>emb|AL589734.5| Human DNA sequence from clone RP4-683H9 on chromosome 1 Contains the 3'
end of the PHGDH gene for phosphoglycerate dehydrogenase
and the HMGCS2 gene for
3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
(mitochondrial), complete sequence
Length = 65882
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 5 cttctctccattgctccatct 25
|||||||||||||||||||||
Sbjct: 23891 cttctctccattgctccatct 23911
>emb|AL355336.15| Human DNA sequence from clone RP11-405O10 on chromosome 6 Contains the
5' end of the RREB1 gene for ras responsive element
binding protein 1, part of a novel gene and CpG islands,
complete sequence
Length = 169616
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 329 gggcgctgcggcggctcgcg 348
||||||||||||||||||||
Sbjct: 60691 gggcgctgcggcggctcgcg 60672
>emb|AL591430.8| Mouse DNA sequence from clone RP23-41B20 on chromosome 2 Contains the
5' end of the Cdh22 gene for cadherin 22, the Ovcov1 gene
for ovarian cancer overexpressed 1, the Elmo2 gene for
engulfment and cell motility 2, ced-12 homolog (C.
elegans), the 3' end of a putative novel zinc finger
protein and three CpG islands, complete sequence
Length = 144243
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 15 ttgctccatctcacgcccac 34
||||||||||||||||||||
Sbjct: 8541 ttgctccatctcacgcccac 8560
>gb|AC170998.2| Mus musculus BAC clone RP24-137E7 from chromosome 17, complete sequence
Length = 148715
Score = 40.1 bits (20), Expect = 8.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 449 aggtagaaacttacatgaac 468
||||||||||||||||||||
Sbjct: 139047 aggtagaaacttacatgaac 139066
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,245,179
Number of Sequences: 3902068
Number of extensions: 4245179
Number of successful extensions: 91484
Number of sequences better than 10.0: 47
Number of HSP's better than 10.0 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90546
Number of HSP's gapped (non-prelim): 938
length of query: 607
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 584
effective length of database: 17,143,297,704
effective search space: 10011685859136
effective search space used: 10011685859136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)