| Clone Name | bart35g09 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_189772.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 3348 Score = 664 bits (335), Expect = 0.0 Identities = 443/479 (92%) Strand = Plus / Plus Query: 97 atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156 |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| Sbjct: 1016 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 1075 Query: 157 aaaaaccggacttatacactcttgttgttctccttaaagatgccaatgggaagcttattg 216 || | || |||||||||||||||||||| ||||||||||| |||| |||||||| |||| Sbjct: 1076 aacatcccaacttatacactcttgttgttgtccttaaagattccaacgggaagctcattg 1135 Query: 217 attgtgaatcatgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttg 276 | |||||||||||||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 1136 agtgtgaatcatgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttg 1195 Query: 277 tcaatggatctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttg 336 ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 1196 tcaatggatgtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttg 1255 Query: 337 ggaagacaaatttagaagcatgcatgatcaaggatctggttttgatgagacaaaacaaca 396 | ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| Sbjct: 1256 gaaagacaaatttagaagcttgcatgattaaggatctggttttgatgagacaaaacaaca 1315 Query: 397 tcaatgctgttagaaactctcattacccccaacatccaaggtggtatgagttatgcgaca 456 | ||||||||||||||| ||||| |||||||||||||||||||||||| | || |||| Sbjct: 1316 ttaatgctgttagaaacagccattatccccaacatccaaggtggtatgagctgtgtgaca 1375 Query: 457 tctttggtctttatgtaattgatgaagccaatatcgagacacatggctttgatgaaacta 516 | ||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| ||| Sbjct: 1376 tttttggactttatgtaattgatgaagccaacatcgagacgcatggctttgatgaatcta 1435 Query: 517 gccatttcaaacatcctacactagaacccatctgggcaaattctatgcttgatcgtgtt 575 |||||||||||||||||||||| |||||| ||||||||| | ||||||||||||||||| Sbjct: 1436 gccatttcaaacatcctacacttgaacccttctgggcaagtgctatgcttgatcgtgtt 1494
>dbj|AK070047.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038J20, full insert sequence Length = 3913 Score = 664 bits (335), Expect = 0.0 Identities = 443/479 (92%) Strand = Plus / Plus Query: 97 atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156 |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| Sbjct: 1191 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 1250 Query: 157 aaaaaccggacttatacactcttgttgttctccttaaagatgccaatgggaagcttattg 216 || | || |||||||||||||||||||| ||||||||||| |||| |||||||| |||| Sbjct: 1251 aacatcccaacttatacactcttgttgttgtccttaaagattccaacgggaagctcattg 1310 Query: 217 attgtgaatcatgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttg 276 | |||||||||||||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 1311 agtgtgaatcatgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttg 1370 Query: 277 tcaatggatctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttg 336 ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 1371 tcaatggatgtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttg 1430 Query: 337 ggaagacaaatttagaagcatgcatgatcaaggatctggttttgatgagacaaaacaaca 396 | ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| Sbjct: 1431 gaaagacaaatttagaagcttgcatgattaaggatctggttttgatgagacaaaacaaca 1490 Query: 397 tcaatgctgttagaaactctcattacccccaacatccaaggtggtatgagttatgcgaca 456 | ||||||||||||||| ||||| |||||||||||||||||||||||| | || |||| Sbjct: 1491 ttaatgctgttagaaacagccattatccccaacatccaaggtggtatgagctgtgtgaca 1550 Query: 457 tctttggtctttatgtaattgatgaagccaatatcgagacacatggctttgatgaaacta 516 | ||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| ||| Sbjct: 1551 tttttggactttatgtaattgatgaagccaacatcgagacgcatggctttgatgaatcta 1610 Query: 517 gccatttcaaacatcctacactagaacccatctgggcaaattctatgcttgatcgtgtt 575 |||||||||||||||||||||| |||||| ||||||||| | ||||||||||||||||| Sbjct: 1611 gccatttcaaacatcctacacttgaacccttctgggcaagtgctatgcttgatcgtgtt 1669
>dbj|AK067525.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108P17, full insert sequence Length = 3268 Score = 664 bits (335), Expect = 0.0 Identities = 443/479 (92%) Strand = Plus / Plus Query: 97 atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156 |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| Sbjct: 753 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 812 Query: 157 aaaaaccggacttatacactcttgttgttctccttaaagatgccaatgggaagcttattg 216 || | || |||||||||||||||||||| ||||||||||| |||| |||||||| |||| Sbjct: 813 aacatcccaacttatacactcttgttgttgtccttaaagattccaacgggaagctcattg 872 Query: 217 attgtgaatcatgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttg 276 | |||||||||||||||||||| || |||||||| ||||||||||||||||||||||||| Sbjct: 873 agtgtgaatcatgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttg 932 Query: 277 tcaatggatctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttg 336 ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 933 tcaatggatgtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttg 992 Query: 337 ggaagacaaatttagaagcatgcatgatcaaggatctggttttgatgagacaaaacaaca 396 | ||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| Sbjct: 993 gaaagacaaatttagaagcttgcatgattaaggatctggttttgatgagacaaaacaaca 1052 Query: 397 tcaatgctgttagaaactctcattacccccaacatccaaggtggtatgagttatgcgaca 456 | ||||||||||||||| ||||| |||||||||||||||||||||||| | || |||| Sbjct: 1053 ttaatgctgttagaaacagccattatccccaacatccaaggtggtatgagctgtgtgaca 1112 Query: 457 tctttggtctttatgtaattgatgaagccaatatcgagacacatggctttgatgaaacta 516 | ||||| ||||||||||||||||||||||| |||||||| ||||||||||||||| ||| Sbjct: 1113 tttttggactttatgtaattgatgaagccaacatcgagacgcatggctttgatgaatcta 1172 Query: 517 gccatttcaaacatcctacactagaacccatctgggcaaattctatgcttgatcgtgtt 575 |||||||||||||||||||||| |||||| ||||||||| | ||||||||||||||||| Sbjct: 1173 gccatttcaaacatcctacacttgaacccttctgggcaagtgctatgcttgatcgtgtt 1231
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 301 bits (152), Expect = 1e-78 Identities = 191/204 (93%) Strand = Plus / Plus Query: 166 acttatacactcttgttgttctccttaaagatgccaatgggaagcttattgattgtgaat 225 |||||||||||||||||||| ||||||||||| |||| |||||||| ||||| ||||||| Sbjct: 41951015 acttatacactcttgttgttgtccttaaagattccaacgggaagctcattgagtgtgaat 41951074 Query: 226 catgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttgtcaatggat 285 ||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 41951075 catgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttgtcaatggat 41951134 Query: 286 ctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttgggaagacaa 345 |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 41951135 gtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttggaaagacaa 41951194 Query: 346 atttagaagcatgcatgatcaagg 369 |||||||||| |||||||| |||| Sbjct: 41951195 atttagaagcttgcatgattaagg 41951218 Score = 280 bits (141), Expect = 5e-72 Identities = 192/209 (91%) Strand = Plus / Plus Query: 367 aggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcattaccccc 426 ||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||| Sbjct: 41951333 aggatctggttttgatgagacaaaacaacattaatgctgttagaaacagccattatcccc 41951392 Query: 427 aacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatgaagcca 486 |||||||||||||||||||| | || ||||| ||||| |||||||||||||||||||||| Sbjct: 41951393 aacatccaaggtggtatgagctgtgtgacatttttggactttatgtaattgatgaagcca 41951452 Query: 487 atatcgagacacatggctttgatgaaactagccatttcaaacatcctacactagaaccca 546 | |||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||| Sbjct: 41951453 acatcgagacgcatggctttgatgaatctagccatttcaaacatcctacacttgaaccct 41951512 Query: 547 tctgggcaaattctatgcttgatcgtgtt 575 ||||||||| | ||||||||||||||||| Sbjct: 41951513 tctgggcaagtgctatgcttgatcgtgtt 41951541 Score = 107 bits (54), Expect = 4e-20 Identities = 60/62 (96%) Strand = Plus / Plus Query: 97 atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156 |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| Sbjct: 41950855 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 41950914 Query: 157 aa 158 || Sbjct: 41950915 aa 41950916
>dbj|AP003683.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431G06 Length = 140466 Score = 301 bits (152), Expect = 1e-78 Identities = 191/204 (93%) Strand = Plus / Plus Query: 166 acttatacactcttgttgttctccttaaagatgccaatgggaagcttattgattgtgaat 225 |||||||||||||||||||| ||||||||||| |||| |||||||| ||||| ||||||| Sbjct: 53092 acttatacactcttgttgttgtccttaaagattccaacgggaagctcattgagtgtgaat 53151 Query: 226 catgccaagtagggattcgtaatgtggtcctggcacacaagcagatgcttgtcaatggat 285 ||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||| Sbjct: 53152 catgccaagtaggaatccgtaatgtcgtcctggcacacaagcagatgcttgtcaatggat 53211 Query: 286 ctcctgttgtaattagaggtgtcaacagacatgagcatcatccacgtgttgggaagacaa 345 |||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 53212 gtcctgttgtaataagaggtgtcaacagacatgagcatcatccacgtgttggaaagacaa 53271 Query: 346 atttagaagcatgcatgatcaagg 369 |||||||||| |||||||| |||| Sbjct: 53272 atttagaagcttgcatgattaagg 53295 Score = 280 bits (141), Expect = 5e-72 Identities = 192/209 (91%) Strand = Plus / Plus Query: 367 aggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcattaccccc 426 ||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||| Sbjct: 53410 aggatctggttttgatgagacaaaacaacattaatgctgttagaaacagccattatcccc 53469 Query: 427 aacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatgaagcca 486 |||||||||||||||||||| | || ||||| ||||| |||||||||||||||||||||| Sbjct: 53470 aacatccaaggtggtatgagctgtgtgacatttttggactttatgtaattgatgaagcca 53529 Query: 487 atatcgagacacatggctttgatgaaactagccatttcaaacatcctacactagaaccca 546 | |||||||| ||||||||||||||| ||||||||||||||||||||||||| |||||| Sbjct: 53530 acatcgagacgcatggctttgatgaatctagccatttcaaacatcctacacttgaaccct 53589 Query: 547 tctgggcaaattctatgcttgatcgtgtt 575 ||||||||| | ||||||||||||||||| Sbjct: 53590 tctgggcaagtgctatgcttgatcgtgtt 53618 Score = 107 bits (54), Expect = 4e-20 Identities = 60/62 (96%) Strand = Plus / Plus Query: 97 atggttttcatggttatgttcttggtggaaaagtggaaaatccaaagctttggtctagtg 156 |||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| Sbjct: 52932 atggttttcatggttatgttcttggtggaaaagtagaaaatccaaaactttggtctagtg 52991 Query: 157 aa 158 || Sbjct: 52992 aa 52993
>ref|NM_148873.1| Arabidopsis thaliana beta-galactosidase/ hydrolase, hydrolyzing O-glycosyl compounds AT3G54440 transcript variant AT3G54440.1 mRNA, complete cds Length = 3567 Score = 87.7 bits (44), Expect = 4e-14 Identities = 167/208 (80%) Strand = Plus / Plus Query: 302 aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361 |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| |||||||| Sbjct: 1346 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 1405 Query: 362 gatcaaggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcatta 421 | |||||||| | || |||||| | || | || |||||||| || ||||| |||||| Sbjct: 1406 ggtcaaggatttaattatgatgaaagaatataatatcaatgcggtgcgaaacagtcatta 1465 Query: 422 cccccaacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatga 481 || |||||||| | |||||||| ||||| || | || || | || | || ||||| Sbjct: 1466 tcctcaacatccccgctggtatgaattatgtgatttgttcggcatgtacatgatcgatga 1525 Query: 482 agccaatatcgagacacatggctttgat 509 ||||||||| ||||||||||| |||||| Sbjct: 1526 agccaatatagagacacatggttttgat 1553
>ref|NM_001035781.1| Arabidopsis thaliana beta-galactosidase/ hydrolase, hydrolyzing O-glycosyl compounds AT3G54440 transcript variant AT3G54440.2 mRNA, complete cds Length = 3604 Score = 87.7 bits (44), Expect = 4e-14 Identities = 167/208 (80%) Strand = Plus / Plus Query: 302 aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361 |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| |||||||| Sbjct: 1346 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 1405 Query: 362 gatcaaggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcatta 421 | |||||||| | || |||||| | || | || |||||||| || ||||| |||||| Sbjct: 1406 ggtcaaggatttaattatgatgaaagaatataatatcaatgcggtgcgaaacagtcatta 1465 Query: 422 cccccaacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatga 481 || |||||||| | |||||||| ||||| || | || || | || | || ||||| Sbjct: 1466 tcctcaacatccccgctggtatgaattatgtgatttgttcggcatgtacatgatcgatga 1525 Query: 482 agccaatatcgagacacatggctttgat 509 ||||||||| ||||||||||| |||||| Sbjct: 1526 agccaatatagagacacatggttttgat 1553
>gb|AY091780.1| Arabidopsis thaliana At3g54435 mRNA, complete cds Length = 3568 Score = 87.7 bits (44), Expect = 4e-14 Identities = 167/208 (80%) Strand = Plus / Plus Query: 302 aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361 |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| |||||||| Sbjct: 1346 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 1405 Query: 362 gatcaaggatctggttttgatgagacaaaacaacatcaatgctgttagaaactctcatta 421 | |||||||| | || |||||| | || | || |||||||| || ||||| |||||| Sbjct: 1406 ggtcaaggatttaattatgatgaaagaatataatatcaatgcggtgcgaaacagtcatta 1465 Query: 422 cccccaacatccaaggtggtatgagttatgcgacatctttggtctttatgtaattgatga 481 || |||||||| | |||||||| ||||| || | || || | || | || ||||| Sbjct: 1466 tcctcaacatccccgctggtatgaattatgtgatttgttcggcatgtacatgatcgatga 1525 Query: 482 agccaatatcgagacacatggctttgat 509 ||||||||| ||||||||||| |||||| Sbjct: 1526 agccaatatagagacacatggttttgat 1553
>emb|AL138656.2|ATT14E10 Arabidopsis thaliana DNA chromosome 3, BAC clone T14E10 Length = 94911 Score = 79.8 bits (40), Expect = 9e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 302 aggtgtcaacagacatgagcatcatccacgtgttgggaagacaaatttagaagcatgcat 361 |||||| ||||| |||||||| |||||||||||||||||||| ||| |||| |||||||| Sbjct: 22173 aggtgtaaacaggcatgagcaccatccacgtgttgggaagacgaatatagaggcatgcat 22114 Query: 362 gatcaagg 369 | |||||| Sbjct: 22113 ggtcaagg 22106 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 477 gatgaagccaatatcgagacacatggctttgat 509 |||||||||||||| ||||||||||| |||||| Sbjct: 21872 gatgaagccaatatagagacacatggttttgat 21840
>ref|XM_452194.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B14883g predicted mRNA Length = 3078 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 298 ttagaggtgtcaacagacatgagcatcatcca 329 |||||||||||||||||||||| || |||||| Sbjct: 1046 ttagaggtgtcaacagacatgatcaccatcca 1077
>gb|AY526090.1| Kluyveromyces marxianus beta-D-galactosidase gene, complete cds Length = 3155 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 298 ttagaggtgtcaacagacatgagcatcatcca 329 |||||||||||||||||||||| || |||||| Sbjct: 1063 ttagaggtgtcaacagacatgatcaccatcca 1094
>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL Y-1140 of Kluyveromyces lactis Length = 1320834 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 298 ttagaggtgtcaacagacatgagcatcatcca 329 |||||||||||||||||||||| || |||||| Sbjct: 1311546 ttagaggtgtcaacagacatgatcaccatcca 1311577
>gb|M84410.1|YSKLAC4A Kluyveromyces lactis beta-D-galactosidase (LAC4) gene, complete cds Length = 3703 Score = 48.1 bits (24), Expect = 0.032 Identities = 30/32 (93%) Strand = Plus / Plus Query: 298 ttagaggtgtcaacagacatgagcatcatcca 329 |||||||||||||||||||||| || |||||| Sbjct: 1088 ttagaggtgtcaacagacatgatcaccatcca 1119
>gb|AC018525.8| Homo sapiens chromosome 8, clone RP11-3J13, complete sequence Length = 150052 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 445 agttatgcgacatctttggtctttatg 471 |||||||| |||||||||||||||||| Sbjct: 96909 agttatgcaacatctttggtctttatg 96935
>gb|AC103853.2| Homo sapiens chromosome 8, clone RP11-642D21, complete sequence Length = 178736 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 445 agttatgcgacatctttggtctttatg 471 |||||||| |||||||||||||||||| Sbjct: 150439 agttatgcaacatctttggtctttatg 150413
>dbj|AP005354.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1159C3, complete sequence Length = 133276 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 445 agttatgcgacatctttggtctttatg 471 |||||||| |||||||||||||||||| Sbjct: 49169 agttatgcaacatctttggtctttatg 49195
>gb|AC107762.8| Mus musculus chromosome 1, clone RP23-183L12, complete sequence Length = 187760 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 247 atgtggtcctggcacacaagcagat 271 |||||||||||||||||| |||||| Sbjct: 42142 atgtggtcctggcacacatgcagat 42118
>gb|AF488695.1| Cloning vector pCpG-LacZdeltaCpG, complete sequence Length = 5239 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 475 ttgatgaagccaatatcgagacacatggc 503 ||||||||||||| || |||||||||||| Sbjct: 1769 ttgatgaagccaacattgagacacatggc 1797
>emb|AL390839.33| Human DNA sequence from clone RP11-214L19 on chromosome 1 Contains a novel gene, complete sequence Length = 92253 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 acttgaagacaaagccaaaac 78 ||||||||||||||||||||| Sbjct: 3572 acttgaagacaaagccaaaac 3592
>gb|AC023934.6| Homo sapiens chromosome 17, clone RP11-618P13, complete sequence Length = 157069 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 184 ttctccttaaagatgccaatg 204 ||||||||||||||||||||| Sbjct: 24641 ttctccttaaagatgccaatg 24661
>gb|AC011193.3| Homo sapiens chromosome 17, clone RP11-521P1, complete sequence Length = 181022 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 89 cccttgccatggttttcatgg 109 ||||||||||||||||||||| Sbjct: 117815 cccttgccatggttttcatgg 117795
>emb|CR338999.2| Gallus gallus finished cDNA, clone ChEST949j11 Length = 1218 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 379 tgatgagacaaaacaacatca 399 ||||||||||||||||||||| Sbjct: 66 tgatgagacaaaacaacatca 86
>gb|AC016909.9| Homo sapiens BAC clone RP11-458A7 from 2, complete sequence Length = 155535 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 498 catggctttgatgaaactagc 518 ||||||||||||||||||||| Sbjct: 117050 catggctttgatgaaactagc 117070
>gb|AC002482.1|AC002482 Human BAC clone CTA-208O3, complete sequence Length = 107815 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 89 cccttgccatggttttcatgg 109 ||||||||||||||||||||| Sbjct: 24992 cccttgccatggttttcatgg 25012
>gb|AC102900.12| Mus musculus chromosome 1, clone RP24-315J13, complete sequence Length = 192545 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 247 atgtggtcctggcacacaagcagat 271 |||||||||||||||||| |||||| Sbjct: 172907 atgtggtcctggcacacatgcagat 172883
>ref|NM_124314.1| Arabidopsis thaliana unknown protein AT5G49370 mRNA, complete cds Length = 357 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 tctttatgtaattgatgaag 483 |||||||||||||||||||| Sbjct: 186 tctttatgtaattgatgaag 205
>gb|AC159245.2| Mus musculus BAC clone RP24-260B5 from chromosome 12, complete sequence Length = 168773 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 135 aatccaaagctttggtctag 154 |||||||||||||||||||| Sbjct: 100608 aatccaaagctttggtctag 100589
>gb|AE008449.1| Streptococcus pneumoniae R6 section 65 of 184 of the complete genome Length = 11727 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 475 ttgatgaagccaatatcgagacac 498 ||||||||||||||||| |||||| Sbjct: 689 ttgatgaagccaatatcaagacac 666
>gb|AF486415.1| Lagotis stolonifera chloroplast tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence Length = 878 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 704 tattgattgtgaatcattccaa-tagggattc 674
>gb|AY423129.1| Titanotrichum oldhamii isolate DNA-G37 tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 881 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 723 tattgattgtgaatcattccaa-tagggattc 693
>gb|AY623324.1| Nematanthus fritschii trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 333 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 148 tattgattgtgaatcattccaa-tagggattc 118
>gb|AY623322.1| Cremersia patula trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 287 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 148 tattgattgtgaatcattccaa-tagggattc 118
>gb|AY623321.1| Rhytidophyllum sp. 2-JFS-2004 trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 338 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623320.1| Rhytidophyllum sp. 1-JFS-2004 trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 338 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623319.1| Rhytidophyllum leucomallon trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 311 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623318.1| Rhytidophyllum tomentosum trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 338 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623317.1| Gesneria pedicellaris trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 315 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623316.1| Gesneria sp. JFS-2004 trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 338 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623315.1| Gesneria viridiflora trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 338 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623314.1| Gesneria ventricosa trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 341 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 149 tattgattgtgaatcattccaa-tagggattc 119
>gb|AY623305.1| Anodiscus xanthophyllus trnL-trnF intergenic spacer, partial sequence; chloroplast Length = 349 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 158 tattgattgtgaatcattccaa-tagggattc 128
>gb|AY364307.1| Sinningia richii chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 383 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 201 tattgattgtgaatcattccaa-tagggattc 171
>gb|AY364306.1| Sinningia speciosa chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 396 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 198 tattgattgtgaatcattccaa-tagggattc 168
>gb|AY364305.1| Alloplectus panamensis chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 391 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 193 tattgattgtgaatcattccaa-tagggattc 163
>gb|AY364303.1| Nematanthus albus chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 393 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 193 tattgattgtgaatcattccaa-tagggattc 163
>gb|AY364301.1| Rhytidophyllum auriculatum chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 398 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 194 tattgattgtgaatcattccaa-tagggattc 164
>gb|AY364299.1| Napeanthus macrostoma chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 391 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 194 tattgattgtgaatcattccaa-tagggattc 164
>gb|AY364298.1| Napeanthus apodemus chloroplast trnL-trnF intergenic spacer and tRNA-Phe gene, partial sequence Length = 392 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 194 tattgattgtgaatcattccaa-tagggattc 164
>gb|AY264499.1| Lopezia laciniata trnL gene, partial sequence; trnL-trnF intergenic spacer region, complete sequence; and trnF gene, partial sequence; chloroplast genes for chloroplast products Length = 941 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 ttattgattgtgaatcatgc 230 |||||||||||||||||||| Sbjct: 773 ttattgattgtgaatcatgc 754
>gb|AY456395.1| 'Chlorella' ellipsoidea oxygen-evolving enhancer protein 1 mRNA, partial cds Length = 817 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 172 acactcttgttgttctcctt 191 |||||||||||||||||||| Sbjct: 353 acactcttgttgttctcctt 334
>ref|XM_547369.2| PREDICTED: Canis familiaris similar to Kinesin-like protein KIF14 (LOC490248), mRNA Length = 5094 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 atttgaattcagatatgtca 41 |||||||||||||||||||| Sbjct: 224 atttgaattcagatatgtca 243
>gb|AC104914.9| Mus musculus chromosome 9, clone RP23-108E20, complete sequence Length = 260181 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 gaattcagatatgtcagatg 45 |||||||||||||||||||| Sbjct: 246716 gaattcagatatgtcagatg 246735
>gb|AC114002.4| Mus musculus BAC clone RP23-165H7 from 12, complete sequence Length = 200112 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 283 gatctcctgttgtaattaga 302 |||||||||||||||||||| Sbjct: 8671 gatctcctgttgtaattaga 8690
>gb|AY047156.1| Alloplectus bolivianus chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 861 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 709 tattgattgtgaatcattccaa-tagggattc 679
>gb|AY047155.1| Neomortonia nummularia chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 874 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>gb|AY047153.1| Corytoplectus cutucuensis chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 838 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 686 tattgattgtgaatcattccaa-tagggattc 656
>gb|AY047152.1| Drymonia serrulata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 878 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 726 tattgattgtgaatcattccaa-tagggattc 696
>gb|AY047151.1| Columnea spathulata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 883 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 731 tattgattgtgaatcattccaa-tagggattc 701
>gb|AY047147.1| Codonanthe carnosa chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 889 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 737 tattgattgtgaatcattccaa-tagggattc 707
>gb|AY047146.1| Paradrymonia binata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 859 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 707 tattgattgtgaatcattccaa-tagggattc 677
>gb|AY047145.1| Nautilocalyx melittifolius chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 862 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 708 tattgattgtgaatcattccaa-tagggattc 678
>gb|AY047144.1| Chrysothemis pulchella chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 887 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 735 tattgattgtgaatcattccaa-tagggattc 705
>gb|AY047143.1| Sinningia lindleyi chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 889 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 737 tattgattgtgaatcattccaa-tagggattc 707
>gb|AY047142.1| Sinningia incarnata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 852 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 700 tattgattgtgaatcattccaa-tagggattc 670
>gb|AY047141.1| Sinningia cooperi chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 884 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047140.1| Paliavana prasinata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 738 tattgattgtgaatcattccaa-tagggattc 708
>gb|AY047139.1| Vanhouttea lanata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 889 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 737 tattgattgtgaatcattccaa-tagggattc 707
>gb|AY047138.1| Gloxinia sarmentiana chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 857 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 705 tattgattgtgaatcattccaa-tagggattc 675
>gb|AY047120.1| Eucodonia verticillata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 894 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||| ||||| |||| ||||||||| Sbjct: 736 tattgattgtgcatcattccaaatagggattc 705
>gb|AY047119.1| Eucodonia andrieuxii chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 907 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||| ||||| |||| ||||||||| Sbjct: 749 tattgattgtgcatcattccaaatagggattc 718
>gb|AY047118.1| Rhytidophyllum vernicosum chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047117.1| Rhytidophyllum auriculatum chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047116.1| Gesneria rupincola chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047115.1| Rhytidophyllum tomentosum chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047114.1| Rhytidophyllum exsertum chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047113.1| Gesneria citrina chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047112.1| Gesneria ventricosa chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047111.1| Gesneria pedunculosa chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047109.1| Gesneria viridiflora chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047108.1| Gesneria pedicellaris chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 829 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 671 tattgattgtgaatcattccaa-tagggattc 641
>gb|AY047107.1| Gesneria reticulata chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047106.1| Gesneria cuneifolia chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047104.1| Gesneria acaulis chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY047102.1| Reldia minutiflora chloroplast tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence Length = 854 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 703 tattgattgtgaatcattccaa-tagggattc 673
>gb|AY047101.1| Gasteranthus quitensis chloroplast tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, partial sequence Length = 866 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>emb|AL138751.18| Human DNA sequence from clone RP11-346E17 on chromosome 9 Contains the 5' end of a novel gene (CGI-67), a novel gene, a novel gene (LOC138240) and a CpG island, complete sequence Length = 195844 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 ttggtggaaaagtggaaaat 137 |||||||||||||||||||| Sbjct: 34242 ttggtggaaaagtggaaaat 34223
>gb|AY702431.1| Pheidonocarpa corymbosa tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer, complete sequence; chloroplast Length = 890 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 732 tattgattgtgaatcattccaa-tagggattc 702
>gb|AY702394.1| Bellonia spinosa tRNA-Leu (trnL) gene, partial sequence; and trnL-trnF intergenic spacer, complete sequence; chloroplast Length = 362 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 204 tattgattgtgaatcattccaa-tagggattc 174
>gb|AC171134.2| Helobdella robusta clone CH306-1A5, complete sequence Length = 95814 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 57 aacttgaagacaaagccaaa 76 |||||||||||||||||||| Sbjct: 33856 aacttgaagacaaagccaaa 33875
>gb|AC137080.13| Medicago truncatula clone mth2-9a7, complete sequence Length = 129121 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 107 tggttatgttcttggtggaaaagt 130 |||||||||| ||||||||||||| Sbjct: 344 tggttatgtttttggtggaaaagt 321
>gb|AF482612.1| Columnea sp. Lindqvist and Albert 30 chloroplast tRNA-Leu (trnL) gene and trnL-trnF intergenic spacer region, partial sequence Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 702 tattgattgtgaatcattccaa-tagggattc 672
>gb|AC159198.2| Mus musculus BAC clone RP23-388C15 from chromosome 12, complete sequence Length = 213311 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 283 gatctcctgttgtaattaga 302 |||||||||||||||||||| Sbjct: 196702 gatctcctgttgtaattaga 196721
>gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome Length = 2160842 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 475 ttgatgaagccaatatcgagacac 498 ||||||||||||||||| |||||| Sbjct: 768268 ttgatgaagccaatatcaagacac 768245
>gb|AC112933.16| Mus musculus chromosome 5, clone RP24-418J2, complete sequence Length = 172244 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 attcagatatgtcagatgct 47 |||||||||||||||||||| Sbjct: 16387 attcagatatgtcagatgct 16406
>dbj|AB023034.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K7J8 Length = 56963 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 464 tctttatgtaattgatgaag 483 |||||||||||||||||||| Sbjct: 16386 tctttatgtaattgatgaag 16405
>emb|AJ492319.1|PPR492319 Paliavana prasinata chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 892 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ492318.1|SCA492318 Sinningia cardinalis chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 887 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ492317.1|RTO492317 Rhytidophyllum tomentosum chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 912 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ492314.1|CSA492314 Columnea sanguinea chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 900 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 721 tattgattgtgaatcattccaa-tagggattc 691
>emb|AJ492310.1|BME492310 Besleria melancholica chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 881 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 709 tattgattgtgaatcattccaa-tagggattc 679
>emb|AJ492308.1|LAU492308 Lenbrassia australiana chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 971 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 758 tattgattgtgaatcattccaa-tagggattc 728
>emb|AJ439819.1|VGA439819 Vanhouttea gardneri chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 873 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 721 tattgattgtgaatcattccaa-tagggattc 691
>emb|AJ439818.1|VSP439818 Vanhouttea sp. Salimena Pires et al. AC501 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 877 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 725 tattgattgtgaatcattccaa-tagggattc 695
>emb|AJ439816.1|VLA439816 Vanhouttea lanata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439815.1|VSP439815 Vanhouttea sp. Salimena Pires et al. AC506 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 869 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 716 tattgattgtgaatcattccaa-tagggattc 686
>emb|AJ439813.1|VSP439813 Vanhouttea sp. Leoni 4197 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 869 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 716 tattgattgtgaatcattccaa-tagggattc 686
>emb|AJ439805.1|SLA439805 Sinningia lateritia chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439804.1|SPU439804 Sinningia pusilla chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439803.1|SAG439803 Sinningia aghensis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439802.1|SIN439802 Sinningia incarnata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 836 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 683 tattgattgtgaatcattccaa-tagggattc 653
>emb|AJ439801.1|SAL439801 Sinningia allagophylla chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 880 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697
>emb|AJ439800.1|SCU439800 Sinningia curtiflora chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 880 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697
>emb|AJ439799.1|SCO439799 Sinningia cochlearis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439798.1|SVI439798 Sinningia villosa chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689
>emb|AJ439797.1|SRI439797 Sinningia richii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 866 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 713 tattgattgtgaatcattccaa-tagggattc 683
>emb|AJ439796.1|SGU439796 Sinningia guttata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439795.1|SVA439795 Sinningia valsuganensis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 883 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 730 tattgattgtgaatcattccaa-tagggattc 700
>emb|AJ439794.1|SMI439794 Sinningia micans chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439793.1|SSC439793 Sinningia sceptrum chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 836 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 683 tattgattgtgaatcattccaa-tagggattc 653
>emb|AJ439792.1|SEL439792 Sinningia elatior chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 837 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 684 tattgattgtgaatcattccaa-tagggattc 654
>emb|AJ439791.1|SSP439791 Sinningia sp. Romero et al. 1709 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 870 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 717 tattgattgtgaatcattccaa-tagggattc 687
>emb|AJ439790.1|SIA439790 Sinningia iarae chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439789.1|SRU439789 Sinningia rupicola chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439788.1|SGI439788 Sinningia gigantifolia chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 855 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 703 tattgattgtgaatcattccaa-tagggattc 673
>emb|AJ439787.1|SCO439787 Sinningia concinna chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 880 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439786.1|SHA439786 Sinningia harleyi chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 866 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 713 tattgattgtgaatcattccaa-tagggattc 683
>emb|AJ439785.1|SCA439785 Sinningia carangolensis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 885 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 730 tattgattgtgaatcattccaa-tagggattc 700
>emb|AJ439784.1|SCO439784 Sinningia conspicua chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 865 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 712 tattgattgtgaatcattccaa-tagggattc 682
>emb|AJ439783.1|SMA439783 Sinningia magnifica chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439782.1|STU439782 Sinningia tuberosa chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 873 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439781.1|SNO439781 Sinningia nordestina chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689
>emb|AJ439780.1|SBA439780 Sinningia barbata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439779.1|SSP439779 Sinningia speciosa chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689
>emb|AJ439778.1|SHI439778 Sinningia hirsuta chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439777.1|SSE439777 Sinningia sellowii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 880 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697
>emb|AJ439776.1|SMA439776 Sinningia mauroana chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439775.1|SCA439775 Sinningia cardinalis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439774.1|STU439774 Sinningia tubiflora chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439773.1|SKA439773 Sinningia kautskyi chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 873 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439772.1|SCA439772 Sinningia calcaria chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439771.1|SLE439771 Sinningia leopoldii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439770.1|SDO439770 Sinningia douglasii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439769.1|SST439769 Sinningia striata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 866 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439768.1|SSP439768 Sinningia sp. Cervi et al. AC484 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439767.1|SNI439767 Sinningia nivalis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439766.1|SIN439766 Sinningia insularis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439765.1|SWA439765 Sinningia warmingii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 880 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 727 tattgattgtgaatcattccaa-tagggattc 697
>emb|AJ439764.1|SCO439764 Sinningia cooperi chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439763.1|SHA439763 Sinningia hatschbachii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439762.1|SGL439762 Sinningia glazioviana chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439761.1|SDE439761 Sinningia defoliata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 870 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 717 tattgattgtgaatcattccaa-tagggattc 687
>emb|AJ439760.1|SLE439760 Sinningia leucotricha chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439759.1|SMA439759 Sinningia macrostachya chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439758.1|SLI439758 Sinningia lineata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439756.1|SBR439756 Sinningia brasiliensis chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439755.1|SRE439755 Sinningia reitzii chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439754.1|SBU439754 Sinningia bulbosa chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439753.1|SEU439753 Sinningia eumorpha chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 865 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 712 tattgattgtgaatcattccaa-tagggattc 682
>emb|AJ439752.1|SMA439752 Sinningia macropoda chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439751.1|SCA439751 Sinningia canescens chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439750.1|SPI439750 Sinningia piresiana chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 867 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439749.1|SMA439749 Sinningia macrophylla chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689
>emb|AJ439748.1|SAR439748 Sinningia araneosa chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 874 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439747.1|SLI439747 Sinningia lindleyi chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439746.1|SSP439746 Sinningia sp. Chautems Perret 99-051 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439745.1|SSC439745 Sinningia schiffneri chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 715 tattgattgtgaatcattccaa-tagggattc 685
>emb|AJ439829.1|NME439829 Nautilocalyx melittifolius chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 869 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>emb|AJ439825.1|NVI439825 Nematanthus villosus chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 873 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689
>emb|AJ439811.1|PCO439811 Paliavana sp. Leoni 1812 chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 869 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 716 tattgattgtgaatcattccaa-tagggattc 686
>emb|AJ439808.1|PSE439808 Paliavana sericiflora chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 872 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439807.1|PTE439807 Paliavana tenuiflora chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439806.1|PPR439806 Paliavana prasinata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 873 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 720 tattgattgtgaatcattccaa-tagggattc 690
>emb|AJ439757.1|SAG439757 Sinningia aggregata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 875 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 722 tattgattgtgaatcattccaa-tagggattc 692
>emb|AJ439826.1|CSE439826 Codonanthe serrulata chloroplast partial tRNA-Leu gene and trnL-trnF intergenic spacer Length = 868 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 714 tattgattgtgaatcattccaa-tagggattc 684
>dbj|AP006108.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT11O06, TM0194, complete sequence Length = 108277 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cactcttgttgttctcctta 192 |||||||||||||||||||| Sbjct: 66730 cactcttgttgttctcctta 66749 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 cactcttgttgttctcctta 192 |||||||||||||||||||| Sbjct: 55827 cactcttgttgttctcctta 55846
>emb|AJ492321.1|NRE492321 Napeanthus reitzii chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 882 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 710 tattgattgtgaatcattccaa-tagggattc 680
>emb|AJ492316.1|NVI492316 Nematanthus villosus chloroplast tRNA-Leu gene (partial), trnL-F intergenic spacer and tRNA-Phe gene (partial) Length = 892 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 719 tattgattgtgaatcattccaa-tagggattc 689
>gb|AC152164.14| Mus musculus chromosome 8, clone RP24-118N20, complete sequence Length = 185586 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 275 tgtcaatggatctcctgttg 294 |||||||||||||||||||| Sbjct: 73009 tgtcaatggatctcctgttg 72990
>emb|AJ296522.1|VAR296522 Verbascum arcturus chloroplast tRNA-Leu (UAA) gene Length = 948 Score = 40.1 bits (20), Expect = 7.8 Identities = 30/32 (93%), Gaps = 1/32 (3%) Strand = Plus / Minus Query: 212 tattgattgtgaatcatgccaagtagggattc 243 ||||||||||||||||| |||| ||||||||| Sbjct: 751 tattgattgtgaatcat-ccaaatagggattc 721 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,540,498 Number of Sequences: 3902068 Number of extensions: 5540498 Number of successful extensions: 109276 Number of sequences better than 10.0: 180 Number of HSP's better than 10.0 without gapping: 44 Number of HSP's successfully gapped in prelim test: 136 Number of HSP's that attempted gapping in prelim test: 109149 Number of HSP's gapped (non-prelim): 263 length of query: 575 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 552 effective length of database: 17,143,297,704 effective search space: 9463100332608 effective search space used: 9463100332608 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)