>emb|AL138696.16| Human DNA sequence from clone RP11-369L4 on chromosome 13, complete
             sequence
          Length = 130931

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 55    accaccatccatatccataat 75
             |||||||||||||||||||||
Sbjct: 78712 accaccatccatatccataat 78732

>gb|AF440620.1|AF440620 Homo sapiens 13q14 chronic lymphocytic leukemia suppressor locus
             section 2 of 2
          Length = 440917

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 55    accaccatccatatccataat 75
             |||||||||||||||||||||
Sbjct: 26642 accaccatccatatccataat 26662

>gb|AF279660.2|AF279660 Homo sapiens CAR (RFP2) gene, complete cds; DLEU2 and DLEU1 genes,
              complete sequence; and RPL18 and p48/Hip pseudogenes,
              complete sequence
          Length = 347503

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 55     accaccatccatatccataat 75
              |||||||||||||||||||||
Sbjct: 328710 accaccatccatatccataat 328730

>gb|AC005948.14| Homo sapiens chromosome 13 clone 460f10 map 13q14, complete sequence
          Length = 154065

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 55     accaccatccatatccataat 75
              |||||||||||||||||||||
Sbjct: 142641 accaccatccatatccataat 142621

>gb|AC013358.32| Homo sapiens chromosome 13 clone 2252c9 map 13q14, complete sequence
          Length = 140312

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 55     accaccatccatatccataat 75
              |||||||||||||||||||||
Sbjct: 120245 accaccatccatatccataat 120265

>emb|AL450169.1|CNS07EEW Genomic sequence at the putative B_CLL involved tumor suppressor gene
              locus on human chromosome 13q14.3 clone PAC 4E7,BAC
              93D9,PAC 63H3 of library LLNL from chromosome 13 of Homo
              sapiens (human)
          Length = 279647

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 55     accaccatccatatccataat 75
              |||||||||||||||||||||
Sbjct: 213888 accaccatccatatccataat 213908

>emb|AL359893.16| Human DNA sequence from clone RP11-35N6 on chromosome 9 Contains the 3'
              end of a novel gene (FLJ20300), a bile acid Coenzyme A
              amino acid N-acyltransferase (BAAT) pseudogene, a RINZF
              zinc finger protein pseudogene, the BAAT gene for bile acid
              Coenzyme A amino acid N-acyltransferase (glycine
              N-choloyltransferase) and two novel pseudogenes, complete
              sequence
          Length = 146627

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     ccaccatccatatccataat 75
              ||||||||||||||||||||
Sbjct: 118366 ccaccatccatatccataat 118385

>gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete sequence
          Length = 164712

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 59    ccatccatatccataatcc 77
             |||||||||||||||||||
Sbjct: 86714 ccatccatatccataatcc 86696

>ref|XM_815217.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506247.460) partial mRNA
          Length = 1140

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 108 ggcggatgcgagtgccacc 126
           |||||||||||||||||||
Sbjct: 642 ggcggatgcgagtgccacc 660

>gb|DQ374029.1| Beta vulgaris chromosome 9 clone BAC57 genomic sequence
          Length = 4899

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 61  atccatatccataatccat 79
           |||||||||||||||||||
Sbjct: 647 atccatatccataatccat 629

>gb|AC009212.5| Drosophila melanogaster, chromosome 3R, region 82E-82F, BAC clone
             BACR01A18, complete sequence
          Length = 190801

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 59    ccatccatatccataatcc 77
             |||||||||||||||||||
Sbjct: 53498 ccatccatatccataatcc 53480

>emb|CR339057.6| Zebrafish DNA sequence from clone DKEY-264L20 in linkage group 7,
             complete sequence
          Length = 109226

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 61    atccatatccataatccat 79
             |||||||||||||||||||
Sbjct: 26742 atccatatccataatccat 26760

>gb|AE003604.4| Drosophila melanogaster chromosome 3R, section 4 of 118 of the complete
              sequence
          Length = 303434

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 59     ccatccatatccataatcc 77
              |||||||||||||||||||
Sbjct: 181695 ccatccatatccataatcc 181677

>dbj|AP000879.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-805J14, complete
             sequence
          Length = 169725

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     cagcacccatccatccatt 19
             |||||||||||||||||||
Sbjct: 45099 cagcacccatccatccatt 45081


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 927,733
Number of Sequences: 3902068
Number of extensions: 927733
Number of successful extensions: 69660
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69623
Number of HSP's gapped (non-prelim): 37
length of query: 133
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 112
effective length of database: 17,151,101,840
effective search space: 1920923406080
effective search space used: 1920923406080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)