ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name bart34a12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB021176.1| Zea mays ZmRCP2 mRNA for root cap protein 2, com... 264 3e-67
2gb|AF134579.1|AF134579 Zea mays clone AGPZm1 arabinogalactan pro... 230 4e-57
3gb|AC120307.3| Oryza sativa (japonica cultivar-group) chromosome... 212 9e-52
4gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosom... 212 9e-52
5dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 212 9e-52
6dbj|AK106826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 9e-52
7gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 212 9e-52
8gb|AY111354.1| Zea mays CL1277_1 mRNA sequence 204 2e-49
9ref|NM_189426.1| Oryza sativa (japonica cultivar-group), predic... 76 1e-10
10dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
11dbj|AP003448.3| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
12ref|XM_472395.1| Oryza sativa (japonica cultivar-group), predic... 72 2e-09
13emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,... 72 2e-09
14dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 72 2e-09
15dbj|AK108077.1| Oryza sativa (japonica cultivar-group) cDNA clon... 72 2e-09
16ref|NM_189425.1| Oryza sativa (japonica cultivar-group), predic... 70 9e-09
17ref|NM_189423.1| Oryza sativa (japonica cultivar-group), predic... 70 9e-09
18dbj|AK122054.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 1e-07
19gb|AC129716.3| Oryza sativa (japonica cultivar-group) chromosome... 62 2e-06
20dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 62 2e-06
21dbj|AB021175.1| Zea mays ZmRCP1 mRNA for root cap protein 1, com... 58 3e-05
22ref|NM_189428.1| Oryza sativa (japonica cultivar-group), predic... 56 1e-04
23gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 52 0.002
24ref|NM_112830.2| Arabidopsis thaliana structural constituent of ... 48 0.032
25dbj|AB025624.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 48 0.032
26gb|L47117.1|PIAEMB7R Picea glauca late embryogenesis abundant pr... 48 0.032
27ref|XM_471700.1| Oryza sativa (japonica cultivar-group), predic... 46 0.13
28emb|AJ009934.1|SMAJ9934 Sordaria macrospora SPO76 gene 46 0.13
29gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 44 0.49
30emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete ... 44 0.49
31gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 44 0.49
32dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.49
33dbj|AP004785.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.49
34gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 44 0.49
35gb|DQ180309.1| Fragaria x ananassa clone PBCESTFXA4 SSR marker 44 0.49
36emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 44 0.49
37dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 44 0.49
38gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 42 2.0
39ref|XM_512923.1| PREDICTED: Pan troglodytes similar to zinc fing... 42 2.0
40gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 42 2.0
41ref|NM_192611.1| Oryza sativa (japonica cultivar-group), predic... 42 2.0
42ref|XM_472356.1| Oryza sativa (japonica cultivar-group), predic... 42 2.0
43gb|AF465798.1| Dichroplus elongatus minisatellite A4 sequence 42 2.0
44gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 42 2.0
45gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 42 2.0
46gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 42 2.0
47gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 42 2.0
48gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 42 2.0
49ref|XM_716953.1| Candida albicans SC5314 hypothetical protein (C... 42 2.0
50ref|XM_716792.1| Candida albicans SC5314 hypothetical protein (C... 42 2.0
51gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome... 42 2.0
52gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome... 42 2.0
53gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosom... 42 2.0
54gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosom... 42 2.0
55gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosom... 42 2.0
56gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 42 2.0
57gb|AC107806.10| Mus musculus chromosome 3, clone RP23-55C1, comp... 42 2.0
58gb|AC157320.2| Zea mays clone ZMMBBb-7C14, complete sequence 42 2.0
59gb|AF173167.3| Pseudomonas alcaligenes putative transposase, put... 42 2.0
60gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 42 2.0
61emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 42 2.0
62emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromos... 42 2.0
63emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 42 2.0
64emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete ... 42 2.0
65emb|AL731642.3|OSJN00289 Oryza sativa genomic DNA, chromosome 4,... 42 2.0
66gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosom... 42 2.0
67dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 42 2.0
68gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome... 42 2.0
69gb|AC024580.6| Homo sapiens chromosome 19 clone CTD-2621I17, com... 42 2.0
70gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 42 2.0
71gb|AC175391.3| Mus musculus BAC clone RP24-92G16 from chromosome... 42 2.0
72gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 42 2.0
73gb|AC175672.2| Mus musculus BAC clone RP24-254K21 from chromosom... 42 2.0
74dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
75gb|AF319534.1|AF319534 Neisseria meningitidis strain Z5005 HemO ... 42 2.0
76gb|AF319532.1|AF319532 Neisseria meningitidis strain GA0929 PqiA... 42 2.0
77gb|AF319530.1|AF319530 Neisseria meningitidis strain NMB PqiA (p... 42 2.0
78dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 2.0
79ref|NM_145722.1| Rattus norvegicus Bartomin (LOC252831), mRNA 42 2.0
80gb|AC175709.2| Mus musculus BAC clone RP24-7D4 from chromosome y... 42 2.0
81ref|XM_580236.1| PREDICTED: Rattus norvegicus LOC502067 (LOC5020... 42 2.0
82dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 42 2.0
83dbj|AP006619.1| Nocardia farcinica IFM 10152 plasmid pNF1 DNA, c... 42 2.0
84dbj|AP003333.4| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
85dbj|AP003253.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
86dbj|AP003682.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
87dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
88dbj|AB114606.1| Streptococcus bovis manL, manM, manN, manO, serS... 42 2.0
89emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right termin... 42 2.0
90dbj|AK070921.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
91emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 2.0
92dbj|AK065876.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
93dbj|AK064665.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
94emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E ... 42 2.0
95emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left termina... 42 2.0
96gb|AY961445.1| Phytophthora infestans clone PH019E7 low complexi... 42 2.0
97gb|AY961443.1| Phytophthora infestans clone PL003F1 low complexi... 42 2.0
98gb|AY961439.1| Phytophthora infestans clone PD011B9 HAM34-like p... 42 2.0
99gb|AY961416.1| Phytophthora infestans clone MY-10-B-05 HAM34-lik... 42 2.0
100gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 2.0
101gb|L20696.1|LILMEIOTIN Lilium longiflorum meiotin-1 mRNA, comple... 42 2.0
102dbj|AB050509.1| Macaca fascicularis brain cDNA, clone:QnpA-13140 42 2.0
103gb|U02467.1|LLU02467 Lilium longiflorum Enchantment meiotin-1 mR... 42 2.0
104dbj|AB077475.1| Rattus norvegicus mRNA for barmotin, complete cds 42 2.0
105gb|CP000148.1| Geobacter metallireducens GS-15, complete genome 40 7.7
106ref|NM_191195.1| Oryza sativa (japonica cultivar-group), predic... 40 7.7
107gb|U29382.1| Caenorhabditis elegans cosmid R03H10, complete sequ... 40 7.7
108gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete ... 40 7.7
109gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 40 7.7
110gb|AF016429.1| Caenorhabditis elegans cosmid T21H3, complete seq... 40 7.7
111emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 7.7
112emb|Z34800.1|CEF45H7 Caenorhabditis elegans Cosmid F45H7, comple... 40 7.7
113emb|CR718834.2|CNS0GHLK Tetraodon nigroviridis full-length cDNA 40 7.7
114emb|CR691174.2|CNS0FW9E Tetraodon nigroviridis full-length cDNA 40 7.7
115gb|AC019210.7| Homo sapiens BAC clone RP11-449G3 from 7, complet... 40 7.7
116gb|AC011228.9| Homo sapiens BAC clone GS1-18A18 from 7, complete... 40 7.7
117ref|XM_775289.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.7
118gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 7.7
119gb|AY118620.1| Drosophila melanogaster LP11788 full insert cDNA 40 7.7
120dbj|AK122767.1| Homo sapiens cDNA FLJ16306 fis, clone PUAEN20039... 40 7.7
121dbj|AK096935.1| Homo sapiens cDNA FLJ39616 fis, clone SMINT2000541 40 7.7
122ref|NM_143313.1| Drosophila melanogaster CG5639-RA (CG5639), mRNA 40 7.7
123ref|NM_137181.1| Drosophila melanogaster PS4 CG16827-RA (alphaPS... 40 7.7
124dbj|AK139555.1| Mus musculus 2 cells egg cDNA, RIKEN full-length... 40 7.7
125gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp ... 40 7.7
126gb|DQ250640.1| Zea mays plastid coproporphyrinogen III oxidase (... 40 7.7
127gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 7.7
128gb|BC023547.2| Homo sapiens chromosome 12 open reading frame 47,... 40 7.7
129dbj|AK077594.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 7.7
130gb|AF320027.1|AF320027 Sorghum bicolor heme oxygenase 2 (HO2) mR... 40 7.7
131gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 7.7
132gb|BT023104.1| Drosophila melanogaster IP03724 full insert cDNA 40 7.7
133dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
134gb|AC008342.12|AC008342 Drosophila melanogaster, chromosome 2R, ... 40 7.7
135gb|AC007817.7|AC007817 Drosophila melanogaster, chromosome 3R, r... 40 7.7
136gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cance... 40 7.7
137dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
138gb|AC025716.2| Caenorhabditis elegans cosmid Y39G10AR, complete ... 40 7.7
139dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
140dbj|AP004650.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.7
141dbj|AK110860.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.7
142dbj|AK102467.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.7
143gb|BC041049.1| Homo sapiens mitogen-activated protein kinase-act... 40 7.7
144gb|AE003761.2| Drosophila melanogaster chromosome 3R, section 99... 40 7.7
145gb|AE003811.3| Drosophila melanogaster chromosome 2R, section 39... 40 7.7
146ref|NM_053104.3| Mus musculus RNA binding motif protein 9 (Rbm9)... 40 7.7
147dbj|AP004982.1| Lotus japonicus genomic DNA, chromosome 6, clone... 40 7.7
148emb|AL772386.4| Mouse DNA sequence from clone RP23-89G22 on chro... 40 7.7

>dbj|AB021176.1| Zea mays ZmRCP2 mRNA for root cap protein 2, complete cds
          Length = 1318

 Score =  264 bits (133), Expect = 3e-67
 Identities = 262/305 (85%)
 Strand = Plus / Plus

                                                                       
Query: 263 atggactgccccgccaactgcccccagtcctgctacccagactgcaacacatgcaaaccc 322
           ||||| ||||||||| | ||  ||||||| |||||| | ||||||| | | |||||||||
Sbjct: 274 atggagtgccccgccgagtgttcccagtcatgctacgccgactgcagctcctgcaaaccc 333

                                                                       
Query: 323 gtctgcgtgtgcaacaccccaggggcgtgcggcgacccgcggttcattggtggtgatggc 382
           ||||||||||||| |   || |||||||||||||||||||| ||||| || || || |||
Sbjct: 334 gtctgcgtgtgcagcgtgccgggggcgtgcggcgacccgcgcttcatcggcggcgacggc 393

                                                                       
Query: 383 aacgccttctatttccacggacgcagggatgccgacttctgcgtcgtctccgaccgtgac 442
           ||||||||||| |||||||| ||| |||| ||||||||||||||  |||||||||| |||
Sbjct: 394 aacgccttctacttccacggccgccgggacgccgacttctgcgtgctctccgaccgcgac 453

                                                                       
Query: 443 cttcacatcaacgcgcatttcatcggcaagagcggccacagcggcatgtcccgggacttc 502
           || |||||||||||||| ||||||||||||  ||||  |  |||||||||||||||||||
Sbjct: 454 ctccacatcaacgcgcacttcatcggcaagcacggcgccgacggcatgtcccgggacttc 513

                                                                       
Query: 503 acctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggcgccagg 562
           || |||||||||||||||||||| |||||||| ||||||   |||||| |||||||||||
Sbjct: 514 acgtggatccaggccatcgccgtgctcttcgacggccacgagctctacgtcggcgccagg 573

                
Query: 563 aagac 567
           |||||
Sbjct: 574 aagac 578



to top

>gb|AF134579.1|AF134579 Zea mays clone AGPZm1 arabinogalactan protein (agp) mRNA, partial
           cds
          Length = 825

 Score =  230 bits (116), Expect = 4e-57
 Identities = 197/224 (87%)
 Strand = Plus / Plus

                                                                       
Query: 344 ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403
           |||||||||||||||||||| ||||| || || || |||||||||||||| |||||||| 
Sbjct: 5   ggggcgtgcggcgacccgcgcttcatcggcggcgacggcaacgccttctacttccacggc 64

                                                                       
Query: 404 cgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463
           ||| |||| ||||||||||||||  |||||||||| ||||| |||||||||||||| |||
Sbjct: 65  cgccgggacgccgacttctgcgtgctctccgaccgcgacctccacatcaacgcgcacttc 124

                                                                       
Query: 464 atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523
           |||||||||  ||||  |  ||||||||||||||||||||| ||||||||||||||||||
Sbjct: 125 atcggcaagcacggcgccgacggcatgtcccgggacttcacgtggatccaggccatcgcc 184

                                                       
Query: 524 gtcctcttcgatggccaccgcctctacctcggcgccaggaagac 567
           || |||||||| ||||||   |||||| ||||||||||||||||
Sbjct: 185 gtgctcttcgacggccacgagctctacgtcggcgccaggaagac 228



to top

>gb|AC120307.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0074E19
              map R1938, complete sequence
          Length = 160847

 Score =  212 bits (107), Expect = 9e-52
 Identities = 170/191 (89%)
 Strand = Plus / Plus

                                                                          
Query: 344    ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403
              |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || 
Sbjct: 138467 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 138526

                                                                          
Query: 404    cgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463
              || ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 138527 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 138586

                                                                          
Query: 464    atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523
              ||||||||| |||||  |  ||||||||| || ||||||||||||||||||||||| |||
Sbjct: 138587 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 138646

                         
Query: 524    gtcctcttcga 534
              |||||||||||
Sbjct: 138647 gtcctcttcga 138657



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                              
Query: 538    ccaccgcctctacctcggcgccaggaagaccg 569
              ||||||||||||| ||||||||||||||||||
Sbjct: 138670 ccaccgcctctacgtcggcgccaggaagaccg 138701



to top

>gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0040B10 map R2918, complete sequence
          Length = 149132

 Score =  212 bits (107), Expect = 9e-52
 Identities = 170/191 (89%)
 Strand = Plus / Plus

                                                                         
Query: 344   ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403
             |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || 
Sbjct: 14610 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 14669

                                                                         
Query: 404   cgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463
             || ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 14670 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 14729

                                                                         
Query: 464   atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523
             ||||||||| |||||  |  ||||||||| || ||||||||||||||||||||||| |||
Sbjct: 14730 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 14789

                        
Query: 524   gtcctcttcga 534
             |||||||||||
Sbjct: 14790 gtcctcttcga 14800



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                             
Query: 538   ccaccgcctctacctcggcgccaggaagaccg 569
             ||||||||||||| ||||||||||||||||||
Sbjct: 14813 ccaccgcctctacgtcggcgccaggaagaccg 14844



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  212 bits (107), Expect = 9e-52
 Identities = 170/191 (89%)
 Strand = Plus / Plus

                                                                           
Query: 344     ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403
               |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || 
Sbjct: 2362468 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 2362527

                                                                           
Query: 404     cgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463
               || ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 2362528 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 2362587

                                                                           
Query: 464     atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523
               ||||||||| |||||  |  ||||||||| || ||||||||||||||||||||||| |||
Sbjct: 2362588 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 2362647

                          
Query: 524     gtcctcttcga 534
               |||||||||||
Sbjct: 2362648 gtcctcttcga 2362658



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                               
Query: 538     ccaccgcctctacctcggcgccaggaagaccg 569
               ||||||||||||| ||||||||||||||||||
Sbjct: 2362671 ccaccgcctctacgtcggcgccaggaagaccg 2362702



to top

>dbj|AK106826.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-116-E12, full
            insert sequence
          Length = 1747

 Score =  212 bits (107), Expect = 9e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                        
Query: 344  ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403
            |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || 
Sbjct: 1593 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 1534

                                                                        
Query: 404  cgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463
            || ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 1533 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 1474

                                                                        
Query: 464  atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523
            ||||||||| |||||  |  ||||||||| || ||||||||||||||||||||||| |||
Sbjct: 1473 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 1414

                       
Query: 524  gtcctcttcga 534
            |||||||||||
Sbjct: 1413 gtcctcttcga 1403



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 538  ccaccgcctctacctcggcgccaggaagaccg 569
            ||||||||||||| ||||||||||||||||||
Sbjct: 1390 ccaccgcctctacgtcggcgccaggaagaccg 1359



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  212 bits (107), Expect = 9e-52
 Identities = 170/191 (89%)
 Strand = Plus / Plus

                                                                           
Query: 344     ggggcgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacgga 403
               |||||||||||||||||| ||||||| || || || |||||||||||||| ||||| || 
Sbjct: 2370249 ggggcgtgcggcgacccgaggttcatcggcggcgacggcaacgccttctacttccatggc 2370308

                                                                           
Query: 404     cgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttc 463
               || ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 2370309 cggagggacgccgacttctgcgtcgtctccgaccgcgacctccacatcaacgcgcacttc 2370368

                                                                           
Query: 464     atcggcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgcc 523
               ||||||||| |||||  |  ||||||||| || ||||||||||||||||||||||| |||
Sbjct: 2370369 atcggcaagcgcggcgccgacggcatgtcgcgcgacttcacctggatccaggccattgcc 2370428

                          
Query: 524     gtcctcttcga 534
               |||||||||||
Sbjct: 2370429 gtcctcttcga 2370439



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                               
Query: 538     ccaccgcctctacctcggcgccaggaagaccg 569
               ||||||||||||| ||||||||||||||||||
Sbjct: 2370452 ccaccgcctctacgtcggcgccaggaagaccg 2370483



to top

>gb|AY111354.1| Zea mays CL1277_1 mRNA sequence
          Length = 1328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 225/269 (83%)
 Strand = Plus / Plus

                                                                       
Query: 263 atggactgccccgccaactgcccccagtcctgctacccagactgcaacacatgcaaaccc 322
           ||||| ||||||||| | ||  ||||||| |||||| | ||||||| | | |||||||||
Sbjct: 274 atggagtgccccgccgagtgttcccagtcatgctacgccgactgcagctcctgcaaaccc 333

                                                                       
Query: 323 gtctgcgtgtgcaacaccccaggggcgtgcggcgacccgcggttcattggtggtgatggc 382
           ||||||||||||      ||     |||||||||||||||| ||||| || || || |||
Sbjct: 334 gtctgcgtgtgcnnnnngccnnnnncgtgcggcgacccgcgcttcatcggcggcgacggc 393

                                                                       
Query: 383 aacgccttctatttccacggacgcagggatgccgacttctgcgtcgtctccgaccgtgac 442
           ||||||||||| |||||||| ||| |||| ||||||||||||||  |||||||||| |||
Sbjct: 394 aacgccttctacttccacggccgccgggacgccgacttctgcgtgctctccgaccgcgac 453

                                                                       
Query: 443 cttcacatcaacgcgcatttcatcggcaagagcggccacagcggcatgtcccgggacttc 502
           || |||||||||||||| ||||||||||||  ||||  |  |||||||||||||||||||
Sbjct: 454 ctccacatcaacgcgcacttcatcggcaagcacggcgccgacggcatgtcccgggacttc 513

                                        
Query: 503 acctggatccaggccatcgccgtcctctt 531
           || |||||||||||||||||||| |||||
Sbjct: 514 acgtggatccaggccatcgccgtgctctt 542



to top

>ref|NM_189426.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 993

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 169/212 (79%), Gaps = 3/212 (1%)
 Strand = Plus / Plus

                                                                       
Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407
           |||||||||||||||||||||  || || || ||||||  |||||| ||||||||    |
Sbjct: 296 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 355

                                                                       
Query: 408 gggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467
            |||   |||||||||| |||||||||||   ||||| ||||||||||| || |||||||
Sbjct: 356 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 415

                                                                       
Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527
           ||||| ||  || ||    ||||  ||| ||||||||||||||||||||| ||| | |||
Sbjct: 416 gcaagcgcaacccca---ccatgagccgcgacttcacctggatccaggccctcggcatcc 472

                                           
Query: 528 tcttcgatggccaccgcctctacctcggcgcc 559
            |||||  | ||||||||||||| | ||||||
Sbjct: 473 gcttcgccgaccaccgcctctacatgggcgcc 504



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 169/212 (79%), Gaps = 3/212 (1%)
 Strand = Plus / Plus

                                                                            
Query: 348      cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407
                |||||||||||||||||||||  || || || ||||||  |||||| ||||||||    |
Sbjct: 42699435 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 42699494

                                                                            
Query: 408      gggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467
                 |||   |||||||||| |||||||||||   ||||| ||||||||||| || |||||||
Sbjct: 42699495 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 42699554

                                                                            
Query: 468      gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527
                ||||| ||  || ||    ||||  ||| ||||||||||||||||||||| ||| | |||
Sbjct: 42699555 gcaagcgcaacccca---ccatgagccgcgacttcacctggatccaggccctcggcatcc 42699611

                                                
Query: 528      tcttcgatggccaccgcctctacctcggcgcc 559
                 |||||  | ||||||||||||| | ||||||
Sbjct: 42699612 gcttcgccgaccaccgcctctacatgggcgcc 42699643



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 115/141 (81%), Gaps = 3/141 (2%)
 Strand = Plus / Minus

                                                                            
Query: 415      cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
                |||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||| |
Sbjct: 42697270 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 42697211

                                                                            
Query: 475      cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
                |  || ||    ||||  ||| ||||||||||||||||||||| ||| | ||| ||||| 
Sbjct: 42697210 caacccca---ccatgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 42697154

                                     
Query: 535      tggccaccgcctctacctcgg 555
                 | ||||||||||||| ||||
Sbjct: 42697153 cgaccaccgcctctacatcgg 42697133



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 118/145 (81%), Gaps = 3/145 (2%)
 Strand = Plus / Minus

                                                                            
Query: 415      cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
                |||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||| |
Sbjct: 42693169 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 42693110

                                                                            
Query: 475      cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
                |  || ||    ||||  ||| ||||||||||||||||||||| ||| | ||| ||||| 
Sbjct: 42693109 caacccca---ccatgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 42693053

                                         
Query: 535      tggccaccgcctctacctcggcgcc 559
                 | ||||||||||||| | ||||||
Sbjct: 42693052 cgaccaccgcctctacatgggcgcc 42693028



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                        
Query: 416      gacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471
                ||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||
Sbjct: 42703655 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 42703710



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                            
Query: 497      gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556
                |||||||||||||||||| || ||| | ||  |||||  | ||||||||||||| |||||
Sbjct: 42703733 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 42703792

                  
Query: 557      gc 558
                ||
Sbjct: 42703793 gc 42703794



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 185      ccgaagccgaagccgaagccg 205
                |||||||||||||||||||||
Sbjct: 23307672 ccgaagccgaagccgaagccg 23307652



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 180      agggcccgaagccgaagccgaagc 203
                |||| |||||||||||||||||||
Sbjct: 31271041 aggggccgaagccgaagccgaagc 31271018



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 185      ccgaagccgaagccgaagcc 204
                ||||||||||||||||||||
Sbjct: 23307705 ccgaagccgaagccgaagcc 23307686



to top

>dbj|AP003448.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1656_A11
          Length = 148887

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 169/212 (79%), Gaps = 3/212 (1%)
 Strand = Plus / Plus

                                                                         
Query: 348   cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407
             |||||||||||||||||||||  || || || ||||||  |||||| ||||||||    |
Sbjct: 32200 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 32259

                                                                         
Query: 408   gggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467
              |||   |||||||||| |||||||||||   ||||| ||||||||||| || |||||||
Sbjct: 32260 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 32319

                                                                         
Query: 468   gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527
             ||||| ||  || ||    ||||  ||| ||||||||||||||||||||| ||| | |||
Sbjct: 32320 gcaagcgcaacccca---ccatgagccgcgacttcacctggatccaggccctcggcatcc 32376

                                             
Query: 528   tcttcgatggccaccgcctctacctcggcgcc 559
              |||||  | ||||||||||||| | ||||||
Sbjct: 32377 gcttcgccgaccaccgcctctacatgggcgcc 32408



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 115/141 (81%), Gaps = 3/141 (2%)
 Strand = Plus / Minus

                                                                         
Query: 415   cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
             |||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||| |
Sbjct: 30035 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 29976

                                                                         
Query: 475   cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
             |  || ||    ||||  ||| ||||||||||||||||||||| ||| | ||| ||||| 
Sbjct: 29975 caacccca---ccatgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 29919

                                  
Query: 535   tggccaccgcctctacctcgg 555
              | ||||||||||||| ||||
Sbjct: 29918 cgaccaccgcctctacatcgg 29898



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 118/145 (81%), Gaps = 3/145 (2%)
 Strand = Plus / Minus

                                                                         
Query: 415   cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
             |||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||| |
Sbjct: 25934 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 25875

                                                                         
Query: 475   cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
             |  || ||    ||||  ||| ||||||||||||||||||||| ||| | ||| ||||| 
Sbjct: 25874 caacccca---ccatgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 25818

                                      
Query: 535   tggccaccgcctctacctcggcgcc 559
              | ||||||||||||| | ||||||
Sbjct: 25817 cgaccaccgcctctacatgggcgcc 25793



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 416   gacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471
             ||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||
Sbjct: 36420 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 36475



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                         
Query: 497   gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556
             |||||||||||||||||| || ||| | ||  |||||  | ||||||||||||| |||||
Sbjct: 36498 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 36557

               
Query: 557   gc 558
             ||
Sbjct: 36558 gc 36559



to top

>ref|XM_472395.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1068

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 494 cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553
           ||||||||||||||| | |||||| ||| | ||| |||||  ||||||||||||||||||
Sbjct: 448 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 507

                           
Query: 554 ggcgccaggaagaccg 569
           |||| ||||| |||||
Sbjct: 508 ggcgtcaggaggaccg 523



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 395 ttccacggacgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaac 454
           |||||||| |||| ||| |||||||||||| |  ||||||||    |||| |||||||||
Sbjct: 352 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 411

                             
Query: 455 gcgcatttcatcggcaag 472
           ||||| ||||||||||||
Sbjct: 412 gcgcacttcatcggcaag 429



to top

>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04,
             complete sequence
          Length = 143301

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                         
Query: 494   cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553
             ||||||||||||||| | |||||| ||| | ||| |||||  ||||||||||||||||||
Sbjct: 20655 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 20714

                             
Query: 554   ggcgccaggaagaccg 569
             |||| ||||| |||||
Sbjct: 20715 ggcgtcaggaggaccg 20730



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                         
Query: 395   ttccacggacgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaac 454
             |||||||| |||| ||| |||||||||||| |  ||||||||    |||| |||||||||
Sbjct: 20559 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 20618

                               
Query: 455   gcgcatttcatcggcaag 472
             ||||| ||||||||||||
Sbjct: 20619 gcgcacttcatcggcaag 20636



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                            
Query: 494      cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553
                ||||||||||||||| | |||||| ||| | ||| |||||  ||||||||||||||||||
Sbjct: 20290022 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 20290081

                                
Query: 554      ggcgccaggaagaccg 569
                |||| ||||| |||||
Sbjct: 20290082 ggcgtcaggaggaccg 20290097



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                            
Query: 395      ttccacggacgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaac 454
                |||||||| |||| ||| |||||||||||| |  ||||||||    |||| |||||||||
Sbjct: 20289926 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 20289985

                                  
Query: 455      gcgcatttcatcggcaag 472
                ||||| ||||||||||||
Sbjct: 20289986 gcgcacttcatcggcaag 20290003



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 185      ccgaagccgaagccgaagccg 205
                |||||||||||||||||||||
Sbjct: 19805450 ccgaagccgaagccgaagccg 19805430



to top

>dbj|AK108077.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E01, full
           insert sequence
          Length = 1481

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Plus

                                                                       
Query: 494 cgggacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctc 553
           ||||||||||||||| | |||||| ||| | ||| |||||  ||||||||||||||||||
Sbjct: 533 cgggacttcacctgggtgcaggccctcggcatccgcttcggcggccaccgcctctacctc 592

                           
Query: 554 ggcgccaggaagaccg 569
           |||| ||||| |||||
Sbjct: 593 ggcgtcaggaggaccg 608



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                       
Query: 395 ttccacggacgcagggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaac 454
           |||||||| |||| ||| |||||||||||| |  ||||||||    |||| |||||||||
Sbjct: 437 ttccacgggcgcaaggacgccgacttctgcctgctctccgacgccaacctgcacatcaac 496

                             
Query: 455 gcgcatttcatcggcaag 472
           ||||| ||||||||||||
Sbjct: 497 gcgcacttcatcggcaag 514



to top

>ref|NM_189425.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 951

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 115/141 (81%), Gaps = 3/141 (2%)
 Strand = Plus / Plus

                                                                       
Query: 415 cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
           |||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||| |
Sbjct: 321 cgacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaagcg 380

                                                                       
Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
           |  || ||    ||||  ||| ||||||||||||||||||||| ||| | ||| ||||| 
Sbjct: 381 caacccca---ccatgagccgtgacttcacctggatccaggccctcggcatccgcttcgc 437

                                
Query: 535 tggccaccgcctctacctcgg 555
            | ||||||||||||| ||||
Sbjct: 438 cgaccaccgcctctacatcgg 458



to top

>ref|NM_189423.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 975

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 118/145 (81%), Gaps = 3/145 (2%)
 Strand = Plus / Plus

                                                                       
Query: 415 cgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaagag 474
           |||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||| |
Sbjct: 345 cgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcggcaagcg 404

                                                                       
Query: 475 cggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcctcttcga 534
           |  || ||    ||||  ||| ||||||||||||||||||||| ||| | ||| ||||| 
Sbjct: 405 caacccca---ccatgagccgcgacttcacctggatccaggccctcggcatccgcttcgc 461

                                    
Query: 535 tggccaccgcctctacctcggcgcc 559
            | ||||||||||||| | ||||||
Sbjct: 462 cgaccaccgcctctacatgggcgcc 486



to top

>dbj|AK122054.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033114J03, full
           insert sequence
          Length = 1352

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 158/199 (79%), Gaps = 3/199 (1%)
 Strand = Plus / Plus

                                                                       
Query: 348 cgtgcggcgacccgcggttcattggtggtgatggcaacgccttctatttccacggacgca 407
           |||||||||||||||||||||  || || || ||||||  |||||| ||||||||    |
Sbjct: 450 cgtgcggcgacccgcggttcaccggcggcgacggcaacaacttctacttccacggcaaga 509

                                                                       
Query: 408 gggatgccgacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcg 467
            |||   |||||||||| |||||||||||   ||||| ||||||||||| || |||||||
Sbjct: 510 aggaccacgacttctgcatcgtctccgacgccgacctccacatcaacgcccacttcatcg 569

                                                                       
Query: 468 gcaagagcggccacagcggcatgtcccgggacttcacctggatccaggccatcgccgtcc 527
           ||||| ||  || || |   |||  ||| ||||||||||||||||||||| ||| | |||
Sbjct: 570 gcaagcgcaaccccacc---atgagccgcgacttcacctggatccaggccctcggcatcc 626

                              
Query: 528 tcttcgatggccaccgcct 546
            |||||  | |||||||||
Sbjct: 627 gcttcgccgaccaccgcct 645



to top

>gb|AC129716.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0068N01, complete sequence
          Length = 152233

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 487   catgtcccgggacttcacctggatccaggccatcgccgtcctcttcg 533
             ||||||||| ||||||||||||||||||||  ||| |||||||||||
Sbjct: 40171 catgtcccgcgacttcacctggatccaggcgctcggcgtcctcttcg 40217



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                             
Query: 487    catgtcccgggacttcacctggatccaggccatcgccgtcctcttcg 533
              ||||||||| ||||||||||||||||||||  ||| |||||||||||
Sbjct: 378524 catgtcccgcgacttcacctggatccaggcgctcggcgtcctcttcg 378570



to top

>dbj|AB021175.1| Zea mays ZmRCP1 mRNA for root cap protein 1, complete cds
          Length = 1225

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                    
Query: 416 gacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaag 472
           ||||||||| |||||||||||   | ||| |||||||||||||| ||||||||||||
Sbjct: 394 gacttctgcatcgtctccgacgccgccctccacatcaacgcgcacttcatcggcaag 450



to top

>ref|NM_189428.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1026

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 416 gacttctgcgtcgtctccgaccgtgaccttcacatcaacgcgcatttcatcggcaa 471
           ||||||||| |||||||||||   ||||| ||||||||||| || |||||||||||
Sbjct: 391 gacttctgcatcgtctccgacgccgacctgcacatcaacgcccacttcatcggcaa 446



 Score = 44.1 bits (22), Expect = 0.49
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 497 gacttcacctggatccaggccatcgccgtcctcttcgatggccaccgcctctacctcggc 556
           |||||||||||||||||| || ||| | ||  |||||  | ||||||||||||| |||||
Sbjct: 469 gacttcacctggatccagtccctcggcatcagcttcggcgaccaccgcctctacatcggc 528

             
Query: 557 gc 558
           ||
Sbjct: 529 gc 530



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 181    gggcccgaagccgaagccgaagccgg 206
              ||||||||||||||||||||||||||
Sbjct: 379629 gggcccgaagccgaagccgaagccgg 379654



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 184     cccgaagccgaagccgaagccgg 206
               |||||||||||||||||||||||
Sbjct: 3856001 cccgaagccgaagccgaagccgg 3855979



to top

>ref|NM_112830.2| Arabidopsis thaliana structural constituent of cell wall AT3G19430
            mRNA, complete cds
          Length = 1878

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 441  accttcacatcaacgcgcatttcatcgg 468
            |||||||||||||||| |||||||||||
Sbjct: 1010 accttcacatcaacgctcatttcatcgg 1037



to top

>dbj|AB025624.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14
          Length = 83097

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 441   accttcacatcaacgcgcatttcatcgg 468
             |||||||||||||||| |||||||||||
Sbjct: 50454 accttcacatcaacgctcatttcatcgg 50427



to top

>gb|L47117.1|PIAEMB7R Picea glauca late embryogenesis abundant protein (EMB7) mRNA,
           complete cds
          Length = 1245

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 441 accttcacatcaacgcgcatttcatcggcaagagcggcca 480
           |||| ||||||||||| |||||||| |||||||| |||||
Sbjct: 350 acctccacatcaacgctcatttcattggcaagagaggcca 389



to top

>ref|XM_471700.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1206

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 185 ccgaagccgaagccgaagccggc 207
           |||||||||||||||||||||||
Sbjct: 116 ccgaagccgaagccgaagccggc 94



to top

>emb|AJ009934.1|SMAJ9934 Sordaria macrospora SPO76 gene
          Length = 6411

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 183  gcccgaagccgaagccgaagccg 205
            |||||||||||||||||||||||
Sbjct: 5195 gcccgaagccgaagccgaagccg 5217



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 185    ccgaagccgaagccgaagccgg 206
              ||||||||||||||||||||||
Sbjct: 127765 ccgaagccgaagccgaagccgg 127744



to top

>emb|AL939107.1|SCO939107 Streptomyces coelicolor A3(2) complete genome; segment 4/29
          Length = 298450

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 185    ccgaagccgaagccgaagccggcgacggtc 214
              |||||||||||||||||||||  |||||||
Sbjct: 113692 ccgaagccgaagccgaagccgaagacggtc 113663



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 184     cccgaagccgaagccgaagccg 205
               ||||||||||||||||||||||
Sbjct: 2462764 cccgaagccgaagccgaagccg 2462785



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 185     ccgaagccgaagccgaagccgg 206
               ||||||||||||||||||||||
Sbjct: 6957200 ccgaagccgaagccgaagccgg 6957179



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 185      ccgaagccgaagccgaagccg 205
                |||||||||||||||||||||
Sbjct: 20612035 ccgaagccgaagccgaagccg 20612055



to top

>dbj|AP004785.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0061B07
          Length = 124766

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 185   ccgaagccgaagccgaagccgg 206
             ||||||||||||||||||||||
Sbjct: 16627 ccgaagccgaagccgaagccgg 16606



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 184    cccgaagccgaagccgaagccg 205
              ||||||||||||||||||||||
Sbjct: 131533 cccgaagccgaagccgaagccg 131512



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131526 ccgaagccgaagccgaagccg 131506



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131520 ccgaagccgaagccgaagccg 131500



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131514 ccgaagccgaagccgaagccg 131494



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131508 ccgaagccgaagccgaagccg 131488



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131502 ccgaagccgaagccgaagccg 131482



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131496 ccgaagccgaagccgaagccg 131476



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131490 ccgaagccgaagccgaagccg 131470



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131484 ccgaagccgaagccgaagccg 131464



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131478 ccgaagccgaagccgaagccg 131458



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131472 ccgaagccgaagccgaagccg 131452



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131466 ccgaagccgaagccgaagccg 131446



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 131460 ccgaagccgaagccgaagccg 131440



to top

>gb|DQ180309.1| Fragaria x ananassa clone PBCESTFXA4 SSR marker
          Length = 850

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 184 cccgaagccgaagccgaagccg 205
           ||||||||||||||||||||||
Sbjct: 268 cccgaagccgaagccgaagccg 289



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 184     cccgaagccgaagccgaagccg 205
               ||||||||||||||||||||||
Sbjct: 2107795 cccgaagccgaagccgaagccg 2107774



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 44.1 bits (22), Expect = 0.49
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 185     ccgaagccgaagccgaagccgg 206
               ||||||||||||||||||||||
Sbjct: 5061707 ccgaagccgaagccgaagccgg 5061728



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 5061701 ccgaagccgaagccgaagccg 5061721



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 5061695 ccgaagccgaagccgaagccg 5061715



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 5061689 ccgaagccgaagccgaagccg 5061709



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 5061683 ccgaagccgaagccgaagccg 5061703



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 5061677 ccgaagccgaagccgaagccg 5061697



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068848 ccgaagccgaagccgaagccg 4068828



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068842 ccgaagccgaagccgaagccg 4068822



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068836 ccgaagccgaagccgaagccg 4068816



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068830 ccgaagccgaagccgaagccg 4068810



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068824 ccgaagccgaagccgaagccg 4068804



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068818 ccgaagccgaagccgaagccg 4068798



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068812 ccgaagccgaagccgaagccg 4068792



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068806 ccgaagccgaagccgaagccg 4068786



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068800 ccgaagccgaagccgaagccg 4068780



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068794 ccgaagccgaagccgaagccg 4068774



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068788 ccgaagccgaagccgaagccg 4068768



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068782 ccgaagccgaagccgaagccg 4068762



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068776 ccgaagccgaagccgaagccg 4068756



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068770 ccgaagccgaagccgaagccg 4068750



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068764 ccgaagccgaagccgaagccg 4068744



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068758 ccgaagccgaagccgaagccg 4068738



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068752 ccgaagccgaagccgaagccg 4068732



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068746 ccgaagccgaagccgaagccg 4068726



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068740 ccgaagccgaagccgaagccg 4068720



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068734 ccgaagccgaagccgaagccg 4068714



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068728 ccgaagccgaagccgaagccg 4068708



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 4068722 ccgaagccgaagccgaagccg 4068702



to top

>ref|XM_512923.1| PREDICTED: Pan troglodytes similar to zinc finger protein 495
            (LOC456317), mRNA
          Length = 9886

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 8053 ccgaagccgaagccgaagccg 8033



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 8047 ccgaagccgaagccgaagccg 8027



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 185  ccgaagccgaagccgaagcc 204
            ||||||||||||||||||||
Sbjct: 8041 ccgaagccgaagccgaagcc 8022



to top

>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence
          Length = 3587082

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 362855 ccgaagccgaagccgaagccg 362875



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 362849 ccgaagccgaagccgaagccg 362869



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 362843 ccgaagccgaagccgaagccg 362863



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 362837 ccgaagccgaagccgaagccg 362857



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 362831 ccgaagccgaagccgaagccg 362851



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 362825 ccgaagccgaagccgaagccg 362845



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 1271924 ccgaagccgaagccgaagcc 1271943



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    cgaagccgaagccgaagccg 205
              ||||||||||||||||||||
Sbjct: 362820 cgaagccgaagccgaagccg 362839



to top

>ref|NM_192611.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 613 ccgaagccgaagccgaagccg 633



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 ccgaagccgaagccgaagcc 204
           ||||||||||||||||||||
Sbjct: 580 ccgaagccgaagccgaagcc 599



to top

>ref|XM_472356.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 750

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 490 ccgaagccgaagccgaagccg 510



to top

>gb|AF465798.1| Dichroplus elongatus minisatellite A4 sequence
          Length = 358

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 271 ccgaagccgaagccgaagccg 251



to top

>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome
          Length = 3188609

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228981 ccgaagccgaagccgaagccg 2228961



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228975 ccgaagccgaagccgaagccg 2228955



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228969 ccgaagccgaagccgaagccg 2228949



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228963 ccgaagccgaagccgaagccg 2228943



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228957 ccgaagccgaagccgaagccg 2228937



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228951 ccgaagccgaagccgaagccg 2228931



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2228945 ccgaagccgaagccgaagccg 2228925



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 2228939 ccgaagccgaagccgaagcc 2228920



to top

>gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, complete sequence
          Length = 3510148

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646706 ccgaagccgaagccgaagccg 2646686



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646700 ccgaagccgaagccgaagccg 2646680



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646694 ccgaagccgaagccgaagccg 2646674



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646688 ccgaagccgaagccgaagccg 2646668



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646682 ccgaagccgaagccgaagccg 2646662



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646676 ccgaagccgaagccgaagccg 2646656



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646670 ccgaagccgaagccgaagccg 2646650



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646664 ccgaagccgaagccgaagccg 2646644



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646658 ccgaagccgaagccgaagccg 2646638



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646652 ccgaagccgaagccgaagccg 2646632



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646646 ccgaagccgaagccgaagccg 2646626



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646640 ccgaagccgaagccgaagccg 2646620



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646634 ccgaagccgaagccgaagccg 2646614



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646628 ccgaagccgaagccgaagccg 2646608



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646622 ccgaagccgaagccgaagccg 2646602



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646616 ccgaagccgaagccgaagccg 2646596



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646610 ccgaagccgaagccgaagccg 2646590



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2646604 ccgaagccgaagccgaagccg 2646584



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2474335 ccgaagccgaagccgaagccg 2474355



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2474329 ccgaagccgaagccgaagccg 2474349



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2474323 ccgaagccgaagccgaagccg 2474343



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2474317 ccgaagccgaagccgaagccg 2474337



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1643129 ccgaagccgaagccgaagccg 1643109



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1643123 ccgaagccgaagccgaagccg 1643103



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1643117 ccgaagccgaagccgaagccg 1643097



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 319290 ccgaagccgaagccgaagccg 319310



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 319284 ccgaagccgaagccgaagccg 319304



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 131     gccgcgggggccaccaccgcg 151
               |||||||||||||||||||||
Sbjct: 2748779 gccgcgggggccaccaccgcg 2748799



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2266011 ccgaagccgaagccgaagccg 2266031



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2266005 ccgaagccgaagccgaagccg 2266025



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2265999 ccgaagccgaagccgaagccg 2266019



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2265993 ccgaagccgaagccgaagccg 2266013



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2265987 ccgaagccgaagccgaagccg 2266007



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2265981 ccgaagccgaagccgaagccg 2266001



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2265975 ccgaagccgaagccgaagccg 2265995



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2038161 ccgaagccgaagccgaagccg 2038181



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2038155 ccgaagccgaagccgaagccg 2038175



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2038149 ccgaagccgaagccgaagccg 2038169



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2038143 ccgaagccgaagccgaagccg 2038163



to top

>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence
          Length = 4126292

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854397 ccgaagccgaagccgaagccg 3854377



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854391 ccgaagccgaagccgaagccg 3854371



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854385 ccgaagccgaagccgaagccg 3854365



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854379 ccgaagccgaagccgaagccg 3854359



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854373 ccgaagccgaagccgaagccg 3854353



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854367 ccgaagccgaagccgaagccg 3854347



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854361 ccgaagccgaagccgaagccg 3854341



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854355 ccgaagccgaagccgaagccg 3854335



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854349 ccgaagccgaagccgaagccg 3854329



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854343 ccgaagccgaagccgaagccg 3854323



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854337 ccgaagccgaagccgaagccg 3854317



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854331 ccgaagccgaagccgaagccg 3854311



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854325 ccgaagccgaagccgaagccg 3854305



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3854319 ccgaagccgaagccgaagccg 3854299



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 181     gggcccgaagccgaagccgaagccg 205
               |||| ||||||||||||||||||||
Sbjct: 3764163 gggcgcgaagccgaagccgaagccg 3764139



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3764153 ccgaagccgaagccgaagccg 3764133



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3764147 ccgaagccgaagccgaagccg 3764127



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3711596 ccgaagccgaagccgaagccg 3711576



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3711590 ccgaagccgaagccgaagccg 3711570



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3711584 ccgaagccgaagccgaagccg 3711564



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3711578 ccgaagccgaagccgaagccg 3711558



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3711572 ccgaagccgaagccgaagccg 3711552



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889993 ccgaagccgaagccgaagccg 2889973



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889987 ccgaagccgaagccgaagccg 2889967



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889981 ccgaagccgaagccgaagccg 2889961



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889975 ccgaagccgaagccgaagccg 2889955



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889969 ccgaagccgaagccgaagccg 2889949



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889963 ccgaagccgaagccgaagccg 2889943



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889957 ccgaagccgaagccgaagccg 2889937



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889951 ccgaagccgaagccgaagccg 2889931



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889945 ccgaagccgaagccgaagccg 2889925



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889939 ccgaagccgaagccgaagccg 2889919



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889933 ccgaagccgaagccgaagccg 2889913



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889927 ccgaagccgaagccgaagccg 2889907



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889921 ccgaagccgaagccgaagccg 2889901



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889915 ccgaagccgaagccgaagccg 2889895



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889909 ccgaagccgaagccgaagccg 2889889



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889903 ccgaagccgaagccgaagccg 2889883



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2889897 ccgaagccgaagccgaagccg 2889877



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1659510 ccgaagccgaagccgaagccg 1659530



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050295 ccgaagccgaagccgaagccg 1050315



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050289 ccgaagccgaagccgaagccg 1050309



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050283 ccgaagccgaagccgaagccg 1050303



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050277 ccgaagccgaagccgaagccg 1050297



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050271 ccgaagccgaagccgaagccg 1050291



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050265 ccgaagccgaagccgaagccg 1050285



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050259 ccgaagccgaagccgaagccg 1050279



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050253 ccgaagccgaagccgaagccg 1050273



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050247 ccgaagccgaagccgaagccg 1050267



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050241 ccgaagccgaagccgaagccg 1050261



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050235 ccgaagccgaagccgaagccg 1050255



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050229 ccgaagccgaagccgaagccg 1050249



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050223 ccgaagccgaagccgaagccg 1050243



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1050217 ccgaagccgaagccgaagccg 1050237



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 342297 ccgaagccgaagccgaagccg 342317



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 186     cgaagccgaagccgaagccg 205
               ||||||||||||||||||||
Sbjct: 1659505 cgaagccgaagccgaagccg 1659524



to top

>ref|XM_716953.1| Candida albicans SC5314 hypothetical protein (CaO19_11459), mRNA
          Length = 1122

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 334 ccgaagccgaagccgaagccg 314



to top

>ref|XM_716792.1| Candida albicans SC5314 hypothetical protein (CaO19_3976), mRNA
          Length = 1122

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 334 ccgaagccgaagccgaagccg 314



to top

>gb|AC174382.2| Mus musculus BAC clone RP24-94K20 from chromosome y, complete sequence
          Length = 207355

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 23     ttagcaacaaaagaaaacacc 43
              |||||||||||||||||||||
Sbjct: 158866 ttagcaacaaaagaaaacacc 158846



to top

>gb|AC147252.4| Mus musculus BAC clone RP24-116A5 from chromosome Y, complete
            sequence
          Length = 197602

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 23   ttagcaacaaaagaaaacacc 43
            |||||||||||||||||||||
Sbjct: 8365 ttagcaacaaaagaaaacacc 8385



to top

>gb|AC133178.3| Mus musculus BAC clone RP24-123P23 from chromosome Y, complete sequence
          Length = 158872

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    ttagcaacaaaagaaaacacc 43
             |||||||||||||||||||||
Sbjct: 30844 ttagcaacaaaagaaaacacc 30864



to top

>gb|AC134567.4| Mus musculus BAC clone RP24-199C24 from chromosome Y, complete sequence
          Length = 163892

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 23     ttagcaacaaaagaaaacacc 43
              |||||||||||||||||||||
Sbjct: 154359 ttagcaacaaaagaaaacacc 154339



to top

>gb|AC136975.2| Mus musculus BAC clone RP24-403M20 from chromosome Y, complete sequence
          Length = 189490

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    ttagcaacaaaagaaaacacc 43
             |||||||||||||||||||||
Sbjct: 90655 ttagcaacaaaagaaaacacc 90675



to top

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1720610 ccgaagccgaagccgaagccg 1720630



to top

>gb|AC107806.10| Mus musculus chromosome 3, clone RP23-55C1, complete sequence
          Length = 214411

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 23    ttagcaacaaaagaaaacacc 43
             |||||||||||||||||||||
Sbjct: 33892 ttagcaacaaaagaaaacacc 33912



to top

>gb|AC157320.2| Zea mays clone ZMMBBb-7C14, complete sequence
          Length = 132140

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 185   ccgaagccgaagccgaagccggcga 209
             |||||||||||||||||||| ||||
Sbjct: 72923 ccgaagccgaagccgaagcctgcga 72899



to top

>gb|AF173167.3| Pseudomonas alcaligenes putative transposase, putative transposase,
            gentisate 1,2-dioxygenase (xlnE), xlnF, hypothetical
            protein (xlnG), hypothetical protein (xlnH), xlnI,
            probable 3-hydroxybenzoate 6-hydroxylase (xlnD),
            transposase subunit (tnpA1), transposase subunit (tnpA2),
            transposase subunit, and putative transposase genes,
            complete cds
          Length = 12161

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 2704 ccgaagccgaagccgaagccg 2684



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 2698 ccgaagccgaagccgaagccg 2678



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 2692 ccgaagccgaagccgaagccg 2672



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559771 ccgaagccgaagccgaagccg 1559791



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559765 ccgaagccgaagccgaagccg 1559785



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559759 ccgaagccgaagccgaagccg 1559779



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559753 ccgaagccgaagccgaagccg 1559773



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559747 ccgaagccgaagccgaagccg 1559767



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559741 ccgaagccgaagccgaagccg 1559761



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559735 ccgaagccgaagccgaagccg 1559755



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559729 ccgaagccgaagccgaagccg 1559749



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559723 ccgaagccgaagccgaagccg 1559743



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559717 ccgaagccgaagccgaagccg 1559737



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559711 ccgaagccgaagccgaagccg 1559731



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559705 ccgaagccgaagccgaagccg 1559725



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559699 ccgaagccgaagccgaagccg 1559719



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559693 ccgaagccgaagccgaagccg 1559713



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559687 ccgaagccgaagccgaagccg 1559707



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559681 ccgaagccgaagccgaagccg 1559701



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559675 ccgaagccgaagccgaagccg 1559695



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559669 ccgaagccgaagccgaagccg 1559689



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559663 ccgaagccgaagccgaagccg 1559683



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559657 ccgaagccgaagccgaagccg 1559677



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559651 ccgaagccgaagccgaagccg 1559671



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559645 ccgaagccgaagccgaagccg 1559665



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559639 ccgaagccgaagccgaagccg 1559659



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559633 ccgaagccgaagccgaagccg 1559653



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559627 ccgaagccgaagccgaagccg 1559647



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559621 ccgaagccgaagccgaagccg 1559641



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559615 ccgaagccgaagccgaagccg 1559635



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559609 ccgaagccgaagccgaagccg 1559629



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559603 ccgaagccgaagccgaagccg 1559623



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559597 ccgaagccgaagccgaagccg 1559617



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559591 ccgaagccgaagccgaagccg 1559611



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559585 ccgaagccgaagccgaagccg 1559605



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559579 ccgaagccgaagccgaagccg 1559599



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1559573 ccgaagccgaagccgaagccg 1559593



to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2053794 ccgaagccgaagccgaagccg 2053774



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2053788 ccgaagccgaagccgaagccg 2053768



to top

>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence
          Length = 3173005

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2533007 ccgaagccgaagccgaagccg 2532987



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2162137 ccgaagccgaagccgaagccg 2162157



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2162131 ccgaagccgaagccgaagccg 2162151



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 734584 ccgaagccgaagccgaagccg 734604



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 427368 ccgaagccgaagccgaagccg 427388



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 427362 ccgaagccgaagccgaagccg 427382



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 427356 ccgaagccgaagccgaagccg 427376



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 427350 ccgaagccgaagccgaagccg 427370



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 199728 ccgaagccgaagccgaagccg 199748



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 199722 ccgaagccgaagccgaagccg 199742



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 186     cgaagccgaagccgaagccg 205
               ||||||||||||||||||||
Sbjct: 2533012 cgaagccgaagccgaagccg 2532993



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 2533001 ccgaagccgaagccgaagcc 2532982



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    cgaagccgaagccgaagccg 205
              ||||||||||||||||||||
Sbjct: 734579 cgaagccgaagccgaagccg 734598



to top

>emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromosome 1, complete sequence
          Length = 4074542

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451904 ccgaagccgaagccgaagccg 3451884



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451898 ccgaagccgaagccgaagccg 3451878



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451892 ccgaagccgaagccgaagccg 3451872



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451886 ccgaagccgaagccgaagccg 3451866



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451880 ccgaagccgaagccgaagccg 3451860



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451874 ccgaagccgaagccgaagccg 3451854



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451868 ccgaagccgaagccgaagccg 3451848



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3451862 ccgaagccgaagccgaagccg 3451842



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620085 ccgaagccgaagccgaagccg 2620065



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620079 ccgaagccgaagccgaagccg 2620059



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620073 ccgaagccgaagccgaagccg 2620053



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620067 ccgaagccgaagccgaagccg 2620047



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620061 ccgaagccgaagccgaagccg 2620041



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620055 ccgaagccgaagccgaagccg 2620035



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620049 ccgaagccgaagccgaagccg 2620029



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620043 ccgaagccgaagccgaagccg 2620023



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2620037 ccgaagccgaagccgaagccg 2620017



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1546493 ccgaagccgaagccgaagccg 1546513



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1546487 ccgaagccgaagccgaagccg 1546507



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 931261 ccgaagccgaagccgaagccg 931281



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 931255 ccgaagccgaagccgaagccg 931275



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 931249 ccgaagccgaagccgaagccg 931269



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 931243 ccgaagccgaagccgaagccg 931263



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 931237 ccgaagccgaagccgaagccg 931257



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 931231 ccgaagccgaagccgaagccg 931251



to top

>emb|AL939110.1|SCO939110 Streptomyces coelicolor A3(2) complete genome; segment 7/29
          Length = 283100

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 275026 ccgaagccgaagccgaagccg 275006



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 275020 ccgaagccgaagccgaagccg 275000



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 275014 ccgaagccgaagccgaagccg 274994



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 275008 ccgaagccgaagccgaagccg 274988



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 275002 ccgaagccgaagccgaagccg 274982



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274996 ccgaagccgaagccgaagccg 274976



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274990 ccgaagccgaagccgaagccg 274970



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274984 ccgaagccgaagccgaagccg 274964



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274978 ccgaagccgaagccgaagccg 274958



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274972 ccgaagccgaagccgaagccg 274952



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274966 ccgaagccgaagccgaagccg 274946



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274960 ccgaagccgaagccgaagccg 274940



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274954 ccgaagccgaagccgaagccg 274934



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274948 ccgaagccgaagccgaagccg 274928



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 274942 ccgaagccgaagccgaagccg 274922



to top

>emb|AL731642.3|OSJN00289 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0014D23,
             complete sequence
          Length = 133759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 93912 ccgaagccgaagccgaagccg 93892



to top

>gb|AC177798.3| Mus musculus BAC clone RP24-456H11 from chromosome y, complete sequence
          Length = 171533

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 23     ttagcaacaaaagaaaacacc 43
              |||||||||||||||||||||
Sbjct: 119964 ttagcaacaaaagaaaacacc 119944



to top

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1880944 ccgaagccgaagccgaagccg 1880964



to top

>gb|AC183416.2| Mus musculus BAC clone RP24-68E17 from chromosome y, complete sequence
          Length = 177325

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 23     ttagcaacaaaagaaaacacc 43
              |||||||||||||||||||||
Sbjct: 102814 ttagcaacaaaagaaaacacc 102834



to top

>gb|AC024580.6| Homo sapiens chromosome 19 clone CTD-2621I17, complete sequence
          Length = 193609

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 87372 ccgaagccgaagccgaagccg 87392



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 87366 ccgaagccgaagccgaagccg 87386



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 87378 ccgaagccgaagccgaagcc 87397



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 87271 ccgaagccgaagccgaagcc 87290



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 670824 ccgaagccgaagccgaagccg 670844



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 186     cgaagccgaagccgaagccg 205
               ||||||||||||||||||||
Sbjct: 3182332 cgaagccgaagccgaagccg 3182351



to top

>gb|AC175391.3| Mus musculus BAC clone RP24-92G16 from chromosome y, complete sequence
          Length = 239400

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 23    ttagcaacaaaagaaaacacc 43
             |||||||||||||||||||||
Sbjct: 51341 ttagcaacaaaagaaaacacc 51321



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2125227 ccgaagccgaagccgaagccg 2125207



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2125221 ccgaagccgaagccgaagccg 2125201



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2125215 ccgaagccgaagccgaagccg 2125195



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2125209 ccgaagccgaagccgaagccg 2125189



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2125203 ccgaagccgaagccgaagccg 2125183



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2125197 ccgaagccgaagccgaagccg 2125177



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1561056 ccgaagccgaagccgaagccg 1561036



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1561050 ccgaagccgaagccgaagccg 1561030



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1561044 ccgaagccgaagccgaagccg 1561024



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1561038 ccgaagccgaagccgaagccg 1561018



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 229978 ccgaagccgaagccgaagccg 229998



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 229972 ccgaagccgaagccgaagccg 229992



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 229966 ccgaagccgaagccgaagccg 229986



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    ccgaagccgaagccgaagcc 204
              ||||||||||||||||||||
Sbjct: 229984 ccgaagccgaagccgaagcc 230003



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    cgaagccgaagccgaagccg 205
              ||||||||||||||||||||
Sbjct: 229961 cgaagccgaagccgaagccg 229980



to top

>gb|AC175672.2| Mus musculus BAC clone RP24-254K21 from chromosome y, complete sequence
          Length = 189044

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 23    ttagcaacaaaagaaaacacc 43
             |||||||||||||||||||||
Sbjct: 44818 ttagcaacaaaagaaaacacc 44798



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 1214022 ccgaagccgaagccgaagccg 1214042



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 186      cgaagccgaagccgaagccg 205
                ||||||||||||||||||||
Sbjct: 19879901 cgaagccgaagccgaagccg 19879920



to top

>gb|AF319534.1|AF319534 Neisseria meningitidis strain Z5005 HemO (hemO) and Exl3A (exl3A)
           genes, complete cds
          Length = 2704

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 cccgaagccgaagccgaagcc 204
           |||||||||||||||||||||
Sbjct: 673 cccgaagccgaagccgaagcc 693



to top

>gb|AF319532.1|AF319532 Neisseria meningitidis strain GA0929 PqiA (pqiA) gene, partial cds;
            HemO (hemO) and Exl2 (exl2) genes, complete cds; Col
            (col) gene, partial cds; and unknown gene
          Length = 4403

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 184  cccgaagccgaagccgaagcc 204
            |||||||||||||||||||||
Sbjct: 1302 cccgaagccgaagccgaagcc 1322



to top

>gb|AF319530.1|AF319530 Neisseria meningitidis strain NMB PqiA (pqiA) gene, partial cds; HemO
            (hemO) gene, complete cds; and HmbR (hmbR) gene, partial
            cds
          Length = 1638

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 184  cccgaagccgaagccgaagcc 204
            |||||||||||||||||||||
Sbjct: 1260 cccgaagccgaagccgaagcc 1280



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052403 ccgaagccgaagccgaagccg 2052383



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052397 ccgaagccgaagccgaagccg 2052377



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052391 ccgaagccgaagccgaagccg 2052371



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052385 ccgaagccgaagccgaagccg 2052365



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052379 ccgaagccgaagccgaagccg 2052359



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052373 ccgaagccgaagccgaagccg 2052353



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2052367 ccgaagccgaagccgaagccg 2052347



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 186     cgaagccgaagccgaagccggcga 209
               ||||||||||||||| ||||||||
Sbjct: 4093684 cgaagccgaagccgaggccggcga 4093661



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 2052361 ccgaagccgaagccgaagcc 2052342



to top

>ref|NM_145722.1| Rattus norvegicus Bartomin (LOC252831), mRNA
          Length = 5352

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4439 ccgaagccgaagccgaagccg 4459



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4433 ccgaagccgaagccgaagccg 4453



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4427 ccgaagccgaagccgaagccg 4447



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4421 ccgaagccgaagccgaagccg 4441



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4415 ccgaagccgaagccgaagccg 4435



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4409 ccgaagccgaagccgaagccg 4429



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4403 ccgaagccgaagccgaagccg 4423



to top

>gb|AC175709.2| Mus musculus BAC clone RP24-7D4 from chromosome y, complete sequence
          Length = 160976

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 23    ttagcaacaaaagaaaacacc 43
             |||||||||||||||||||||
Sbjct: 81802 ttagcaacaaaagaaaacacc 81782



to top

>ref|XM_580236.1| PREDICTED: Rattus norvegicus LOC502067 (LOC502067), mRNA
          Length = 543

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 133 ccgaagccgaagccgaagccg 153



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 ccgaagccgaagccgaagcc 204
           ||||||||||||||||||||
Sbjct: 139 ccgaagccgaagccgaagcc 158



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 192     cgaagccgaagccggcgacgg 212
               |||||||||||||||||||||
Sbjct: 4286159 cgaagccgaagccggcgacgg 4286139



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 190     gccgaagccgaagccggcga 209
               ||||||||||||||||||||
Sbjct: 6093365 gccgaagccgaagccggcga 6093346



to top

>dbj|AP006619.1| Nocardia farcinica IFM 10152 plasmid pNF1 DNA, complete sequence
          Length = 184026

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 183    gcccgaagccgaagccgaagc 203
              |||||||||||||||||||||
Sbjct: 120407 gcccgaagccgaagccgaagc 120427



to top

>dbj|AP003333.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1103C09
          Length = 163996

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 33370 ccgaagccgaagccgaagccg 33350



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 33403 ccgaagccgaagccgaagcc 33384



to top

>dbj|AP003253.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0451D05
          Length = 148381

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 94414 ccgaagccgaagccgaagccg 94394



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 94447 ccgaagccgaagccgaagcc 94428



to top

>dbj|AP003682.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427B07
          Length = 172058

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 34442 ccgaagccgaagccgaagccg 34462



to top

>dbj|AP004885.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0575F10
          Length = 150462

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 45113 ccgaagccgaagccgaagccg 45133



to top

>dbj|AB114606.1| Streptococcus bovis manL, manM, manN, manO, serS genes for
           mannose-specific phosphotransferase syste component
           IIAB, mannose-specific phosphotransferase system
           component IIC, mannose-specific phosphotransferase
           system component IID, hypothetical protein, seryl-tRNA
           synthetase, partial and complete sequence
          Length = 5428

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 455 gcgcatttcatcggcaagagc 475
           |||||||||||||||||||||
Sbjct: 489 gcgcatttcatcggcaagagc 469



to top

>emb|AJ937741.1| Streptomyces ambofaciens ATCC 23877 right terminal inverted repeat
          Length = 243019

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 94370 ccgaagccgaagccgaagccg 94350



to top

>dbj|AK070921.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074J04, full
           insert sequence
          Length = 1015

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 659 ccgaagccgaagccgaagccg 679



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 ccgaagccgaagccgaagcc 204
           ||||||||||||||||||||
Sbjct: 626 ccgaagccgaagccgaagcc 645



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430310 ccgaagccgaagccgaagccg 3430290



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430304 ccgaagccgaagccgaagccg 3430284



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430298 ccgaagccgaagccgaagccg 3430278



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430292 ccgaagccgaagccgaagccg 3430272



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430286 ccgaagccgaagccgaagccg 3430266



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430280 ccgaagccgaagccgaagccg 3430260



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430274 ccgaagccgaagccgaagccg 3430254



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430268 ccgaagccgaagccgaagccg 3430248



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430262 ccgaagccgaagccgaagccg 3430242



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430256 ccgaagccgaagccgaagccg 3430236



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430250 ccgaagccgaagccgaagccg 3430230



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430244 ccgaagccgaagccgaagccg 3430224



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430238 ccgaagccgaagccgaagccg 3430218



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430232 ccgaagccgaagccgaagccg 3430212



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430226 ccgaagccgaagccgaagccg 3430206



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430220 ccgaagccgaagccgaagccg 3430200



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430214 ccgaagccgaagccgaagccg 3430194



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430208 ccgaagccgaagccgaagccg 3430188



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430202 ccgaagccgaagccgaagccg 3430182



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430196 ccgaagccgaagccgaagccg 3430176



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 3430190 ccgaagccgaagccgaagccg 3430170



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2488108 ccgaagccgaagccgaagccg 2488128



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2488102 ccgaagccgaagccgaagccg 2488122



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2488096 ccgaagccgaagccgaagccg 2488116



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2488090 ccgaagccgaagccgaagccg 2488110



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 3430184 ccgaagccgaagccgaagcc 3430165



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 2488114 ccgaagccgaagccgaagcc 2488133



to top

>dbj|AK065876.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047J07, full
           insert sequence
          Length = 3499

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 17  ccgaagccgaagccgaagccg 37



to top

>dbj|AK064665.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-115-B07, full
           insert sequence
          Length = 1424

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 185 ccgaagccgaagccgaagccg 205
           |||||||||||||||||||||
Sbjct: 16  ccgaagccgaagccgaagccg 36



to top

>emb|CT573071.1| Kuenenia stuttgartiensis genome fragment KUST_E (5 of 5)
          Length = 2199546

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 185    ccgaagccgaagccgaagccg 205
              |||||||||||||||||||||
Sbjct: 849001 ccgaagccgaagccgaagccg 849021



to top

>emb|AJ937740.1| Streptomyces ambofaciens ATCC 23877 left terminal inverted repeat
          Length = 273746

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 185   ccgaagccgaagccgaagccg 205
             |||||||||||||||||||||
Sbjct: 94370 ccgaagccgaagccgaagccg 94350



to top

>gb|AY961445.1| Phytophthora infestans clone PH019E7 low complexity protein mRNA,
           complete cds
          Length = 535

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 gcccgaagccgaagccgaagc 203
           |||||||||||||||||||||
Sbjct: 399 gcccgaagccgaagccgaagc 379



to top

>gb|AY961443.1| Phytophthora infestans clone PL003F1 low complexity protein mRNA,
           complete cds
          Length = 570

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 gcccgaagccgaagccgaagc 203
           |||||||||||||||||||||
Sbjct: 397 gcccgaagccgaagccgaagc 377



to top

>gb|AY961439.1| Phytophthora infestans clone PD011B9 HAM34-like putative membrane
           protein mRNA, complete cds
          Length = 647

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 gcccgaagccgaagccgaagc 203
           |||||||||||||||||||||
Sbjct: 431 gcccgaagccgaagccgaagc 411



to top

>gb|AY961416.1| Phytophthora infestans clone MY-10-B-05 HAM34-like putative
           membrane protein mRNA, complete cds
          Length = 592

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 183 gcccgaagccgaagccgaagc 203
           |||||||||||||||||||||
Sbjct: 395 gcccgaagccgaagccgaagc 375



to top

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 185     ccgaagccgaagccgaagccg 205
               |||||||||||||||||||||
Sbjct: 2049091 ccgaagccgaagccgaagccg 2049071



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 2554551 ccgaagccgaagccgaagcc 2554532



to top

>gb|L20696.1|LILMEIOTIN Lilium longiflorum meiotin-1 mRNA, complete cds
          Length = 1317

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 186 cgaagccgaagccgaagccgg 206
           |||||||||||||||||||||
Sbjct: 784 cgaagccgaagccgaagccgg 804



to top

>dbj|AB050509.1| Macaca fascicularis brain cDNA, clone:QnpA-13140
          Length = 2535

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 cccgaagccgaagccgaagcc 204
           |||||||||||||||||||||
Sbjct: 372 cccgaagccgaagccgaagcc 392



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 ccgaagccgaagccgaagcc 204
           ||||||||||||||||||||
Sbjct: 18  ccgaagccgaagccgaagcc 37



to top

>gb|U02467.1|LLU02467 Lilium longiflorum Enchantment meiotin-1 mRNA, partial cds
          Length = 902

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 186 cgaagccgaagccgaagccgg 206
           |||||||||||||||||||||
Sbjct: 690 cgaagccgaagccgaagccgg 710



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 186 cgaagccgaagccgaagccgg 206
           |||||||||||||||||||||
Sbjct: 645 cgaagccgaagccgaagccgg 665



to top

>dbj|AB077475.1| Rattus norvegicus mRNA for barmotin, complete cds
          Length = 5352

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4439 ccgaagccgaagccgaagccg 4459



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4433 ccgaagccgaagccgaagccg 4453



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4427 ccgaagccgaagccgaagccg 4447



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4421 ccgaagccgaagccgaagccg 4441



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4415 ccgaagccgaagccgaagccg 4435



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4409 ccgaagccgaagccgaagccg 4429



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 185  ccgaagccgaagccgaagccg 205
            |||||||||||||||||||||
Sbjct: 4403 ccgaagccgaagccgaagccg 4423



to top

>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome
          Length = 3997420

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 184     cccgaagccgaagccgaagccggc 207
               |||||||||||||||| |||||||
Sbjct: 2791028 cccgaagccgaagccggagccggc 2791005



to top

>ref|NM_191195.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1914

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 180 agggcccgaagccgaagccgaagc 203
           |||| |||||||||||||||||||
Sbjct: 695 aggggccgaagccgaagccgaagc 718



to top

>gb|U29382.1| Caenorhabditis elegans cosmid R03H10, complete sequence
          Length = 35080

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 185  ccgaagccgaagccgaagcc 204
            ||||||||||||||||||||
Sbjct: 4857 ccgaagccgaagccgaagcc 4838



to top

>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome
          Length = 2584158

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 185     ccgaagccgaagccgaagcc 204
               ||||||||||||||||||||
Sbjct: 1124856 ccgaagccgaagccgaagcc 1124875



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 189     agccgaagccgaagccggcg 208
               ||||||||||||||||||||
Sbjct: 2736082 agccgaagccgaagccggcg 2736063



to top

>gb|AF016429.1| Caenorhabditis elegans cosmid T21H3, complete sequence
          Length = 38092

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 20013 ccgaagccgaagccgaagcc 20032



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    ccgaagccgaagccgaagcc 204
              ||||||||||||||||||||
Sbjct: 487088 ccgaagccgaagccgaagcc 487107



to top

>emb|Z34800.1|CEF45H7 Caenorhabditis elegans Cosmid F45H7, complete sequence
          Length = 39580

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 185  ccgaagccgaagccgaagcc 204
            ||||||||||||||||||||
Sbjct: 3955 ccgaagccgaagccgaagcc 3936



 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 185  ccgaagccgaagccgaagcc 204
            ||||||||||||||||||||
Sbjct: 3925 ccgaagccgaagccgaagcc 3906



to top

>emb|CR718834.2|CNS0GHLK Tetraodon nigroviridis full-length cDNA
          Length = 805

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 514 ggccatcgccgtcctcttcg 533
           ||||||||||||||||||||
Sbjct: 440 ggccatcgccgtcctcttcg 421



to top

>emb|CR691174.2|CNS0FW9E Tetraodon nigroviridis full-length cDNA
          Length = 1728

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 514 ggccatcgccgtcctcttcg 533
           ||||||||||||||||||||
Sbjct: 502 ggccatcgccgtcctcttcg 483



to top

>gb|AC019210.7| Homo sapiens BAC clone RP11-449G3 from 7, complete sequence
          Length = 177402

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     attagcaacaaaagaaaaca 41
              ||||||||||||||||||||
Sbjct: 124314 attagcaacaaaagaaaaca 124333



to top

>gb|AC011228.9| Homo sapiens BAC clone GS1-18A18 from 7, complete sequence
          Length = 163782

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 22     attagcaacaaaagaaaaca 41
              ||||||||||||||||||||
Sbjct: 125820 attagcaacaaaagaaaaca 125839



to top

>ref|XM_775289.1| PREDICTED: Strongylocentrotus purpuratus similar to SMAD specific
           E3 ubiquitin protein ligase 2 (LOC574887), mRNA
          Length = 1812

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 436 ccgtgaccttcacatcaacg 455
           ||||||||||||||||||||
Sbjct: 378 ccgtgaccttcacatcaacg 397



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 190     gccgaagccgaagccggcga 209
               ||||||||||||||||||||
Sbjct: 4551991 gccgaagccgaagccggcga 4552010



to top

>gb|AY118620.1| Drosophila melanogaster LP11788 full insert cDNA
          Length = 4704

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 530  ttcgatggccaccgcctcta 549
            ||||||||||||||||||||
Sbjct: 3936 ttcgatggccaccgcctcta 3917



to top

>dbj|AK122767.1| Homo sapiens cDNA FLJ16306 fis, clone PUAEN2003954, highly  similar
           to Homo sapiens mitogen-activated protein
           kinase-activated protein kinase 5
          Length = 2527

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 186 cgaagccgaagccgaagccg 205
           ||||||||||||||||||||
Sbjct: 328 cgaagccgaagccgaagccg 309



to top

>dbj|AK096935.1| Homo sapiens cDNA FLJ39616 fis, clone SMINT2000541
          Length = 2285

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 186 cgaagccgaagccgaagccg 205
           ||||||||||||||||||||
Sbjct: 598 cgaagccgaagccgaagccg 617



to top

>ref|NM_143313.1| Drosophila melanogaster CG5639-RA (CG5639), mRNA
          Length = 4849

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 530  ttcgatggccaccgcctcta 549
            ||||||||||||||||||||
Sbjct: 4011 ttcgatggccaccgcctcta 3992



to top

>ref|NM_137181.1| Drosophila melanogaster PS4 CG16827-RA (alphaPS4), mRNA
          Length = 3048

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 141  ccaccaccgcgcaatcctcg 160
            ||||||||||||||||||||
Sbjct: 1669 ccaccaccgcgcaatcctcg 1650



to top

>dbj|AK139555.1| Mus musculus 2 cells egg cDNA, RIKEN full-length enriched library,
           clone:B020004H18 product:RNA binding motif protein 9,
           full insert sequence
          Length = 2132

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 gaagccgaagccgaagccgg 206
           ||||||||||||||||||||
Sbjct: 347 gaagccgaagccgaagccgg 366



to top

>gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp gene cluster, partial
            sequence
          Length = 16929

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 185  ccgaagccgaagccgaagcc 204
            ||||||||||||||||||||
Sbjct: 9500 ccgaagccgaagccgaagcc 9519



to top

>gb|DQ250640.1| Zea mays plastid coproporphyrinogen III oxidase (cpx1) mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1645

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 186 cgaagccgaagccgaagccg 205
           ||||||||||||||||||||
Sbjct: 364 cgaagccgaagccgaagccg 345



to top

>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 532    cgatggccaccgcctctacc 551
              ||||||||||||||||||||
Sbjct: 488870 cgatggccaccgcctctacc 488851



to top

>gb|BC023547.2| Homo sapiens chromosome 12 open reading frame 47, mRNA (cDNA clone
           IMAGE:4110415)
          Length = 1954

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 186 cgaagccgaagccgaagccg 205
           ||||||||||||||||||||
Sbjct: 249 cgaagccgaagccgaagccg 268



to top

>dbj|AK077594.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730462H23 product:fox-1 homolog
           (C. elegans), full insert sequence
          Length = 3559

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 gaagccgaagccgaagccgg 206
           ||||||||||||||||||||
Sbjct: 222 gaagccgaagccgaagccgg 241



to top

>gb|AF320027.1|AF320027 Sorghum bicolor heme oxygenase 2 (HO2) mRNA, partial cds; nuclear
           gene for chloroplast product
          Length = 1444

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 186 cgaagccgaagccgaagccg 205
           ||||||||||||||||||||
Sbjct: 191 cgaagccgaagccgaagccg 210



to top

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 196    gccgaagccggcgacggtca 215
              ||||||||||||||||||||
Sbjct: 273819 gccgaagccggcgacggtca 273838



to top

>gb|BT023104.1| Drosophila melanogaster IP03724 full insert cDNA
          Length = 2049

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 141 ccaccaccgcgcaatcctcg 160
           ||||||||||||||||||||
Sbjct: 515 ccaccaccgcgcaatcctcg 496



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 185      ccgaagccgaagccgaagcc 204
                ||||||||||||||||||||
Sbjct: 10251595 ccgaagccgaagccgaagcc 10251614



to top

>gb|AC008342.12|AC008342 Drosophila melanogaster, chromosome 2R, region 51F-51F, BAC clone
             BACR33K06, complete sequence
          Length = 175007

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   ccaccaccgcgcaatcctcg 160
             ||||||||||||||||||||
Sbjct: 66099 ccaccaccgcgcaatcctcg 66080



to top

>gb|AC007817.7|AC007817 Drosophila melanogaster, chromosome 3R, region 98A-98B, BAC clone
              BACR15D01, complete sequence
          Length = 180499

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 530    ttcgatggccaccgcctcta 549
              ||||||||||||||||||||
Sbjct: 101848 ttcgatggccaccgcctcta 101867



to top

>gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cancer institute Human PAC
             Library) complete sequence
          Length = 137830

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   cgaagccgaagccgaagccg 205
             ||||||||||||||||||||
Sbjct: 51087 cgaagccgaagccgaagccg 51068



to top

>dbj|AP003076.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0481E12
          Length = 161563

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 180   agggcccgaagccgaagccgaagc 203
             |||| |||||||||||||||||||
Sbjct: 25324 aggggccgaagccgaagccgaagc 25301



to top

>gb|AC025716.2| Caenorhabditis elegans cosmid Y39G10AR, complete sequence
          Length = 132558

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 48030 ccgaagccgaagccgaagcc 48011



to top

>dbj|AP004753.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0508B05
          Length = 166165

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   cgaagccgaagccgaagccg 205
             ||||||||||||||||||||
Sbjct: 57502 cgaagccgaagccgaagccg 57521



to top

>dbj|AP004650.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1540_G08
          Length = 126263

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 185   ccgaagccgaagccgaagcc 204
             ||||||||||||||||||||
Sbjct: 57618 ccgaagccgaagccgaagcc 57637



to top

>dbj|AK110860.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-172-D05, full
           insert sequence
          Length = 1629

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 185 ccgaagccgaagccgaagcc 204
           ||||||||||||||||||||
Sbjct: 255 ccgaagccgaagccgaagcc 274



to top

>dbj|AK102467.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094F14, full
            insert sequence
          Length = 2636

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 180  agggcccgaagccgaagccgaagc 203
            |||| |||||||||||||||||||
Sbjct: 1188 aggggccgaagccgaagccgaagc 1211



to top

>gb|BC041049.1| Homo sapiens mitogen-activated protein kinase-activated protein
           kinase 5, transcript variant 1, mRNA (cDNA clone
           MGC:52129 IMAGE:4909021), complete cds
          Length = 2024

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 186 cgaagccgaagccgaagccg 205
           ||||||||||||||||||||
Sbjct: 65  cgaagccgaagccgaagccg 46



to top

>gb|AE003761.2| Drosophila melanogaster chromosome 3R, section 99 of 118 of the complete
              sequence
          Length = 224910

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 530    ttcgatggccaccgcctcta 549
              ||||||||||||||||||||
Sbjct: 151034 ttcgatggccaccgcctcta 151053



to top

>gb|AE003811.3| Drosophila melanogaster chromosome 2R, section 39 of 73 of the complete
              sequence
          Length = 255652

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 141    ccaccaccgcgcaatcctcg 160
              ||||||||||||||||||||
Sbjct: 107601 ccaccaccgcgcaatcctcg 107582



to top

>ref|NM_053104.3| Mus musculus RNA binding motif protein 9 (Rbm9), transcript variant
           1, mRNA
          Length = 3559

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 gaagccgaagccgaagccgg 206
           ||||||||||||||||||||
Sbjct: 222 gaagccgaagccgaagccgg 241



to top

>dbj|AP004982.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT04L20, TM0437a,
             complete sequence
          Length = 48314

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 495   gggacttcacctggatccaggccatcgccgtcctcttcga 534
             |||||||||||||| ||||  |||||||  ||||||||||
Sbjct: 25999 gggacttcacctgggtccaatccatcgctatcctcttcga 25960



to top

>emb|AL772386.4| Mouse DNA sequence from clone RP23-89G22 on chromosome 15, complete
              sequence
          Length = 149807

 Score = 40.1 bits (20), Expect = 7.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 187    gaagccgaagccgaagccgg 206
              ||||||||||||||||||||
Sbjct: 117840 gaagccgaagccgaagccgg 117859


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,927,888
Number of Sequences: 3902068
Number of extensions: 3927888
Number of successful extensions: 83545
Number of sequences better than 10.0: 148
Number of HSP's better than 10.0 without gapping: 154
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79935
Number of HSP's gapped (non-prelim): 3506
length of query: 569
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 546
effective length of database: 17,143,297,704
effective search space: 9360240546384
effective search space used: 9360240546384
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top