggc 247
           |||||||||||||||||||||||||||||||| |||||||||||||| || |||||||| 
Sbjct: 118 gtcaagtcgctcgccaactccaagaacgccgccgacgacatgatccggatactctccggg 177

                                                  
Query: 248 ttcgacaaccgcttctccctcatgtccgacctcttcccg 286
           |||||| ||||| || || ||||||||||||||||||||
Sbjct: 178 ttcgacgaccgcctcaccttcatgtccgacctcttcccg 216

---

>ref|XM_472246.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2067

 Score =  145 bits (73), Expect = 1e-31
 Identities = 97/105 (92%)
 Strand = Plus / Plus

                                                                       
Query: 161 aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
           |||||| |||||||||||||||| ||||| |||||||| ||||  || ||||||||||||
Sbjct: 94  aaggtgctcgcggcggcgcagcacatcgtgaagtcgctggccacgtcgaagaacgccgcg 153

                                                        
Query: 221 gacgacatgatccgcatcctctccggcttcgacaaccgcttctcc 265
           ||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 154 gacgacatgatccgcatcctctccggcttcgaccaccgcttctcc 198

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  145 bits (73), Expect = 1e-31
 Identities = 97/105 (92%)
 Strand = Plus / Plus

                                                                            
Query: 161      aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
                |||||| |||||||||||||||| ||||| |||||||| ||||  || ||||||||||||
Sbjct: 18751694 aaggtgctcgcggcggcgcagcacatcgtgaagtcgctggccacgtcgaagaacgccgcg 18751753

                                                             
Query: 221      gacgacatgatccgcatcctctccggcttcgacaaccgcttctcc 265
                ||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 18751754 gacgacatgatccgcatcctctccggcttcgaccaccgcttctcc 18751798



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 373      cggctacggcggcgacgacgacgac 397
                |||| ||||||||||||||||||||
Sbjct: 22322885 cggcgacggcggcgacgacgacgac 22322909



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 275      gacctcttcccggccgccggc 295
                |||||||||||||||||||||
Sbjct: 11159169 gacctcttcccggccgccggc 11159189



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 23759894 acggcggcgacgacgacgac 23759913



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 17491739 acggcggcgacgacgacgac 17491758



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 1041898 acggcggcgacgacgacgac 1041917

---

>emb|AL662977.3|OSJN00176 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0072D21,
              complete sequence
          Length = 160456

 Score =  145 bits (73), Expect = 1e-31
 Identities = 97/105 (92%)
 Strand = Plus / Plus

                                                                          
Query: 161    aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
              |||||| |||||||||||||||| ||||| |||||||| ||||  || ||||||||||||
Sbjct: 100857 aaggtgctcgcggcggcgcagcacatcgtgaagtcgctggccacgtcgaagaacgccgcg 100916

                                                           
Query: 221    gacgacatgatccgcatcctctccggcttcgacaaccgcttctcc 265
              ||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 100917 gacgacatgatccgcatcctctccggcttcgaccaccgcttctcc 100961

---

>dbj|AK103564.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033132L03, full
           insert sequence
          Length = 2581

 Score =  145 bits (73), Expect = 1e-31
 Identities = 97/105 (92%)
 Strand = Plus / Plus

                                                                       
Query: 161 aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
           |||||| |||||||||||||||| ||||| |||||||| ||||  || ||||||||||||
Sbjct: 204 aaggtgctcgcggcggcgcagcacatcgtgaagtcgctggccacgtcgaagaacgccgcg 263

                                                        
Query: 221 gacgacatgatccgcatcctctccggcttcgacaaccgcttctcc 265
           ||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 264 gacgacatgatccgcatcctctccggcttcgaccaccgcttctcc 308

---

>ref|XM_465879.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2280

 Score =  131 bits (66), Expect = 2e-27
 Identities = 113/128 (88%), Gaps = 3/128 (2%)
 Strand = Plus / Plus

                                                                       
Query: 161 aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
           |||||| |||| ||||||||||| |||||||||||||| || |  |||||||||||||| 
Sbjct: 142 aaggtgctcgccgcggcgcagcacatcgtcaagtcgctggcgacatccaagaacgccgcc 201

                                                                       
Query: 221 gacgacatgatccgcatcctctccggcttcgacaaccgcttctccc---tcatgtccgac 277
           ||||||||||||||||||||||| ||||||||||||||| ||||||   |||  ||||||
Sbjct: 202 gacgacatgatccgcatcctctcgggcttcgacaaccgcctctcccagatcacctccgac 261

                   
Query: 278 ctcttccc 285
           ||||||||
Sbjct: 262 ctcttccc 269

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  131 bits (66), Expect = 2e-27
 Identities = 113/128 (88%), Gaps = 3/128 (2%)
 Strand = Plus / Plus

                                                                            
Query: 161      aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
                |||||| |||| ||||||||||| |||||||||||||| || |  |||||||||||||| 
Sbjct: 18075237 aaggtgctcgccgcggcgcagcacatcgtcaagtcgctggcgacatccaagaacgccgcc 18075296

                                                                            
Query: 221      gacgacatgatccgcatcctctccggcttcgacaaccgcttctccc---tcatgtccgac 277
                ||||||||||||||||||||||| ||||||||||||||| ||||||   |||  ||||||
Sbjct: 18075297 gacgacatgatccgcatcctctcgggcttcgacaaccgcctctcccagatcacctccgac 18075356

                        
Query: 278      ctcttccc 285
                ||||||||
Sbjct: 18075357 ctcttccc 18075364



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 379      cggcggcgacgacgacgacc 398
                ||||||||||||||||||||
Sbjct: 21339750 cggcggcgacgacgacgacc 21339769



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 108     gcggcgcgggcgcggggggc 127
               ||||||||||||||||||||
Sbjct: 5180594 gcggcgcgggcgcggggggc 5180575

---

>dbj|AP005285.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1003_F04
          Length = 139563

 Score =  131 bits (66), Expect = 2e-27
 Identities = 113/128 (88%), Gaps = 3/128 (2%)
 Strand = Plus / Plus

                                                                          
Query: 161    aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
              |||||| |||| ||||||||||| |||||||||||||| || |  |||||||||||||| 
Sbjct: 136831 aaggtgctcgccgcggcgcagcacatcgtcaagtcgctggcgacatccaagaacgccgcc 136890

                                                                          
Query: 221    gacgacatgatccgcatcctctccggcttcgacaaccgcttctccc---tcatgtccgac 277
              ||||||||||||||||||||||| ||||||||||||||| ||||||   |||  ||||||
Sbjct: 136891 gacgacatgatccgcatcctctcgggcttcgacaaccgcctctcccagatcacctccgac 136950

                      
Query: 278    ctcttccc 285
              ||||||||
Sbjct: 136951 ctcttccc 136958

---

>dbj|AK120466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108M03, full
           insert sequence
          Length = 5557

 Score =  131 bits (66), Expect = 2e-27
 Identities = 113/128 (88%), Gaps = 3/128 (2%)
 Strand = Plus / Plus

                                                                       
Query: 161 aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
           |||||| |||| ||||||||||| |||||||||||||| || |  |||||||||||||| 
Sbjct: 141 aaggtgctcgccgcggcgcagcacatcgtcaagtcgctggcgacatccaagaacgccgcc 200

                                                                       
Query: 221 gacgacatgatccgcatcctctccggcttcgacaaccgcttctccc---tcatgtccgac 277
           ||||||||||||||||||||||| ||||||||||||||| ||||||   |||  ||||||
Sbjct: 201 gacgacatgatccgcatcctctcgggcttcgacaaccgcctctcccagatcacctccgac 260

                   
Query: 278 ctcttccc 285
           ||||||||
Sbjct: 261 ctcttccc 268

---

>dbj|AK102812.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033108L10, full
           insert sequence
          Length = 2279

 Score =  131 bits (66), Expect = 2e-27
 Identities = 113/128 (88%), Gaps = 3/128 (2%)
 Strand = Plus / Plus

                                                                       
Query: 161 aaggtgatcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcg 220
           |||||| |||| ||||||||||| |||||||||||||| || |  |||||||||||||| 
Sbjct: 141 aaggtgctcgccgcggcgcagcacatcgtcaagtcgctggcgacatccaagaacgccgcc 200

                                                                       
Query: 221 gacgacatgatccgcatcctctccggcttcgacaaccgcttctccc---tcatgtccgac 277
           ||||||||||||||||||||||| ||||||||||||||| ||||||   |||  ||||||
Sbjct: 201 gacgacatgatccgcatcctctcgggcttcgacaaccgcctctcccagatcacctccgac 260

                   
Query: 278 ctcttccc 285
           ||||||||
Sbjct: 261 ctcttccc 268

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                            
Query: 168      tcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcggacgaca 227
                |||| ||||||||||| ||||| |||||||| ||||  || |||||| ||||||| ||||
Sbjct: 13751955 tcgccgcggcgcagcacatcgtgaagtcgctagccacgtcgaagaacaccgcggatgaca 13751896

                              
Query: 228      tgatccgcatcctc 241
                ||||||||||||||
Sbjct: 13751895 tgatccgcatcctc 13751882



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 379      cggcggcgacgacgacgacctg 400
                ||||||||||||||||||||||
Sbjct: 24650554 cggcggcgacgacgacgacctg 24650533



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 394     cgacctgnaggacgagagggacgcg 418
               ||||||| |||||||||||||||||
Sbjct: 7540510 cgacctggaggacgagagggacgcg 7540534



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 378     acggcggcgacgacgacgacc 398
               |||||||||||||||||||||
Sbjct: 8503260 acggcggcgacgacgacgacc 8503240



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 287      gccgccggcgcccccgacgccgcggccg 314
                |||||||||||| |||||||||| ||||
Sbjct: 33670959 gccgccggcgccgccgacgccgccgccg 33670932



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 17550658 acggcggcgacgacgacgac 17550677

---

>gb|AC107619.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0048D11, from chromosome 3, complete sequence
          Length = 158911

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                         
Query: 168   tcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcggacgaca 227
             |||| ||||||||||| ||||| |||||||| ||||  || |||||| ||||||| ||||
Sbjct: 28483 tcgccgcggcgcagcacatcgtgaagtcgctagccacgtcgaagaacaccgcggatgaca 28424

                           
Query: 228   tgatccgcatcctc 241
             ||||||||||||||
Sbjct: 28423 tgatccgcatcctc 28410

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                            
Query: 168      tcgcggcggcgcagcagatcgtcaagtcgctcgccaactccaagaacgccgcggacgaca 227
                |||| ||||||||||| ||||| |||||||| ||||  || |||||| ||||||| ||||
Sbjct: 13746930 tcgccgcggcgcagcacatcgtgaagtcgctagccacgtcgaagaacaccgcggatgaca 13746871

                              
Query: 228      tgatccgcatcctc 241
                ||||||||||||||
Sbjct: 13746870 tgatccgcatcctc 13746857



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 379      cggcggcgacgacgacgacctg 400
                ||||||||||||||||||||||
Sbjct: 24568023 cggcggcgacgacgacgacctg 24568002



 Score = 44.1 bits (22), Expect = 0.39
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 394     cgacctgnaggacgagagggacgcg 418
               ||||||| |||||||||||||||||
Sbjct: 7538345 cgacctggaggacgagagggacgcg 7538369



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 378     acggcggcgacgacgacgacc 398
               |||||||||||||||||||||
Sbjct: 8501095 acggcggcgacgacgacgacc 8501075



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 287      gccgccggcgcccccgacgccgcggccg 314
                |||||||||||| |||||||||| ||||
Sbjct: 33761431 gccgccggcgccgccgacgccgccgccg 33761404



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 17544199 acggcggcgacgacgacgac 17544218

---

>gb|AC145383.3| Oryza sativa chromosome 3 BAC OSJNBa0038E17 genomic sequence, complete
             sequence
          Length = 141691

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 379   cggcggcgacgacgacgacctg 400
             ||||||||||||||||||||||
Sbjct: 26740 cggcggcgacgacgacgacctg 26719

---

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 169     cgcggcggcgcagcagatcgtc 190
               ||||||||||||||||||||||
Sbjct: 1145721 cgcggcggcgcagcagatcgtc 1145700

---

>gb|AC130598.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0056I11, complete sequence
          Length = 145796

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 376   ctacggcggcgacgacgacgac 397
             ||||||||||||||||||||||
Sbjct: 60084 ctacggcggcgacgacgacgac 60063

---

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 169     cgcggcggcgcagcagatcgtc 190
               ||||||||||||||||||||||
Sbjct: 2054339 cgcggcggcgcagcagatcgtc 2054360

---

>ref|XM_390509.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG10333.1)
           partial mRNA
          Length = 1524

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 378 acggcggcgacgacgacgacct 399
           ||||||||||||||||||||||
Sbjct: 440 acggcggcgacgacgacgacct 461

---

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 169     cgcggcggcgcagcagatcgtc 190
               ||||||||||||||||||||||
Sbjct: 2321787 cgcggcggcgcagcagatcgtc 2321766

---

>emb|AL732379.5|CNS08C92 Oryza sativa chromosome 3, . BAC OSJNBa0025B02 of library OSJNBa from
             chromosome 3 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 136470

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 379   cggcggcgacgacgacgacctg 400
             ||||||||||||||||||||||
Sbjct: 82600 cggcggcgacgacgacgacctg 82579

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 376     ctacggcggcgacgacgacgac 397
               ||||||||||||||||||||||
Sbjct: 1607924 ctacggcggcgacgacgacgac 1607903



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 22876041 acggcggcgacgacgacgac 22876060



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                           
Query: 133     ggcggcggcgccgcccgacgggcaggag 160
               ||||||||||||| ||||||||||||||
Sbjct: 8500248 ggcggcggcgccg-ccgacgggcaggag 8500222

---

>dbj|AP002482.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0706B05
          Length = 187835

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 372   ccggctacggcggcgacgacgacgac 397
             ||||| ||||||||||||||||||||
Sbjct: 57984 ccggcgacggcggcgacgacgacgac 57959

---

>gb|AC134239.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0042A11, complete sequence
          Length = 113049

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 394   cgacctgnaggacgagagggacgcg 418
             ||||||| |||||||||||||||||
Sbjct: 69406 cgacctggaggacgagagggacgcg 69430

---

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                             
Query: 413     gacgcggcggtggaggacgcgctgcggctc 442
               ||||||||||||| | ||||||||||||||
Sbjct: 1723363 gacgcggcggtggcgcacgcgctgcggctc 1723392



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 415     cgcggcggtggaggacgcgct 435
               |||||||||||||||||||||
Sbjct: 4983684 cgcggcggtggaggacgcgct 4983704



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcggcgcgggcgcggggggc 127
               ||||||||||||||||||||
Sbjct: 3808349 gcggcgcgggcgcggggggc 3808368

---

>dbj|AK108683.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-149-B10, full
           insert sequence
          Length = 1528

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 376 ctacggcggcgacgacgacgac 397
           ||||||||||||||||||||||
Sbjct: 592 ctacggcggcgacgacgacgac 613

---

>dbj|AK070443.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023054D03, full
           insert sequence
          Length = 1655

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 372 ccggctacggcggcgacgacgacgac 397
           ||||| ||||||||||||||||||||
Sbjct: 42  ccggcgacggcggcgacgacgacgac 67

---

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 363     agcggggccccggctacggcggcgacgacgacga 396
               |||||||| ||||||||||||||| | |||||||
Sbjct: 3408952 agcggggcgccggctacggcggcggccacgacga 3408919



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 423     tggaggacgcgctgcggctc 442
               ||||||||||||||||||||
Sbjct: 1982315 tggaggacgcgctgcggctc 1982296



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 418     ggcggtggaggacgcgctgcggct 441
               |||| |||||||||||||||||||
Sbjct: 1975891 ggcgctggaggacgcgctgcggct 1975868

---

>gb|AC125495.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0085M22,
              complete sequence
          Length = 145104

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 378    acggcggcgacgacgacgacc 398
              |||||||||||||||||||||
Sbjct: 126803 acggcggcgacgacgacgacc 126783

---

>ref|XM_462658.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1335

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 373 cggctacggcggcgacgacgacgac 397
           |||| ||||||||||||||||||||
Sbjct: 47  cggcgacggcggcgacgacgacgac 71

---

>ref|XM_471465.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1605

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 275  gacctcttcccggccgccggc 295
            |||||||||||||||||||||
Sbjct: 1030 gacctcttcccggccgccggc 1050

---

>ref|XM_958092.1| Neurospora crassa OR74A hypothetical protein (NCU08425.1) partial
            mRNA
          Length = 1461

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 329  gagggggacgaggaggaggtggagt 353
            |||||||||||||||||||| ||||
Sbjct: 1435 gagggggacgaggaggaggttgagt 1459

---

>ref|XM_329470.1| Neurospora crassa OR74A hypothetical protein (NCU08425.1) partial
            mRNA
          Length = 1461

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 329  gagggggacgaggaggaggtggagt 353
            |||||||||||||||||||| ||||
Sbjct: 1435 gagggggacgaggaggaggttgagt 1459

---

>ref|XM_844924.1| PREDICTED: Canis familiaris similar to purine rich element binding
           protein B (LOC608031), mRNA
          Length = 1026

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 376 ctacggcggcgacgacgacga 396
           |||||||||||||||||||||
Sbjct: 678 ctacggcggcgacgacgacga 698

---

>ref|NM_013022.1| Rattus norvegicus Rho-associated coiled-coil forming kinase 2
           (Rock2), mRNA
          Length = 4470

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 291 ccggcgcccccgacgccgcggccgg 315
           ||||||||||||| |||||||||||
Sbjct: 78  ccggcgcccccgaggccgcggccgg 102

---

>emb|BX072038.1|CNS09RQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 700 ccgaggaggacgaggaggaggtgga 676

---

>emb|BX072037.1|CNS09RQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 532 ccgaggaggacgaggaggaggtgga 556

---

>emb|BX071074.1|CNS09R06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 707 ccgaggaggacgaggaggaggtgga 683

---

>emb|BX071073.1|CNS09R05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 535 ccgaggaggacgaggaggaggtgga 559

---

>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 241 ccgaggaggacgaggaggaggtgga 217

---

>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 712 ccgaggaggacgaggaggaggtgga 736

---

>emb|BX065976.1|CNS09N2K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 695 ccgaggaggacgaggaggaggtgga 671

---

>emb|BX065975.1|CNS09N2J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 494 ccgaggaggacgaggaggaggtgga 518

---

>emb|BX064684.1|CNS09M2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 507 ccgaggaggacgaggaggaggtgga 531

---

>emb|BX063673.1|CNS09LAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 480 ccgaggaggacgaggaggaggtgga 504

---

>emb|BX061993.1|CNS09JZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 722 ccgaggaggacgaggaggaggtgga 698

---

>emb|BX061992.1|CNS09JZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 533 ccgaggaggacgaggaggaggtgga 557

---

>emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 703 ccgaggaggacgaggaggaggtgga 679

---

>emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 520 ccgaggaggacgaggaggaggtgga 544

---

>emb|BX054844.1|CNS09EHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 454

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 337 ccgaggaggacgaggaggaggtgga 361

---

>emb|BX054383.1|CNS09E4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 139 ccgaggaggacgaggaggaggtgga 115

---

>emb|BX054382.1|CNS09E4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 459 ccgaggaggacgaggaggaggtgga 483

---

>emb|BX052598.1|CNS09CQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 713 ccgaggaggacgaggaggaggtgga 689

---

>emb|BX052597.1|CNS09CQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 194 ccgaggaggacgaggaggaggtgga 218

---

>emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 551 ccgaggaggacgaggaggaggtgga 575

---

>emb|BX051766.1|CNS09C3U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 705 ccgaggaggacgaggaggaggtgga 681

---

>emb|BX051765.1|CNS09C3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 532 ccgaggaggacgaggaggaggtgga 556

---

>emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 705 ccgaggaggacgaggaggaggtgga 681

---

>emb|BX050825.1|CNS09BDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 525 ccgaggaggacgaggaggaggtgga 549

---

>emb|BX049822.1|CNS09ALU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 713 ccgaggaggacgaggaggaggtgga 689

---

>emb|BX049821.1|CNS09ALT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 529 ccgaggaggacgaggaggaggtgga 553

---

>emb|BX030920.1|CNS08W0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 721 ccgaggaggacgaggaggaggtgga 697

---

>emb|BX030919.1|CNS08W0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 574 ccgaggaggacgaggaggaggtgga 598

---

>emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 552 ccgaggaggacgaggaggaggtgga 576

---

>emb|BX045807.1|CNS097IB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 710 ccgaggaggacgaggaggaggtgga 686

---

>emb|BX045806.1|CNS097IA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 528 ccgaggaggacgaggaggaggtgga 552

---

>emb|BX042049.1|CNS094LX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 708 ccgaggaggacgaggaggaggtgga 684

---

>emb|BX042048.1|CNS094LW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 524 ccgaggaggacgaggaggaggtgga 548

---

>emb|BX040221.1|CNS09375 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 707 ccgaggaggacgaggaggaggtgga 683

---

>emb|BX040220.1|CNS09374 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 494 ccgaggaggacgaggaggaggtgga 518

---

>emb|BX037502.1|CNS0913M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 258 ccgaggaggacgaggaggaggtgga 234

---

>emb|BX037471.1|CNS0912R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 542 ccgaggaggacgaggaggaggtgga 566

---

>emb|BX036960.1|CNS090OK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 720 ccgaggaggacgaggaggaggtgga 696

---

>emb|BX036959.1|CNS090OJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 554 ccgaggaggacgaggaggaggtgga 578

---

>emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 717 ccgaggaggacgaggaggaggtgga 693

---

>emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 545 ccgaggaggacgaggaggaggtgga 569

---

>emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 713 ccgaggaggacgaggaggaggtgga 689

---

>emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 546 ccgaggaggacgaggaggaggtgga 570

---

>emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 703 ccgaggaggacgaggaggaggtgga 679

---

>emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 531 ccgaggaggacgaggaggaggtgga 555

---

>emb|BX034217.1|CNS08YKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 570 ccgaggaggacgaggaggaggtgga 594

---

>emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 532 ccgaggaggacgaggaggaggtgga 556

---

>emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 229 ccgaggaggacgaggaggaggtgga 205

---

>emb|BX033034.1|CNS08XNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 564 ccgaggaggacgaggaggaggtgga 588

---

>emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 541 ccgaggaggacgaggaggaggtgga 565

---

>emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 600 ccgaggaggacgaggaggaggtgga 576

---

>emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 556 ccgaggaggacgaggaggaggtgga 580

---

>emb|BX028005.1|CNS08TRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 722 ccgaggaggacgaggaggaggtgga 698

---

>emb|BX028004.1|CNS08TRS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 541 ccgaggaggacgaggaggaggtgga 565

---

>emb|BX027756.1|CNS08TKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 311

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 237 ccgaggaggacgaggaggaggtgga 213

---

>emb|BX024640.1|CNS08R6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 520 ccgaggaggacgaggaggaggtgga 544

---

>emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 544 ccgaggaggacgaggaggaggtgga 520

---

>emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 536 ccgaggaggacgaggaggaggtgga 560

---

>emb|BX022052.1|CNS08P6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 602 ccgaggaggacgaggaggaggtgga 578

---

>emb|BX022051.1|CNS08P6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 543 ccgaggaggacgaggaggaggtgga 567

---

>emb|BX019569.1|CNS08N9H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 719 ccgaggaggacgaggaggaggtgga 695

---

>emb|BX019568.1|CNS08N9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 555 ccgaggaggacgaggaggaggtgga 579

---

>emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 541 ccgaggaggacgaggaggaggtgga 565

---

>emb|BX019149.1|CNS08MXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 261

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 85  ccgaggaggacgaggaggaggtgga 109

---

>emb|BX018722.1|CNS08MLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 552 ccgaggaggacgaggaggaggtgga 576

---

>emb|BX018239.1|CNS08M8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 706 ccgaggaggacgaggaggaggtgga 682

---

>emb|BX018238.1|CNS08M8I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 565 ccgaggaggacgaggaggaggtgga 589

---

>emb|BX017233.1|CNS08LGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 715 ccgaggaggacgaggaggaggtgga 691

---

>emb|BX017232.1|CNS08LGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 566 ccgaggaggacgaggaggaggtgga 590

---

>emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 235 ccgaggaggacgaggaggaggtgga 211

---

>emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 730 ccgaggaggacgaggaggaggtgga 706

---

>emb|BX016618.1|CNS08KZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 558 ccgaggaggacgaggaggaggtgga 582

---

>emb|BX016202.1|CNS08KNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 698 ccgaggaggacgaggaggaggtgga 674

---

>emb|BX016201.1|CNS08KNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 529 ccgaggaggacgaggaggaggtgga 553

---

>emb|BX016072.1|CNS08KKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 555 ccgaggaggacgaggaggaggtgga 531

---

>emb|BX016071.1|CNS08KKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 446

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 276 ccgaggaggacgaggaggaggtgga 300

---

>emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 711 ccgaggaggacgaggaggaggtgga 687

---

>emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 528 ccgaggaggacgaggaggaggtgga 552

---

>emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 708 ccgaggaggacgaggaggaggtgga 684

---

>emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 688 ccgaggaggacgaggaggaggtgga 664

---

>emb|BX014834.1|CNS08JLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 537 ccgaggaggacgaggaggaggtgga 561

---

>emb|BX014823.1|CNS08JLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 564 ccgaggaggacgaggaggaggtgga 588

---

>emb|BX012788.1|CNS08I14 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 490 ccgaggaggacgaggaggaggtgga 514

---

>emb|BX011620.1|CNS08H4O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 546 ccgaggaggacgaggaggaggtgga 570

---

>emb|BX009503.1|CNS08FHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 718 ccgaggaggacgaggaggaggtgga 694

---

>emb|BX009502.1|CNS08FHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 541 ccgaggaggacgaggaggaggtgga 565

---

>emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1018

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 698 ccgaggaggacgaggaggaggtgga 674

---

>emb|BX009475.1|CNS08FH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 544 ccgaggaggacgaggaggaggtgga 568

---

>emb|BX007868.1|CNS08E8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 676 ccgaggaggacgaggaggaggtgga 652

---

>emb|BX007867.1|CNS08E8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 461 ccgaggaggacgaggaggaggtgga 485

---

>emb|BX007827.1|CNS08E7B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 723 ccgaggaggacgaggaggaggtgga 699

---

>emb|BX007826.1|CNS08E7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 535 ccgaggaggacgaggaggaggtgga 559

---

>emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 718 ccgaggaggacgaggaggaggtgga 694

---

>emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 566 ccgaggaggacgaggaggaggtgga 590

---

>emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 709 ccgaggaggacgaggaggaggtgga 685

---

>emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 544 ccgaggaggacgaggaggaggtgga 568

---

>emb|BX284762.1|NCB13B3 Neurospora crassa DNA linkage group II BAC contig B13B3
          Length = 82584

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 329   gagggggacgaggaggaggtggagt 353
             |||||||||||||||||||| ||||
Sbjct: 75096 gagggggacgaggaggaggttgagt 75072

---

>dbj|AB219074.1| Sorghum bicolor SbPCL1 mRNA, partial cds
          Length = 600

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 375 gctacggcggcgacgacgacg 395
           |||||||||||||||||||||
Sbjct: 44  gctacggcggcgacgacgacg 64

---

>gb|AF169823.1| Spodoptera exigua nucleopolyhedrovirus complete genome
          Length = 135611

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 379    cggcggcgacgacgacgacct 399
              |||||||||||||||||||||
Sbjct: 117696 cggcggcgacgacgacgacct 117716

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 379      cggcggcgacgacgacgacct 399
                |||||||||||||||||||||
Sbjct: 20441842 cggcggcgacgacgacgacct 20441862



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 26916087 acggcggcgacgacgacgac 26916106



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 16544227 acggcggcgacgacgacgac 16544208



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 379     cggcggcgacgacgacgacc 398
               ||||||||||||||||||||
Sbjct: 7806328 cggcggcgacgacgacgacc 7806309



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 2350198 acggcggcgacgacgacgac 2350217



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 2346090 acggcggcgacgacgacgac 2346109

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 373      cggctacggcggcgacgacgacgac 397
                ||||| |||||||||||||||||||
Sbjct: 23840269 cggctgcggcggcgacgacgacgac 23840245



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 370     ccccggctacggcggcgacga 390
               |||||||||||||||||||||
Sbjct: 7855539 ccccggctacggcggcgacga 7855559



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 25773370 acggcggcgacgacgacgac 25773389



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 25449304 acggcggcgacgacgacgac 25449285



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 23828634 acggcggcgacgacgacgac 23828615



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 3952602 acggcggcgacgacgacgac 3952621



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 3722662 acggcggcgacgacgacgac 3722643

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 287     gccgccggcgcccccgacgcc 307
               |||||||||||||||||||||
Sbjct: 4749408 gccgccggcgcccccgacgcc 4749388



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 412     ggacgcggcggtggaggacgcgctgcggctcatcgag 448
               |||||||||||  ||| |||| |||||||||||||||
Sbjct: 3556956 ggacgcggcggccgagtacgccctgcggctcatcgag 3556920



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 305     gccgcggccggctccgagct 324
               ||||||||||||||||||||
Sbjct: 7310747 gccgcggccggctccgagct 7310766

---

>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0431E05
          Length = 146091

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 370   ccccggctacggcggcgacga 390
             |||||||||||||||||||||
Sbjct: 69921 ccccggctacggcggcgacga 69941

---

>dbj|AP004279.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0556B08
          Length = 136775

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 373   cggctacggcggcgacgacgacgac 397
             ||||| |||||||||||||||||||
Sbjct: 79934 cggctgcggcggcgacgacgacgac 79910



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 68299 acggcggcgacgacgacgac 68280

---

>dbj|AK121181.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023084D19, full
           insert sequence
          Length = 1919

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 378 acggcggcgacgacgacgacc 398
           |||||||||||||||||||||
Sbjct: 748 acggcggcgacgacgacgacc 768

---

>dbj|AK120786.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023010M08, full
           insert sequence
          Length = 1770

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 373 cggctacggcggcgacgacgacgac 397
           |||| ||||||||||||||||||||
Sbjct: 279 cggcgacggcggcgacgacgacgac 303

---

>ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147
           (ENSANGG00000017834), partial mRNA
          Length = 619

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 501 ccgaggaggacgaggaggaggtgga 525

---

>dbj|AK109494.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-A01, full
           insert sequence
          Length = 1610

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 373 cggctacggcggcgacgacgacgac 397
           |||| ||||||||||||||||||||
Sbjct: 101 cggcgacggcggcgacgacgacgac 125

---

>ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323
           (ENSANGG00000017834), partial mRNA
          Length = 694

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 327 ccgagggggacgaggaggaggtgga 351
           |||||| ||||||||||||||||||
Sbjct: 537 ccgaggaggacgaggaggaggtgga 561

---

>dbj|AK104440.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-H05, full
           insert sequence
          Length = 1074

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 373 cggctacggcggcgacgacgacgac 397
           ||||| |||||||||||||||||||
Sbjct: 106 cggctgcggcggcgacgacgacgac 82

---

>dbj|AK067034.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013089M24, full
           insert sequence
          Length = 1951

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 370 ccccggctacggcggcgacga 390
           |||||||||||||||||||||
Sbjct: 75  ccccggctacggcggcgacga 55

---

>dbj|AK061418.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E09, full
           insert sequence
          Length = 1160

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 373 cggctacggcggcgacgacgacgac 397
           ||||| |||||||||||||||||||
Sbjct: 140 cggctgcggcggcgacgacgacgac 116

---

>dbj|AK060717.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-E06, full
           insert sequence
          Length = 1324

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 378 acggcggcgacgacgacgacc 398
           |||||||||||||||||||||
Sbjct: 61  acggcggcgacgacgacgacc 81

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 379      cggcggcgacgacgacgacct 399
                |||||||||||||||||||||
Sbjct: 20368056 cggcggcgacgacgacgacct 20368076



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 26844257 acggcggcgacgacgacgac 26844276



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 378      acggcggcgacgacgacgac 397
                ||||||||||||||||||||
Sbjct: 16497460 acggcggcgacgacgacgac 16497441



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 379     cggcggcgacgacgacgacc 398
               ||||||||||||||||||||
Sbjct: 7806209 cggcggcgacgacgacgacc 7806190



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 2350142 acggcggcgacgacgacgac 2350161



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 378     acggcggcgacgacgacgac 397
               ||||||||||||||||||||
Sbjct: 2346034 acggcggcgacgacgacgac 2346053

---

>emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0115I09,
             complete sequence
          Length = 141580

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 275   gacctcttcccggccgccggc 295
             |||||||||||||||||||||
Sbjct: 27793 gacctcttcccggccgccggc 27813

---

>emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064H22,
             complete sequence
          Length = 147214

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 373   cggctacggcggcgacgacgacgac 397
             |||| ||||||||||||||||||||
Sbjct: 73789 cggcgacggcggcgacgacgacgac 73813

---

>emb|BX000456.3|CNS08CDD Oryza sativa chromosome 12, . BAC OSJNBa0050D07 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 185820

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 379   cggcggcgacgacgacgacct 399
             |||||||||||||||||||||
Sbjct: 69859 cggcggcgacgacgacgacct 69839

---

>gb|AF010496.1|AF010496 Rhodobacter capsulatus strain SB1003, partial genome
          Length = 189370

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 166   gatcgcggcggcgcagcagat 186
             |||||||||||||||||||||
Sbjct: 29297 gatcgcggcggcgcagcagat 29317

---

>gb|U38481.1|RNU38481 Rattus norvegicus ROK-alpha mRNA, complete cds
          Length = 4470

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 291 ccggcgcccccgacgccgcggccgg 315
           ||||||||||||| |||||||||||
Sbjct: 78  ccggcgcccccgaggccgcggccgg 102

---

>gb|M80237.1|STMDNRI S.peucetius DnrI and DnrJ genes, complete cds
          Length = 2313

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 146  cccgacgggcaggagaaggtgatcg 170
            ||||||| |||||||||||||||||
Sbjct: 2099 cccgacgcgcaggagaaggtgatcg 2123

---

>dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic gene cluster
          Length = 104326

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 412   ggacgcggcggtggaggacgcgctgcggctcatcgag 448
             |||||||||||  ||| |||| |||||||||||||||
Sbjct: 80849 ggacgcggcggccgagtacgccctgcggctcatcgag 80885

---

>ref|NM_122273.2| Arabidopsis thaliana unknown protein AT5G23680 mRNA, complete cds
          Length = 1898

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 824 acggcggcgacgacgacgac 843

---

>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome
          Length = 3730232

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 108     gcggcgcgggcgcggggggc 127
               ||||||||||||||||||||
Sbjct: 2826825 gcggcgcgggcgcggggggc 2826844

---

>ref|XM_462793.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 501

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 110 acggcggcgacgacgacgac 129

---

>ref|NM_188436.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1095

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 38  acggcggcgacgacgacgac 19

---

>ref|XM_476317.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1761

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 101 acggcggcgacgacgacgac 120

---

>gb|AC007441.9| Drosophila melanogaster clone BACR10E03, complete sequence
          Length = 195212

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 90318 acggcggcgacgacgacgac 90299

---

>ref|XM_480995.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1584

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 379 cggcggcgacgacgacgacc 398
           ||||||||||||||||||||
Sbjct: 63  cggcggcgacgacgacgacc 44

---

>ref|XM_475411.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 585

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 554 acggcggcgacgacgacgac 573

---

>ref|XM_521691.1| PREDICTED: Pan troglodytes LOC466291 (LOC466291), mRNA
          Length = 1206

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 287 gccgccggcgcccccgacgccgcggccg 314
           |||||||||||||||| |||||| ||||
Sbjct: 78  gccgccggcgcccccgccgccgccgccg 51

---

>ref|XM_470048.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1307

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 287 gccgccggcgcccccgacgccgcggccg 314
           |||||||||||| |||||||||| ||||
Sbjct: 647 gccgccggcgccgccgacgccgccgccg 620

---

>ref|XM_519705.1| PREDICTED: Pan troglodytes similar to FLJ14299 protein (LOC464109),
            mRNA
          Length = 1211

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 328  cgagggggacgaggaggaggtgga 351
            ||||| ||||||||||||||||||
Sbjct: 1069 cgaggaggacgaggaggaggtgga 1046

---

>ref|XM_466263.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2473

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 379 cggcggcgacgacgacgacc 398
           ||||||||||||||||||||
Sbjct: 311 cggcggcgacgacgacgacc 330

---

>ref|XM_450503.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1102

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 379 cggcggcgacgacgacgacc 398
           ||||||||||||||||||||
Sbjct: 47  cggcggcgacgacgacgacc 28

---

>ref|XM_506646.1| PREDICTED Oryza sativa (japonica cultivar-group), P0651G05.38 mRNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 379 cggcggcgacgacgacgacc 398
           ||||||||||||||||||||
Sbjct: 48  cggcggcgacgacgacgacc 29

---

>ref|NM_190483.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1356

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 202 acggcggcgacgacgacgac 183

---

>ref|XM_468758.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2377

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 209 acggcggcgacgacgacgac 228

---

>ref|XM_479391.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 900

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 620 acggcggcgacgacgacgac 639

---

>ref|NM_188838.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1684

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 379 cggcggcgacgacgacgacc 398
           ||||||||||||||||||||
Sbjct: 119 cggcggcgacgacgacgacc 100

---

>ref|NM_194130.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 600

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 110 acggcggcgacgacgacgac 91

---

>ref|XM_472858.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 923 acggcggcgacgacgacgac 942

---

>gb|AC105259.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_B04,
             complete sequence
          Length = 95383

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 133   ggcggcggcgccgcccgacgggcaggag 160
             ||||||||||||| ||||||||||||||
Sbjct: 78518 ggcggcggcgccg-ccgacgggcaggag 78492

---

>gb|AY137656.1| Brevicoryne brassicae microsatellite Bb68 sequence
          Length = 496

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 372 acggcggcgacgacgacgac 391

---

>gb|AY023466.1| Oryza sativa microsatellite MRG5791 containing (TCG)X9, genomic
           sequence
          Length = 227

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 176 acggcggcgacgacgacgac 157

---

>gb|AY023325.1| Oryza sativa microsatellite MRG5650 containing (GTC)X11, genomic
           sequence
          Length = 233

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 216 acggcggcgacgacgacgac 197

---

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   gcgcccccgacgccgcggcc 313
             ||||||||||||||||||||
Sbjct: 51184 gcgcccccgacgccgcggcc 51165

---

>gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0094P07,
              complete sequence
          Length = 162311

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 129    ggatggcggcggcgccgcccgacg 152
              ||||||||||||||| ||||||||
Sbjct: 109282 ggatggcggcggcgcggcccgacg 109259

---

>gb|AC114983.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0032H19
             map E30331S, complete sequence
          Length = 164820

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 13085 acggcggcgacgacgacgac 13066

---

>gb|AY644643.1| Oryza sativa (indica cultivar-group) hypothetical protein (RP2)
           mRNA, complete cds
          Length = 1343

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 648 acggcggcgacgacgacgac 667

---

>gb|AC027133.3| Oryza sativa (japonica cultivar-group) chromosome 12 clone
             OSJNBb0003F09, complete sequence
          Length = 159600

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 41054 acggcggcgacgacgacgac 41073

---

>gb|AC010919.11| Drosophila melanogaster clone BACR32K23, complete sequence
          Length = 198967

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 11835 acggcggcgacgacgacgac 11816

---

>ref|XM_368973.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
           (MG00271.4) partial mRNA
          Length = 819

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 331 gggggacgaggaggaggtgg 350
           ||||||||||||||||||||
Sbjct: 213 gggggacgaggaggaggtgg 194

---

>ref|XM_363785.1| Magnaporthe grisea 70-15 hypothetical protein (MG01711.4) partial
            mRNA
          Length = 1986

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1202 acggcggcgacgacgacgac 1221

---

>ref|XM_596366.2| PREDICTED: Bos taurus similar to v-crk sarcoma virus CT10 oncogene
           homolog (avian)-like (LOC518180), mRNA
          Length = 3607

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 284 ccggccgccggcgcccccgacgccgcgg 311
           |||||||||||||||||||  |||||||
Sbjct: 970 ccggccgccggcgcccccggggccgcgg 997

---

>ref|XM_960503.1| Neurospora crassa OR74A hypothetical protein (NCU02914.1) partial
            mRNA
          Length = 2571

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1736 acggcggcgacgacgacgac 1755

---

>ref|XM_603547.2| PREDICTED: Bos taurus similar to zinc finger protein 336
           (LOC525199), mRNA
          Length = 4198

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 329 gagggggacgaggaggaggtggag 352
           ||||||||||||||||||| ||||
Sbjct: 907 gagggggacgaggaggaggaggag 930

---

>ref|XM_959450.1| Neurospora crassa OR74A hypothetical protein (NCU00709.1) partial
            mRNA
          Length = 2442

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 329  gagggggacgaggaggaggtggag 352
            ||||||||||||||||||| ||||
Sbjct: 2009 gagggggacgaggaggaggaggag 1986

---

>ref|XM_324888.1| Neurospora crassa OR74A hypothetical protein (NCU00709.1) partial
            mRNA
          Length = 2442

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 329  gagggggacgaggaggaggtggag 352
            ||||||||||||||||||| ||||
Sbjct: 2009 gagggggacgaggaggaggaggag 1986

---

>gb|AC112159.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1058_C01,
             complete sequence
          Length = 114236

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 74745 acggcggcgacgacgacgac 74764

---

>ref|XM_330101.1| Neurospora crassa OR74A hypothetical protein (NCU02914.1) partial
            mRNA
          Length = 2571

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1736 acggcggcgacgacgacgac 1755

---

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 418    ggcggtggaggacgcgctgc 437
              ||||||||||||||||||||
Sbjct: 551716 ggcggtggaggacgcgctgc 551697

---

>ref|NM_033212.2| Homo sapiens coiled-coil domain containing 102A (CCDC102A), mRNA
          Length = 2461

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 111 gcgcgggcgcggggggcagg 130
           ||||||||||||||||||||
Sbjct: 400 gcgcgggcgcggggggcagg 381

---

>gb|BC032534.1| Homo sapiens zinc finger protein 703, mRNA (cDNA clone MGC:44951
           IMAGE:5527569), complete cds
          Length = 2144

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 328 cgagggggacgaggaggaggtgga 351
           ||||| ||||||||||||||||||
Sbjct: 710 cgaggaggacgaggaggaggtgga 687

---

>gb|BC009941.2| Homo sapiens coiled-coil domain containing 102A, mRNA (cDNA clone
           MGC:13119 IMAGE:4100726), complete cds
          Length = 2461

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 111 gcgcgggcgcggggggcagg 130
           ||||||||||||||||||||
Sbjct: 400 gcgcgggcgcggggggcagg 381

---

>gb|BC008285.1| Homo sapiens coiled-coil domain containing 102A, mRNA (cDNA clone
           MGC:10992 IMAGE:3637387), complete cds
          Length = 2328

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 111 gcgcgggcgcggggggcagg 130
           ||||||||||||||||||||
Sbjct: 379 gcgcgggcgcggggggcagg 360

---

>gb|AC004382.1|HUAC004382 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-152E5, complete sequence
          Length = 217873

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 111    gcgcgggcgcggggggcagg 130
              ||||||||||||||||||||
Sbjct: 178756 gcgcgggcgcggggggcagg 178775

---

>gb|AC125085.4| Mus musculus BAC clone RP24-135G18 from chromosome 8, complete sequence
          Length = 168721

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 329   gagggggacgaggaggaggtggag 352
             |||||||| |||||||||||||||
Sbjct: 68485 gagggggaggaggaggaggtggag 68508

---

>ref|XM_848401.1| PREDICTED: Canis familiaris similar to Prostaglandin D2 receptor
           (Prostanoid DP receptor) (PGD receptor) (LOC610845),
           mRNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 403 ggacgagagggacgcggcgg 422
           ||||||||||||||||||||
Sbjct: 735 ggacgagagggacgcggcgg 754

---

>emb|CR729832.2|CNS0GQ32 Tetraodon nigroviridis full-length cDNA
          Length = 1529

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1055 acggcggcgacgacgacgac 1074

---

>emb|CR727009.2|CNS0GNWN Tetraodon nigroviridis full-length cDNA
          Length = 1522

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1054 acggcggcgacgacgacgac 1073

---

>emb|CR726703.1|CNS0GNO5 Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1022 acggcggcgacgacgacgac 1041

---

>emb|CR726496.2|CNS0GNIE Tetraodon nigroviridis full-length cDNA
          Length = 1463

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1028 acggcggcgacgacgacgac 1047

---

>emb|CR723983.1|CNS0GLKL Tetraodon nigroviridis full-length cDNA
          Length = 1472

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1032 acggcggcgacgacgacgac 1051

---

>emb|CR721090.2|CNS0GJC8 Tetraodon nigroviridis full-length cDNA
          Length = 737

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 285 acggcggcgacgacgacgac 304

---

>emb|CR693296.2|CNS0FXWC Tetraodon nigroviridis full-length cDNA
          Length = 897

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 443 acggcggcgacgacgacgac 462

---

>emb|CR684960.2|CNS0FRGS Tetraodon nigroviridis full-length cDNA
          Length = 925

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 447 acggcggcgacgacgacgac 466

---

>emb|CR675506.2|CNS0FK6W Tetraodon nigroviridis full-length cDNA
          Length = 720

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 249 acggcggcgacgacgacgac 268

---

>emb|CR673642.1|CNS0FIR4 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 378  acggcggcgacgacgacgac 397
            ||||||||||||||||||||
Sbjct: 1034 acggcggcgacgacgacgac 1053

---

>emb|CR672092.2|CNS0FHK2 Tetraodon nigroviridis full-length cDNA
          Length = 690

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 212 acggcggcgacgacgacgac 231

---

>emb|CR671889.2|CNS0FHEF Tetraodon nigroviridis full-length cDNA
          Length = 952

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 471 acggcggcgacgacgacgac 490

---

>emb|CR660398.2|CNS0F8J8 Tetraodon nigroviridis full-length cDNA
          Length = 830

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 352 acggcggcgacgacgacgac 371

---

>emb|CR659860.2|CNS0F84A Tetraodon nigroviridis full-length cDNA
          Length = 948

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 470 acggcggcgacgacgacgac 489

---

>ref|XM_852439.1| PREDICTED: Canis familiaris hypothetical LOC57614, transcript
           variant 4 (LOC476181), mRNA
          Length = 5451

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 281 ttcccggccgccggcgcccccgacgccg 308
           ||||||||| |||||||||||| |||||
Sbjct: 709 ttcccggcctccggcgcccccgccgccg 682

---

>ref|XM_533386.2| PREDICTED: Canis familiaris hypothetical LOC57614, transcript
           variant 1 (LOC476181), mRNA
          Length = 5451

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 281 ttcccggccgccggcgcccccgacgccg 308
           ||||||||| |||||||||||| |||||
Sbjct: 709 ttcccggcctccggcgcccccgccgccg 682

---

>emb|CR646529.2|CNS0EXTZ Tetraodon nigroviridis full-length cDNA
          Length = 1387

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 934 acggcggcgacgacgacgac 953

---

>emb|AL163249.2|HS21C049 Homo sapiens chromosome 21 segment HS21C049
          Length = 340000

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 282    tcccggccgccggcgccccc 301
              ||||||||||||||||||||
Sbjct: 314968 tcccggccgccggcgccccc 314949

---

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 122     gggggcaggatggcggcggcgccg 145
               ||||||||| ||||||||||||||
Sbjct: 3735739 gggggcaggctggcggcggcgccg 3735716

---

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 242     tccggcttcgacaaccgctt 261
               ||||||||||||||||||||
Sbjct: 3049645 tccggcttcgacaaccgctt 3049664

---

>emb|AL162397.14| Human DNA sequence from clone RP11-86C4 on chromosome 9, complete
              sequence
          Length = 121963

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 329    gagggggacgaggaggaggtggag 352
              ||||||||||||||||||| ||||
Sbjct: 115286 gagggggacgaggaggaggaggag 115309

---

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 132     tggcggcggcgccgcccgac 151
               ||||||||||||||||||||
Sbjct: 1853428 tggcggcggcgccgcccgac 1853409

---

>emb|AL158035.14| Human DNA sequence from clone RP1-97J1 on chromosome 6 Contains the 5'
             end of the FYN gene for the FYN oncogene related to SRC,
             FGR, YES and a CpG island, complete sequence
          Length = 218548

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 283   cccggccgccggcgcccccg 302
             ||||||||||||||||||||
Sbjct: 88983 cccggccgccggcgcccccg 88964

---

>gb|AC137507.3| Oryza sativa chromosome 3 BAC OSJNBb0033J23 genomic sequence, complete
             sequence
          Length = 126862

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 287   gccgccggcgcccccgacgccgcggccg 314
             |||||||||||| |||||||||| ||||
Sbjct: 42328 gccgccggcgccgccgacgccgccgccg 42301

---

>emb|BX640452.1| Bordetella bronchiseptica strain RB50, complete genome; segment 16/16
          Length = 123385

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   cgcggcggcgcagcagatcg 188
             ||||||||||||||||||||
Sbjct: 23651 cgcggcggcgcagcagatcg 23670

---

>emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete genome; segment 8/16
          Length = 349008

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 298    ccccgacgccgcggccggct 317
              ||||||||||||||||||||
Sbjct: 303850 ccccgacgccgcggccggct 303869

---

>emb|BX640436.1| Bordetella parapertussis strain 12822, complete genome; segment 14/14
          Length = 255260

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    cgcggcggcgcagcagatcg 188
              ||||||||||||||||||||
Sbjct: 159449 cgcggcggcgcagcagatcg 159468

---

>emb|BX640427.1| Bordetella parapertussis strain 12822, complete genome; segment 5/14
          Length = 348997

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 298    ccccgacgccgcggccggct 317
              ||||||||||||||||||||
Sbjct: 211694 ccccgacgccgcggccggct 211713

---

>emb|BX640411.1| Bordetella pertussis strain Tohama I, complete genome; segment 1/12
          Length = 346359

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 169    cgcggcggcgcagcagatcg 188
              ||||||||||||||||||||
Sbjct: 124257 cgcggcggcgcagcagatcg 124238

---

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 418     ggcggtggaggacgcgctgc 437
               ||||||||||||||||||||
Sbjct: 1871007 ggcggtggaggacgcgctgc 1870988

---

>emb|AL939118.1|SCO939118 Streptomyces coelicolor A3(2) complete genome; segment 15/29
          Length = 303550

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 378    acggcggcgacgacgacgac 397
              ||||||||||||||||||||
Sbjct: 128770 acggcggcgacgacgacgac 128751

---

>emb|AL731582.2|OSJN00232 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0022H21,
             complete sequence
          Length = 160155

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 378   acggcggcgacgacgacgac 397
             ||||||||||||||||||||
Sbjct: 80806 acggcggcgacgacgacgac 80825

---

>emb|AL606631.2|OSJN00069 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0050O03,
              complete sequence
          Length = 140948

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 378    acggcggcgacgacgacgac 397
              ||||||||||||||||||||
Sbjct: 121617 acggcggcgacgacgacgac 121636

---

>emb|AJ720094.1| Gallus gallus mRNA for hypothetical protein, clone 10g15
          Length = 3692

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 133 ggcggcggcgccgcccgacgggca 156
           |||||| |||||||||||||||||
Sbjct: 212 ggcggccgcgccgcccgacgggca 189

---

>gb|AC097633.2| Homo sapiens chromosome 3 clone RP11-96F15, complete sequence
          Length = 159349

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 329    gagggggacgaggaggaggtggag 352
              |||||||| |||||||||||||||
Sbjct: 145984 gagggggaggaggaggaggtggag 145961

---

>gb|AC124043.2| Homo sapiens chromosome 3 clone RP11-143A18, complete sequence
          Length = 160693

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 329   gagggggacgaggaggaggtggag 352
             |||||||| |||||||||||||||
Sbjct: 85704 gagggggaggaggaggaggtggag 85681

---

>gb|AY118524.1| Drosophila melanogaster LD22609 full insert cDNA
          Length = 8362

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 726 acggcggcgacgacgacgac 745

---

>gb|AE005811.1| Caulobacter crescentus CB15 section 137 of 359 of the complete genome
          Length = 10363

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 160  gaaggtgatcgcggcggcgc 179
            ||||||||||||||||||||
Sbjct: 4293 gaaggtgatcgcggcggcgc 4312

---

>dbj|AK024361.1| Homo sapiens cDNA FLJ14299 fis, clone PLACE1010310, weakly similar
           to SPIDROIN 2
          Length = 2174

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 328 cgagggggacgaggaggaggtgga 351
           ||||| ||||||||||||||||||
Sbjct: 749 cgaggaggacgaggaggaggtgga 726

---

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 94      tccaaaatcatcaagcggcg 113
               ||||||||||||||||||||
Sbjct: 2555949 tccaaaatcatcaagcggcg 2555968

---

>gb|AC069300.7| Oryza sativa chromosome 10 BAC OSJNBa0010C11 genomic sequence, complete
             sequence
          Length = 147117

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 372   ccggctacggcggcgacgacgacg 395
             ||||| ||||||||||||||||||
Sbjct: 72221 ccggcgacggcggcgacgacgacg 72198

---

>ref|NM_132858.2| Drosophila melanogaster CG9056-RA (CG9056), mRNA
          Length = 8336

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 378 acggcggcgacgacgacgac 397
           ||||||||||||||||||||
Sbjct: 726 acggcggcgacgacgacgac 745

---

>ref|NM_025069.1| Homo sapiens zinc finger protein 703 (ZNF703), mRNA
          Length = 2174

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 328 cgagggggacgaggaggaggtgga 351
           ||||| ||||||||||||||||||
Sbjct: 749 cgaggaggacgaggaggaggtgga 726

---

>gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 216030

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 155   caggagaaggtgatcgcggc 174
             ||||||||||||||||||||
Sbjct: 86357 caggagaaggtgatcgcggc 86338


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,275,670
Number of Sequences: 3902068
Number of extensions: 3275670
Number of successful extensions: 122772
Number of sequences better than 10.0: 332
Number of HSP's better than 10.0 without gapping: 361
Number of HSP's successfully gapped in prelim test: 4
Number of HSP's that attempted gapping in prelim test: 109694
Number of HSP's gapped (non-prelim): 13072
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---