ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart45c05 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT009218.1| Triticum aestivum clone wle1n.pk0060.c11:fis, full insert mRNA sequence Length = 1940 Score = 454 bits (229), Expect = e-124 Identities = 352/393 (89%) Strand = Plus / Plus Query: 161 gctcgccggcgtggctgcgccgcctgatcgacacggaggaggcgtgggcgcagctgcagt 220 ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||| Sbjct: 138 gctcgccggcgtggctgcgcctcctgatcgacacggaggaggcctgggcgcagctacagt 197 Query: 221 tcgcggtgccgatggtcctcaccaacatgtcctactacggcatcccgctggtgtccgtca 280 ||||| ||||||||||||| ||||||||||||||||||| |||||||||||||||||| | Sbjct: 198 tcgcgctgccgatggtcctgaccaacatgtcctactacgccatcccgctggtgtccgtga 257 Query: 281 tgttctccggccacctcggcaacgtccacctcgccggcgccacgctcgccaactcctggg 340 ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 258 tgttctccggccacctcggcaacgtccacctcgccggcgccaccctcggcaactcctggg 317 Query: 341 ccaacgtcaccggctacgccttcgtgactggtatgagcggcgccctggagacgctatgcg 400 ||| ||||||||||||||||||||| || || |||||||||||| ||||||| || || | Sbjct: 318 ccaccgtcaccggctacgccttcgttaccggcatgagcggcgccatggagacactgtgtg 377 Query: 401 ggcaggcctacggcgcccgactataccgcatgctaggactgtacctgcagtcgtcgctca 460 | ||||||||||||||||| | |||||| |||| || |||||||||| |||||||||| Sbjct: 378 gacaggcctacggcgcccggatgtaccgcctgctgggcttgtacctgcaatcgtcgctca 437 Query: 461 tcatgtcggcggtggtgtccatggtcatcgccgtcctgtggctgttcacggagccgctgc 520 ||||||| ||| |||||||| | ||||| ||||| |||||||||||||||||||| | | Sbjct: 438 tcatgtcagcgatggtgtccgtactcatctccgtcgtgtggctgttcacggagccgatcc 497 Query: 521 ttctgtgcctgcatcaagaacctgaggtgtccc 553 | ||| |||||||| ||||| |||||||||| Sbjct: 498 tgttgtctctgcatcaggaacccgaggtgtccc 530
>ref|XM_478265.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1449 Score = 379 bits (191), Expect = e-102 Identities = 266/291 (91%) Strand = Plus / Plus Query: 190 gacacggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatg 249 |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| Sbjct: 97 gacacggaggaggcgtgggcgcagacgcggttcgcggtgccgatggtgctcaccaacatg 156 Query: 250 tcctactacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccac 309 |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 157 tcctactacgccatcccgctggtgtccgtcatgttctccggccacctcggcgacgtccac 216 Query: 310 ctcgccggcgccacgctcgccaactcctgggccaacgtcaccggctacgccttcgtgact 369 ||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| || Sbjct: 217 ctcgccggcgccacgctcggcaactcgtgggccaccgtcaccggctacgccttcgtcacg 276 Query: 370 ggtatgagcggcgccctggagacgctatgcgggcaggcctacggcgcccgactataccgc 429 || |||||||| |||||||||||||| ||||||||||| |||||||| || | |||||| Sbjct: 277 ggcatgagcggggccctggagacgctgtgcgggcaggcgtacggcgcgcggatgtaccgc 336 Query: 430 atgctaggactgtacctgcagtcgtcgctcatcatgtcggcggtggtgtcc 480 ||||| || || ||||||||||||||||| |||||||||||| ||||||| Sbjct: 337 atgctgggcctctacctgcagtcgtcgctgctcatgtcggcggcggtgtcc 387
>dbj|AK120682.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013163C05, full insert sequence Length = 1623 Score = 379 bits (191), Expect = e-102 Identities = 266/291 (91%) Strand = Plus / Plus Query: 190 gacacggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatg 249 |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| Sbjct: 193 gacacggaggaggcgtgggcgcagacgcggttcgcggtgccgatggtgctcaccaacatg 252 Query: 250 tcctactacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccac 309 |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 253 tcctactacgccatcccgctggtgtccgtcatgttctccggccacctcggcgacgtccac 312 Query: 310 ctcgccggcgccacgctcgccaactcctgggccaacgtcaccggctacgccttcgtgact 369 ||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| || Sbjct: 313 ctcgccggcgccacgctcggcaactcgtgggccaccgtcaccggctacgccttcgtcacg 372 Query: 370 ggtatgagcggcgccctggagacgctatgcgggcaggcctacggcgcccgactataccgc 429 || |||||||| |||||||||||||| ||||||||||| |||||||| || | |||||| Sbjct: 373 ggcatgagcggggccctggagacgctgtgcgggcaggcgtacggcgcgcggatgtaccgc 432 Query: 430 atgctaggactgtacctgcagtcgtcgctcatcatgtcggcggtggtgtcc 480 ||||| || || ||||||||||||||||| |||||||||||| ||||||| Sbjct: 433 atgctgggcctctacctgcagtcgtcgctgctcatgtcggcggcggtgtcc 483
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 278 bits (140), Expect = 2e-71 Identities = 167/176 (94%) Strand = Plus / Minus Query: 190 gacacggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatg 249 |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| Sbjct: 18909251 gacacggaggaggcgtgggcgcagacgcggttcgcggtgccgatggtgctcaccaacatg 18909192 Query: 250 tcctactacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccac 309 |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 18909191 tcctactacgccatcccgctggtgtccgtcatgttctccggccacctcggcgacgtccac 18909132 Query: 310 ctcgccggcgccacgctcgccaactcctgggccaacgtcaccggctacgccttcgt 365 ||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| Sbjct: 18909131 ctcgccggcgccacgctcggcaactcgtgggccaccgtcaccggctacgccttcgt 18909076 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 373 atgagcggcgccctggagacgctatgcgggcaggcctacggcgcccgactataccgcatg 432 |||||||| |||||||||||||| ||||||||||| |||||||| || | ||||||||| Sbjct: 18904875 atgagcggggccctggagacgctgtgcgggcaggcgtacggcgcgcggatgtaccgcatg 18904816 Query: 433 ctaggactgtacctgcagtcgtcgctcatcatgtcggcggtggtgtcc 480 || || || ||||||||||||||||| |||||||||||| ||||||| Sbjct: 18904815 ctgggcctctacctgcagtcgtcgctgctcatgtcggcggcggtgtcc 18904768 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 195 ggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatgtccta 254 |||||||||| || ||||||| |||||||| ||||||||| |||| |||| |||| Sbjct: 443723 ggaggaggcggcggggcagctggcgttcgcggcgccgatggtggcgaccagcatggccta 443664 Query: 255 ctacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccacctcgc 314 ||||| |||||||||||| |||||||||| | |||||| |||||| | || | ||||| Sbjct: 443663 ctacgccatcccgctggtctccgtcatgtacgccggccgcctcggagagctcgagctcgc 443604 Query: 315 cggcgccacgctcgccaactcctgggccaacgtcaccgg 353 ||||||||| |||| ||||||||||| || ||||||||| Sbjct: 443603 cggcgccaccctcggcaactcctggggcaccgtcaccgg 443565 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 386 tggagacgctatgcgggcaggcctacggcgcc 417 |||||||||| ||||||||||| ||||||||| Sbjct: 19858314 tggagacgctgtgcgggcaggcgtacggcgcc 19858345 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 3157021 cttcttcttcttcttcctcctccc 3157044 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 23845948 cttcttcttcttcttcctcctcc 23845970 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 5032627 cttcttcttcttcttcctcctcc 5032605 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 26733198 cttcttcttcttcttcctcctc 26733219 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctc 48 ||||||||||||||||||||| Sbjct: 23728715 ttcttcttcttcttcctcctc 23728735 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 8415252 tcttcttcttcttcctcctcc 8415232 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 30 cttcttcttcttcctcctcc 49 |||||||||||||||||||| Sbjct: 27630889 cttcttcttcttcctcctcc 27630908 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcct 47 |||||||||||||||||||| Sbjct: 17687248 ttcttcttcttcttcctcct 17687229 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 7867680 tcttcttcctcctccctctc 7867661 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 cttcttcttcttcctcctcc 49 |||||||||||||||||||| Sbjct: 2680004 cttcttcttcttcctcctcc 2679985
>dbj|AP005186.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0430F03 Length = 183095 Score = 278 bits (140), Expect = 2e-71 Identities = 167/176 (94%) Strand = Plus / Minus Query: 190 gacacggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatg 249 |||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| Sbjct: 11236 gacacggaggaggcgtgggcgcagacgcggttcgcggtgccgatggtgctcaccaacatg 11177 Query: 250 tcctactacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccac 309 |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 11176 tcctactacgccatcccgctggtgtccgtcatgttctccggccacctcggcgacgtccac 11117 Query: 310 ctcgccggcgccacgctcgccaactcctgggccaacgtcaccggctacgccttcgt 365 ||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| Sbjct: 11116 ctcgccggcgccacgctcggcaactcgtgggccaccgtcaccggctacgccttcgt 11061 Score = 111 bits (56), Expect = 2e-21 Identities = 95/108 (87%) Strand = Plus / Minus Query: 373 atgagcggcgccctggagacgctatgcgggcaggcctacggcgcccgactataccgcatg 432 |||||||| |||||||||||||| ||||||||||| |||||||| || | ||||||||| Sbjct: 6860 atgagcggggccctggagacgctgtgcgggcaggcgtacggcgcgcggatgtaccgcatg 6801 Query: 433 ctaggactgtacctgcagtcgtcgctcatcatgtcggcggtggtgtcc 480 || || || ||||||||||||||||| |||||||||||| ||||||| Sbjct: 6800 ctgggcctctacctgcagtcgtcgctgctcatgtcggcggcggtgtcc 6753
>gb|AY019975.1| Oryza sativa microsatellite MRG2300 containing (CT)X14, genomic sequence Length = 228 Score = 145 bits (73), Expect = 2e-31 Identities = 85/89 (95%) Strand = Plus / Plus Query: 277 gtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcgccaactcc 336 |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| Sbjct: 1 gtcatgttctccggccacctcggcgacgtccacctcgccggcgccacgctcggcaactcg 60 Query: 337 tgggccaacgtcaccggctacgccttcgt 365 ||||||| ||||||||||||||||||||| Sbjct: 61 tgggccaccgtcaccggctacgccttcgt 89
>ref|NM_186151.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1707 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Plus Query: 195 ggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatgtccta 254 |||||||||| || ||||||| |||||||| ||||||||| |||| |||| |||| Sbjct: 279 ggaggaggcggcggggcagctggcgttcgcggcgccgatggtggcgaccagcatggccta 338 Query: 255 ctacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccacctcgc 314 ||||| |||||||||||| |||||||||| | |||||| |||||| | || | ||||| Sbjct: 339 ctacgccatcccgctggtctccgtcatgtacgccggccgcctcggagagctcgagctcgc 398 Query: 315 cggcgccacgctcgccaactcctgggccaacgtcaccgg 353 ||||||||| |||| ||||||||||| || ||||||||| Sbjct: 399 cggcgccaccctcggcaactcctggggcaccgtcaccgg 437
>dbj|AP004342.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0585H11 Length = 149371 Score = 101 bits (51), Expect = 2e-18 Identities = 132/159 (83%) Strand = Plus / Minus Query: 195 ggaggaggcgtgggcgcagctgcagttcgcggtgccgatggtcctcaccaacatgtccta 254 |||||||||| || ||||||| |||||||| ||||||||| |||| |||| |||| Sbjct: 45887 ggaggaggcggcggggcagctggcgttcgcggcgccgatggtggcgaccagcatggccta 45828 Query: 255 ctacggcatcccgctggtgtccgtcatgttctccggccacctcggcaacgtccacctcgc 314 ||||| |||||||||||| |||||||||| | |||||| |||||| | || | ||||| Sbjct: 45827 ctacgccatcccgctggtctccgtcatgtacgccggccgcctcggagagctcgagctcgc 45768 Query: 315 cggcgccacgctcgccaactcctgggccaacgtcaccgg 353 ||||||||| |||| ||||||||||| || ||||||||| Sbjct: 45767 cggcgccaccctcggcaactcctggggcaccgtcaccgg 45729
>ref|NM_195893.1| Oryza sativa (japonica cultivar-group) putative integral membrane protein (OSJNBa0045C13.2), mRNA Length = 1434 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 152 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 211 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 212 ccacctccctcgccaacgtcaccggct 238 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 263 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 299
>gb|AC090441.3| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNBb0052C09, complete sequence Length = 139468 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 130667 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 130726 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 130727 ccacctccctcgccaacgtcaccggct 130753 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggc 318 ||||||||||||||||| ||||||||||||| | |||| ||||||||| Sbjct: 71458 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccggc 71409 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccgg 317 ||||||||||||||||| ||||||||||||| | |||| |||||||| Sbjct: 89708 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccgg 89660 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 130887 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 130923 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 89494 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 89458 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 71241 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 71205
>gb|AC079634.3|AC079634 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0045C13, from Chromosome 10, complete sequence Length = 161250 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 10621 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 10680 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 10681 ccacctccctcgccaacgtcaccggct 10707 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| |||||||||||| | ||| ||||||||||||| | |||| Sbjct: 21382 tggtgtccgtcatgttcgtcggccacctcggtgagctccccctcgccggcgcctccctcg 21323 Query: 329 ccaactcctgggccaacgtcaccggctac 357 ||| |||| |||||||||||||||||| Sbjct: 21322 ccacctccctcgccaacgtcaccggctac 21294 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 10841 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 10877
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 9778142 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 9778201 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 9778202 ccacctccctcgccaacgtcaccggct 9778228 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| |||||||||||| | ||| ||||||||||||| | |||| Sbjct: 9788903 tggtgtccgtcatgttcgtcggccacctcggtgagctccccctcgccggcgcctccctcg 9788844 Query: 329 ccaactcctgggccaacgtcaccggctac 357 ||| |||| |||||||||||||||||| Sbjct: 9788843 ccacctccctcgccaacgtcaccggctac 9788815 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggc 318 ||||||||||||||||| ||||||||||||| | |||| ||||||||| Sbjct: 9718933 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccggc 9718884 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||||| |||| Sbjct: 19410787 gcttcttcttcttcttcctcctccatctc 19410759 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccgg 317 ||||||||||||||||| ||||||||||||| | |||| |||||||| Sbjct: 9737183 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccgg 9737135 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 17490408 cttcttcttcttcttcctcctcc 17490386 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccc 50 |||||||||||||||||||||| Sbjct: 21255043 tcttcttcttcttcctcctccc 21255064 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcctc 48 ||||||||||||||||||||| Sbjct: 19381758 ttcttcttcttcttcctcctc 19381738 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 9778362 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 9778398 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 9736969 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 9736933 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 9718716 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 9718680 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 ttcttcttcctcctccctctc 54 ||||||||||||||||||||| Sbjct: 9321602 ttcttcttcctcctccctctc 9321582 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 ttcttcttcctcctccctct 53 |||||||||||||||||||| Sbjct: 10742977 ttcttcttcctcctccctct 10742958 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 9469553 cttcttcttcttcttcctcc 9469534
>dbj|AK103119.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119H22, full insert sequence Length = 1743 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 214 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 273 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 274 ccacctccctcgccaacgtcaccggct 300 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 325 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 361
>dbj|AK073245.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033012J16, full insert sequence Length = 1759 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 225 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 284 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 285 ccacctccctcgccaacgtcaccggct 311 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 336 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 372
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 77.8 bits (39), Expect = 3e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| ||||||||||||| | ||| ||||||||||||| | |||| Sbjct: 9784181 tggtgtccgtcatgttcgtcggccacctcggcgagctccccctcgccggcgcctccctcg 9784240 Query: 329 ccaactcctgggccaacgtcaccggct 355 ||| |||| |||||||||||||||| Sbjct: 9784241 ccacctccctcgccaacgtcaccggct 9784267 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| |||||||||||| | ||| ||||||||||||| | |||| Sbjct: 9794942 tggtgtccgtcatgttcgtcggccacctcggtgagctccccctcgccggcgcctccctcg 9794883 Query: 329 ccaactcctgggccaacgtcaccggctac 357 ||| |||| |||||||||||||||||| Sbjct: 9794882 ccacctccctcgccaacgtcaccggctac 9794854 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggc 318 ||||||||||||||||| ||||||||||||| | |||| ||||||||| Sbjct: 9724972 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccggc 9724923 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||||| |||| Sbjct: 19422063 gcttcttcttcttcttcctcctccatctc 19422035 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccgg 317 ||||||||||||||||| ||||||||||||| | |||| |||||||| Sbjct: 9743222 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccgg 9743174 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 17499448 cttcttcttcttcttcctcctcc 17499426 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccc 50 |||||||||||||||||||||| Sbjct: 21266307 tcttcttcttcttcctcctccc 21266328 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcctc 48 ||||||||||||||||||||| Sbjct: 19393034 ttcttcttcttcttcctcctc 19393014 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 9784401 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 9784437 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 9743008 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 9742972 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 9724755 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 9724719 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 ttcttcttcctcctccctctc 54 ||||||||||||||||||||| Sbjct: 9326741 ttcttcttcctcctccctctc 9326721 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 ttcttcttcctcctccctct 53 |||||||||||||||||||| Sbjct: 10749016 ttcttcttcctcctccctct 10748997 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 9475592 cttcttcttcttcttcctcc 9475573
>ref|NM_195894.1| Oryza sativa (japonica cultivar-group) putative transmembrane protein (OSJNBa0045C13.3), mRNA Length = 1461 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| |||||||||||| | ||| ||||||||||||| | |||| Sbjct: 179 tggtgtccgtcatgttcgtcggccacctcggtgagctccccctcgccggcgcctccctcg 238 Query: 329 ccaactcctgggccaacgtcaccggctac 357 ||| |||| |||||||||||||||||| Sbjct: 239 ccacctccctcgccaacgtcaccggctac 267
>dbj|AK069792.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023031K22, full insert sequence Length = 1903 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggcgccacgctcg 328 ||||||||||||||||| |||||||||||| | ||| ||||||||||||| | |||| Sbjct: 161 tggtgtccgtcatgttcgtcggccacctcggtgagctccccctcgccggcgcctccctcg 220 Query: 329 ccaactcctgggccaacgtcaccggctac 357 ||| |||| |||||||||||||||||| Sbjct: 221 ccacctccctcgccaacgtcaccggctac 249
>ref|XM_479696.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1575 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctctcg 55 ||||||||||||||||||||||||||| Sbjct: 56 tcttcttcttcttcctcctccctctcg 82
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctctcg 55 ||||||||||||||||||||||||||| Sbjct: 312673 tcttcttcttcttcctcctccctctcg 312699 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||||||||||||||| ||||||||||| Sbjct: 28178314 gcgccctggagacgctgtgcgggcaggc 28178287 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 19420266 gcttcttcttcttcttcctcctcc 19420289 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 10517822 cttcttcttcttcttcctcctcc 10517800 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 5102989 cttcttcttcttcttcctcctcc 5103011 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 244989 cttcttcttcttcttcctcctcc 245011 Score = 44.1 bits (22), Expect = 0.48 Identities = 34/38 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgcc 417 |||| ||||||||||| ||||||||||| | ||||||| Sbjct: 23708000 gcgcgctggagacgctgtgcgggcaggcgttcggcgcc 23708037 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctc 52 ||||||||||||||||||||| |||| Sbjct: 7478028 cttcttcttcttcttcctccttcctc 7478003 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Plus Query: 23 ccagcttcttcttcttcttcctcctc 48 |||||| ||||||||||||||||||| Sbjct: 132805 ccagctgcttcttcttcttcctcctc 132830 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 28062310 tcttcttcttcttcctcctcc 28062330 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 28052684 tcttcttcttcttcctcctcc 28052704 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggca 404 |||| |||||||||||||||||||| Sbjct: 27587538 gcgcgctggagacgctatgcgggca 27587514 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 26594133 tcttcttcttcttcctcctcc 26594153 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 23457050 tcttcttcttcttcctcctcc 23457070 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 23078440 tcttcttcttcttcctcctcc 23078460 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 11275162 cttcttcttcttcttcctcct 11275182 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 4288143 tcttcttcttcttcctcctcc 4288163 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 25391949 cttcttcttcttcttcctcc 25391968 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 24475180 cttcttcttcttcttcctcc 24475199 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 ||||||||||||| |||||||||| Sbjct: 23078441 cttcttcttcttcctcctcctccc 23078464 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 22109878 tcttcttcctcctccctctc 22109859 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctc 48 |||||||||||||||||||| Sbjct: 21113497 tcttcttcttcttcctcctc 21113478 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 13501296 cttcttcttcttcttcctcc 13501315 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||| ||||||| Sbjct: 13501293 cttcttcttcttcttcttcctccc 13501316 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 11557606 cttcttcttcttcttcctcc 11557587 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||| ||||||| Sbjct: 11557609 cttcttcttcttcttcttcctccc 11557586 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 32 tcttcttcttcctcctccct 51 |||||||||||||||||||| Sbjct: 10360941 tcttcttcttcctcctccct 10360960 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 ||||||||||||| |||||||||| Sbjct: 5102992 cttcttcttcttcctcctcctccc 5103015
>emb|AL807785.7| Mouse DNA sequence from clone RP23-460B18 on chromosome X, complete sequence Length = 69447 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||||||| Sbjct: 65844 ttcttcttcttcttcctcctccctctc 65870
>dbj|AP004462.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0450B04 Length = 153268 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctctcg 55 ||||||||||||||||||||||||||| Sbjct: 22187 tcttcttcttcttcctcctccctctcg 22213
>dbj|AP003909.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1300_E01 Length = 103022 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctctcg 55 ||||||||||||||||||||||||||| Sbjct: 79099 tcttcttcttcttcctcctccctctcg 79125 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 11415 cttcttcttcttcttcctcctcc 11437
>ref|NM_195885.1| Oryza sativa (japonica cultivar-group) putative integral membrane protein (OSJNBb0052C09.8), mRNA Length = 1545 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggc 318 ||||||||||||||||| ||||||||||||| | |||| ||||||||| Sbjct: 170 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccggc 219 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 281 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 317
>gb|AC149084.5| Mus musculus BAC clone RP23-173A12 from chromosome 19, complete sequence Length = 188848 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||||| Sbjct: 103426 cagcttcttcttcttcttcctcctcc 103401
>gb|AC145549.3| Mus musculus BAC clone RP23-21M23 from chromosome 19, complete sequence Length = 247655 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||||| Sbjct: 162209 cagcttcttcttcttcttcctcctcc 162184
>gb|AC132957.3| Mus musculus BAC clone RP23-149E9 from chromosome 19, complete sequence Length = 246177 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||||| Sbjct: 222413 cagcttcttcttcttcttcctcctcc 222388
>ref|XM_802619.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053509563.50) partial mRNA Length = 3585 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||||| Sbjct: 2503 cagcttcttcttcttcttcctcctcc 2478 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 cttcttcttcttcctcctcc 49 |||||||||||||||||||| Sbjct: 2740 cttcttcttcttcctcctcc 2721
>emb|AJ969441.1| Trypanosoma cruzi garp gene for glutamic acid rich protein Length = 4859 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||||| Sbjct: 3192 cagcttcttcttcttcttcctcctcc 3167
>gb|AC008794.8| Homo sapiens chromosome 19 clone CTD-2050I18, complete sequence Length = 131972 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctc 52 |||||||||||||||||||||||||| Sbjct: 100458 cttcttcttcttcttcctcctccctc 100483
>dbj|AK105578.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-128-E01, full insert sequence Length = 1782 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccggc 318 ||||||||||||||||| ||||||||||||| | |||| ||||||||| Sbjct: 216 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccggc 265 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 433 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 469
>gb|AC170878.4| Mus musculus BAC clone RP24-226F17 from chromosome 19, complete sequence Length = 148454 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||||| Sbjct: 41199 cagcttcttcttcttcttcctcctcc 41174
>emb|AL645600.11| Mouse DNA sequence from clone RP23-396N4 on chromosome 11, complete sequence Length = 180286 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctc 52 |||||||||||||||||||||||||| Sbjct: 135286 cttcttcttcttcttcctcctccctc 135261
>ref|NM_197355.1| Oryza sativa (japonica cultivar-group) putative transcription factor (OSJNBa0076F20.5), mRNA Length = 3478 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||||| |||| Sbjct: 2534 gcttcttcttcttcttcctcctccatctc 2562
>ref|NM_195888.1| Oryza sativa (japonica cultivar-group) putative integral membrane protein (OSJNBb0052C09.11), mRNA Length = 975 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Plus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccgg 317 ||||||||||||||||| ||||||||||||| | |||| |||||||| Sbjct: 89 tggtgtccgtcatgttcgtcggccacctcggcgagctccagctcgccgg 137 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||| ||||| ||||||||||| |||||||| Sbjct: 200 gcgcgctggacacgctgtgcgggcaggcgtacggcgc 236
>gb|AY771675.1| Lynx rufus clone bcb9d microsatellite sequence Length = 430 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 cttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||||| Sbjct: 41 cttcttcttcttcctcctccctctc 65
>gb|AY163380.1| Zea mays putative ROP family GTPase ROP6 gene, complete cds Length = 2031 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctccc 50 ||||||||||||||||||||||||| Sbjct: 474 gcttcttcttcttcttcctcctccc 498
>gb|AC122043.4| Mus musculus BAC clone RP24-448C16 from chromosome 5, complete sequence Length = 187106 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctct 53 ||||||||||||||||||||||||| Sbjct: 80427 tcttcttcttcttcctcctccctct 80451
>gb|AC115690.13| Mus musculus chromosome 12, clone RP24-537M9, complete sequence Length = 178140 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 30 cttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||||| Sbjct: 2098 cttcttcttcttcctcctccctctc 2122
>dbj|AK147733.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270012F21 product:unclassifiable, full insert sequence Length = 4406 Score = 50.1 bits (25), Expect = 0.008 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 3788 cttcttcttcttcttcctcctccntctc 3761
>gb|AC025296.10| Oryza sativa chromosome 10 BAC OSJNBa0076F20 genomic sequence, complete sequence Length = 165394 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||||| |||| Sbjct: 38653 gcttcttcttcttcttcctcctccatctc 38625 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcctc 48 ||||||||||||||||||||| Sbjct: 9624 ttcttcttcttcttcctcctc 9604
>gb|AC159198.2| Mus musculus BAC clone RP23-388C15 from chromosome 12, complete sequence Length = 213311 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 30 cttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||||| Sbjct: 55659 cttcttcttcttcctcctccctctc 55635
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctc 48 ||||||||||||||||||||||||| Sbjct: 6389950 cagcttcttcttcttcttcctcctc 6389926 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 38002999 cttcttcttcttcttcctcctcc 38003021 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 21756091 cttcttcttcttcttcctcctcc 21756113 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 42130506 cttcttcttcttcttcctcctc 42130485 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 32 tcttcttcttcctcctccctct 53 |||||||||||||||||||||| Sbjct: 27849590 tcttcttcttcctcctccctct 27849569 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctcc 49 |||||||||||||||||||||| Sbjct: 10512625 ttcttcttcttcttcctcctcc 10512646 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 1058555 cttcttcttcttcttcctcctc 1058534 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 42911908 tcttcttcttcttcctcctcc 42911928 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctc 48 ||||||||||||||||||||| Sbjct: 31904923 ttcttcttcttcttcctcctc 31904943 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctc 48 ||||||||||||||||||||| Sbjct: 31900580 ttcttcttcttcttcctcctc 31900600 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 34 ttcttcttcctcctccctctc 54 ||||||||||||||||||||| Sbjct: 21969292 ttcttcttcctcctccctctc 21969272 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 5766929 cttcttcttcttcttcctcct 5766909 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 5529360 cttcttcttcttcttcctcct 5529340 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 39577133 gcttcttcttcttcttcctc 39577114 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 33488119 cttcttcttcttcttcctcc 33488100 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||| ||||||||||| ||||||||||| Sbjct: 32265073 gcgcgctggagacgctgtgcgggcaggc 32265046 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 28060314 gcttcttcttcttcttcctc 28060295 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 cttcttcttcttcctcctcc 49 |||||||||||||||||||| Sbjct: 26781860 cttcttcttcttcctcctcc 26781841 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 cttcttcttcttcctcctcc 49 |||||||||||||||||||| Sbjct: 22923714 cttcttcttcttcctcctcc 22923695 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 25 agcttcttcttcttcttcctcctc 48 ||||||||||||||| |||||||| Sbjct: 22923716 agcttcttcttcttcctcctcctc 22923693 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 15859473 tcttcttcctcctccctctc 15859492 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 ttcttcttcctcctccctct 53 |||||||||||||||||||| Sbjct: 15632038 ttcttcttcctcctccctct 15632057 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 cttcttcttcctcctccctc 52 |||||||||||||||||||| Sbjct: 3429193 cttcttcttcctcctccctc 3429212 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 526851 cttcttcttcttcttcctcc 526832 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||| ||||||| Sbjct: 526854 cttcttcttcttcttcttcctccc 526831
>gb|AC010585.6|AC010585 Homo sapiens chromosome 5 clone CTC-315O24, complete sequence Length = 174882 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctccctc 52 ||||||||||||||||||||||||| Sbjct: 55415 ttcttcttcttcttcctcctccctc 55439
>dbj|AP002861.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0665D10 Length = 134967 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctc 48 ||||||||||||||||||||||||| Sbjct: 12345 cagcttcttcttcttcttcctcctc 12321
>dbj|AP001633.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0515G01 Length = 175072 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Minus Query: 24 cagcttcttcttcttcttcctcctc 48 ||||||||||||||||||||||||| Sbjct: 161016 cagcttcttcttcttcttcctcctc 160992
>dbj|AK105803.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-B01, full insert sequence Length = 1391 Score = 50.1 bits (25), Expect = 0.008 Identities = 25/25 (100%) Strand = Plus / Plus Query: 24 cagcttcttcttcttcttcctcctc 48 ||||||||||||||||||||||||| Sbjct: 46 cagcttcttcttcttcttcctcctc 70
>dbj|AK059055.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-021-F02, full insert sequence Length = 1418 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||||| |||| Sbjct: 802 gcttcttcttcttcttcctcctccatctc 830
>gb|AY664417.1| Zea mays cultivar Mo17 locus 9002, complete sequence Length = 366120 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccgg 317 ||||||||||||||||| |||||||||||| || ||| ||||||||| Sbjct: 133868 tggtgtccgtcatgttcgtcggccacctcgggaagctccccctcgccgg 133820
>gb|AY664413.1| Zea mays cultivar B73 locus 9002, complete sequence Length = 317137 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 269 tggtgtccgtcatgttctccggccacctcggcaacgtccacctcgccgg 317 ||||||||||||||||| |||||||||||| || ||| ||||||||| Sbjct: 126336 tggtgtccgtcatgttcgtcggccacctcgggaagctccccctcgccgg 126288
>gb|AC153729.1| Mus musculus BAC RP23-88C11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 250801 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 34251 cttcttcttcttcttcctcctccc 34274 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 31332 tcttcttcttcttcctcctcc 31312
>ref|XM_482316.1| Oryza sativa (japonica cultivar-group), mRNA Length = 222 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 125 gcttcttcttcttcttcctcctcc 102
>gb|AC113121.27| Mus musculus chromosome 8, clone RP23-347G12, complete sequence Length = 192877 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| ||||||||||| Sbjct: 179925 cttcttcttcttcttcttcctccctctc 179952
>gb|AC124828.14| Mus musculus chromosome 5, clone RP24-126A19, complete sequence Length = 188504 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 128073 cttcttcttcttcttcctcctctctctc 128046
>gb|AC164549.4| Mus musculus BAC clone RP24-273K1 from chromosome 16, complete sequence Length = 182658 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 26015 cttcttcttcttcttcctcctccttctc 25988
>ref|XM_483803.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1635 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||||||||||||||| ||||||||||| Sbjct: 311 gcgccctggagacgctgtgcgggcaggc 338
>ref|XM_483802.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1597 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||||||||||||||| ||||||||||| Sbjct: 162 gcgccctggagacgctgtgcgggcaggc 189
>ref|NM_187397.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1515 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 386 tggagacgctatgcgggcaggcctacggcgcc 417 |||||||||| ||||||||||| ||||||||| Sbjct: 209 tggagacgctgtgcgggcaggcgtacggcgcc 240
>gb|AC101802.9| Mus musculus chromosome 1, clone RP24-221A4, complete sequence Length = 166975 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 57975 cttcttcttcttcttcctcctccttctc 58002 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 58088 cttcttcttcttcttcctcctcc 58110 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 57627 cttcttcttcttcttcctcctcc 57649 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 57774 cttcttcttcttcttcctcctc 57795 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 57693 cttcttcttcttcttcctcctc 57714 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 57863 cttcttcttcttcttcctcct 57883 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| |||||| |||| Sbjct: 57860 cttcttcttcttcttcttcctccttctc 57887
>gb|AC100427.25| Mus musculus chromosome 10, clone RP23-136J15, complete sequence Length = 206339 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 112577 cttcttcttcttcttcctcctccc 112554
>gb|AC136518.3| Mus musculus BAC clone RP23-304K22 from chromosome 16, complete sequence Length = 206486 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 10101 gcttcttcttcttcttcctcctcc 10078
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctc 52 |||||||||||||||||||||||| Sbjct: 34729123 tcttcttcttcttcctcctccctc 34729146 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 3268390 cttcttcttcttcttcctcctccc 3268367 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 25868718 cttcttcttcttcttcctcctcc 25868740 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 22235259 cttcttcttcttcttcctcctcc 22235281 Score = 46.1 bits (23), Expect = 0.12 Identities = 35/39 (89%) Strand = Plus / Minus Query: 283 ttctccggccacctcggcaacgtccacctcgccggcgcc 321 ||||||||||||||||||||| || | ||||||| |||| Sbjct: 20682903 ttctccggccacctcggcaacctcgagctcgccgccgcc 20682865 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 386 tggagacgctatgcgggcaggcctacggcgc 416 |||||||||| ||||||||||| |||||||| Sbjct: 20604786 tggagacgctgtgcgggcaggcgtacggcgc 20604756 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 16568337 cttcttcttcttcttcctcctcc 16568359 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccc 50 |||||||||||||||||||||| Sbjct: 33698402 tcttcttcttcttcctcctccc 33698423 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccc 50 |||||||||||||||||||||| Sbjct: 25318033 tcttcttcttcttcctcctccc 25318054 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctcc 49 |||||||||||||||||||||| Sbjct: 15483807 ttcttcttcttcttcctcctcc 15483828 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 36036496 cttcttcttcttcttcctcct 36036516 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 agcttcttcttcttcttcctc 45 ||||||||||||||||||||| Sbjct: 35130633 agcttcttcttcttcttcctc 35130653 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 28733302 cttcttcttcttcttcctcct 28733282 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 5609692 tcttcttcttcttcctcctcc 5609672 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||||||||| ||||||||||| | |||||| Sbjct: 4595854 gcgcgctggagacgctgtgcgggcaggcgttcggcgc 4595890 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 32913319 gcttcttcttcttcttcctc 32913300 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 520 cttctgtgcctgcatcaaga 539 |||||||||||||||||||| Sbjct: 31095658 cttctgtgcctgcatcaaga 31095677 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 28897192 tcttcttcctcctccctctc 28897211 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 26394334 tcttcttcctcctccctctc 26394315 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctc 48 |||||||||||||||||||| Sbjct: 26388037 tcttcttcttcttcctcctc 26388056 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 22052849 tcttcttcctcctccctctc 22052868 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggc 407 ||||| |||||||||| ||||||||||| Sbjct: 20679153 gcgccgtggagacgctgtgcgggcaggc 20679126 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| || |||||||| Sbjct: 16925864 cttcttcttcttcttcttcatccctctc 16925837 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 12346764 gcttcttcttcttcttcctc 12346783
>gb|AC125082.3| Mus musculus BAC clone RP24-90M24 from chromosome 10, complete sequence Length = 226256 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 90581 cttcttcttcttcttcctcctccttctc 90608 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 178294 cttcttcttcttcttcctcctcc 178272
>gb|AC128670.3| Mus musculus BAC clone RP23-137H4 from chromosome 13, complete sequence Length = 173020 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 104737 cttcttcttcttcttcctcctctctctc 104764
>gb|AC113244.19| Mus musculus chromosome 19, clone RP23-172E2, complete sequence Length = 224351 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 83361 cttcttcttcttcttcctcctccc 83338
>gb|AC092557.7| Oryza sativa chromosome 3 BAC OSJNBa0096I06 genomic sequence, complete sequence Length = 164352 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctccctc 52 |||||||||||||||||||||||| Sbjct: 133527 tcttcttcttcttcctcctccctc 133504
>gb|AC126270.4| Mus musculus BAC clone RP23-233A12 from chromosome 10, complete sequence Length = 208709 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 71156 cttcttcttcttcttcctcctccc 71133
>ref|XM_391686.1| Gibberella zeae PH-1 chromosome linkage group 10 hypothetical protein (FG11510.1) partial mRNA Length = 3390 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 2794 cttcttcttcttcttcctcctccc 2771
>gb|AC124403.3| Mus musculus BAC clone RP24-369I6 from chromosome 16, complete sequence Length = 159138 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 18728 cttcttcttcttcttcctcctccc 18705
>gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome 12, complete sequence Length = 196285 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 85081 cttcttcttcttcttcctcctccttctc 85108 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 85182 cttcttcttcttcttcctcct 85202 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| |||||| |||| Sbjct: 85179 cttcttcttcttcttcttcctccttctc 85206
>gb|AC124190.4| Mus musculus BAC clone RP23-267M9 from 3, complete sequence Length = 167681 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 123916 cttcttcttcttcttcctcctctctctc 123943
>gb|AC126457.3| Mus musculus BAC clone RP23-68E6 from 16, complete sequence Length = 147585 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 98526 cttcttcttcttcttcctcctccttctc 98499
>gb|AC117198.3| Mus musculus BAC clone RP23-127K18 from 9, complete sequence Length = 193044 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 133494 cttcttcttcttcttcctcctccc 133471
>gb|AC164955.2| Mus musculus BAC clone RP24-233H9 from chromosome 9, complete sequence Length = 221907 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 220871 cttcttcttcttcttcctcctccttctc 220844
>gb|AC153364.4| Mus musculus BAC clone RP23-35J21 from chromosome 10, complete sequence Length = 231668 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 215999 cttcttcttcttcttcctcctccc 215976 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 82962 cttcttcttcttcttcctcct 82982
>emb|BX649553.6| Human DNA sequence from clone RP4-674K6 on chromosome X, complete sequence Length = 86882 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 53717 cttcttcttcttcttcctcctccttctc 53744
>gb|AC112163.7| Mus Musculus chromosome 13 BAC, clone MGS1-437011 ES cell line, Complete Sequence, complete sequence Length = 159042 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 98725 cttcttcttcttcttcctcctccttctc 98752 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 ||||||||||||||||| |||||| Sbjct: 98721 gcttcttcttcttcttcttcctcc 98744
>gb|AC105729.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1607A12, complete sequence Length = 177327 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 160824 cttcttcttcttcttcctcctccc 160847
>gb|AC163342.2| Mus musculus BAC clone RP24-115M13 from chromosome 9, complete sequence Length = 204620 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||| |||||||||| Sbjct: 183554 cttcttcttcttcttccccctccctctc 183581
>emb|AL645637.18| Mouse DNA sequence from clone RP23-388B5 on chromosome 1 Contains the 5' end of the Adam23 gene for a disintegrin and metalloprotease domain 23, a pleckstrin homology domain-containing family A (phosphoinositide binding specific) member 3 (Plekha3) pseudogene, a px19-like protein (PX19) pseudogene and a CpG island, complete sequence Length = 207629 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||| |||||||||||||| Sbjct: 38140 cttcttcttcttcctcctcctccctctc 38167 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 38137 cttcttcttcttcttcctcctcc 38159
>emb|AL606656.3|OSJN00099 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0020J19, complete sequence Length = 123272 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 95139 gcttcttcttcttcttcctcctcc 95162
>gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, complete sequence Length = 190368 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 151895 cttcttcttcttcttcctcctccttctc 151922
>gb|AC122587.5| Rattus norvegicus BAC CH230-173H6 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 202972 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||| |||||| Sbjct: 140398 cttcttcttcttcttcctccttcctctc 140371
>gb|AC164579.5| Mus musculus 6 BAC RP23-384P24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 214578 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| ||||||||||| Sbjct: 149735 cttcttcttcttcttcttcctccctctc 149708
>emb|AL662902.14| Mouse DNA sequence from clone RP23-417K16 on chromosome 11 Contains two novel genes, complete sequence Length = 154002 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctccct 51 |||||||||||||||||||||||| Sbjct: 65822 ttcttcttcttcttcctcctccct 65845 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 94889 cttcttcttcttcttcctcctcc 94911
>emb|AL606661.23| Mouse DNA sequence from clone RP23-355P23 on chromosome 11 Contains a ubiquitin C (Ubc) pseudogene, complete sequence Length = 91585 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 80322 cttcttcttcttcttcctcctctctctc 80295
>emb|BX072541.1| Mouse DNA sequence from clone RP23-189G9 on chromosome 4 Contains a novel gene and a aldo-keto reductase family 1 member B8 (Akr1b8) pseudogene, complete sequence Length = 179699 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 110408 cttcttcttcttcttcctcctccttctc 110381
>gb|AC154350.3| Mus musculus BAC clone RP23-225B15 from chromosome 13, complete sequence Length = 213847 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 167543 cttcttcttcttcttcctcctccttctc 167516 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 ||||||||||||||||| |||||| Sbjct: 167547 gcttcttcttcttcttcttcctcc 167524
>gb|AC158662.7| Mus musculus 6 BAC RP23-20K24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 250218 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| ||||||||||| Sbjct: 78418 cttcttcttcttcttcttcctccctctc 78391
>gb|AC154847.2| Mus musculus BAC clone RP23-38J13 from chromosome 13, complete sequence Length = 200027 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 95486 cttcttcttcttcttcctcctccttctc 95459
>gb|AC158394.2| Mus musculus BAC clone RP23-406A1 from chromosome 14, complete sequence Length = 185214 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 102212 cttcttcttcttcttcctcctccttctc 102185 Score = 44.1 bits (22), Expect = 0.48 Identities = 25/26 (96%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||| |||| Sbjct: 102099 tcttcttcttcttcctcctccttctc 102074 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 102153 tcttcttcttcttcctcctcc 102133
>gb|AC154357.2| Mus musculus BAC clone RP23-192E11 from chromosome 9, complete sequence Length = 195151 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 20579 cttcttcttcttcttcctcctccttctc 20552
>gb|AC153969.12| Mus musculus 10 BAC RP24-86H7 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 209599 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 106071 cttcttcttcttcttcctcctccc 106048 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 108990 tcttcttcttcttcctcctcc 109010
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 35470336 gcttcttcttcttcttcctcctcc 35470359 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 31094226 cttcttcttcttcttcctcctcc 31094204 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 8096475 cttcttcttcttcttcctcctcc 8096497 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 489726 cttcttcttcttcttcctcctc 489705 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 28835905 tcttcttcttcttcctcctcc 28835925 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 22524842 cttcttcttcttcttcctcct 22524822 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 ccagcttcttcttcttcttc 42 |||||||||||||||||||| Sbjct: 35333018 ccagcttcttcttcttcttc 35332999 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctc 48 |||||||||||||||||||| Sbjct: 32052067 tcttcttcttcttcctcctc 32052086 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcc 46 |||||||||||||||||||| Sbjct: 27161479 cttcttcttcttcttcctcc 27161498 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 ||||||||||||||||| |||||| Sbjct: 24140285 cttcttcttcttcttccgcctccc 24140308 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 ||||||||||||||||| |||||| Sbjct: 22524846 gcttcttcttcttcttcttcctcc 22524823 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 cagcttcttcttcttcttcc 43 |||||||||||||||||||| Sbjct: 16128092 cagcttcttcttcttcttcc 16128111 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcct 47 |||||||||||||||||||| Sbjct: 2373117 ttcttcttcttcttcctcct 2373136 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 987082 gcttcttcttcttcttcctc 987101
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccctc 52 |||||||||||||||||||||||| Sbjct: 34819195 tcttcttcttcttcctcctccctc 34819218 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 3268500 cttcttcttcttcttcctcctccc 3268477 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 25960027 cttcttcttcttcttcctcctcc 25960049 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 22228288 cttcttcttcttcttcctcctcc 22228310 Score = 46.1 bits (23), Expect = 0.12 Identities = 35/39 (89%) Strand = Plus / Minus Query: 283 ttctccggccacctcggcaacgtccacctcgccggcgcc 321 ||||||||||||||||||||| || | ||||||| |||| Sbjct: 20675932 ttctccggccacctcggcaacctcgagctcgccgccgcc 20675894 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Minus Query: 386 tggagacgctatgcgggcaggcctacggcgc 416 |||||||||| ||||||||||| |||||||| Sbjct: 20597815 tggagacgctgtgcgggcaggcgtacggcgc 20597785 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 16561970 cttcttcttcttcttcctcctcc 16561992 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccc 50 |||||||||||||||||||||| Sbjct: 33788874 tcttcttcttcttcctcctccc 33788895 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctccc 50 |||||||||||||||||||||| Sbjct: 25409342 tcttcttcttcttcctcctccc 25409363 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctcc 49 |||||||||||||||||||||| Sbjct: 15478341 ttcttcttcttcttcctcctcc 15478362 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 36126570 cttcttcttcttcttcctcct 36126590 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 agcttcttcttcttcttcctc 45 ||||||||||||||||||||| Sbjct: 35220705 agcttcttcttcttcttcctc 35220725 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 28824626 cttcttcttcttcttcctcct 28824606 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 5608905 tcttcttcttcttcctcctcc 5608885 Score = 42.1 bits (21), Expect = 1.9 Identities = 33/37 (89%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggcctacggcgc 416 |||| ||||||||||| ||||||||||| | |||||| Sbjct: 4595969 gcgcgctggagacgctgtgcgggcaggcgttcggcgc 4596005 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 33003829 gcttcttcttcttcttcctc 33003810 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 520 cttctgtgcctgcatcaaga 539 |||||||||||||||||||| Sbjct: 31186181 cttctgtgcctgcatcaaga 31186200 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 28988614 tcttcttcctcctccctctc 28988633 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 26485643 tcttcttcctcctccctctc 26485624 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctc 48 |||||||||||||||||||| Sbjct: 26479346 tcttcttcttcttcctcctc 26479365 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcttcttcctcctccctctc 54 |||||||||||||||||||| Sbjct: 22045878 tcttcttcctcctccctctc 22045897 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggc 407 ||||| |||||||||| ||||||||||| Sbjct: 20672182 gcgccgtggagacgctgtgcgggcaggc 20672155 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| || |||||||| Sbjct: 16919437 cttcttcttcttcttcttcatccctctc 16919410 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctc 45 |||||||||||||||||||| Sbjct: 12343527 gcttcttcttcttcttcctc 12343546
>gb|AC155822.2| Mus musculus BAC clone RP23-319J10 from chromosome 16, complete sequence Length = 192526 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 151375 gcttcttcttcttcttcctcctcc 151352 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 73090 cttcttcttcttcttcctcctcc 73068
>gb|AC119797.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0083G16, complete sequence Length = 145590 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 93262 cttcttcttcttcttcctcctccc 93239
>dbj|AP005103.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0036M16 Length = 158880 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 386 tggagacgctatgcgggcaggcctacggcgcc 417 |||||||||| ||||||||||| ||||||||| Sbjct: 22964 tggagacgctgtgcgggcaggcgtacggcgcc 22995
>dbj|AP005454.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0455F03 Length = 158201 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 72011 cttcttcttcttcttcctcctccc 72034
>dbj|AP005320.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0650C03 Length = 144337 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 386 tggagacgctatgcgggcaggcctacggcgcc 417 |||||||||| ||||||||||| ||||||||| Sbjct: 98473 tggagacgctgtgcgggcaggcgtacggcgcc 98504
>gb|AC090977.48| Mus musculus strain C57BL/6J clone rp23-213m14 map 16, complete sequence Length = 208412 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 205905 cttcttcttcttcttcctcctccttctc 205878
>dbj|AP004587.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0543D10 Length = 134866 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||||||||||||||| ||||||||||| Sbjct: 61787 gcgccctggagacgctgtgcgggcaggc 61760
>dbj|AK120864.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023025C14, full insert sequence Length = 1864 Score = 48.1 bits (24), Expect = 0.031 Identities = 30/32 (93%) Strand = Plus / Plus Query: 386 tggagacgctatgcgggcaggcctacggcgcc 417 |||||||||| ||||||||||| ||||||||| Sbjct: 432 tggagacgctgtgcgggcaggcgtacggcgcc 463
>dbj|AP004691.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0453D01 Length = 147461 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 15023 gcttcttcttcttcttcctcctcc 15046
>dbj|AK105950.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-C12, full insert sequence Length = 1635 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||||||||||||||| ||||||||||| Sbjct: 311 gcgccctggagacgctgtgcgggcaggc 338
>dbj|AK103815.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033147C23, full insert sequence Length = 1597 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggc 407 |||||||||||||||| ||||||||||| Sbjct: 162 gcgccctggagacgctgtgcgggcaggc 189
>dbj|AK070717.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023058L06, full insert sequence Length = 2475 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 13 gcttcttcttcttcttcctcctcc 36
>gb|AC127686.4| Mus musculus BAC clone RP24-188G23 from 3, complete sequence Length = 173474 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||| ||||||| Sbjct: 69452 cttcttcttcttcttcctcccccctctc 69479 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||| ||||||| Sbjct: 69449 cttcttcttcttcttcttcctccc 69472
>gb|AC158127.3| Mus musculus chromosome 19, clone RP23-135N12, complete sequence Length = 217544 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 25065 gcttcttcttcttcttcctcctcc 25088
>emb|Y18323.1|SLAP18323 Homo sapiens SLAP gene, clone SEQ.D Length = 1365 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||| ||||||||| Sbjct: 18 cttcttcttcttcttccttctccctctc 45
>gb|AC104197.14| Mus musculus chromosome 8, clone RP24-319N16, complete sequence Length = 195334 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 61117 cttcttcttcttcttcctcctctctctc 61144 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 14827 cttcttcttcttcttcctcctcc 14805 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 2540 cttcttcttcttcttcctcctcc 2518
>gb|AC123676.9| Mus musculus chromosome 1, clone RP23-275F9, complete sequence Length = 169201 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||| ||||||||||||| Sbjct: 128081 cttcttcttcttctccctcctccctctc 128108
>emb|AL954335.11| Mouse DNA sequence from clone RP23-160N10 on chromosome 4, complete sequence Length = 73892 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 607 cttcttcttcttcttcctcctccttctc 580
>gb|AC153373.4| Mus musculus 6 BAC RP23-100J14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 218409 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 6734 cttcttcttcttcttcctcctctctctc 6761
>emb|AL953851.13| Mouse DNA sequence from clone RP24-423N4 on chromosome 4, complete sequence Length = 43627 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 42234 cttcttcttcttcttcctcctccttctc 42207
>emb|CT010489.8| Mouse DNA sequence from clone RP23-189F18 on chromosome 12, complete sequence Length = 112028 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 13875 cttcttcttcttcttcctcctccttctc 13848 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 13774 cttcttcttcttcttcctcct 13754 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| |||||| |||| Sbjct: 13777 cttcttcttcttcttcttcctccttctc 13750
>gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, complete sequence Length = 171340 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 106244 cttcttcttcttcttcctcctccc 106267
>gb|AC002539.1|AC002539 Homo sapiens chromosome 17, clone 195o20, complete sequence Length = 87246 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 34490 cttcttcttcttcttcctcctccc 34513
>gb|AC124490.4| Mus musculus BAC clone RP23-453I1 from 16, complete sequence Length = 189215 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 163884 cttcttcttcttcttcctcctccc 163861
>gb|AC158600.17| Mus musculus 10 BAC RP24-211K19 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 165879 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 103520 cttcttcttcttcttcctcctccc 103497
>emb|CT025660.9| Mouse DNA sequence from clone RP24-79I19 on chromosome 9, complete sequence Length = 219226 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 132170 cttcttcttcttcttcctcctccc 132193
>emb|CT025159.8| Mouse DNA sequence from clone RP23-336K1 on chromosome 14, complete sequence Length = 198530 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 134307 cttcttcttcttcttcctcctccttctc 134280
>gb|U35314.1|U35314 Penaeus vannamei microsatellites 1 and 2, complete sequence Length = 1259 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 895 cttcttcttcttcttcctcctccttctc 868
>dbj|AB241457.1| Lotus japonicus TINod mRNA for transcription initiator for nodulation, complete cds Length = 1500 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 260 gcttcttcttcttcttcctcctcc 237
>dbj|AB241456.1| Lotus japonicus TINod gene for transcription initiator for nodulation, complete cds Length = 23401 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 7335 gcttcttcttcttcttcctcctcc 7312
>gb|AC153605.2| Mus musculus 6 BAC RP23-346H23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 229744 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 47525 cttcttcttcttcttcctcctctctctc 47498
>emb|AL772297.10| Mouse DNA sequence from clone RP23-462N15 on chromosome 4, complete sequence Length = 55367 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 34515 cttcttcttcttcttcctcctccc 34492 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 tcttcttcttcttcctcctc 48 |||||||||||||||||||| Sbjct: 17118 tcttcttcttcttcctcctc 17137
>gb|AC170086.2| Mus musculus BAC clone RP24-127E11 from chromosome 13, complete sequence Length = 167543 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||||| |||| Sbjct: 35978 cttcttcttcttcttcctcctccttctc 35951 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 ||||||||||||||||| |||||| Sbjct: 35982 gcttcttcttcttcttcttcctcc 35959
>gb|AC108836.23| Mus musculus chromosome 19, clone RP23-276L15, complete sequence Length = 196065 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 135625 gcttcttcttcttcttcctcctcc 135648
>emb|AL672266.9| Mouse DNA sequence from clone RP23-342A10 on chromosome X, complete sequence Length = 216754 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 187572 gcttcttcttcttcttcctcctcc 187595
>emb|AL671173.12| Mouse DNA sequence from clone RP23-426N4 on chromosome 4, complete sequence Length = 201741 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||||||||| ||||| Sbjct: 194953 cttcttcttcttcttcctcctctctctc 194926
>gb|M28059.1|WHTUBE2 Wheat ubiquitin carrier protein (E2) mRNA, complete cds Length = 965 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Minus Query: 26 gcttcttcttcttcttcctcctcc 49 |||||||||||||||||||||||| Sbjct: 47 gcttcttcttcttcttcctcctcc 24
>emb|AL627307.18| Mouse DNA sequence from clone RP23-258J11 on chromosome 4, complete sequence Length = 108542 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 |||||||||||||||||||||||| Sbjct: 32586 cttcttcttcttcttcctcctccc 32609 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 13790 cttcttcttcttcttcctcctcc 13768
>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence Length = 214638 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 18243 cttcttcttcttcttcctcctcc 18221 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 18439 tcttcttcttcttcctcctcc 18419 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 18328 tcttcttcttcttcctcctcc 18308
>gb|AC138358.12| Mus musculus chromosome 1, clone RP24-147G10, complete sequence Length = 180227 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 135743 cttcttcttcttcttcctcctcc 135765
>gb|AC121514.14| Mus musculus chromosome 8, clone RP24-394H9, complete sequence Length = 168316 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 148031 cttcttcttcttcttcctcctcc 148009
>gb|AC114608.5| Mus musculus chromosome 8, clone RP23-418L5, complete sequence Length = 190200 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 181865 cttcttcttcttcttcctcctcc 181887
>gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 221782 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 156827 cttcttcttcttcttcctcctcc 156849
>gb|AC110510.6| Mus musculus chromosome 1, clone RP24-503F14, complete sequence Length = 198372 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 12272 cttcttcttcttcttcctcctcc 12250
>gb|AC116759.13| Mus musculus chromosome 18, clone RP23-383E12, complete sequence Length = 203049 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 139536 cttcttcttcttcttcctcctcc 139514
>gb|AC124810.14| Mus musculus chromosome 15, clone RP23-163N4, complete sequence Length = 212156 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 83714 cttcttcttcttcttcctcctcc 83736
>gb|AC091470.16| Mus musculus chromosome 3, clone RP23-237K2, complete sequence Length = 141824 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 64220 cttcttcttcttcttcctcctcc 64198
>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence Length = 190298 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 8380 cttcttcttcttcttcctcctcc 8402
>gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, complete sequence Length = 185846 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 122465 cttcttcttcttcttcctcctcc 122443
>gb|AC116696.20| Mus musculus chromosome 3, clone RP24-425N23, complete sequence Length = 168053 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 122562 cttcttcttcttcttcctcctcc 122584
>gb|AC119870.17| Mus musculus chromosome 3, clone RP24-261K17, complete sequence Length = 144502 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 38718 cttcttcttcttcttcctcctcc 38740
>gb|AC115877.13| Mus musculus chromosome 15, clone RP24-358H21, complete sequence Length = 169136 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 30400 cttcttcttcttcttcctcctcc 30422
>gb|AC118200.8| Mus musculus chromosome 5, clone RP23-330E5, complete sequence Length = 208710 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 144400 cttcttcttcttcttcctcctcc 144378
>gb|AC166253.18| Mus musculus BAC RP23-231M6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 207999 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 19054 cttcttcttcttcttcctcctcc 19076
>ref|NM_125889.1| Arabidopsis thaliana unknown protein AT5G64905 mRNA, complete cds Length = 486 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 262 cttcttcttcttcttcctcctcc 240
>ref|NM_100693.2| Arabidopsis thaliana nucleotide binding AT1G08190 mRNA, complete cds Length = 3344 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 241 cttcttcttcttcttcctcctcc 219
>ref|NM_120531.2| Arabidopsis thaliana phosphatidate cytidylyltransferase AT5G04490 mRNA, complete cds Length = 1104 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 62 cttcttcttcttcttcctcctcc 84
>ref|NM_105228.2| Arabidopsis thaliana calcium ion binding AT1G65540 mRNA, complete cds Length = 2211 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 1549 cttcttcttcttcttcctcctcc 1527
>ref|NM_121239.3| Arabidopsis thaliana unknown protein AT5G12010 mRNA, complete cds Length = 1728 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 117 cttcttcttcttcttcctcctcc 95
>ref|NM_122746.2| Arabidopsis thaliana unknown protein AT5G28630 mRNA, complete cds Length = 619 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 417 cttcttcttcttcttcctcctcc 395
>ref|NM_128655.3| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G31010 mRNA, complete cds Length = 3023 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 19 cttcttcttcttcttcctcctcc 41
>gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, complete sequence Length = 184794 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 153580 cttcttcttcttcttcctcctcc 153558
>gb|AC108914.8| Mus musculus chromosome 1, clone RP23-435E15, complete sequence Length = 212494 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 86150 cttcttcttcttcttcctcctcc 86128 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 cagcttcttcttcttcttcctc 45 |||||||||||||||||||||| Sbjct: 183463 cagcttcttcttcttcttcctc 183484
>gb|AC152947.1| Mus musculus 10 BAC RP23-12H20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 222139 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 209922 cttcttcttcttcttcctcctcc 209900 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 189141 cttcttcttcttcttcctcctcc 189119
>ref|NM_123446.3| Arabidopsis thaliana electron transporter/ electron transporter, transferring electrons within CoQH2-cytochrome c reductase complex AT5G40810 mRNA, complete cds Length = 1366 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 35 cttcttcttcttcttcctcctcc 57
>ref|NM_129069.2| Arabidopsis thaliana unknown protein AT2G35155 mRNA, complete cds Length = 2263 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 92 cttcttcttcttcttcctcctcc 114
>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence Length = 186266 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 58138 cttcttcttcttcttcctcctcc 58160 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 57971 cttcttcttcttcttcctcctcc 57993 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 57849 cttcttcttcttcttcctcctcc 57871
>gb|AC161271.2| Mus musculus BAC clone RP23-59D8 from chromosome 14, complete sequence Length = 206083 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 148254 cttcttcttcttcttcctcctcc 148276 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 121871 cttcttcttcttcttcctcctcc 121849
>gb|AC140431.4| Mus musculus BAC clone RP24-172K3 from chromosome 7, complete sequence Length = 172958 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 23001 cttcttcttcttcttcctcctcc 22979 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 22816 cttcttcttcttcttcctcctcc 22794
>gb|AC146980.9| Mus musculus chromosome 3, clone RP24-97N14, complete sequence Length = 161054 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 74226 cttcttcttcttcttcctcctcc 74204
>gb|AC137127.11| Mus musculus chromosome 9, clone RP24-264F17, complete sequence Length = 181842 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 174130 cttcttcttcttcttcctcctcc 174108 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 174004 cttcttcttcttcttcctcctcc 173982 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 173944 cttcttcttcttcttcctcctcc 173922
>gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, complete sequence Length = 152264 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 46706 cttcttcttcttcttcctcctcc 46728
>gb|AC157992.7| Mus musculus chromosome 8, clone RP23-302J17, complete sequence Length = 196519 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcctccc 50 ||||||||||||||||||||||| Sbjct: 133127 ttcttcttcttcttcctcctccc 133105 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| ||||| ||||| Sbjct: 3477 cttcttcttcttcttcttcctctctctc 3450
>gb|AC163390.2| Mus musculus chromosome 1, clone RP24-300C19, complete sequence Length = 180465 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 134708 cttcttcttcttcttcctcctcc 134730
>gb|AC101706.9| Mus musculus chromosome 15, clone RP23-256L18, complete sequence Length = 170006 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 12075 cttcttcttcttcttcctcctcc 12053
>gb|AC138367.14| Mus musculus chromosome 8, clone RP23-296G24, complete sequence Length = 177856 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 173421 cttcttcttcttcttcctcctcc 173399
>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence Length = 171409 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 50574 cttcttcttcttcttcctcctcc 50552 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 22431 cttcttcttcttcttcctcctc 22452
>gb|AC166111.4| Mus musculus BAC clone RP23-68O7 from chromosome 1, complete sequence Length = 185692 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 179554 cttcttcttcttcttcctcctcc 179532
>gb|AC161120.5| Mus musculus BAC clone RP23-84A2 from chromosome 10, complete sequence Length = 214638 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 55207 cttcttcttcttcttcctcctcc 55229
>gb|AC154375.2| Mus musculus BAC clone RP23-69H21 from chromosome 12, complete sequence Length = 169125 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 114275 cttcttcttcttcttcctcctcc 114253
>gb|AC131975.28| Mus musculus chromosome 17, clone RP24-146B4, complete sequence Length = 175318 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 46911 cttcttcttcttcttcctcctcc 46933
>gb|AC160526.13| Mus musculus chromosome 8, clone RP24-191C23, complete sequence Length = 174746 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 151726 cttcttcttcttcttcctcctcc 151748
>gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, complete sequence Length = 180366 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 46911 cttcttcttcttcttcctcctcc 46933
>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence Length = 176001 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 74223 cttcttcttcttcttcctcctcc 74245
>gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, complete sequence Length = 208483 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 59797 cttcttcttcttcttcctcctcc 59775 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 92843 tcttcttcttcttcctcctcc 92823
>gb|AC111028.10| Mus musculus chromosome 8, clone RP23-221P20, complete sequence Length = 193256 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 22580 cttcttcttcttcttcctcctcc 22558
>gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, complete sequence Length = 222682 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 59564 cttcttcttcttcttcctcctcc 59542
>gb|AC102219.11| Mus musculus chromosome 15, clone RP24-96K14, complete sequence Length = 194425 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 160256 cttcttcttcttcttcctcctcc 160234
>ref|XM_641357.1| Dictyostelium discoideum hypothetical protein (DDB0216728), partial mRNA Length = 3519 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 1210 cttcttcttcttcttcctcctcc 1188
>gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, complete sequence Length = 172348 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 21411 cttcttcttcttcttcctcctcc 21433
>gb|AC135720.8| Mus musculus chromosome 15, clone RP24-298F20, complete sequence Length = 156107 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 154746 cttcttcttcttcttcctcctcc 154724
>gb|AC109498.10| Mus musculus chromosome 5, clone RP23-22K24, complete sequence Length = 218246 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 3189 cttcttcttcttcttcctcctcc 3211
>ref|XM_635272.1| Dictyostelium discoideum hypothetical protein (DDB0205144), partial mRNA Length = 7872 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 1592 cttcttcttcttcttcctcctcc 1614
>gb|AC162528.5| Mus musculus BAC clone RP23-4P1 from chromosome 5, complete sequence Length = 219218 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 114311 cttcttcttcttcttcctcctcc 114289
>gb|AC151846.3| Mus musculus BAC clone RP23-13B8 from chromosome 10, complete sequence Length = 252639 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 110200 cttcttcttcttcttcctcctcc 110178
>gb|AC151577.2| Mus musculus BAC clone RP23-371D23 from chromosome 5, complete sequence Length = 206735 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 159148 cttcttcttcttcttcctcctcc 159170
>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete sequence Length = 186202 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 51562 cttcttcttcttcttcctcctcc 51540
>gb|AC144767.4| Mus musculus BAC clone RP23-82F8 from chromosome 6, complete sequence Length = 229027 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 191446 cttcttcttcttcttcctcctcc 191424
>gb|AC125407.4| Mus musculus BAC clone RP23-94F17 from chromosome 5, complete sequence Length = 233082 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 212816 cttcttcttcttcttcctcctcc 212794
>gb|AC159286.3| Mus musculus BAC clone RP23-314E22 from chromosome 14, complete sequence Length = 210984 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 174260 cttcttcttcttcttcctcctcc 174282
>gb|AC169984.2| Mus musculus BAC clone RP23-450I9 from chromosome 6, complete sequence Length = 181976 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 152243 cttcttcttcttcttcctcctcc 152265
>gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosome 14, complete sequence Length = 199186 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 120310 cttcttcttcttcttcctcctcc 120288
>gb|AC165247.2| Mus musculus BAC clone RP24-213G21 from chromosome 13, complete sequence Length = 162597 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 25124 cttcttcttcttcttcctcctcc 25146 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 7740 cttcttcttcttcttcctcctcc 7762 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctc 48 |||||||||||||||||||||| Sbjct: 7857 cttcttcttcttcttcctcctc 7878 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcct 47 ||||||||||||||||||||| Sbjct: 7962 cttcttcttcttcttcctcct 7982 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccctctc 54 |||||||||||||||| |||||| |||| Sbjct: 7959 cttcttcttcttcttcttcctccttctc 7986
>gb|AC155304.4| Mus musculus BAC clone RP24-212I6 from chromosome 8, complete sequence Length = 165128 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 85414 cttcttcttcttcttcctcctcc 85436
>gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome 18, complete sequence Length = 193523 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 167520 cttcttcttcttcttcctcctcc 167542
>gb|AC163660.4| Mus musculus BAC clone RP23-283J16 from chromosome 13, complete sequence Length = 198752 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 116156 cttcttcttcttcttcctcctcc 116134 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 72305 cttcttcttcttcttcctcctcc 72327
>gb|AC135668.5| Mus musculus BAC clone RP23-280P7 from chromosome 6, complete sequence Length = 207975 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 1754 cttcttcttcttcttcctcctcc 1776
>gb|AC154204.2| Mus musculus BAC clone RP24-393D5 from chromosome 17, complete sequence Length = 183408 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 145826 cttcttcttcttcttcctcctcc 145804
>gb|AC162799.4| Mus musculus BAC clone RP24-392E13 from chromosome 3, complete sequence Length = 177586 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 176387 cttcttcttcttcttcctcctcc 176409 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 98534 cttcttcttcttcttcctcctcc 98556
>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence Length = 196951 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 11018 cttcttcttcttcttcctcctcc 10996 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tcttcttcttcttcctcctcc 49 ||||||||||||||||||||| Sbjct: 153505 tcttcttcttcttcctcctcc 153485 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctccctctc 54 ||||||||||||| ||||||||| |||| Sbjct: 153504 cttcttcttcttcctcctcctccttctc 153477
>gb|AC160986.5| Mus musculus BAC clone RP23-258K21 from chromosome 6, complete sequence Length = 209886 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcctccctctc 54 ||||||||||||||||||||| ||||| Sbjct: 112266 ttcttcttcttcttcctcctctctctc 112240
>gb|AC120404.25| Mus musculus chromosome 6, clone RP24-405O23, complete sequence Length = 202146 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 77093 cttcttcttcttcttcctcctcc 77071 Score = 40.1 bits (20), Expect = 7.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 30 cttcttcttcttcctcctcc 49 |||||||||||||||||||| Sbjct: 173436 cttcttcttcttcctcctcc 173417
>gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, complete sequence Length = 156900 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 91740 cttcttcttcttcttcctcctcc 91762
>gb|AC153580.19| Mus musculus 6 BAC RP23-389F23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180936 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 50873 cttcttcttcttcttcctcctcc 50851
>gb|AC154039.17| Mus musculus 10 BAC RP23-282M20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 210923 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 16719 cttcttcttcttcttcctcctcc 16697
>gb|AC166238.7| Mus musculus chromosome 1, clone RP23-469H11, complete sequence Length = 181980 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 102439 cttcttcttcttcttcctcctcc 102461
>gb|AC166972.8| Mus musculus chromosome 3, clone RP24-330F18, complete sequence Length = 142975 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 75244 cttcttcttcttcttcctcctcc 75222 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 75079 cttcttcttcttcttcctcctcc 75057
>ref|XM_480435.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3294 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 66 cttcttcttcttcttcctcctcc 88 Score = 40.1 bits (20), Expect = 7.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctccc 50 ||||||||||||| |||||||||| Sbjct: 69 cttcttcttcttcctcctcctccc 92
>ref|XM_474931.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2298 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 814 cttcttcttcttcttcctcctcc 792
>ref|XM_469171.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1421 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 172 cttcttcttcttcttcctcctcc 150
>ref|XM_468414.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3183 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 3112 cttcttcttcttcttcctcctcc 3090
>ref|XM_468413.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2928 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 2434 cttcttcttcttcttcctcctcc 2412
>ref|XM_465895.1| Oryza sativa (japonica cultivar-group), mRNA Length = 711 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 339 cttcttcttcttcttcctcctcc 317
>gb|AC163020.9| Mus musculus chromosome 7, clone RP23-36L11, complete sequence Length = 215384 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 205909 cttcttcttcttcttcctcctcc 205887
>ref|NM_184850.1| Oryza sativa (japonica cultivar-group), mRNA Length = 417 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 57 cttcttcttcttcttcctcctcc 79
>ref|XM_462988.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1913 Score = 46.1 bits (23), Expect = 0.12 Identities = 35/39 (89%) Strand = Plus / Plus Query: 283 ttctccggccacctcggcaacgtccacctcgccggcgcc 321 ||||||||||||||||||||| || | ||||||| |||| Sbjct: 259 ttctccggccacctcggcaacctcgagctcgccgccgcc 297 Score = 40.1 bits (20), Expect = 7.5 Identities = 26/28 (92%) Strand = Plus / Plus Query: 380 gcgccctggagacgctatgcgggcaggc 407 ||||| |||||||||| ||||||||||| Sbjct: 356 gcgccgtggagacgctgtgcgggcaggc 383
>ref|XM_462973.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1654 Score = 46.1 bits (23), Expect = 0.12 Identities = 29/31 (93%) Strand = Plus / Plus Query: 386 tggagacgctatgcgggcaggcctacggcgc 416 |||||||||| ||||||||||| |||||||| Sbjct: 435 tggagacgctgtgcgggcaggcgtacggcgc 465
>gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosome 16, complete sequence Length = 211870 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 4084 cttcttcttcttcttcctcctcc 4062
>gb|AC159891.2| Mus musculus BAC clone RP23-394E10 from chromosome 9, complete sequence Length = 178766 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 153087 cttcttcttcttcttcctcctcc 153065
>gb|AC115898.22| Mus musculus chromosome 7, clone RP24-444C13, complete sequence Length = 177754 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 79273 cttcttcttcttcttcctcctcc 79295
>gb|AC165151.2| Mus musculus BAC clone RP24-77O15 from chromosome 16, complete sequence Length = 177446 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 57126 cttcttcttcttcttcctcctcc 57148
>gb|AC167138.6| Mus musculus chromosome 15, clone RP24-358O3, complete sequence Length = 190097 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 169305 cttcttcttcttcttcctcctcc 169283
>gb|AC166984.7| Mus musculus chromosome 15, clone RP24-359A11, complete sequence Length = 167492 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 43633 cttcttcttcttcttcctcctcc 43611
>gb|AC100043.9| Mus musculus chromosome 3, clone RP23-32D13, complete sequence Length = 234931 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 196538 cttcttcttcttcttcctcctcc 196560
>gb|AC104932.22| Mus musculus chromosome 3, clone RP24-337A16, complete sequence Length = 184718 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 52060 cttcttcttcttcttcctcctcc 52038
>gb|AC166332.7| Mus musculus chromosome 1, clone RP24-266F18, complete sequence Length = 167566 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 128230 cttcttcttcttcttcctcctcc 128252 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 128098 cttcttcttcttcttcctcctcc 128120
>gb|AC131065.16| Mus musculus chromosome 18, clone RP23-21J21, complete sequence Length = 208270 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 126723 cttcttcttcttcttcctcctcc 126701
>gb|AC166646.4| Mus musculus chromosome 3, clone RP24-400P18, complete sequence Length = 176864 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 67098 cttcttcttcttcttcctcctcc 67120
>gb|AC133489.32| Mus musculus strain C57BL/6J clone rp23-74a5, complete sequence Length = 225524 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 158674 cttcttcttcttcttcctcctcc 158652
>gb|AC113325.7| Mus musculus chromosome 1, clone RP23-453H23, complete sequence Length = 191225 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 65427 cttcttcttcttcttcctcctcc 65405
>gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosome 12, complete sequence Length = 206281 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 55343 cttcttcttcttcttcctcctcc 55365 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctcc 49 |||||||||||||||||||||| Sbjct: 55314 ttcttcttcttcttcctcctcc 55335
>gb|AC160028.9| Mus musculus 10 BAC RP24-570M12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 223055 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 204184 cttcttcttcttcttcctcctcc 204162 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 28 ttcttcttcttcttcctcctcc 49 |||||||||||||||||||||| Sbjct: 94572 ttcttcttcttcttcctcctcc 94551
>gb|AC123882.6| Mus musculus chromosome 1, clone RP23-447L15, complete sequence Length = 177559 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 45874 cttcttcttcttcttcctcctcc 45852
>gb|AC102490.7| Mus musculus chromosome 1, clone RP24-512M8, complete sequence Length = 133883 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 847 cttcttcttcttcttcctcctcc 869 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 28 ttcttcttcttcttcctcctcc 49 |||||||||||||||||||||| Sbjct: 61185 ttcttcttcttcttcctcctcc 61206
>gb|AC113444.9| Mus musculus chromosome 15, clone RP23-268C9, complete sequence Length = 189539 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 148206 cttcttcttcttcttcctcctcc 148228
>gb|AC123744.8| Mus musculus chromosome 7, clone RP24-120F8, complete sequence Length = 160977 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 92496 cttcttcttcttcttcctcctcc 92474
>gb|AC121116.7| Mus musculus chromosome 8, clone RP23-267D22, complete sequence Length = 200891 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 28628 cttcttcttcttcttcctcctcc 28650
>gb|BT018119.1| Zea mays clone EL01N0554A10.c mRNA sequence Length = 761 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 556 cttcttcttcttcttcctcctcc 578
>gb|AC113177.16| Mus musculus chromosome 15, clone RP23-447G7, complete sequence Length = 179268 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 136700 cttcttcttcttcttcctcctcc 136678
>gb|AC116895.12| Mus musculus chromosome 8, clone RP24-531C8, complete sequence Length = 170041 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 120396 cttcttcttcttcttcctcctcc 120374
>gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, complete sequence Length = 171020 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 65159 cttcttcttcttcttcctcctcc 65181
>gb|AC102484.7| Mus musculus chromosome 1, clone RP24-455F18, complete sequence Length = 150669 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 145138 cttcttcttcttcttcctcctcc 145160
>gb|AC113509.14| Mus musculus chromosome 1, clone RP23-377L11, complete sequence Length = 193588 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 86519 cttcttcttcttcttcctcctcc 86497
>gb|AC120135.7| Mus musculus chromosome 7, clone RP23-64O4, complete sequence Length = 220872 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Minus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 150433 cttcttcttcttcttcctcctcc 150411
>gb|AC117803.12| Mus musculus chromosome 17, clone RP24-562I11, complete sequence Length = 168136 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 55253 cttcttcttcttcttcctcctcc 55275
>gb|AC107843.10| Mus musculus chromosome 1, clone RP23-306B14, complete sequence Length = 180315 Score = 46.1 bits (23), Expect = 0.12 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 cttcttcttcttcttcctcctcc 49 ||||||||||||||||||||||| Sbjct: 81299 cttcttcttcttcttcctcctcc 81321 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,536,005 Number of Sequences: 3902068 Number of extensions: 5536005 Number of successful extensions: 863963 Number of sequences better than 10.0: 4794 Number of HSP's better than 10.0 without gapping: 4854 Number of HSP's successfully gapped in prelim test: 22 Number of HSP's that attempted gapping in prelim test: 691104 Number of HSP's gapped (non-prelim): 171064 length of query: 554 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 531 effective length of database: 17,143,297,704 effective search space: 9103091080824 effective search space used: 9103091080824 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
