No.
Definition
Score (bits)
E Value
1 dbj|AB021176.1| Zea mays ZmRCP2 mRNA for root cap protein 2, com...
264
3e-67
2 gb|AF134579.1|AF134579 Zea mays clone AGPZm1 arabinogalactan pro...
230
4e-57
3 gb|AC120307.3| Oryza sativa (japonica cultivar-group) chromosome...
212
9e-52
4 gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosom...
212
9e-52
5 dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...
212
9e-52
6 dbj|AK106826.1| Oryza sativa (japonica cultivar-group) cDNA clon...
212
9e-52
7 gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...
212
9e-52
8 gb|AY111354.1| Zea mays CL1277_1 mRNA sequence
204
2e-49
9 ref|NM_189426.1| Oryza sativa (japonica cultivar-group), predic...
76
1e-10
10 dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...
76
1e-10
11 dbj|AP003448.3| Oryza sativa (japonica cultivar-group) genomic D...
76
1e-10
12 ref|XM_472395.1| Oryza sativa (japonica cultivar-group), predic...
72
2e-09
13 emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,...
72
2e-09
14 dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...
72
2e-09
15 dbj|AK108077.1| Oryza sativa (japonica cultivar-group) cDNA clon...
72
2e-09
16 ref|NM_189425.1| Oryza sativa (japonica cultivar-group), predic...
70
9e-09
17 ref|NM_189423.1| Oryza sativa (japonica cultivar-group), predic...
70
9e-09
18 dbj|AK122054.1| Oryza sativa (japonica cultivar-group) cDNA clon...
66
1e-07
19 gb|AC129716.3| Oryza sativa (japonica cultivar-group) chromosome...
62
2e-06
20 dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...
62
2e-06
21 dbj|AB021175.1| Zea mays ZmRCP1 mRNA for root cap protein 1, com...
58
3e-05
22 ref|NM_189428.1| Oryza sativa (japonica cultivar-group), predic...
56
1e-04
23 gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...
52
0.002
24 ref|NM_112830.2| Arabidopsis thaliana structural constituent of ...
48
0.032
25 dbj|AB025624.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...
48
0.032
26 gb|L47117.1|PIAEMB7R Picea glauca late embryogenesis abundant pr...
48
0.032
27 ref|XM_471700.1| Oryza sativa (japonica cultivar-group), predic...
46
0.13
28 emb|AJ009934.1|SMAJ9934 Sordaria macrospora SPO76 gene
46
0.13
29 gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl...
44
0.49
30 emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete ...
44
0.49
31 gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple...
44
0.49
32 dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...
44
0.49
33 dbj|AP004785.2| Oryza sativa (japonica cultivar-group) genomic D...
44
0.49
34 gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
44
0.49
35 gb|DQ180309.1| Fragaria x ananassa clone PBCESTFXA4 SSR marker
44
0.49
36 emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1...
44
0.49
37 dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
44
0.49
38 gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
42
2.0
39 ref|XM_512923.1| PREDICTED: Pan troglodytes similar to zinc fing...
42
2.0
40 gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
42
2.0
41 ref|NM_192611.1| Oryza sativa (japonica cultivar-group), predic...
42
2.0
42 ref|XM_472356.1| Oryza sativa (japonica cultivar-group), predic...
42
2.0
43 gb|AF465798.1| Dichroplus elongatus minisatellite A4 sequence
42
2.0
44 gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...
42
2.0
45 gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp...
42
2.0
46 gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge...
42
2.0
47 gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co...
42
2.0
48 gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com...
42
2.0
49 ref|XM_716953.1| Candida albicans SC5314 hypothetical protein (C...
42
2.0
50 ref|XM_716792.1| Candida albicans SC5314 hypothetical protein (C...
42
2.0
51 gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome...
42
2.0
52 gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome...
42
2.0
53 gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosom...
42
2.0
54 gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosom...
42
2.0
55 gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosom...
42
2.0
56 gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
42
2.0
57 gb|AC107806.10| Mus musculus chromosome 3, clone RP23-55C1, comp...
42
2.0
58 gb|AC157320.2| Zea mays clone ZMMBBb-7C14, complete sequence
42
2.0
59 gb|AF173167.3| Pseudomonas alcaligenes putative transposase, put...
42
2.0
60 gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ...
42
2.0
61 emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ...
42
2.0
62 emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos...
42
2.0
63 emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos...
42
2.0
64 emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ...
42
2.0
65 emb|AL731642.3|OSJN00289 Oryza sativa genomic DNA, chromosome 4,...
42
2.0
66 gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosom...
42
2.0
67 dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
42
2.0
68 gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome...
42
2.0
69 gb|AC024580.6| Homo sapiens chromosome 19 clone CTD-2621I17, com...
42
2.0
70 gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
42
2.0
71 gb|AC175391.3| Mus musculus BAC clone RP24-92G16 from chromosome...
42
2.0
72 gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp...
42
2.0
73 gb|AC175672.2| Mus musculus BAC clone RP24-254K21 from chromosom...
42
2.0
74 dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...
42
2.0
75 gb|AF319534.1|AF319534 Neisseria meningitidis strain Z5005 HemO ...
42
2.0
76 gb|AF319532.1|AF319532 Neisseria meningitidis strain GA0929 PqiA...
42
2.0
77 gb|AF319530.1|AF319530 Neisseria meningitidis strain NMB PqiA (p...
42
2.0
78 dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...
42
2.0
79 ref|NM_145722.1| Rattus norvegicus Bartomin (LOC252831), mRNA
42
2.0
80 gb|AC175709.2| Mus musculus BAC clone RP24-7D4 from chromosome y...
42
2.0
81 ref|XM_580236.1| PREDICTED: Rattus norvegicus LOC502067 (LOC5020...
42
2.0
82 dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...
42
2.0
83 dbj|AP006619.1| Nocardia farcinica IFM 10152 plasmid pNF1 DNA, c...
42
2.0
84 dbj|AP003333.4| Oryza sativa (japonica cultivar-group) genomic D...
42
2.0
85 dbj|AP003253.3| Oryza sativa (japonica cultivar-group) genomic D...
42
2.0
86 dbj|AP003682.3| Oryza sativa (japonica cultivar-group) genomic D...
42
2.0
87 dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic D...
42
2.0
88 dbj|AB114606.1| Streptococcus bovis manL, manM, manN, manO, serS...
42
2.0
89 emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right termin...
42
2.0
90 dbj|AK070921.1| Oryza sativa (japonica cultivar-group) cDNA clon...
42
2.0
91 emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp...
42
2.0
92 dbj|AK065876.1| Oryza sativa (japonica cultivar-group) cDNA clon...
42
2.0
93 dbj|AK064665.1| Oryza sativa (japonica cultivar-group) cDNA clon...
42
2.0
94 emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E ...
42
2.0
95 emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left termina...
42
2.0
96 gb|AY961445.1| Phytophthora infestans clone PH019E7 low complexi...
42
2.0
97 gb|AY961443.1| Phytophthora infestans clone PL003F1 low complexi...
42
2.0
98 gb|AY961439.1| Phytophthora infestans clone PD011B9 HAM34-like p...
42
2.0
99 gb|AY961416.1| Phytophthora infestans clone MY-10-B-05 HAM34-lik...
42
2.0
100 gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co...
42
2.0
101 gb|L20696.1|LILMEIOTIN Lilium longiflorum meiotin-1 mRNA, comple...
42
2.0
102 dbj|AB050509.1| Macaca fascicularis brain cDNA, clone:QnpA-13140
42
2.0
103 gb|U02467.1|LLU02467 Lilium longiflorum Enchantment meiotin-1 mR...
42
2.0
104 dbj|AB077475.1| Rattus norvegicus mRNA for barmotin, complete cds
42
2.0
105 gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
40
7.7
106 ref|NM_191195.1| Oryza sativa (japonica cultivar-group), predic...
40
7.7
107 gb|U29382.1| Caenorhabditis elegans cosmid R03H10, complete sequ...
40
7.7
108 gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ...
40
7.7
109 gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
40
7.7
110 gb|AF016429.1| Caenorhabditis elegans cosmid T21H3, complete seq...
40
7.7
111 emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...
40
7.7
112 emb|Z34800.1|CEF45H7 Caenorhabditis elegans Cosmid F45H7, comple...
40
7.7
113 emb|CR718834.2|CNS0GHLK Tetraodon nigroviridis full-length cDNA
40
7.7
114 emb|CR691174.2|CNS0FW9E Tetraodon nigroviridis full-length cDNA
40
7.7
115 gb|AC019210.7| Homo sapiens BAC clone RP11-449G3 from 7, complet...
40
7.7
116 gb|AC011228.9| Homo sapiens BAC clone GS1-18A18 from 7, complete...
40
7.7
117 ref|XM_775289.1| PREDICTED: Strongylocentrotus purpuratus simila...
40
7.7
118 gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
40
7.7
119 gb|AY118620.1| Drosophila melanogaster LP11788 full insert cDNA
40
7.7
120 dbj|AK122767.1| Homo sapiens cDNA FLJ16306 fis, clone PUAEN20039...
40
7.7
121 dbj|AK096935.1| Homo sapiens cDNA FLJ39616 fis, clone SMINT2000541
40
7.7
122 ref|NM_143313.1| Drosophila melanogaster CG5639-RA (CG5639), mRNA
40
7.7
123 ref|NM_137181.1| Drosophila melanogaster PS4 CG16827-RA (alphaPS...
40
7.7
124 dbj|AK139555.1| Mus musculus 2 cells egg cDNA, RIKEN full-length...
40
7.7
125 gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp ...
40
7.7
126 gb|DQ250640.1| Zea mays plastid coproporphyrinogen III oxidase (...
40
7.7
127 gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
40
7.7
128 gb|BC023547.2| Homo sapiens chromosome 12 open reading frame 47,...
40
7.7
129 dbj|AK077594.1| Mus musculus 8 days embryo whole body cDNA, RIKE...
40
7.7
130 gb|AF320027.1|AF320027 Sorghum bicolor heme oxygenase 2 (HO2) mR...
40
7.7
131 gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...
40
7.7
132 gb|BT023104.1| Drosophila melanogaster IP03724 full insert cDNA
40
7.7
133 dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...
40
7.7
134 gb|AC008342.12|AC008342 Drosophila melanogaster, chromosome 2R, ...
40
7.7
135 gb|AC007817.7|AC007817 Drosophila melanogaster, chromosome 3R, r...
40
7.7
136 gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cance...
40
7.7
137 dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic D...
40
7.7
138 gb|AC025716.2| Caenorhabditis elegans cosmid Y39G10AR, complete ...
40
7.7
139 dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic D...
40
7.7
140 dbj|AP004650.2| Oryza sativa (japonica cultivar-group) genomic D...
40
7.7
141 dbj|AK110860.1| Oryza sativa (japonica cultivar-group) cDNA clon...
40
7.7
142 dbj|AK102467.1| Oryza sativa (japonica cultivar-group) cDNA clon...
40
7.7
143 gb|BC041049.1| Homo sapiens mitogen-activated protein kinase-act...
40
7.7
144 gb|AE003761.2| Drosophila melanogaster chromosome 3R, section 99...
40
7.7
145 gb|AE003811.3| Drosophila melanogaster chromosome 2R, section 39...
40
7.7
146 ref|NM_053104.3| Mus musculus RNA binding motif protein 9 (Rbm9)...
40
7.7
147 dbj|AP004982.1| Lotus japonicus genomic DNA, chromosome 6, clone...
40
7.7
148 emb|AL772386.4| Mouse DNA sequence from clone RP23-89G22 on chro...
40
7.7
>dbj|AP008207.1 | Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
sequence
Length = 43261740
Score = 75.8 bits (38), Expect = 1e-10
Identities = 169/212 (79%), Gaps = 3/212 (1%)
Strand = Plus / Plus
Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407
||||||||||||||||||||| || || || |||||| |||||| |||||||| |
Sbjct: 42699435 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 42699494
Query: 408 gggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467
||| |||||||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 42699495 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 42699554
Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527
||||| || || || |||| ||| ||||||||||||||||||||| ||| | |||
Sbjct: 42699555 gcaagcgcaacccca---ccatgagccgcgacttcacctggatccaggccctcggcatcc 42699611
Query: 528 tcttcgatggccaccgcctctacctcggcgcc 559
||||| | ||||||||||||| | ||||||
Sbjct: 42699612 gcttcgccgaccaccgcctctacatgggcgcc 42699643
Score = 69.9 bits (35), Expect = 9e-09
Identities = 115/141 (81%), Gaps = 3/141 (2%)
Strand = Plus / Minus
Query: 415 cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
|||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| |
Sbjct: 42697270 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 42697211
Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
| || || |||| ||| ||||||||||||||||||||| ||| | ||| |||||
Sbjct: 42697210 caacccca---ccatgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 42697154
Query: 535 tggccaccgcctctacctcgg 555
| ||||||||||||| ||||
Sbjct: 42697153 cgaccaccgcctctacatcgg 42697133
Score = 69.9 bits (35), Expect = 9e-09
Identities = 118/145 (81%), Gaps = 3/145 (2%)
Strand = Plus / Minus
Query: 415 cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
|||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| |
Sbjct: 42693169 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 42693110
Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
| || || |||| ||| ||||||||||||||||||||| ||| | ||| |||||
Sbjct: 42693109 caacccca---ccatgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 42693053
Query: 535 tggccaccgcctctacctcggcgcc 559
| ||||||||||||| | ||||||
Sbjct: 42693052 cgaccaccgcctctacatgggcgcc 42693028
Score = 56.0 bits (28), Expect = 1e-04
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 416 gacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471
||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||
Sbjct: 42703655 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 42703710
Score = 44.1 bits (22), Expect = 0.49
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 497 gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556
|||||||||||||||||| || ||| | || ||||| | ||||||||||||| |||||
Sbjct: 42703733 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 42703792
Query: 557 gc 558
||
Sbjct: 42703793 gc 42703794
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 23307672 ccgaagccgaagccgaagccg 23307652
Score = 40.1 bits (20), Expect = 7.7
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 180 agggcccgaagccgaagccgaagc 203
|||| |||||||||||||||||||
Sbjct: 31271041 aggggccgaagccgaagccgaagc 31271018
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 23307705 ccgaagccgaagccgaagcc 23307686
>dbj|AP003448.3 | Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
clone:OJ1656_A11
Length = 148887
Score = 75.8 bits (38), Expect = 1e-10
Identities = 169/212 (79%), Gaps = 3/212 (1%)
Strand = Plus / Plus
Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407
||||||||||||||||||||| || || || |||||| |||||| |||||||| |
Sbjct: 32200 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 32259
Query: 408 gggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467
||| |||||||||| ||||||||||| ||||| ||||||||||| || |||||||
Sbjct: 32260 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 32319
Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527
||||| || || || |||| ||| ||||||||||||||||||||| ||| | |||
Sbjct: 32320 gcaagcgcaacccca---ccatgagccgcgacttcacctggatccaggccctcggcatcc 32376
Query: 528 tcttcgatggccaccgcctctacctcggcgcc 559
||||| | ||||||||||||| | ||||||
Sbjct: 32377 gcttcgccgaccaccgcctctacatgggcgcc 32408
Score = 69.9 bits (35), Expect = 9e-09
Identities = 115/141 (81%), Gaps = 3/141 (2%)
Strand = Plus / Minus
Query: 415 cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
|||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| |
Sbjct: 30035 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 29976
Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
| || || |||| ||| ||||||||||||||||||||| ||| | ||| |||||
Sbjct: 29975 caacccca---ccatgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 29919
Query: 535 tggccaccgcctctacctcgg 555
| ||||||||||||| ||||
Sbjct: 29918 cgaccaccgcctctacatcgg 29898
Score = 69.9 bits (35), Expect = 9e-09
Identities = 118/145 (81%), Gaps = 3/145 (2%)
Strand = Plus / Minus
Query: 415 cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
|||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||| |
Sbjct: 25934 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 25875
Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
| || || |||| ||| ||||||||||||||||||||| ||| | ||| |||||
Sbjct: 25874 caacccca---ccatgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 25818
Query: 535 tggccaccgcctctacctcggcgcc 559
| ||||||||||||| | ||||||
Sbjct: 25817 cgaccaccgcctctacatgggcgcc 25793
Score = 56.0 bits (28), Expect = 1e-04
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 416 gacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471
||||||||| ||||||||||| ||||| ||||||||||| || |||||||||||
Sbjct: 36420 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 36475
Score = 44.1 bits (22), Expect = 0.49
Identities = 52/62 (83%)
Strand = Plus / Plus
Query: 497 gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556
|||||||||||||||||| || ||| | || ||||| | ||||||||||||| |||||
Sbjct: 36498 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 36557
Query: 557 gc 558
||
Sbjct: 36558 gc 36559
>gb|CP000009.1 | Gluconobacter oxydans 621H, complete genome
Length = 2702173
Score = 44.1 bits (22), Expect = 0.49
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 184 cccgaagccgaagccgaagccg 205
||||||||||||||||||||||
Sbjct: 131533 cccgaagccgaagccgaagccg 131512
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131526 ccgaagccgaagccgaagccg 131506
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131520 ccgaagccgaagccgaagccg 131500
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131514 ccgaagccgaagccgaagccg 131494
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131508 ccgaagccgaagccgaagccg 131488
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131502 ccgaagccgaagccgaagccg 131482
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131496 ccgaagccgaagccgaagccg 131476
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131490 ccgaagccgaagccgaagccg 131470
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131484 ccgaagccgaagccgaagccg 131464
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131478 ccgaagccgaagccgaagccg 131458
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131472 ccgaagccgaagccgaagccg 131452
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131466 ccgaagccgaagccgaagccg 131446
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 131460 ccgaagccgaagccgaagccg 131440
>gb|CP000031.1 | Silicibacter pomeroyi DSS-3, complete genome
Length = 4109442
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068848 ccgaagccgaagccgaagccg 4068828
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068842 ccgaagccgaagccgaagccg 4068822
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068836 ccgaagccgaagccgaagccg 4068816
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068830 ccgaagccgaagccgaagccg 4068810
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068824 ccgaagccgaagccgaagccg 4068804
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068818 ccgaagccgaagccgaagccg 4068798
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068812 ccgaagccgaagccgaagccg 4068792
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068806 ccgaagccgaagccgaagccg 4068786
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068800 ccgaagccgaagccgaagccg 4068780
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068794 ccgaagccgaagccgaagccg 4068774
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068788 ccgaagccgaagccgaagccg 4068768
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068782 ccgaagccgaagccgaagccg 4068762
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068776 ccgaagccgaagccgaagccg 4068756
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068770 ccgaagccgaagccgaagccg 4068750
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068764 ccgaagccgaagccgaagccg 4068744
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068758 ccgaagccgaagccgaagccg 4068738
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068752 ccgaagccgaagccgaagccg 4068732
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068746 ccgaagccgaagccgaagccg 4068726
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068740 ccgaagccgaagccgaagccg 4068720
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068734 ccgaagccgaagccgaagccg 4068714
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068728 ccgaagccgaagccgaagccg 4068708
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 4068722 ccgaagccgaagccgaagccg 4068702
>gb|CP000152.1 | Burkholderia sp. 383 chromosome 2, complete sequence
Length = 3587082
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 362855 ccgaagccgaagccgaagccg 362875
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 362849 ccgaagccgaagccgaagccg 362869
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 362843 ccgaagccgaagccgaagccg 362863
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 362837 ccgaagccgaagccgaagccg 362857
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 362831 ccgaagccgaagccgaagccg 362851
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 362825 ccgaagccgaagccgaagccg 362845
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 1271924 ccgaagccgaagccgaagcc 1271943
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 186 cgaagccgaagccgaagccg 205
||||||||||||||||||||
Sbjct: 362820 cgaagccgaagccgaagccg 362839
>gb|CP000143.1 | Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
Length = 3188609
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228981 ccgaagccgaagccgaagccg 2228961
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228975 ccgaagccgaagccgaagccg 2228955
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228969 ccgaagccgaagccgaagccg 2228949
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228963 ccgaagccgaagccgaagccg 2228943
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228957 ccgaagccgaagccgaagccg 2228937
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228951 ccgaagccgaagccgaagccg 2228931
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2228945 ccgaagccgaagccgaagccg 2228925
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 2228939 ccgaagccgaagccgaagcc 2228920
>gb|CP000010.1 | Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
Length = 3510148
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646706 ccgaagccgaagccgaagccg 2646686
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646700 ccgaagccgaagccgaagccg 2646680
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646694 ccgaagccgaagccgaagccg 2646674
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646688 ccgaagccgaagccgaagccg 2646668
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646682 ccgaagccgaagccgaagccg 2646662
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646676 ccgaagccgaagccgaagccg 2646656
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646670 ccgaagccgaagccgaagccg 2646650
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646664 ccgaagccgaagccgaagccg 2646644
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646658 ccgaagccgaagccgaagccg 2646638
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646652 ccgaagccgaagccgaagccg 2646632
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646646 ccgaagccgaagccgaagccg 2646626
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646640 ccgaagccgaagccgaagccg 2646620
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646634 ccgaagccgaagccgaagccg 2646614
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646628 ccgaagccgaagccgaagccg 2646608
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646622 ccgaagccgaagccgaagccg 2646602
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646616 ccgaagccgaagccgaagccg 2646596
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646610 ccgaagccgaagccgaagccg 2646590
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2646604 ccgaagccgaagccgaagccg 2646584
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2474335 ccgaagccgaagccgaagccg 2474355
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2474329 ccgaagccgaagccgaagccg 2474349
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2474323 ccgaagccgaagccgaagccg 2474343
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2474317 ccgaagccgaagccgaagccg 2474337
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1643129 ccgaagccgaagccgaagccg 1643109
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1643123 ccgaagccgaagccgaagccg 1643103
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1643117 ccgaagccgaagccgaagccg 1643097
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 319290 ccgaagccgaagccgaagccg 319310
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 319284 ccgaagccgaagccgaagccg 319304
>gb|CP000125.1 | Burkholderia pseudomallei 1710b chromosome II, complete sequence
Length = 3181762
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2266011 ccgaagccgaagccgaagccg 2266031
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2266005 ccgaagccgaagccgaagccg 2266025
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2265999 ccgaagccgaagccgaagccg 2266019
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2265993 ccgaagccgaagccgaagccg 2266013
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2265987 ccgaagccgaagccgaagccg 2266007
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2265981 ccgaagccgaagccgaagccg 2266001
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2265975 ccgaagccgaagccgaagccg 2265995
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2038161 ccgaagccgaagccgaagccg 2038181
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2038155 ccgaagccgaagccgaagccg 2038175
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2038149 ccgaagccgaagccgaagccg 2038169
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2038143 ccgaagccgaagccgaagccg 2038163
>gb|CP000124.1 | Burkholderia pseudomallei 1710b chromosome I, complete sequence
Length = 4126292
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854397 ccgaagccgaagccgaagccg 3854377
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854391 ccgaagccgaagccgaagccg 3854371
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854385 ccgaagccgaagccgaagccg 3854365
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854379 ccgaagccgaagccgaagccg 3854359
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854373 ccgaagccgaagccgaagccg 3854353
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854367 ccgaagccgaagccgaagccg 3854347
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854361 ccgaagccgaagccgaagccg 3854341
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854355 ccgaagccgaagccgaagccg 3854335
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854349 ccgaagccgaagccgaagccg 3854329
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854343 ccgaagccgaagccgaagccg 3854323
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854337 ccgaagccgaagccgaagccg 3854317
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854331 ccgaagccgaagccgaagccg 3854311
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854325 ccgaagccgaagccgaagccg 3854305
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3854319 ccgaagccgaagccgaagccg 3854299
Score = 42.1 bits (21), Expect = 2.0
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 181 gggcccgaagccgaagccgaagccg 205
|||| ||||||||||||||||||||
Sbjct: 3764163 gggcgcgaagccgaagccgaagccg 3764139
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3764153 ccgaagccgaagccgaagccg 3764133
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3764147 ccgaagccgaagccgaagccg 3764127
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3711596 ccgaagccgaagccgaagccg 3711576
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3711590 ccgaagccgaagccgaagccg 3711570
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3711584 ccgaagccgaagccgaagccg 3711564
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3711578 ccgaagccgaagccgaagccg 3711558
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3711572 ccgaagccgaagccgaagccg 3711552
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889993 ccgaagccgaagccgaagccg 2889973
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889987 ccgaagccgaagccgaagccg 2889967
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889981 ccgaagccgaagccgaagccg 2889961
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889975 ccgaagccgaagccgaagccg 2889955
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889969 ccgaagccgaagccgaagccg 2889949
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889963 ccgaagccgaagccgaagccg 2889943
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889957 ccgaagccgaagccgaagccg 2889937
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889951 ccgaagccgaagccgaagccg 2889931
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889945 ccgaagccgaagccgaagccg 2889925
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889939 ccgaagccgaagccgaagccg 2889919
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889933 ccgaagccgaagccgaagccg 2889913
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889927 ccgaagccgaagccgaagccg 2889907
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889921 ccgaagccgaagccgaagccg 2889901
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889915 ccgaagccgaagccgaagccg 2889895
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889909 ccgaagccgaagccgaagccg 2889889
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889903 ccgaagccgaagccgaagccg 2889883
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2889897 ccgaagccgaagccgaagccg 2889877
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1659510 ccgaagccgaagccgaagccg 1659530
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050295 ccgaagccgaagccgaagccg 1050315
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050289 ccgaagccgaagccgaagccg 1050309
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050283 ccgaagccgaagccgaagccg 1050303
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050277 ccgaagccgaagccgaagccg 1050297
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050271 ccgaagccgaagccgaagccg 1050291
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050265 ccgaagccgaagccgaagccg 1050285
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050259 ccgaagccgaagccgaagccg 1050279
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050253 ccgaagccgaagccgaagccg 1050273
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050247 ccgaagccgaagccgaagccg 1050267
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050241 ccgaagccgaagccgaagccg 1050261
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050235 ccgaagccgaagccgaagccg 1050255
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050229 ccgaagccgaagccgaagccg 1050249
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050223 ccgaagccgaagccgaagccg 1050243
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1050217 ccgaagccgaagccgaagccg 1050237
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 342297 ccgaagccgaagccgaagccg 342317
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 186 cgaagccgaagccgaagccg 205
||||||||||||||||||||
Sbjct: 1659505 cgaagccgaagccgaagccg 1659524
>gb|AF173167.3 | Pseudomonas alcaligenes putative transposase, putative transposase,
gentisate 1,2-dioxygenase (xlnE), xlnF, hypothetical
protein (xlnG), hypothetical protein (xlnH), xlnI,
probable 3-hydroxybenzoate 6-hydroxylase (xlnD),
transposase subunit (tnpA1), transposase subunit (tnpA2),
transposase subunit, and putative transposase genes,
complete cds
Length = 12161
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2704 ccgaagccgaagccgaagccg 2684
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2698 ccgaagccgaagccgaagccg 2678
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2692 ccgaagccgaagccgaagccg 2672
>gb|CP000090.1 | Ralstonia eutropha JMP134 chromosome 1, complete sequence
Length = 3806533
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559771 ccgaagccgaagccgaagccg 1559791
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559765 ccgaagccgaagccgaagccg 1559785
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559759 ccgaagccgaagccgaagccg 1559779
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559753 ccgaagccgaagccgaagccg 1559773
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559747 ccgaagccgaagccgaagccg 1559767
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559741 ccgaagccgaagccgaagccg 1559761
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559735 ccgaagccgaagccgaagccg 1559755
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559729 ccgaagccgaagccgaagccg 1559749
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559723 ccgaagccgaagccgaagccg 1559743
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559717 ccgaagccgaagccgaagccg 1559737
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559711 ccgaagccgaagccgaagccg 1559731
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559705 ccgaagccgaagccgaagccg 1559725
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559699 ccgaagccgaagccgaagccg 1559719
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559693 ccgaagccgaagccgaagccg 1559713
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559687 ccgaagccgaagccgaagccg 1559707
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559681 ccgaagccgaagccgaagccg 1559701
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559675 ccgaagccgaagccgaagccg 1559695
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559669 ccgaagccgaagccgaagccg 1559689
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559663 ccgaagccgaagccgaagccg 1559683
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559657 ccgaagccgaagccgaagccg 1559677
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559651 ccgaagccgaagccgaagccg 1559671
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559645 ccgaagccgaagccgaagccg 1559665
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559639 ccgaagccgaagccgaagccg 1559659
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559633 ccgaagccgaagccgaagccg 1559653
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559627 ccgaagccgaagccgaagccg 1559647
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559621 ccgaagccgaagccgaagccg 1559641
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559615 ccgaagccgaagccgaagccg 1559635
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559609 ccgaagccgaagccgaagccg 1559629
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559603 ccgaagccgaagccgaagccg 1559623
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559597 ccgaagccgaagccgaagccg 1559617
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559591 ccgaagccgaagccgaagccg 1559611
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559585 ccgaagccgaagccgaagccg 1559605
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559579 ccgaagccgaagccgaagccg 1559599
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1559573 ccgaagccgaagccgaagccg 1559593
>emb|BX571966.1 | Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
Length = 3173005
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2533007 ccgaagccgaagccgaagccg 2532987
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2162137 ccgaagccgaagccgaagccg 2162157
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2162131 ccgaagccgaagccgaagccg 2162151
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 734584 ccgaagccgaagccgaagccg 734604
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 427368 ccgaagccgaagccgaagccg 427388
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 427362 ccgaagccgaagccgaagccg 427382
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 427356 ccgaagccgaagccgaagccg 427376
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 427350 ccgaagccgaagccgaagccg 427370
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 199728 ccgaagccgaagccgaagccg 199748
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 199722 ccgaagccgaagccgaagccg 199742
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 186 cgaagccgaagccgaagccg 205
||||||||||||||||||||
Sbjct: 2533012 cgaagccgaagccgaagccg 2532993
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 2533001 ccgaagccgaagccgaagcc 2532982
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 186 cgaagccgaagccgaagccg 205
||||||||||||||||||||
Sbjct: 734579 cgaagccgaagccgaagccg 734598
>emb|BX571965.1 | Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
Length = 4074542
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451904 ccgaagccgaagccgaagccg 3451884
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451898 ccgaagccgaagccgaagccg 3451878
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451892 ccgaagccgaagccgaagccg 3451872
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451886 ccgaagccgaagccgaagccg 3451866
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451880 ccgaagccgaagccgaagccg 3451860
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451874 ccgaagccgaagccgaagccg 3451854
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451868 ccgaagccgaagccgaagccg 3451848
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3451862 ccgaagccgaagccgaagccg 3451842
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620085 ccgaagccgaagccgaagccg 2620065
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620079 ccgaagccgaagccgaagccg 2620059
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620073 ccgaagccgaagccgaagccg 2620053
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620067 ccgaagccgaagccgaagccg 2620047
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620061 ccgaagccgaagccgaagccg 2620041
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620055 ccgaagccgaagccgaagccg 2620035
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620049 ccgaagccgaagccgaagccg 2620029
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620043 ccgaagccgaagccgaagccg 2620023
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2620037 ccgaagccgaagccgaagccg 2620017
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1546493 ccgaagccgaagccgaagccg 1546513
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1546487 ccgaagccgaagccgaagccg 1546507
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 931261 ccgaagccgaagccgaagccg 931281
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 931255 ccgaagccgaagccgaagccg 931275
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 931249 ccgaagccgaagccgaagccg 931269
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 931243 ccgaagccgaagccgaagccg 931263
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 931237 ccgaagccgaagccgaagccg 931257
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 931231 ccgaagccgaagccgaagccg 931251
>emb|AL939110.1 |SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29
Length = 283100
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 275026 ccgaagccgaagccgaagccg 275006
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 275020 ccgaagccgaagccgaagccg 275000
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 275014 ccgaagccgaagccgaagccg 274994
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 275008 ccgaagccgaagccgaagccg 274988
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 275002 ccgaagccgaagccgaagccg 274982
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274996 ccgaagccgaagccgaagccg 274976
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274990 ccgaagccgaagccgaagccg 274970
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274984 ccgaagccgaagccgaagccg 274964
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274978 ccgaagccgaagccgaagccg 274958
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274972 ccgaagccgaagccgaagccg 274952
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274966 ccgaagccgaagccgaagccg 274946
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274960 ccgaagccgaagccgaagccg 274940
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274954 ccgaagccgaagccgaagccg 274934
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274948 ccgaagccgaagccgaagccg 274928
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 274942 ccgaagccgaagccgaagccg 274922
>gb|CP000011.2 | Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
Length = 2325379
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2125227 ccgaagccgaagccgaagccg 2125207
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2125221 ccgaagccgaagccgaagccg 2125201
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2125215 ccgaagccgaagccgaagccg 2125195
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2125209 ccgaagccgaagccgaagccg 2125189
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2125203 ccgaagccgaagccgaagccg 2125183
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2125197 ccgaagccgaagccgaagccg 2125177
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1561056 ccgaagccgaagccgaagccg 1561036
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1561050 ccgaagccgaagccgaagccg 1561030
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1561044 ccgaagccgaagccgaagccg 1561024
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 1561038 ccgaagccgaagccgaagccg 1561018
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 229978 ccgaagccgaagccgaagccg 229998
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 229972 ccgaagccgaagccgaagccg 229992
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 229966 ccgaagccgaagccgaagccg 229986
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 229984 ccgaagccgaagccgaagcc 230003
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 186 cgaagccgaagccgaagccg 205
||||||||||||||||||||
Sbjct: 229961 cgaagccgaagccgaagccg 229980
>dbj|BA000030.2 | Streptomyces avermitilis MA-4680 genomic DNA, complete genome
Length = 9025608
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052403 ccgaagccgaagccgaagccg 2052383
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052397 ccgaagccgaagccgaagccg 2052377
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052391 ccgaagccgaagccgaagccg 2052371
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052385 ccgaagccgaagccgaagccg 2052365
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052379 ccgaagccgaagccgaagccg 2052359
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052373 ccgaagccgaagccgaagccg 2052353
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2052367 ccgaagccgaagccgaagccg 2052347
Score = 40.1 bits (20), Expect = 7.7
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 186 cgaagccgaagccgaagccggcga 209
||||||||||||||| ||||||||
Sbjct: 4093684 cgaagccgaagccgaggccggcga 4093661
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 2052361 ccgaagccgaagccgaagcc 2052342
>dbj|AB114606.1 | Streptococcus bovis manL, manM, manN, manO, serS genes for
mannose-specific phosphotransferase syste component
IIAB, mannose-specific phosphotransferase system
component IIC, mannose-specific phosphotransferase
system component IID, hypothetical protein, seryl-tRNA
synthetase, partial and complete sequence
Length = 5428
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 455 gcgcatttcatcggcaagagc 475
|||||||||||||||||||||
Sbjct: 489 gcgcatttcatcggcaagagc 469
>emb|CT573326.1 | Pseudomonas entomophila str. L48 chromosome,complete sequence
Length = 5888780
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430310 ccgaagccgaagccgaagccg 3430290
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430304 ccgaagccgaagccgaagccg 3430284
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430298 ccgaagccgaagccgaagccg 3430278
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430292 ccgaagccgaagccgaagccg 3430272
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430286 ccgaagccgaagccgaagccg 3430266
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430280 ccgaagccgaagccgaagccg 3430260
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430274 ccgaagccgaagccgaagccg 3430254
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430268 ccgaagccgaagccgaagccg 3430248
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430262 ccgaagccgaagccgaagccg 3430242
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430256 ccgaagccgaagccgaagccg 3430236
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430250 ccgaagccgaagccgaagccg 3430230
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430244 ccgaagccgaagccgaagccg 3430224
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430238 ccgaagccgaagccgaagccg 3430218
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430232 ccgaagccgaagccgaagccg 3430212
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430226 ccgaagccgaagccgaagccg 3430206
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430220 ccgaagccgaagccgaagccg 3430200
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430214 ccgaagccgaagccgaagccg 3430194
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430208 ccgaagccgaagccgaagccg 3430188
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430202 ccgaagccgaagccgaagccg 3430182
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430196 ccgaagccgaagccgaagccg 3430176
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 3430190 ccgaagccgaagccgaagccg 3430170
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2488108 ccgaagccgaagccgaagccg 2488128
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2488102 ccgaagccgaagccgaagccg 2488122
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2488096 ccgaagccgaagccgaagccg 2488116
Score = 42.1 bits (21), Expect = 2.0
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagccg 205
|||||||||||||||||||||
Sbjct: 2488090 ccgaagccgaagccgaagccg 2488110
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 3430184 ccgaagccgaagccgaagcc 3430165
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 185 ccgaagccgaagccgaagcc 204
||||||||||||||||||||
Sbjct: 2488114 ccgaagccgaagccgaagcc 2488133
>emb|AL772386.4 | Mouse DNA sequence from clone RP23-89G22 on chromosome 15, complete
sequence
Length = 149807
Score = 40.1 bits (20), Expect = 7.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 187 gaagccgaagccgaagccgg 206
||||||||||||||||||||
Sbjct: 117840 gaagccgaagccgaagccgg 117859
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,927,888
Number of Sequences: 3902068
Number of extensions: 3927888
Number of successful extensions: 83545
Number of sequences better than 10.0: 148
Number of HSP's better than 10.0 without gapping: 154
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79935
Number of HSP's gapped (non-prelim): 3506
length of query: 569
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 546
effective length of database: 17,143,297,704
effective search space: 9360240546384
effective search space used: 9360240546384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)