ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | bart26h11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY107771.1| Zea mays PCO121395 mRNA sequence Length = 1573 Score = 341 bits (172), Expect = 1e-90 Identities = 387/459 (84%) Strand = Plus / Plus Query: 47 cagccctccttcagcgtcaaggacaggccggcaacatccatgattgaagatgcggagaag 106 ||||| |||||||||||||| ||||| ||||| | || ||| | ||||| || || ||| Sbjct: 460 cagccgtccttcagcgtcaaagacagaccggcgatctcgatgctggaagacgctgaaaag 519 Query: 107 aagggattgatcaccccgggcaagacgacgctgatcgagcctacgtccggcaacatgggc 166 | ||| | ||||| || || ||||| ||| |||||||||| ||||| || ||||||||| Sbjct: 520 agggggctcatcactccaggaaagaccacgttgatcgagcccacgtcggggaacatgggc 579 Query: 167 atcggcctggcgttcatggcggcgctcaaagggtacgagctcgtgctgacgatgccgtcc 226 ||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||||||| Sbjct: 580 atcgggctggcgttcatggcggcgctcaaggggtacgagctcgtgctcaccatgccgtcc 639 Query: 227 tacaccagcctcgagcggagggtggtcatgaaggccttcggcgcgcagctcgtgctcacc 286 ||||||||||| ||| |||||||| ||| ||| |||||||| | || ||||| ||| Sbjct: 640 tacaccagcctggagaggagggtgacgatgcgggcgttcggcgccaacctggtgctgacc 699 Query: 287 gacccggccaaagggatggggggcaccgtgaggaaggccacccagctctatgagaaccat 346 |||||||||||||||||||| || || ||||||||||| || |||| || |||| ||| Sbjct: 700 gacccggccaaagggatgggcgggacggtgaggaaggcgacggagctgtacgagagacat 759 Query: 347 cctagcgcattcatgctccagcagttcgagaaccctgccaacgtacaggtgcactacgag 406 || ||||| |||||||||||||||| |||||||||||||||| ||||||||||||| Sbjct: 760 cccagcgcgcacatgctccagcagttccagaaccctgccaacgtcaaggtgcactacgac 819 Query: 407 accaccggtccagagatatgggaggacacgcttgggcaggtcgacatcttcgtcatgggc 466 || || || || ||||| ||||||||||||||||| |||||||| |||||||||||||| Sbjct: 820 acgacgggaccggagatctgggaggacacgcttggccaggtcgatatcttcgtcatgggg 879 Query: 467 atcgggagcggcggtactgtcaccggcgtcggcnagtac 505 |||||||||||||| || ||||| || |||||| ||||| Sbjct: 880 atcgggagcggcggcaccgtcacgggagtcggcaagtac 918
>gb|AY720933.1| Oryza sativa (indica cultivar-group) beta-cyanoalanine synthase (CAS) mRNA, complete cds Length = 1406 Score = 291 bits (147), Expect = 1e-75 Identities = 369/443 (83%) Strand = Plus / Plus Query: 47 cagccctccttcagcgtcaaggacaggccggcaacatccatgattgaagatgcggagaag 106 ||||| |||||||||||||||||||| || |||| || ||| | |||||||| || ||| Sbjct: 333 cagccgtccttcagcgtcaaggacagaccagcaatttcaatgttggaagatgctgaaaag 392 Query: 107 aagggattgatcaccccgggcaagacgacgctgatcgagcctacgtccggcaacatgggc 166 ||||| ||||||||||| |||||||| || ||||||||||| || || || |||||||| Sbjct: 393 aaggggttgatcaccccaggcaagaccacactgatcgagccgacatcagggaacatgggt 452 Query: 167 atcggcctggcgttcatggcggcgctcaaagggtacgagctcgtgctgacgatgccgtcc 226 || |||||||| |||||||| || || |||||||| || ||| | || || ||||| || Sbjct: 453 attggcctggcattcatggctgctcttaaagggtatgaactcatactcacaatgccttca 512 Query: 227 tacaccagcctcgagcggagggtggtcatgaaggccttcggcgcgcagctcgtgctcacc 286 ||||||||||| ||| |||||||| ||||| |||||||||||| | ||||| || ||| Sbjct: 513 tacaccagccttgagaggagggtgaccatgagggccttcggcgcaaaactcgtccttacc 572 Query: 287 gacccggccaaagggatggggggcaccgtgaggaaggccacccagctctatgagaaccat 346 ||||| | ||||| ||||| ||||| |||||||||||| || |||| |||||||||||| Sbjct: 573 gacccaacaaaaggtatgggaggcacggtgaggaaggccgccgagctgtatgagaaccat 632 Query: 347 cctagcgcattcatgctccagcagttcgagaaccctgccaacgtacaggtgcactacgag 406 |||||||| |||||||| |||||||| ||||| ||||| || || |||| ||||| ||| Sbjct: 633 cctagcgcgttcatgctgcagcagtttgagaatcctgcaaatgtcaaggtacactatgag 692 Query: 407 accaccggtccagagatatgggaggacacgcttgggcaggtcgacatcttcgtcatgggc 466 || || |||||||| || |||||||| || ||||||||||| || || || |||||||| Sbjct: 693 acaactggtccagaaatctgggaggatacacttgggcaggttgatatttttgtcatggga 752 Query: 467 atcgggagcggcggtactgtcac 489 |||||||||||||| || ||||| Sbjct: 753 atcgggagcggcggcaccgtcac 775
>ref|XM_474584.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1134 Score = 283 bits (143), Expect = 3e-73 Identities = 368/443 (83%) Strand = Plus / Plus Query: 47 cagccctccttcagcgtcaaggacaggccggcaacatccatgattgaagatgcggagaag 106 ||||| |||||||||||||||||||| || |||| || ||| | |||||||| || ||| Sbjct: 277 cagccgtccttcagcgtcaaggacagaccagcaatttcaatgttggaagatgctgaaaag 336 Query: 107 aagggattgatcaccccgggcaagacgacgctgatcgagcctacgtccggcaacatgggc 166 ||||| ||||||||||| || ||||| || ||||||||||| || || || |||||||| Sbjct: 337 aaggggttgatcaccccaggtaagaccacactgatcgagccgacatcagggaacatgggt 396 Query: 167 atcggcctggcgttcatggcggcgctcaaagggtacgagctcgtgctgacgatgccgtcc 226 || |||||||| |||||||| || || |||||||| || ||| | || || ||||| || Sbjct: 397 attggcctggcattcatggctgctcttaaagggtatgaactcatactcacaatgccttca 456 Query: 227 tacaccagcctcgagcggagggtggtcatgaaggccttcggcgcgcagctcgtgctcacc 286 ||||||||||| ||| |||||||| ||||| |||||||||||| | ||||| || ||| Sbjct: 457 tacaccagccttgagaggagggtgaccatgagggccttcggcgcaaaactcgtccttacc 516 Query: 287 gacccggccaaagggatggggggcaccgtgaggaaggccacccagctctatgagaaccat 346 ||||| | ||||| ||||| ||||| |||||||||||| || |||| |||||||||||| Sbjct: 517 gacccaacaaaaggtatgggaggcacggtgaggaaggccgccgagctgtatgagaaccat 576 Query: 347 cctagcgcattcatgctccagcagttcgagaaccctgccaacgtacaggtgcactacgag 406 |||||||| |||||||| |||||||| ||||| ||||| || || |||| ||||| ||| Sbjct: 577 cctagcgcgttcatgctgcagcagtttgagaatcctgcaaatgtcaaggtacactatgag 636 Query: 407 accaccggtccagagatatgggaggacacgcttgggcaggtcgacatcttcgtcatgggc 466 || || |||||||| || |||||||| || ||||||||||| || || || |||||||| Sbjct: 637 acaactggtccagaaatctgggaggatacacttgggcaggttgatatttttgtcatggga 696 Query: 467 atcgggagcggcggtactgtcac 489 |||||||||||||| || ||||| Sbjct: 697 atcgggagcggcggcaccgtcac 719
>dbj|AK102512.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095I16, full insert sequence Length = 1436 Score = 283 bits (143), Expect = 3e-73 Identities = 368/443 (83%) Strand = Plus / Plus Query: 47 cagccctccttcagcgtcaaggacaggccggcaacatccatgattgaagatgcggagaag 106 ||||| |||||||||||||||||||| || |||| || ||| | |||||||| || ||| Sbjct: 333 cagccgtccttcagcgtcaaggacagaccagcaatttcaatgttggaagatgctgaaaag 392 Query: 107 aagggattgatcaccccgggcaagacgacgctgatcgagcctacgtccggcaacatgggc 166 ||||| ||||||||||| || ||||| || ||||||||||| || || || |||||||| Sbjct: 393 aaggggttgatcaccccaggtaagaccacactgatcgagccgacatcagggaacatgggt 452 Query: 167 atcggcctggcgttcatggcggcgctcaaagggtacgagctcgtgctgacgatgccgtcc 226 || |||||||| |||||||| || || |||||||| || ||| | || || ||||| || Sbjct: 453 attggcctggcattcatggctgctcttaaagggtatgaactcatactcacaatgccttca 512 Query: 227 tacaccagcctcgagcggagggtggtcatgaaggccttcggcgcgcagctcgtgctcacc 286 ||||||||||| ||| |||||||| ||||| |||||||||||| | ||||| || ||| Sbjct: 513 tacaccagccttgagaggagggtgaccatgagggccttcggcgcaaaactcgtccttacc 572 Query: 287 gacccggccaaagggatggggggcaccgtgaggaaggccacccagctctatgagaaccat 346 ||||| | ||||| ||||| ||||| |||||||||||| || |||| |||||||||||| Sbjct: 573 gacccaacaaaaggtatgggaggcacggtgaggaaggccgccgagctgtatgagaaccat 632 Query: 347 cctagcgcattcatgctccagcagttcgagaaccctgccaacgtacaggtgcactacgag 406 |||||||| |||||||| |||||||| ||||| ||||| || || |||| ||||| ||| Sbjct: 633 cctagcgcgttcatgctgcagcagtttgagaatcctgcaaatgtcaaggtacactatgag 692 Query: 407 accaccggtccagagatatgggaggacacgcttgggcaggtcgacatcttcgtcatgggc 466 || || |||||||| || |||||||| || ||||||||||| || || || |||||||| Sbjct: 693 acaactggtccagaaatctgggaggatacacttgggcaggttgatatttttgtcatggga 752 Query: 467 atcgggagcggcggtactgtcac 489 |||||||||||||| || ||||| Sbjct: 753 atcgggagcggcggcaccgtcac 775
>emb|AL662959.3|OSJN00160 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019G23, complete sequence Length = 150305 Score = 167 bits (84), Expect = 4e-38 Identities = 207/248 (83%) Strand = Plus / Minus Query: 137 ctgatcgagcctacgtccggcaacatgggcatcggcctggcgttcatggcggcgctcaaa 196 ||||||||||| || || || |||||||| || |||||||| |||||||| || || ||| Sbjct: 59438 ctgatcgagccgacatcagggaacatgggtattggcctggcattcatggctgctcttaaa 59379 Query: 197 gggtacgagctcgtgctgacgatgccgtcctacaccagcctcgagcggagggtggtcatg 256 ||||| || ||| | || || ||||| || ||||||||||| ||| |||||||| |||| Sbjct: 59378 gggtatgaactcatactcacaatgccttcatacaccagccttgagaggagggtgaccatg 59319 Query: 257 aaggccttcggcgcgcagctcgtgctcaccgacccggccaaagggatggggggcaccgtg 316 | |||||||||||| | ||||| || |||||||| | ||||| ||||| ||||| ||| Sbjct: 59318 agggccttcggcgcaaaactcgtccttaccgacccaacaaaaggtatgggaggcacggtg 59259 Query: 317 aggaaggccacccagctctatgagaaccatcctagcgcattcatgctccagcagttcgag 376 ||||||||| || |||| |||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 59258 aggaaggccgccgagctgtatgagaaccatcctagcgcgttcatgctgcagcagtttgag 59199 Query: 377 aaccctgc 384 || ||||| Sbjct: 59198 aatcctgc 59191 Score = 73.8 bits (37), Expect = 5e-10 Identities = 82/97 (84%) Strand = Plus / Minus Query: 393 aggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcgaca 452 |||| ||||| ||||| || |||||||| || |||||||| || ||||||||||| || | Sbjct: 58916 aggtacactatgagacaactggtccagaaatctgggaggatacacttgggcaggttgata 58857 Query: 453 tcttcgtcatgggcatcgggagcggcggtactgtcac 489 | || |||||||| |||||||||||||| || ||||| Sbjct: 58856 tttttgtcatgggaatcgggagcggcggcaccgtcac 58820 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 47 cagccctccttcagcgtcaaggacagg 73 ||||| ||||||||||||||||||||| Sbjct: 61018 cagccgtccttcagcgtcaaggacagg 60992 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 92 gaagatgcggagaagaagggattgatcacccc 123 |||||||| || |||||||| ||||||||||| Sbjct: 59801 gaagatgctgaaaagaaggggttgatcacccc 59770
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 167 bits (84), Expect = 4e-38 Identities = 207/248 (83%) Strand = Plus / Minus Query: 137 ctgatcgagcctacgtccggcaacatgggcatcggcctggcgttcatggcggcgctcaaa 196 ||||||||||| || || || |||||||| || |||||||| |||||||| || || ||| Sbjct: 4431706 ctgatcgagccgacatcagggaacatgggtattggcctggcattcatggctgctcttaaa 4431647 Query: 197 gggtacgagctcgtgctgacgatgccgtcctacaccagcctcgagcggagggtggtcatg 256 ||||| || ||| | || || ||||| || ||||||||||| ||| |||||||| |||| Sbjct: 4431646 gggtatgaactcatactcacaatgccttcatacaccagccttgagaggagggtgaccatg 4431587 Query: 257 aaggccttcggcgcgcagctcgtgctcaccgacccggccaaagggatggggggcaccgtg 316 | |||||||||||| | ||||| || |||||||| | ||||| ||||| ||||| ||| Sbjct: 4431586 agggccttcggcgcaaaactcgtccttaccgacccaacaaaaggtatgggaggcacggtg 4431527 Query: 317 aggaaggccacccagctctatgagaaccatcctagcgcattcatgctccagcagttcgag 376 ||||||||| || |||| |||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 4431526 aggaaggccgccgagctgtatgagaaccatcctagcgcgttcatgctgcagcagtttgag 4431467 Query: 377 aaccctgc 384 || ||||| Sbjct: 4431466 aatcctgc 4431459 Score = 73.8 bits (37), Expect = 5e-10 Identities = 82/97 (84%) Strand = Plus / Minus Query: 393 aggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcgaca 452 |||| ||||| ||||| || |||||||| || |||||||| || ||||||||||| || | Sbjct: 4431184 aggtacactatgagacaactggtccagaaatctgggaggatacacttgggcaggttgata 4431125 Query: 453 tcttcgtcatgggcatcgggagcggcggtactgtcac 489 | || |||||||| |||||||||||||| || ||||| Sbjct: 4431124 tttttgtcatgggaatcgggagcggcggcaccgtcac 4431088 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 47 cagccctccttcagcgtcaaggacagg 73 ||||| ||||||||||||||||||||| Sbjct: 4433286 cagccgtccttcagcgtcaaggacagg 4433260 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 92 gaagatgcggagaagaagggattgatcacccc 123 |||||||| || |||||||| ||||||||||| Sbjct: 4432069 gaagatgctgaaaagaaggggttgatcacccc 4432038
>emb|AL442113.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0806H05, complete sequence Length = 102515 Score = 167 bits (84), Expect = 4e-38 Identities = 207/248 (83%) Strand = Plus / Minus Query: 137 ctgatcgagcctacgtccggcaacatgggcatcggcctggcgttcatggcggcgctcaaa 196 ||||||||||| || || || |||||||| || |||||||| |||||||| || || ||| Sbjct: 95969 ctgatcgagccgacatcagggaacatgggtattggcctggcattcatggctgctcttaaa 95910 Query: 197 gggtacgagctcgtgctgacgatgccgtcctacaccagcctcgagcggagggtggtcatg 256 ||||| || ||| | || || ||||| || ||||||||||| ||| |||||||| |||| Sbjct: 95909 gggtatgaactcatactcacaatgccttcatacaccagccttgagaggagggtgaccatg 95850 Query: 257 aaggccttcggcgcgcagctcgtgctcaccgacccggccaaagggatggggggcaccgtg 316 | |||||||||||| | ||||| || |||||||| | ||||| ||||| ||||| ||| Sbjct: 95849 agggccttcggcgcaaaactcgtccttaccgacccaacaaaaggtatgggaggcacggtg 95790 Query: 317 aggaaggccacccagctctatgagaaccatcctagcgcattcatgctccagcagttcgag 376 ||||||||| || |||| |||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 95789 aggaaggccgccgagctgtatgagaaccatcctagcgcgttcatgctgcagcagtttgag 95730 Query: 377 aaccctgc 384 || ||||| Sbjct: 95729 aatcctgc 95722 Score = 73.8 bits (37), Expect = 5e-10 Identities = 82/97 (84%) Strand = Plus / Minus Query: 393 aggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcgaca 452 |||| ||||| ||||| || |||||||| || |||||||| || ||||||||||| || | Sbjct: 95447 aggtacactatgagacaactggtccagaaatctgggaggatacacttgggcaggttgata 95388 Query: 453 tcttcgtcatgggcatcgggagcggcggtactgtcac 489 | || |||||||| |||||||||||||| || ||||| Sbjct: 95387 tttttgtcatgggaatcgggagcggcggcaccgtcac 95351 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Minus Query: 47 cagccctccttcagcgtcaaggacagg 73 ||||| ||||||||||||||||||||| Sbjct: 97549 cagccgtccttcagcgtcaaggacagg 97523 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/39 (89%) Strand = Plus / Minus Query: 92 gaagatgcggagaagaagggattgatcaccccgggcaag 130 |||||||| || |||||||| ||||||||||| |||||| Sbjct: 96332 gaagatgctgaaaagaaggggttgatcaccccaggcaag 96294
>gb|DQ428338.1| Sorghum propinquum locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacaggagtcggcaagtac 359
>gb|DQ428337.1| Sorghum bicolor voucher PI585454 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428336.1| Sorghum bicolor voucher PI267539 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428335.1| Sorghum bicolor voucher PI267408 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428334.1| Sorghum bicolor voucher PI221607 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428333.1| Sorghum bicolor voucher PI152702 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428332.1| Sorghum bicolor voucher NSL92371 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428331.1| Sorghum bicolor voucher NSL87902 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428330.1| Sorghum bicolor voucher NSL87666 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428329.1| Sorghum bicolor voucher NSL77217 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428328.1| Sorghum bicolor voucher NSL77034 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428327.1| Sorghum bicolor voucher NSL56174 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428326.1| Sorghum bicolor voucher NSL56003 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428325.1| Sorghum bicolor voucher NSL55243 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428324.1| Sorghum bicolor voucher NSL51365 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428323.1| Sorghum bicolor voucher NSL51030 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428322.1| Sorghum bicolor voucher NSL50875 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>gb|DQ428321.1| Sorghum bicolor voucher BTx623 locus PRC0362 genomic sequence Length = 766 Score = 111 bits (56), Expect = 2e-21 Identities = 100/115 (86%) Strand = Plus / Plus Query: 391 acaggtgcactacgagaccaccggtccagagatatgggaggacacgcttgggcaggtcga 450 |||||| || || ||||| || |||||||| |||||||||||||| ||||| ||||| || Sbjct: 245 acaggtacattatgagacaacgggtccagaaatatgggaggacacacttggacaggttga 304 Query: 451 catcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggcnagtac 505 ||| || ||||||||||||||||| |||||||||||||| || |||||| ||||| Sbjct: 305 catttttgtcatgggcatcgggagtggcggtactgtcacgggagtcggcaagtac 359
>dbj|D37963.1|SPICYSCA Spinacia oleracea cysC mRNA for cysteine synthase, complete cds Length = 1468 Score = 56.0 bits (28), Expect = 1e-04 Identities = 85/104 (81%) Strand = Plus / Plus Query: 86 atgattgaagatgcggagaagaagggattgatcaccccgggcaagacgacgctgatcgag 145 |||||||||||||| ||||| |||||||| || | || || |||||| | |||||||| Sbjct: 455 atgattgaagatgcagagaaaaagggattaatttctccaggaaagacggtgttgatcgag 514 Query: 146 cctacgtccggcaacatgggcatcggcctggcgttcatggcggc 189 || || || || |||||||| || || |||||||||||||||| Sbjct: 515 ccaacatcaggaaacatgggaataagcatggcgttcatggcggc 558
>gb|AE004527.1| Pseudomonas aeruginosa PAO1, section 88 of 529 of the complete genome Length = 12080 Score = 48.1 bits (24), Expect = 0.028 Identities = 39/44 (88%) Strand = Plus / Plus Query: 134 acgctgatcgagcctacgtccggcaacatgggcatcggcctggc 177 |||||||||||| |||| |||||||||| ||||||| |||||| Sbjct: 9946 acgctgatcgaggctacttccggcaacaccggcatcgccctggc 9989
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 48.1 bits (24), Expect = 0.028 Identities = 30/32 (93%) Strand = Plus / Plus Query: 357 tcatgctccagcagttcgagaaccctgccaac 388 |||| |||||||||||||||||||| |||||| Sbjct: 3022171 tcatcctccagcagttcgagaacccagccaac 3022202 Score = 46.1 bits (23), Expect = 0.11 Identities = 26/27 (96%) Strand = Plus / Plus Query: 362 ctccagcagttcgagaaccctgccaac 388 |||||||||||||||||||| |||||| Sbjct: 1486159 ctccagcagttcgagaacccggccaac 1486185
>gb|AF078693.1|AF078693 Chlamydomonas reinhardtii putative O-acetylserine(thiol)lyase precursor (Crcys-1A) mRNA, nuclear gene encoding organellar protein, complete cds Length = 1492 Score = 48.1 bits (24), Expect = 0.028 Identities = 57/68 (83%) Strand = Plus / Plus Query: 356 ttcatgctccagcagttcgagaaccctgccaacgtacaggtgcactacgagaccaccggt 415 |||||||| ||||||||| ||||||| |||| |||||||||||||||||||||| Sbjct: 583 ttcatgctgcagcagttccagaaccccaacaaccccaaggtgcactacgagaccaccggc 642 Query: 416 ccagagat 423 || ||||| Sbjct: 643 cccgagat 650
>ref|NM_117574.2| Arabidopsis thaliana OASA1 AT4G14880 (OASA1) transcript variant AT4G14880.1 mRNA, complete cds Length = 1365 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 580 catgcttcagcagtttgagaaccctgccaac 610
>ref|NM_179055.2| Arabidopsis thaliana OASA1 AT4G14880 (OASA1) transcript variant AT4G14880.2 mRNA, complete cds Length = 1314 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 525 catgcttcagcagtttgagaaccctgccaac 555
>emb|Z97337.2|ATFCA2 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 2 Length = 202860 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 84434 catgcttcagcagtttgagaaccctgccaac 84404
>emb|Y10845.1|BJY10845 Brassica juncea mRNA for O-acetylserine(thiol) lyase, clone OAS-TL4 Length = 1280 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 ||||||||| ||||| ||||||||||||||| Sbjct: 502 catgctccaacagtttgagaaccctgccaac 532
>emb|X84097.1|ATCYS3A A.thaliana mRNA for cysteine synthase Length = 1332 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 527 catgcttcagcagtttgagaaccctgccaac 557
>emb|X80376.2|ATOACLY Arabidopsis thaliana mRNA for O-acetylserine lyase (At.OAS.5-8) Length = 1253 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 490 catgcttcagcagtttgagaaccctgccaac 520
>gb|AY045825.1| Arabidopsis thaliana putative cytosolic O-acetylserine(thiol)lyase (At4g14880) mRNA, complete cds Length = 1254 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 503 catgcttcagcagtttgagaaccctgccaac 533
>emb|AJ272027.1|ATH272027 Arabidopsis thaliana oasA1 gene for O-acetylserine (thiol) lyase A1, exons 1-11 Length = 5340 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 2832 catgcttcagcagtttgagaaccctgccaac 2862
>emb|BX827385.1|CNS0A2GK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS48ZF11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1229 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 493 catgcttcagcagtttgagaaccctgccaac 523
>gb|AY112530.1| Zea mays CL5251_1 mRNA sequence Length = 1258 Score = 46.1 bits (23), Expect = 0.11 Identities = 62/75 (82%) Strand = Plus / Plus Query: 358 catgctccagcagttcgagaaccctgccaacgtacaggtgcactacgagaccaccggtcc 417 |||||| || |||||||| |||||||||||| |||| || || ||||| || ||||| Sbjct: 423 catgcttcaacagttcgataaccctgccaaccctaaggtacattatgagactactggtcc 482 Query: 418 agagatatgggagga 432 |||||| |||||||| Sbjct: 483 agagatctgggagga 497
>dbj|AB075037.1| Rhodococcus erythropolis pDR51-orf4, pDR51-orf1, pDR51-orf2, pDR51-orf3 genes, partial and complete cds Length = 3871 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Plus Query: 398 cactacgagaccaccggtccagagatatggg 428 |||||||||||||||||||| ||||| |||| Sbjct: 1251 cactacgagaccaccggtcccgagatctggg 1281
>emb|AL161540.2|ATCHRIV40 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 40 Length = 197405 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 358 catgctccagcagttcgagaaccctgccaac 388 |||||| |||||||| ||||||||||||||| Sbjct: 29888 catgcttcagcagtttgagaaccctgccaac 29858
>gb|CP000148.1| Geobacter metallireducens GS-15, complete genome Length = 3997420 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 398 cactacgagaccaccggtccagagat 423 |||||||||||||||||||| ||||| Sbjct: 296321 cactacgagaccaccggtccggagat 296296
>gb|AF319543.1| Streptomyces venezuelae putative acetyl-CoA acetyltransferase and cystathionine beta-synthase (CbsSV) genes, complete cds Length = 6927 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Plus Query: 141 tcgagcctacgtccggcaacatgggcatcggcctggcg 178 ||||||| ||||||||||||| ||| ||||||||||| Sbjct: 4662 tcgagcccacgtccggcaacaccggcgtcggcctggcg 4699 Score = 42.1 bits (21), Expect = 1.7 Identities = 30/33 (90%) Strand = Plus / Plus Query: 398 cactacgagaccaccggtccagagatatgggag 430 |||||||||||||||||||| ||| | |||||| Sbjct: 4928 cactacgagaccaccggtcccgagctctgggag 4960
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 44.1 bits (22), Expect = 0.44 Identities = 28/30 (93%) Strand = Plus / Minus Query: 132 cgacgctgatcgagcctacgtccggcaaca 161 |||||||||||||||| ||||| ||||||| Sbjct: 740206 cgacgctgatcgagccaacgtcgggcaaca 740177
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 44.1 bits (22), Expect = 0.44 Identities = 40/46 (86%) Strand = Plus / Minus Query: 125 ggcaagacgacgctgatcgagcctacgtccggcaacatgggcatcg 170 |||||||||||||||||||| || || || ||||||| ||||||| Sbjct: 3663526 ggcaagacgacgctgatcgaaccgacctcgggcaacaccggcatcg 3663481 Score = 40.1 bits (20), Expect = 6.8 Identities = 47/56 (83%) Strand = Plus / Minus Query: 444 aggtcgacatcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggc 499 ||||||||||||||||| |||||||| | ||||| || |||||||||||||| Sbjct: 3663207 aggtcgacatcttcgtcgccggcatcggcacgggcggcaccatcaccggcgtcggc 3663152
>ref|NM_211739.1| Eremothecium gossypii AGR012Cp (AGR012C), mRNA Length = 1479 Score = 44.1 bits (22), Expect = 0.44 Identities = 28/30 (93%) Strand = Plus / Plus Query: 132 cgacgctgatcgagcctacgtccggcaaca 161 |||||||||||||||| ||||| ||||||| Sbjct: 206 cgacgctgatcgagccaacgtcgggcaaca 235
>gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome Length = 2364842 Score = 42.1 bits (21), Expect = 1.7 Identities = 45/53 (84%) Strand = Plus / Plus Query: 447 tcgacatcttcgtcatgggcatcgggagcggcggtactgtcaccggcgtcggc 499 |||||||||||||| |||||||| | |||||| || |||||||||||||| Sbjct: 1742877 tcgacatcttcgtctccggcatcggcaccggcggcaccatcaccggcgtcggc 1742929
>gb|AE016853.1| Pseudomonas syringae pv. tomato str. DC3000 complete genome Length = 6397126 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 129 agacgacgctgatcgagcctacgtccggcaacatggg 165 ||||||||||||||||| || | ||||||||| |||| Sbjct: 3329656 agacgacgctgatcgagtcttcatccggcaacctggg 3329620
>gb|DQ471309.1| Malus x domestica beta-cyanoalanine synthase 2 mRNA, complete cds Length = 1486 Score = 42.1 bits (21), Expect = 1.7 Identities = 51/61 (83%) Strand = Plus / Plus Query: 129 agacgacgctgatcgagcctacgtccggcaacatgggcatcggcctggcgttcatggcgg 188 |||| |||||||||||||| ||||| || || ||||| ||| || |||| || ||||||| Sbjct: 420 agacaacgctgatcgagccaacgtcggggaatatgggaatcagcatggcttttatggcgg 479 Query: 189 c 189 | Sbjct: 480 c 480
>gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete sequence Length = 108644 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 407 accaccggtccagagatatgg 427 ||||||||||||||||||||| Sbjct: 101131 accaccggtccagagatatgg 101111
>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome Length = 4639675 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 405 agaccaccggtccagagatatggga 429 ||||||||||||| ||||||||||| Sbjct: 2530894 agaccaccggtccggagatatggga 2530918
>emb|X12615.1|ECCYSK E. coli cysK gene for O-acetylserine sulfhydrylase Length = 1923 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 405 agaccaccggtccagagatatggga 429 ||||||||||||| ||||||||||| Sbjct: 1240 agaccaccggtccggagatatggga 1264
>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome Length = 4646332 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 405 agaccaccggtccagagatatggga 429 ||||||||||||| ||||||||||| Sbjct: 2538318 agaccaccggtccggagatatggga 2538342
>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome Length = 4712337 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 71 aggccggcaacatccatgatt 91 ||||||||||||||||||||| Sbjct: 3822649 aggccggcaacatccatgatt 3822629
>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome Length = 3544776 Score = 42.1 bits (21), Expect = 1.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 149 acgtccggcaacatgggcatcggcctggc 177 ||||||||||||| |||||||||||||| Sbjct: 1561317 acgtccggcaacaccggcatcggcctggc 1561345
>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome Length = 1849742 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Plus Query: 257 aaggccttcggcgcgcagctcgtgctcaccgacccgg 293 |||||||| ||||| ||||||| ||||||||||||| Sbjct: 328390 aaggcctttggcgccgagctcgtcctcaccgacccgg 328426
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 259 ggccttcggcgcgcagctcgt 279 ||||||||||||||||||||| Sbjct: 3556828 ggccttcggcgcgcagctcgt 3556848 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 461 atgggcatcgggagcggcgg 480 |||||||||||||||||||| Sbjct: 349623 atgggcatcgggagcggcgg 349604
>gb|AE017221.1| Thermus thermophilus HB27, complete genome Length = 1894877 Score = 42.1 bits (21), Expect = 1.7 Identities = 33/37 (89%) Strand = Plus / Minus Query: 257 aaggccttcggcgcgcagctcgtgctcaccgacccgg 293 |||||||| ||||| ||||||| ||||||||||||| Sbjct: 1557071 aaggcctttggcgccgagctcgtcctcaccgacccgg 1557035
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 152 tccggcaacatgggcatcggc 172 ||||||||||||||||||||| Sbjct: 1067777 tccggcaacatgggcatcggc 1067757
>gb|M21451.1|ECOCYSPTS E.coli cysZ, cysK, ptsH, and ptsI genes, complete cds Length = 2597 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Plus Query: 405 agaccaccggtccagagatatggga 429 ||||||||||||| ||||||||||| Sbjct: 1241 agaccaccggtccggagatatggga 1265
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 154 cggcaacatgggcatcggcc 173 |||||||||||||||||||| Sbjct: 1254938 cggcaacatgggcatcggcc 1254919
>ref|NM_194725.1| Oryza sativa (japonica cultivar-group) putative NBS-LRR type resistance protein (OSJNAb0072F04.16), mRNA Length = 3969 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 89 attgaagatgcggagaagaaggga 112 ||||||||||||||| |||||||| Sbjct: 145 attgaagatgcggaggagaaggga 168
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 cgggcaagacgacgctgatc 142 |||||||||||||||||||| Sbjct: 1561735 cgggcaagacgacgctgatc 1561716
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 365 cagcagttcgagaaccctgccaac 388 |||||||||||||| ||||||||| Sbjct: 1662296 cagcagttcgagaatcctgccaac 1662273
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 40.1 bits (20), Expect = 6.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 260 gccttcggcgcgcagctcgtgctcaccgaccc 291 |||| ||||||||||||| | ||||||||||| Sbjct: 1760999 gcctacggcgcgcagctcattctcaccgaccc 1761030
>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome Length = 2462499 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 164 ggcatcggcctggcgttcat 183 |||||||||||||||||||| Sbjct: 1703695 ggcatcggcctggcgttcat 1703714
>gb|AC108419.7| Mus musculus chromosome 1, clone RP23-210C21, complete sequence Length = 212445 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 agaagaagggattgatcacc 121 |||||||||||||||||||| Sbjct: 48968 agaagaagggattgatcacc 48987
>gb|CP000272.1| Burkholderia xenovorans LB400 chromosome 3, complete sequence Length = 1471779 Score = 40.1 bits (20), Expect = 6.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 136 gctgatcgagcctacgtccggcaacatgggcatcgg 171 |||||||||||| || ||||| |||| ||||||||| Sbjct: 262282 gctgatcgagccgacctccgggaacacgggcatcgg 262317
>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence Length = 3806533 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 ccggcaacatgggcatcggc 172 |||||||||||||||||||| Sbjct: 1348573 ccggcaacatgggcatcggc 1348554
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone Pseudo10p0.0-10p4.4, complete sequence Length = 2331000 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 89 attgaagatgcggagaagaaggga 112 ||||||||||||||| |||||||| Sbjct: 1888181 attgaagatgcggaggagaaggga 1888158
>emb|BX572606.1| Rhodopseudomonas palustris CGA009 complete genome; segment 14/16 Length = 349841 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 271 gcagctcgtgctcaccgacc 290 |||||||||||||||||||| Sbjct: 295087 gcagctcgtgctcaccgacc 295068
>emb|AJ294324.1|PVE294324 Paracoccus versutus partial soxB gene for thiosulfate-oxidizing enzyme, strain DSM 582T Length = 956 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 260 gccttcggcgcgcagctcgt 279 |||||||||||||||||||| Sbjct: 334 gccttcggcgcgcagctcgt 315
>gb|AC122147.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0072F04, complete sequence Length = 137724 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 89 attgaagatgcggagaagaaggga 112 ||||||||||||||| |||||||| Sbjct: 106634 attgaagatgcggaggagaaggga 106611
>gb|AC087726.36| Chlamydomonas reinhardtii clone cr-40a20, complete sequence Length = 168794 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 365 cagcagttcgagaaccctgccaac 388 ||||||||||||||||| |||||| Sbjct: 13637 cagcagttcgagaaccccgccaac 13660
>gb|AC090433.10| Chlamydomonas reinhardtii clone cr-19b23, complete sequence Length = 118183 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 365 cagcagttcgagaaccctgccaac 388 ||||||||||||||||| |||||| Sbjct: 73619 cagcagttcgagaaccccgccaac 73642
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 cgggcaagacgacgctgatc 142 |||||||||||||||||||| Sbjct: 760425 cgggcaagacgacgctgatc 760406
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 259 ggccttcggcgcgcagctcgtgctcacc 286 |||| |||||||| |||||||||||||| Sbjct: 2820274 ggccctcggcgcggagctcgtgctcacc 2820247 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 cgggcaagacgacgctgatc 142 |||||||||||||||||||| Sbjct: 455236 cgggcaagacgacgctgatc 455255
>gb|AF372655.1|AF372655 Rhizobium leguminosarum bv. trifolii CpsF (cpsF) gene, partial cds; and putative succinoglycan biosynthesis transport protein, FolD (folD), AglR (aglR), FadB (fadB), XynA (xynA), HndI (hndI), HndJ (hndJ), putative short-chain dehydrogenase, and LysR-type transcriptional regulator genes, complete cds Length = 11431 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 123 cgggcaagacgacgctgatc 142 |||||||||||||||||||| Sbjct: 7573 cgggcaagacgacgctgatc 7592
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 89 attgaagatgcggagaagaaggga 112 ||||||||||||||| |||||||| Sbjct: 1888181 attgaagatgcggaggagaaggga 1888158
>gb|AC083863.2|AC083863 Homo sapiens chromosome 7 clone RP11-162O1, complete sequence Length = 179488 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 ggcctggcgttcatggcggc 189 |||||||||||||||||||| Sbjct: 62926 ggcctggcgttcatggcggc 62945
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 365 cagcagttcgagaaccctgccaac 388 ||||||||||||||||| |||||| Sbjct: 2353049 cagcagttcgagaacccggccaac 2353072
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 89 attgaagatgcggagaagaaggga 112 ||||||||||||||| |||||||| Sbjct: 1888132 attgaagatgcggaggagaaggga 1888109
>gb|AC124406.4| Mus musculus BAC clone RP24-376E14 from 1, complete sequence Length = 140266 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 agaagaagggattgatcacc 121 |||||||||||||||||||| Sbjct: 66822 agaagaagggattgatcacc 66841
>dbj|AB209352.1| Homo sapiens mRNA for FK506 binding protein 9 variant protein Length = 5179 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 ggcctggcgttcatggcggc 189 |||||||||||||||||||| Sbjct: 3370 ggcctggcgttcatggcggc 3389
>emb|AL805911.6| Mouse DNA sequence from clone RP23-71K8 on chromosome X, complete sequence Length = 157092 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 350 agcgcattcatgctccagcagttc 373 ||||| |||||||||||||||||| Sbjct: 73567 agcgccttcatgctccagcagttc 73590 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,858,608 Number of Sequences: 3902068 Number of extensions: 2858608 Number of successful extensions: 64028 Number of sequences better than 10.0: 85 Number of HSP's better than 10.0 without gapping: 84 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 62481 Number of HSP's gapped (non-prelim): 1543 length of query: 505 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 483 effective length of database: 17,147,199,772 effective search space: 8282097489876 effective search space used: 8282097489876 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
