| Clone Name | bart26e12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_481984.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1017 Score = 129 bits (65), Expect = 1e-26 Identities = 110/125 (88%) Strand = Plus / Plus Query: 435 gatcctttcatctccttggatgagtttgaattttctcgtccagctggcttttctgatcat 494 ||||||||||||||| | || ||||| || ||||||| ||||| ||||| ||||||| Sbjct: 241 gatcctttcatctccctcgacgagttcgagttttctccaccagccggcttccatgatcat 300 Query: 495 ccacaccgaggattcgagaatgttacctacatgcttgagggaggcttgagttaccatgac 554 || ||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 301 ccccacagaggattcgagaatgttacctacatgctcgagggaggcttcagttaccatgac 360 Query: 555 ttttc 559 ||||| Sbjct: 361 ttttc 365
>dbj|AK105533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G12, full insert sequence Length = 1726 Score = 129 bits (65), Expect = 1e-26 Identities = 110/125 (88%) Strand = Plus / Plus Query: 435 gatcctttcatctccttggatgagtttgaattttctcgtccagctggcttttctgatcat 494 ||||||||||||||| | || ||||| || ||||||| ||||| ||||| ||||||| Sbjct: 716 gatcctttcatctccctcgacgagttcgagttttctccaccagccggcttccatgatcat 775 Query: 495 ccacaccgaggattcgagaatgttacctacatgcttgagggaggcttgagttaccatgac 554 || ||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||| Sbjct: 776 ccccacagaggattcgagaatgttacctacatgctcgagggaggcttcagttaccatgac 835 Query: 555 ttttc 559 ||||| Sbjct: 836 ttttc 840 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 86 gccggccatgtctgccgccgcctg 109 |||||||||||||||||||||||| Sbjct: 430 gccggccatgtctgccgccgcctg 453
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 503 aggattcgagaatgttacctacatgcttgagg 534 ||||||||||||||||||||||||||| |||| Sbjct: 16886563 aggattcgagaatgttacctacatgctcgagg 16886594 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 532 agggaggcttgagttaccatgacttttc 559 |||||||||| ||||||||||||||||| Sbjct: 16886776 agggaggcttcagttaccatgacttttc 16886803 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 86 gccggccatgtctgccgccgcctg 109 |||||||||||||||||||||||| Sbjct: 16885161 gccggccatgtctgccgccgcctg 16885184
>dbj|AP005817.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1118_F01 Length = 119248 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 503 aggattcgagaatgttacctacatgcttgagg 534 ||||||||||||||||||||||||||| |||| Sbjct: 99928 aggattcgagaatgttacctacatgctcgagg 99959 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 532 agggaggcttgagttaccatgacttttc 559 |||||||||| ||||||||||||||||| Sbjct: 100141 agggaggcttcagttaccatgacttttc 100168 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 86 gccggccatgtctgccgccgcctg 109 |||||||||||||||||||||||| Sbjct: 98526 gccggccatgtctgccgccgcctg 98549
>dbj|AP003913.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1484_G09 Length = 124695 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 503 aggattcgagaatgttacctacatgcttgagg 534 ||||||||||||||||||||||||||| |||| Sbjct: 33574 aggattcgagaatgttacctacatgctcgagg 33605 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 532 agggaggcttgagttaccatgacttttc 559 |||||||||| ||||||||||||||||| Sbjct: 33787 agggaggcttcagttaccatgacttttc 33814 Score = 48.1 bits (24), Expect = 0.031 Identities = 24/24 (100%) Strand = Plus / Plus Query: 86 gccggccatgtctgccgccgcctg 109 |||||||||||||||||||||||| Sbjct: 32172 gccggccatgtctgccgccgcctg 32195
>gb|BC076253.1| Danio rerio zgc:92778, mRNA (cDNA clone MGC:92778 IMAGE:7087116), complete cds Length = 1743 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Plus Query: 474 ccagctggcttttctgatcatccacaccgaggattcgaga 513 |||||||||||| |||||||||| ||||| ||||| |||| Sbjct: 306 ccagctggctttcctgatcatcctcaccgtggatttgaga 345
>emb|CR450831.4| Zebrafish DNA sequence from clone CH211-79O8 in linkage group 11, complete sequence Length = 190163 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Plus Query: 474 ccagctggcttttctgatcatccacaccgaggattcgaga 513 |||||||||||| |||||||||| ||||| ||||| |||| Sbjct: 10495 ccagctggctttcctgatcatcctcaccgtggatttgaga 10534
>ref|NM_001002550.1| Danio rerio zgc:92778 (zgc:92778), mRNA Length = 1743 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Plus Query: 474 ccagctggcttttctgatcatccacaccgaggattcgaga 513 |||||||||||| |||||||||| ||||| ||||| |||| Sbjct: 306 ccagctggctttcctgatcatcctcaccgtggatttgaga 345
>gb|BC024062.1| Mus musculus pirin, mRNA (cDNA clone MGC:37739 IMAGE:5067536), complete cds Length = 1527 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 347 ctgatcatccacaccgaggatt 368
>ref|NM_001009474.1| Rattus norvegicus pirin (Pir), mRNA Length = 1537 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 301 ctgatcatccacaccgaggatt 322
>dbj|AK134541.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length enriched library, clone:6330407G18 product:Pirin, full insert sequence Length = 1497 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 442 ctgatcatccacaccgaggatt 463
>dbj|AK138314.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230064J22 product:Pirin, full insert sequence Length = 1596 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 437 ctgatcatccacaccgaggatt 458
>dbj|AK151301.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830027N05 product:Pirin, full insert sequence Length = 1396 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 344 ctgatcatccacaccgaggatt 365
>dbj|AK009757.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched library, clone:2310042L19 product:PIRIN [Mus musculus], full insert sequence Length = 1313 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 384 ctgatcatccacaccgaggatt 405
>dbj|AK082922.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430020E23 product:PIRIN homolog [Mus musculus], full insert sequence Length = 2917 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 326 ctgatcatccacaccgaggatt 347
>dbj|AK090023.1| Mus musculus brain CRL-1443 BC3H1 cDNA, RIKEN full-length enriched library, clone:G430064M09 product:PIRIN homolog [Mus musculus], full insert sequence Length = 2228 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 298 ctgatcatccacaccgaggatt 319
>ref|NM_027153.1| Mus musculus pirin (Pir), mRNA Length = 1487 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 435 ctgatcatccacaccgaggatt 456
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 107 ctgtgtctccttctgcccctcc 128 |||||||||||||||||||||| Sbjct: 3887876 ctgtgtctccttctgcccctcc 3887897
>emb|AL671706.8| Mouse DNA sequence from clone RP23-330O24 on chromosome X, complete sequence Length = 192676 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 161143 ctgatcatccacaccgaggatt 161164
>gb|BC088290.1| Rattus norvegicus pirin, mRNA (cDNA clone MGC:109484 IMAGE:7322321), complete cds Length = 1537 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 487 ctgatcatccacaccgaggatt 508 |||||||||||||||||||||| Sbjct: 301 ctgatcatccacaccgaggatt 322
>gb|AC147706.3| Felis catus clone RP86-363G23, complete sequence Length = 142721 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 106 cctgtgtctccttctgcccctcccc 130 ||||||||||| ||||||||||||| Sbjct: 136731 cctgtgtctccctctgcccctcccc 136755
>gb|AC105275.3| Homo sapiens chromosome 1 clone RP11-359E8, complete sequence Length = 164736 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 200 ggaggaggagcgcggcgccgggagg 224 ||||||||||||||||||| ||||| Sbjct: 58248 ggaggaggagcgcggcgcctggagg 58272
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.9 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Plus Query: 194 ggaggcggaggaggagcgcg-gcgccgggaggg 225 ||||| |||||||||||||| |||||||||||| Sbjct: 2203251 ggaggaggaggaggagcgcgagcgccgggaggg 2203283
>dbj|AK108267.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-B11, full insert sequence Length = 1025 Score = 42.1 bits (21), Expect = 1.9 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 194 ggaggcggaggaggagcgcg-gcgccgggaggg 225 ||||| |||||||||||||| |||||||||||| Sbjct: 229 ggaggaggaggaggagcgcgagcgccgggaggg 197
>emb|AJ505558.1|BAC505558 Bacteriophage phiKMV complete genome Length = 42519 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 237 ttcggcgccgacgggatgatcggcg 261 |||||||| |||||||||||||||| Sbjct: 12769 ttcggcgcggacgggatgatcggcg 12793
>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome Length = 4829781 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 tcgtcgacgtcgtcgtcgggc 180 ||||||||||||||||||||| Sbjct: 467335 tcgtcgacgtcgtcgtcgggc 467355 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 161 cgtcgacgtcgtcgtcgggctgcc 184 |||||| ||||||||||||||||| Sbjct: 1132068 cgtcgaggtcgtcgtcgggctgcc 1132091
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.9 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Plus Query: 194 ggaggcggaggaggagcgcg-gcgccgggaggg 225 ||||| |||||||||||||| |||||||||||| Sbjct: 2211032 ggaggaggaggaggagcgcgagcgccgggaggg 2211064
>emb|BX000499.1|CNS08CDP Oryza sativa chromosome 11, . BAC OSJNBa0039D03 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 125593 Score = 42.1 bits (21), Expect = 1.9 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Plus Query: 194 ggaggcggaggaggagcgcg-gcgccgggaggg 225 ||||| |||||||||||||| |||||||||||| Sbjct: 99945 ggaggaggaggaggagcgcgagcgccgggaggg 99977
>gb|U88875.1|MAU88875 Mycobacterium avium hypoxanthine-guanine phosphoribosyl transferase gene, complete cds Length = 840 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 160 tcgtcgacgtcgtcgtcgggc 180 ||||||||||||||||||||| Sbjct: 403 tcgtcgacgtcgtcgtcgggc 423
>dbj|D85843.1| Bothrops jararaca mRNA for bradykinin-potentiating peptide and C-type natriuretic peptide precursor, complete cds Length = 1722 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 cggaggcggaggaggagcgcg 213 ||||||||||||||||||||| Sbjct: 829 cggaggcggaggaggagcgcg 849
>ref|NM_100859.2| Arabidopsis thaliana XBCP3; cysteine-type endopeptidase/ cysteine-type peptidase AT1G09850 (XBCP3) mRNA, complete cds Length = 1638 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 tggatgagtttgaattttct 470 |||||||||||||||||||| Sbjct: 1406 tggatgagtttgaattttct 1387
>gb|AE014840.1| Plasmodium falciparum 3D7 chromosome 11 section 5 of 8 of the complete sequence Length = 249995 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 158 gatcgtcgacgtcgtcgtcg 177 |||||||||||||||||||| Sbjct: 77808 gatcgtcgacgtcgtcgtcg 77789
>gb|BT018625.1| Zea mays clone EL01N0502F08.d mRNA sequence Length = 1332 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 tgtctccttctgcccctccc 129 |||||||||||||||||||| Sbjct: 102 tgtctccttctgcccctccc 121
>gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, complete sequence Length = 203230 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 108 tgtgtctccttctgcccctccccc 131 ||||||||| |||||||||||||| Sbjct: 16520 tgtgtctccatctgcccctccccc 16543
>gb|AC068501.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-23C4, complete sequence Length = 196175 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 418 ctgagttgcagagcttggatcctt 441 |||||||||||| ||||||||||| Sbjct: 5541 ctgagttgcagaacttggatcctt 5564
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 329 gaggaggtcacgggcggtgg 348 |||||||||||||||||||| Sbjct: 636641 gaggaggtcacgggcggtgg 636622
>gb|AC127551.7| Mus musculus BAC clone RP24-547H23 from chromosome 8, complete sequence Length = 204342 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 108 tgtgtctccttctgcccctccccc 131 ||||||||| |||||||||||||| Sbjct: 19809 tgtgtctccatctgcccctccccc 19786
>gb|AC124676.7| Mus musculus chromosome 6, clone RP24-93M1, complete sequence Length = 212789 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 418 ctgagttgcagagcttggatcctt 441 |||||||||||| ||||||||||| Sbjct: 91153 ctgagttgcagaacttggatcctt 91130
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 386 cggcttcgctctcaggaggagcat 409 ||||||| |||||||||||||||| Sbjct: 1649660 cggcttccctctcaggaggagcat 1649637
>gb|AC147707.5| Canis Familiaris, clone XX-10C7, complete sequence Length = 199690 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 tctccttctgcccctccccc 131 |||||||||||||||||||| Sbjct: 167001 tctccttctgcccctccccc 167020
>gb|AC147784.3| Canis Familiaris, clone XX-25F3, complete sequence Length = 176851 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 tctccttctgcccctccccc 131 |||||||||||||||||||| Sbjct: 167355 tctccttctgcccctccccc 167374
>ref|XM_860979.1| PREDICTED: Canis familiaris hypothetical protein LOC610128 (LOC610128), mRNA Length = 1220 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 193 cggaggcggaggaggagcgcggcg 216 ||||||||||||||| |||||||| Sbjct: 91 cggaggcggaggaggcgcgcggcg 68
>gb|AC092728.2| Canis familiaris clone RP81-237O17, complete sequence Length = 141578 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 tctccttctgcccctccccc 131 |||||||||||||||||||| Sbjct: 48990 tctccttctgcccctccccc 49009
>ref|NM_001896.2| Homo sapiens casein kinase 2, alpha prime polypeptide (CSNK2A2), mRNA Length = 1674 Score = 40.1 bits (20), Expect = 7.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 194 ggaggcggaggaggagcgcggcgccggg 221 ||||| ||||||||||||||||| |||| Sbjct: 35 ggaggaggaggaggagcgcggcggcggg 8
>emb|AL939120.1|SCO939120 Streptomyces coelicolor A3(2) complete genome; segment 17/29 Length = 248550 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 acggaggcggaggaggagcgcggc 215 |||||||||||||||| ||||||| Sbjct: 131499 acggaggcggaggaggggcgcggc 131522
>emb|AJ630365.1| Canis familiaris MHC class II region on chromosome CFA12, partial sequence, BAC clone 181g17, containing DLA-DMB, DLA-DMA and BRD2 genes, GL004-like protein pseudogene, DLA-DOA gene, RPL26 and RPL11 pseudogenes, DLA-DPB1 pseudogenes, DLA-DPA1 pseudogene, UPF0224 family pseudogene and partial col11a2 gene Length = 155570 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 tctccttctgcccctccccc 131 |||||||||||||||||||| Sbjct: 84379 tctccttctgcccctccccc 84398
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 157 cgatcgtcgacgtcgtcgtc 176 |||||||||||||||||||| Sbjct: 219199 cgatcgtcgacgtcgtcgtc 219180
>gb|AF388175.1|AF388175 Arabidopsis thaliana papain-like cysteine peptidase XBCP3 mRNA, complete cds Length = 1638 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 tggatgagtttgaattttct 470 |||||||||||||||||||| Sbjct: 1406 tggatgagtttgaattttct 1387
>gb|AC153625.2| Mus musculus 6 BAC RP23-277O13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 175711 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 472 gtccagctggcttttctgat 491 |||||||||||||||||||| Sbjct: 73507 gtccagctggcttttctgat 73488
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 ggaggaggagcgcggcgccgggag 223 |||||||||| ||||||||||||| Sbjct: 11815971 ggaggaggagggcggcgccgggag 11815994 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 ggaggaggagcgcggcgccgggag 223 |||||||||| ||||||||||||| Sbjct: 11815867 ggaggaggagggcggcgccgggag 11815890
>emb|BX813678.1|CNS0AC25 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1484 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 tggatgagtttgaattttct 470 |||||||||||||||||||| Sbjct: 1386 tggatgagtttgaattttct 1367
>gb|AC146266.4| Pan troglodytes BAC clone RP43-30L11 from chromosome 7, complete sequence Length = 187603 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 472 gtccagctggcttttctgat 491 |||||||||||||||||||| Sbjct: 298 gtccagctggcttttctgat 279
>gb|AC010883.8| Homo sapiens BAC clone RP11-339H12 from 2, complete sequence Length = 215532 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 411 ggcaggcctgagttgcagag 430 |||||||||||||||||||| Sbjct: 101399 ggcaggcctgagttgcagag 101418
>gb|AC009107.11| Homo sapiens chromosome 16 clone RP11-459F6, complete sequence Length = 208220 Score = 40.1 bits (20), Expect = 7.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 194 ggaggcggaggaggagcgcggcgccggg 221 ||||| ||||||||||||||||| |||| Sbjct: 69421 ggaggaggaggaggagcgcggcggcggg 69448
>gb|AC022173.7|AC022173 Homo sapiens chromosome 7 clone RP11-29B3, complete sequence Length = 155136 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 472 gtccagctggcttttctgat 491 |||||||||||||||||||| Sbjct: 120587 gtccagctggcttttctgat 120606
>gb|AF106004.1|AF106004 Streptomyces coelicolor whiJ sporulation regulatory locus Length = 3842 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 acggaggcggaggaggagcgcggc 215 |||||||||||||||| ||||||| Sbjct: 2421 acggaggcggaggaggggcgcggc 2444
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 7.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 195 gaggcggaggaggagcgcggcgccggga 222 ||||||| ||||||| |||||||||||| Sbjct: 4345728 gaggcggtggaggagagcggcgccggga 4345755
>dbj|AP006343.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:B1032F05 Length = 151412 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 ggaggaggagcgcggcgccgggag 223 |||||||||| ||||||||||||| Sbjct: 48271 ggaggaggagggcggcgccgggag 48294 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 200 ggaggaggagcgcggcgccgggag 223 |||||||||| ||||||||||||| Sbjct: 48167 ggaggaggagggcggcgccgggag 48190
>dbj|AK110169.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-161-G03, full insert sequence Length = 3628 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 230 ccttgagttcggcgccgacg 249 |||||||||||||||||||| Sbjct: 3212 ccttgagttcggcgccgacg 3193
>gb|AC084291.27| Homo sapiens 12 BAC RP11-465L8 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 125429 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 194 ggaggcggaggaggagcgcg 213 |||||||||||||||||||| Sbjct: 35949 ggaggcggaggaggagcgcg 35930
>gb|AE016830.1| Enterococcus faecalis V583, complete genome Length = 3218031 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 262 ccagcagtgacagtgaccaa 281 |||||||||||||||||||| Sbjct: 900759 ccagcagtgacagtgaccaa 900778
>gb|AC000132.1|F21M12 Sequence of BAC F21M12 from Arabidopsis thaliana chromosome 1, complete sequence Length = 146505 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 451 tggatgagtttgaattttct 470 |||||||||||||||||||| Sbjct: 90804 tggatgagtttgaattttct 90785
>emb|AJ001218.1|HSCGG16P5 Homo sapiens DNA for (CGG)n trinucleotide repeat region, isolate CL16-1 (Chr.16) Length = 2837 Score = 40.1 bits (20), Expect = 7.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 194 ggaggcggaggaggagcgcggcgccggg 221 ||||| ||||||||||||||||| |||| Sbjct: 1213 ggaggaggaggaggagcgcggcggcggg 1240 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,542,976 Number of Sequences: 3902068 Number of extensions: 4542976 Number of successful extensions: 112545 Number of sequences better than 10.0: 63 Number of HSP's better than 10.0 without gapping: 59 Number of HSP's successfully gapped in prelim test: 4 Number of HSP's that attempted gapping in prelim test: 111627 Number of HSP's gapped (non-prelim): 936 length of query: 562 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 539 effective length of database: 17,143,297,704 effective search space: 9240237462456 effective search space used: 9240237462456 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)