>emb|AL359997.8| Human DNA sequence from clone RP11-71A24 on chromosome 9 Contains the 5'
end of the ALDH1A1 gene for member A1 of the aldehyde
dehydrogenase 1 family, a cytochrome P450 family 1
subfamily A polypeptide 1 (CYP1A1) pseudogene and the ANXA1
gene for annexin I, complete sequence
Length = 169102
Score = 42.1 bits (21), Expect = 1.6
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 307 tgtgtccaaggagttctttaa 327
|||||||||||||||||||||
Sbjct: 134477 tgtgtccaaggagttctttaa 134457
>emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on chromosome 10 Contains the
3' end of the gene for a novel protein (LOC220929)
(FLJ32761), a DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide
10 (RNA helicase) (DDH10) pseudogene and a CpG island,
complete sequence
Length = 179798
Score = 40.1 bits (20), Expect = 6.3
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 221 aaactgcagtccgctttggagaac 244
|||||||||||| |||||||||||
Sbjct: 17022 aaactgcagtcccctttggagaac 17045
>emb|AL683828.8| Mouse DNA sequence from clone RP23-340H1 on chromosome 4 Contains the
3' end of the Col27a1 gene for procollagen type XXVII
alpha 1, the Orm1, Orm2 and Orm3 genes for orosomucoid 1,
2 and 3, an orosomucoid pseudogene, the gene for a novel
protein similar to human AT-hook protein AKNA, gene
4933437N03Rik, the Whrn gene for whirlin and two CpG
islands, complete sequence
Length = 214370
Score = 40.1 bits (20), Expect = 6.3
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 235 tttggagaactggggctttt 254
||||||||||||||||||||
Sbjct: 19796 tttggagaactggggctttt 19815
>dbj|AP004798.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
clone:P0572D06
Length = 148920
Score = 40.1 bits (20), Expect = 6.3
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 77 ctggtggccggcggcgtgcaggag 100
||||||||||||||||||| ||||
Sbjct: 19565 ctggtggccggcggcgtgccggag 19542
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,063,476
Number of Sequences: 3902068
Number of extensions: 3063476
Number of successful extensions: 53078
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52756
Number of HSP's gapped (non-prelim): 322
length of query: 469
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 447
effective length of database: 17,147,199,772
effective search space: 7664798298084
effective search space used: 7664798298084
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)