| Clone Name | bart22d04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds Length = 820 Score = 979 bits (494), Expect = 0.0 Identities = 539/554 (97%) Strand = Plus / Plus Query: 46 cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 31 cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 90 Query: 106 atctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaagaagcag 165 |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| Sbjct: 91 atctccaaggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagcag 150 Query: 166 tggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgtg 225 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 151 tggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtg 210 Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 |||||||| |||||||||||||||||||||||||| ||||||||| ||||||| |||||| Sbjct: 211 tccaggacgcagggtaccaagattgcctcagagggtctgaagcacagggtgttcgaagta 270 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 271 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 330 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 331 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactgac 390 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 391 aagctcaggtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaag 450 Query: 466 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525 ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct: 451 accactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaac 510 Query: 526 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatg 585 ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 511 caggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatg 570 Query: 586 gttgagatcatggt 599 |||||||||||||| Sbjct: 571 gttgagatcatggt 584
>gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA, partial sequence Length = 885 Score = 922 bits (465), Expect = 0.0 Identities = 528/549 (96%), Gaps = 1/549 (0%) Strand = Plus / Plus Query: 46 cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 32 cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 91 Query: 106 atctccaagggg-aggaagggtagcaagaagaaggccgtggatccgttcaccaagaagca 164 |||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||| Sbjct: 92 atctccaagggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagca 151 Query: 165 gtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgt 224 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 152 gtggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgt 211 Query: 225 gtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagt 284 ||||||||| |||||||||||||||| ||||||||| ||||||||| |||||| ||||| Sbjct: 212 gtccaggacgcagggtaccaagattgnctcagagggtctgaagcacanggtgttcgaagt 271 Query: 285 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 344 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 272 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 331 Query: 345 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactga 404 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 332 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactga 391 Query: 405 caagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaa 464 |||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||| Sbjct: 392 caagctcaagtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaa 451 Query: 465 gaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaa 524 |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 452 gaccactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaa 511 Query: 525 ccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagat 584 |||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| ||||| Sbjct: 512 ccaggtgaagcgcacttgctatgcccaagcnagtcagatcagacagatccgccgcaagat 571 Query: 585 ggttgagat 593 || |||||| Sbjct: 572 ggntgagat 580
>dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds Length = 1065 Score = 335 bits (169), Expect = 1e-88 Identities = 439/529 (82%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 84 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 143 Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189 ||||||||| |||| ||||| || | |||||| | |||||||| |||||||| ||| | Sbjct: 144 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 203 Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249 | |||| || ||| |||||||||||||||||||||||||||||||||| |||||| Sbjct: 204 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 263 Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309 || || |||||||| ||||| | |||||||| || || |||||||||| ||||||||| Sbjct: 264 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 323 Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369 ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || Sbjct: 324 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 383 Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429 ||||| ||||| ||||||||| || || || || |||||||| || ||||| | |||| Sbjct: 384 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 443 Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489 |||||||| || |||||||||||||| ||||| || ||||| ||| |||||||| || Sbjct: 444 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 503 Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549 |||| || |||||||||||| | || || |||||||| ||| | |||||||||||| Sbjct: 504 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 563 Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatgg 598 ||||| ||||||||||||||||| || || ||||||||||| ||||||| Sbjct: 564 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatgg 612
>dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-D02, full insert sequence Length = 1032 Score = 335 bits (169), Expect = 1e-88 Identities = 439/529 (82%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 60 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 119 Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189 ||||||||| |||| ||||| || | |||||| | |||||||| |||||||| ||| | Sbjct: 120 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 179 Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249 | |||| || ||| |||||||||||||||||||||||||||||||||| |||||| Sbjct: 180 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 239 Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309 || || |||||||| ||||| | |||||||| || || |||||||||| ||||||||| Sbjct: 240 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 299 Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369 ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || Sbjct: 300 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 359 Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429 ||||| ||||| ||||||||| || || || || |||||||| || ||||| | |||| Sbjct: 360 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 419 Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489 |||||||| || |||||||||||||| ||||| || ||||| ||| |||||||| || Sbjct: 420 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 479 Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549 |||| || |||||||||||| | || || |||||||| ||| | |||||||||||| Sbjct: 480 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 539 Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatgg 598 ||||| ||||||||||||||||| || || ||||||||||| ||||||| Sbjct: 540 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatgg 588
>dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023013H23, full insert sequence Length = 1097 Score = 335 bits (169), Expect = 1e-88 Identities = 439/529 (82%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 61 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 120 Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189 ||||||||| |||| ||||| || | |||||| | |||||||| |||||||| ||| | Sbjct: 121 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 180 Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249 | |||| || ||| |||||||||||||||||||||||||||||||||| |||||| Sbjct: 181 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 240 Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309 || || |||||||| ||||| | |||||||| || || |||||||||| ||||||||| Sbjct: 241 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 300 Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369 ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || Sbjct: 301 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 360 Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429 ||||| ||||| ||||||||| || || || || |||||||| || ||||| | |||| Sbjct: 361 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 420 Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489 |||||||| || |||||||||||||| ||||| || ||||| ||| |||||||| || Sbjct: 421 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 480 Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549 |||| || |||||||||||| | || || |||||||| ||| | |||||||||||| Sbjct: 481 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 540 Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatgg 598 ||||| ||||||||||||||||| || || ||||||||||| ||||||| Sbjct: 541 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatgg 589
>ref|XM_464995.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1063 Score = 315 bits (159), Expect = 9e-83 Identities = 429/519 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 34 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 93 Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199 |||| ||||| || |||||||| | ||||| ||||||||||||||| | ||| || Sbjct: 94 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153 Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259 ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || |||| Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213 Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319 | || ||||| || || |||||||| || | || ||||||||||| || ||||| |||| Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273 Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379 | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || | Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333 Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439 ||||||||||| ||| ||||| ||||| || ||||| | || | ||| ||||| || Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393 Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499 | ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| || Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453 Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559 |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || | Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513 Query: 560 agatcagacagatccgccggaagatggttgagatcatgg 598 ||||| | ||||||||||||||||||||||||||||||| Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatgg 552
>ref|XM_506775.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1115_D03.49 mRNA Length = 1171 Score = 315 bits (159), Expect = 9e-83 Identities = 429/519 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 70 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129 Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199 |||| ||||| || |||||||| | ||||| ||||||||||||||| | ||| || Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189 Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259 ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || |||| Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249 Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319 | || ||||| || || |||||||| || | || ||||||||||| || ||||| |||| Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309 Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379 | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || | Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369 Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439 ||||||||||| ||| ||||| ||||| || ||||| | || | ||| ||||| || Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429 Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499 | ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| || Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489 Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559 |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || | Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549 Query: 560 agatcagacagatccgccggaagatggttgagatcatgg 598 ||||| | ||||||||||||||||||||||||||||||| Sbjct: 550 agatccggcagatccgccggaagatggttgagatcatgg 588
>dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C03, full insert sequence Length = 942 Score = 313 bits (158), Expect = 4e-82 Identities = 413/498 (82%) Strand = Plus / Plus Query: 101 agcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaaga 160 |||||||||||||||||| |||||| |||||||||| |||| ||||| || | |||| Sbjct: 1 agcgcatctccaaggggaagaagggatccaagaagaagaccgtcgatccctttgctaaga 60 Query: 161 agcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccc 220 || | |||||||| |||||||| ||| | | |||| || ||| |||||||||||| Sbjct: 61 aggactggtatgatatcaaggccccgtcggtgttcaatgtgcggaacatcggcaagaccc 120 Query: 221 tcgtgtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttg 280 |||||||||||||||||||||| |||||||| || |||||||| ||||| | ||||||| Sbjct: 121 tcgtgtccaggacacagggtacaaagattgcttctgagggcctaaagcatagagtgtttg 180 Query: 281 aagtatctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactcc 340 | || || |||||||||| |||||||||||||| ||||| ||||||||||||||||| | Sbjct: 181 aggtctccttagctgatctccagaacgatgaggatcaggcgtacaggaagatcagacttc 240 Query: 341 gtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcacca 400 ||||||||||||||||||||| ||| || ||||| ||||| ||||||||| || || | Sbjct: 241 gtgctgaggatgtgcaagggaagaacgtgctcaccaacttttggggcatgtcgtttacta 300 Query: 401 ctgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatg 460 | || |||||||| || ||||| | |||||||||||| || |||||||||||||| |||| Sbjct: 301 ccgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatg 360 Query: 461 tgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcc 520 | || ||||| ||| |||||||| || |||| || |||||||||||| | || | Sbjct: 361 tcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggc 420 Query: 521 caaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccgga 580 | |||||||| ||| | ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 421 ctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacagattcgtcgca 480 Query: 581 agatggttgagatcatgg 598 |||||||||| ||||||| Sbjct: 481 agatggttgaaatcatgg 498
>dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048M05, full insert sequence Length = 1063 Score = 307 bits (155), Expect = 2e-80 Identities = 428/519 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| || ||||||||| || | ||||||||||| |||||||| |||||||||||| Sbjct: 34 ccatggccgtgggcaagaacgagaggatctccaagggcaggaagggcagcaagaagaaga 93 Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199 |||| ||||| || |||||||| | ||||| ||||||||||||||| | ||| || Sbjct: 94 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153 Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259 ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || |||| Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213 Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319 | || ||||| || || |||||||| || | || ||||||||||| || ||||| |||| Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273 Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379 | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || | Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333 Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439 ||||||||||| ||| ||||| ||||| || ||||| | || | ||| ||||| || Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393 Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499 | ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| || Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453 Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559 |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || | Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513 Query: 560 agatcagacagatccgccggaagatggttgagatcatgg 598 ||||| | ||||||||||||||||||||||||||||||| Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatgg 552
>dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C03, full insert sequence Length = 1171 Score = 307 bits (155), Expect = 2e-80 Identities = 428/519 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 70 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129 Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199 |||| ||||| || |||||||| | ||||| ||||||||||||||| | ||| || Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189 Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259 ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || |||| Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249 Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319 | || ||||| || || |||||||| || | || ||||||||||| || ||||| |||| Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309 Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379 | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || | Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369 Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439 ||||||||||| ||| ||||| ||||| || ||||| | || | ||| ||||| || Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429 Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499 | ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| || Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489 Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559 |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || | Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549 Query: 560 agatcagacagatccgccggaagatggttgagatcatgg 598 ||||| | ||||||| ||||||||||||||||||||||| Sbjct: 550 agatccggcagatcctccggaagatggttgagatcatgg 588
>dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079A13, full insert sequence Length = 1118 Score = 305 bits (154), Expect = 9e-80 Identities = 436/530 (82%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| ||||||||||||||||| ||||| ||||||| |||||| | Sbjct: 92 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 151 Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189 ||||||||| |||| ||||| || | |||||| | |||||||| |||||||| ||| | Sbjct: 152 aagaagaagaccgtcgatccttttgcgaagaaggattggtatgatatcaaggccccgtcg 211 Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249 | |||| | | |||||||| ||||| |||||||||||||||||||| || |||||| Sbjct: 212 gtgttcaacgtgagaaacgtcgggaagacgctcgtgtccaggacacagggcacaaagatt 271 Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309 || ||||||||||| |||||||| |||||||| || || | |||||||||||||||||| Sbjct: 272 gcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcagaacgat 331 Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369 ||||| ||||| ||| | ||||||||||| ||||| ||||||||||| |||| ||||| Sbjct: 332 gaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaaatgtt 391 Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429 || |||||||||||||||||| |||||| || ||||||||||| || | || | ||| Sbjct: 392 cttacaaacttctggggcatgagtttcacgaccgacaagctcagatcattggtcaagaaa 451 Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489 |||||||| || || ||||||||||| ||||| |||||||||| || |||||||| || Sbjct: 452 tggcagacgctaatagaggctcatgtggatgtagagaccactgataactacatgctgcgt 511 Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549 | || | |||||||||||||||| | ||||| || ||||| || || ||||||||| Sbjct: 512 ctcttctgcgttggcttcaccaagaggaggccaaatcaagtcaaacggacatgctatgct 571 Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggt 599 |||||||| ||||| |||||||||| || |||||||| |||| |||||| Sbjct: 572 caagcaagccagattcgacagatccgtcgcaagatggtggagaccatggt 621
>gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal protein (RSPSP94) mRNA, complete cds Length = 1027 Score = 278 bits (140), Expect = 2e-71 Identities = 427/520 (82%), Gaps = 2/520 (0%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 31 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 90 Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199 |||| ||||| || |||||||| | ||||| ||||||||||||||| | ||| || Sbjct: 91 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 150 Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259 ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || |||| Sbjct: 151 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 210 Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319 | || ||||| || || |||||||| || | || ||||||| ||| || ||||| |||| Sbjct: 211 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcggaatgacgaggatcagg 270 Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379 | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || | Sbjct: 271 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 330 Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439 ||||||||||| ||| ||||| ||||| || ||||| | || | ||| ||||| || Sbjct: 331 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 390 Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499 | ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| || Sbjct: 391 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 450 Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559 |||| ||||||||| | |||||||| ||||| ||||| || || || |||| || || | Sbjct: 451 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctc-aggtagcc 509 Query: 560 agatcagacagat-ccgccggaagatggttgagatcatgg 598 ||||| | ||||| |||||||||||||||||||||||||| Sbjct: 510 agatccggcagatcccgccggaagatggttgagatcatgg 549
>gb|BT016390.1| Zea mays clone Contig223 mRNA sequence Length = 1104 Score = 264 bits (133), Expect = 3e-67 Identities = 424/521 (81%) Strand = Plus / Plus Query: 73 gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaag 132 ||||| |||||||| ||||| ||||||||| | ||||||||||| | ||||||| ||||| Sbjct: 65 gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 124 Query: 133 aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 192 || ||| |||| || || ||| | |||||| | ||||||||||||||||| ||| | | Sbjct: 125 aaaaagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 184 Query: 193 ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 252 |||| |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| Sbjct: 185 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 244 Query: 253 tcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgag 312 || ||||| ||||||||| | || ||||| || | ||||||||||||||| ||| ||| Sbjct: 245 tctgagggtctgaagcacagagtctttgaggtttgcctagctgatcttcagggcgacgag 304 Query: 313 gaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctc 372 || || || |||||||| ||||| ||||||||||| |||||||| || | |||||| ||| Sbjct: 305 gatcaagcttacaggaaaatcaggctccgtgctgaagatgtgcagggcaggaatgtgctc 364 Query: 373 acaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtgg 432 |||||||| ||||| ||| |||| |||||||| || || || || || |||| ||||||| Sbjct: 365 acaaacttttggggtatgaattttaccactgataaactgagatccctagtgaagaagtgg 424 Query: 433 cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 492 ||||| | || || || ||||| ||||| ||||| || ||||| |||||| | || || Sbjct: 425 cagacattaatcgaagcccatgttgatgtcaagacaaccgacaactacatgttgcgtttg 484 Query: 493 tttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 552 || ||| |||||||||||||| ||||||||||| |||||| | || ||||||||||| Sbjct: 485 ttctgcatcggcttcaccaagaggcgcccaaaccaagtcaagagaacctgctatgctcag 544 Query: 553 gcaagtcagatcagacagatccgccggaagatggttgagat 593 ||| |||||| | ||||||||||| |||||||||||||| Sbjct: 545 gcatcccagatccgtcagatccgccgaaagatggttgagat 585
>gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, partial cds Length = 879 Score = 159 bits (80), Expect = 1e-35 Identities = 152/176 (86%) Strand = Plus / Plus Query: 292 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 351 ||||||||||||||||||||||| | ||||||||||||||| |||| | ||||||||| Sbjct: 145 gctgatcttcagaacgatgaggatcgtgcctacaggaagatccgactgagagctgaggat 204 Query: 352 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 411 |||||||| | |||||||||||||||||||||||| ||||| || || || |||||||| Sbjct: 205 gtgcaaggaaagaatgtcctcacaaacttctggggaatggactttacaacagacaagctg 264 Query: 412 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 |||||| | ||| | ||||||||||| | |||||||||||||| ||||| ||||| Sbjct: 265 aggtctttggtgcgcaagtggcagacattgattgaggctcatgtggatgttaagac 320
>gb|AY109383.1| Zea mays CL7224_1 mRNA sequence Length = 1236 Score = 153 bits (77), Expect = 8e-34 Identities = 212/257 (82%) Strand = Plus / Minus Query: 337 ctccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttc 396 ||||||||||| ||||||||||| | |||||| ||||||||||| ||||| ||| |||| Sbjct: 866 ctccgtgctgaagatgtgcaaggcaggaatgtgctcacaaacttttggggtatgaatttt 807 Query: 397 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 456 |||||||| || || || || || |||| |||||||||||| | || || || ||||| Sbjct: 806 accactgataaactgagatccctagtgaagaagtggcagacattaatcgaagcccatgtt 747 Query: 457 gatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagaga 516 ||||| ||||| || ||||| |||||| | || |||| ||| |||||||||||||| Sbjct: 746 gatgtcaagacaaccgacaactacatgttgcgtttgttctgcatcggcttcaccaagagg 687 Query: 517 cgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgc 576 |||||||||||||||||| | || ||||||||||| ||| |||||| | ||||||||| Sbjct: 686 cgcccaaaccaggtcaagagaacctgctatgctcaggcatcccagatccgtcagatccgc 627 Query: 577 cggaagatggttgagat 593 || |||||||||||||| Sbjct: 626 cgtaagatggttgagat 610 Score = 97.6 bits (49), Expect = 4e-17 Identities = 160/198 (80%) Strand = Plus / Minus Query: 73 gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaag 132 ||||| |||||||| ||||| ||||||||| | ||||||||||| | ||||||| ||||| Sbjct: 1130 gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 1071 Query: 133 aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 192 || |||| || || ||| | |||||| | ||||||||||||||||| ||| | | Sbjct: 1070 nnncagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 1011 Query: 193 ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 252 |||| |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| Sbjct: 1010 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 951 Query: 253 tcagagggcctgaagcac 270 || ||||| ||||||||| Sbjct: 950 tctgagggtctgaagcac 933
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence Length = 439641 Score = 149 bits (75), Expect = 1e-32 Identities = 84/87 (96%) Strand = Plus / Minus Query: 434 agaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgt 493 |||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 46711 agaccctcattgaggctcatgtggatgtgaagacaactgacaattacatgctccgcatgt 46652 Query: 494 ttgccattggcttcaccaagagacgcc 520 ||||||||||||||||||||| ||||| Sbjct: 46651 ttgccattggcttcaccaagaaacgcc 46625 Score = 79.8 bits (40), Expect = 9e-12 Identities = 49/52 (94%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 |||||||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 46885 gcagaccctcattgaggctcatgtggatgtgaagacaactgacaactacatg 46834 Score = 71.9 bits (36), Expect = 2e-09 Identities = 45/48 (93%) Strand = Plus / Minus Query: 436 accctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 |||||||||||||||||||| ||||||||||| |||||||| |||||| Sbjct: 47052 accctcattgaggctcatgtggatgtgaagacaactgacaactacatg 47005
>ref|NM_119633.2| Arabidopsis thaliana structural constituent of ribosome AT4G34670 mRNA, complete cds Length = 1093 Score = 147 bits (74), Expect = 5e-32 Identities = 316/394 (80%), Gaps = 2/394 (0%) Strand = Plus / Plus Query: 78 aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137 ||||||||| ||||| ||||||||| | || || ||||| ||||| || | |||||||| Sbjct: 75 aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134 Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 196 ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || |||| Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193 Query: 197 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 256 | | | | || || || ||||| || || |||||||| |||||||||||||||||||| | Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253 Query: 257 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 316 |||| ||||| ||| |||||||||| || ||||| |||||||| || || |||||||| Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313 Query: 317 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 376 | ||||||||||||||| | || | ||||| ||||| || || | |||||| | || Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373 Query: 377 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 436 | |||||||| ||||||||||| || |||||||| ||||| | |||| ||||||||||| Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433 Query: 437 ccctcattgaggctcatgtcgatgtgaagaccac 470 | | ||||| || |||||||||||||| ||||| Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467
>gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein (At4g34670; T4L20.250) mRNA, complete cds Length = 1094 Score = 147 bits (74), Expect = 5e-32 Identities = 316/394 (80%), Gaps = 2/394 (0%) Strand = Plus / Plus Query: 78 aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137 ||||||||| ||||| ||||||||| | || || ||||| ||||| || | |||||||| Sbjct: 75 aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134 Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 196 ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || |||| Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193 Query: 197 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 256 | | | | || || || ||||| || || |||||||| |||||||||||||||||||| | Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253 Query: 257 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 316 |||| ||||| ||| |||||||||| || ||||| |||||||| || || |||||||| Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313 Query: 317 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 376 | ||||||||||||||| | || | ||||| ||||| || || | |||||| | || Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373 Query: 377 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 436 | |||||||| ||||||||||| || |||||||| ||||| | |||| ||||||||||| Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433 Query: 437 ccctcattgaggctcatgtcgatgtgaagaccac 470 | | ||||| || |||||||||||||| ||||| Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467
>emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH6ZD12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 147 bits (74), Expect = 5e-32 Identities = 316/394 (80%), Gaps = 2/394 (0%) Strand = Plus / Plus Query: 78 aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137 ||||||||| ||||| ||||||||| | || || ||||| ||||| || | |||||||| Sbjct: 60 aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 119 Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 196 ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || |||| Sbjct: 120 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 178 Query: 197 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 256 | | | | || || || ||||| || || |||||||| |||||||||||||||||||| | Sbjct: 179 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 238 Query: 257 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 316 |||| ||||| ||| |||||||||| || ||||| |||||||| || || |||||||| Sbjct: 239 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 298 Query: 317 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 376 | ||||||||||||||| | || | ||||| ||||| || || | |||||| | || Sbjct: 299 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 358 Query: 377 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 436 | |||||||| ||||||||||| || |||||||| ||||| | |||| ||||||||||| Sbjct: 359 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 418 Query: 437 ccctcattgaggctcatgtcgatgtgaagaccac 470 | | ||||| || |||||||||||||| ||||| Sbjct: 419 ctttgattgaagcccatgtcgatgtgaaaaccac 452
>gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein (At4g34670) mRNA, complete cds Length = 581 Score = 145 bits (73), Expect = 2e-31 Identities = 315/393 (80%), Gaps = 2/393 (0%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138 |||||||| ||||| ||||||||| | || || ||||| ||||| || | ||||||||| Sbjct: 581 accatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaag 522 Query: 139 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcac 197 || || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||| Sbjct: 521 gctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcac 463 Query: 198 cagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcaga 257 | | | || || || ||||| || || |||||||| |||||||||||||||||||| || Sbjct: 462 gaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctga 403 Query: 258 gggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacca 317 ||| ||||| ||| |||||||||| || ||||| |||||||| || || |||||||| | Sbjct: 402 gggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataa 343 Query: 318 ggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaa 377 ||||||||||||||| | || | ||||| ||||| || || | |||||| | || | Sbjct: 342 tgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccca 283 Query: 378 cttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagac 437 |||||||| ||||||||||| || |||||||| ||||| | |||| |||||||||||| Sbjct: 282 gttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagac 223 Query: 438 cctcattgaggctcatgtcgatgtgaagaccac 470 | ||||| || |||||||||||||| ||||| Sbjct: 222 tttgattgaagcccatgtcgatgtgaaaaccac 190
>emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-specific ribosomal protein Length = 906 Score = 139 bits (70), Expect = 1e-29 Identities = 312/390 (80%), Gaps = 2/390 (0%) Strand = Plus / Plus Query: 82 atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 141 ||||| ||||| ||||||||| | || || ||||| ||||| || | ||||||||||| Sbjct: 1 atggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaaggct 60 Query: 142 gtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcaccag 200 || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||| | Sbjct: 61 gttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcacgaa 119 Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260 | | || || || ||||| || || |||||||| |||||||||||||||||||| ||||| Sbjct: 120 caggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctgaggg 179 Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggc 320 ||||| ||| |||||||||| || ||||| |||||||| || || |||||||| | || Sbjct: 180 actgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataatgc 239 Query: 321 ctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaactt 380 ||||||||||||| | || | ||||| ||||| || || | |||||| | || | || Sbjct: 240 ctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgacccagtt 299 Query: 381 ctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccct 440 |||||| ||||||||||| || |||||||| ||||| | |||| |||||||||||| | Sbjct: 300 ctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagacttt 359 Query: 441 cattgaggctcatgtcgatgtgaagaccac 470 ||||| || |||||||||||||| ||||| Sbjct: 360 gattgaagcccatgtcgatgtgaaaaccac 389
>gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds Length = 786 Score = 137 bits (69), Expect = 5e-29 Identities = 210/257 (81%) Strand = Plus / Plus Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264 ||||| ||||||||||| || | ||||| |||||||| |||||||| || || || || Sbjct: 124 aacgttggcaagaccctggtcactaggactcagggtactaagattgcttcggaaggacta 183 Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324 |||||| | || |||||||| | | |||||||||||||| |||||||| || | | | Sbjct: 184 aagcacagagtatttgaagtcagtttggctgatcttcagaaggatgaggatcaatctttc 243 Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384 ||||||||| | | | || || ||||||||||||| |||||||||||||||||||||| Sbjct: 244 aggaagatccgcttgagggcagaagatgtgcaagggaagaatgtcctcacaaacttctgg 303 Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444 || ||||||||||| || |||||| | |||||||| || | |||||||||||| | ||| Sbjct: 304 ggaatggatttcacaacagacaagttgaggtctctggtaaagaagtggcagacattgatt 363 Query: 445 gaggctcatgtcgatgt 461 ||||||||||| ||||| Sbjct: 364 gaggctcatgtggatgt 380 Score = 50.1 bits (25), Expect = 0.008 Identities = 82/101 (81%) Strand = Plus / Plus Query: 82 atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 141 ||||| ||||||||||||||| | || || ||||| | ||| || | ||||||||||| Sbjct: 1 atggctgtcggcaagaacaagaggatttcaaagggaaagaaaggaggaaagaagaaggcg 60 Query: 142 gtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 | |||||||| | | |||||| | ||||||||||| ||||| Sbjct: 61 gcggatccgtacgcaaagaaggactggtatgacataaaggc 101 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Plus Query: 559 cagatcagacagatccgccggaagatggttgagatcatg 597 |||||| | |||||||| ||||| ||||||||||||||| Sbjct: 478 cagatccgtcagatccgtcggaaaatggttgagatcatg 516
>emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB21ZE07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 836 Score = 137 bits (69), Expect = 5e-29 Identities = 201/245 (82%) Strand = Plus / Plus Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 |||||||| |||||||||||||||||||| ||||| ||||| ||| |||||||||| || Sbjct: 52 tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 111 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 ||||| |||||||| || || |||||||| | ||||||||||||||| | || | ||| Sbjct: 112 tctcttgctgatctacaaaatgatgaggataatgcctacaggaagatccgtcttagagct 171 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 || ||||| || || | |||||| | || | |||||||| ||||||||||| || ||| Sbjct: 172 gaagatgttcagggaaggaatgtgttgacccagttctggggtatggatttcacaaccgac 231 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 ||||| ||||| | |||| |||||||||||| | ||||| || |||||||||||||| Sbjct: 232 aagctaaggtcattggtgaagaagtggcagactttgattgaagcccatgtcgatgtgaaa 291 Query: 466 accac 470 ||||| Sbjct: 292 accac 296
>emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene Length = 1050 Score = 131 bits (66), Expect = 3e-27 Identities = 222/274 (81%) Strand = Plus / Plus Query: 208 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 267 ||||| ||||| || || ||||| || ||||||||||||||||| |||||||| |||| Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291 Query: 268 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 327 ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| |||||| Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351 Query: 328 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 387 |||||| | ||| | ||||| ||||| || || | ||||||| | || | |||||||| Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411 Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 ||||| ||||| || ||||| |||||||| | || | |||||||||||| | || ||| Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471 Query: 448 gctcatgtcgatgtgaagaccactgacaattaca 481 ||||||| ||||| |||||||||||||| |||| Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505 Score = 75.8 bits (38), Expect = 1e-10 Identities = 89/106 (83%) Strand = Plus / Plus Query: 77 caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136 |||||||||| ||||| ||||||||| | ||||||||||| || ||||| ||||||||| Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160 Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 || || ||||| ||| |||||||| | |||||||| |||||||| Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206 Score = 40.1 bits (20), Expect = 8.2 Identities = 41/48 (85%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 551 ||||||||||||||| | ||||| || ||| | |||||||||||||| Sbjct: 528 cttcaccaagagacgtgctaaccaagttaagagaacttgctatgctca 575
>gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein mRNA, complete cds Length = 1020 Score = 131 bits (66), Expect = 3e-27 Identities = 195/238 (81%) Strand = Plus / Plus Query: 230 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 289 |||| |||||||| |||||||| ||||| || || |||||| | || |||||||| | Sbjct: 192 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 251 Query: 290 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 349 | |||||||||||||| |||||||| ||||| |||||||||||| | | | || || | Sbjct: 252 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 311 Query: 350 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 409 |||||||||||| ||||||||||||||||||| || ||||| ||||| || |||||| Sbjct: 312 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 371 Query: 410 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 | |||||||| ||| | ||||||||||| | |||||||||||||| ||||| ||||| Sbjct: 372 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 429
>gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, complete cds Length = 996 Score = 131 bits (66), Expect = 3e-27 Identities = 195/238 (81%) Strand = Plus / Plus Query: 230 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 289 |||| |||||||| |||||||| ||||| || || |||||| | || |||||||| | Sbjct: 170 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 229 Query: 290 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 349 | |||||||||||||| |||||||| ||||| |||||||||||| | | | || || | Sbjct: 230 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 289 Query: 350 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 409 |||||||||||| ||||||||||||||||||| || ||||| ||||| || |||||| Sbjct: 290 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 349 Query: 410 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 | |||||||| ||| | ||||||||||| | |||||||||||||| ||||| ||||| Sbjct: 350 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 407
>gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA, complete cds Length = 1050 Score = 131 bits (66), Expect = 3e-27 Identities = 222/274 (81%) Strand = Plus / Plus Query: 208 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 267 ||||| ||||| || || ||||| || ||||||||||||||||| |||||||| |||| Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291 Query: 268 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 327 ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| |||||| Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351 Query: 328 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 387 |||||| | ||| | ||||| ||||| || || | ||||||| | || | |||||||| Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411 Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 ||||| ||||| || ||||| |||||||| | || | |||||||||||| | || ||| Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471 Query: 448 gctcatgtcgatgtgaagaccactgacaattaca 481 ||||||| ||||| |||||||||||||| |||| Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505 Score = 75.8 bits (38), Expect = 1e-10 Identities = 89/106 (83%) Strand = Plus / Plus Query: 77 caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136 |||||||||| ||||| ||||||||| | ||||||||||| || ||||| ||||||||| Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160 Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 || || ||||| ||| |||||||| | |||||||| |||||||| Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206 Score = 40.1 bits (20), Expect = 8.2 Identities = 41/48 (85%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 551 ||||||||||||||| | ||||| || ||| | |||||||||||||| Sbjct: 528 cttcaccaagagacgtgctaaccaagttaagagaacttgctatgctca 575
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Plus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || |||||||| ||||| | |||||||| || || |||||||||| |||| Sbjct: 5244369 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5244428 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| || Sbjct: 5244429 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5244488 Query: 365 atgtcctcacaaacttctggg 385 | || ||||| ||||| |||| Sbjct: 5244489 acgtgctcaccaacttttggg 5244509 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Plus Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || Sbjct: 5244600 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5244659 Query: 466 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525 ||||| ||| |||||||| || |||| || |||||||||||| | || || ||| Sbjct: 5244660 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5244719 Query: 526 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570 ||||| ||| | ||||||||||||||||| ||||||||||||||| Sbjct: 5244720 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5244764 Score = 67.9 bits (34), Expect = 4e-08 Identities = 34/34 (100%) Strand = Plus / Plus Query: 209 tcggcaagaccctcgtgtccaggacacagggtac 242 |||||||||||||||||||||||||||||||||| Sbjct: 5243526 tcggcaagaccctcgtgtccaggacacagggtac 5243559 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 5243269 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5243328 Query: 130 aagaagaag 138 ||||||||| Sbjct: 5243329 aagaagaag 5243337
>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3 clone OSJNBa0021H20, complete sequence Length = 133079 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Plus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || |||||||| ||||| | |||||||| || || |||||||||| |||| Sbjct: 67771 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 67830 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| || Sbjct: 67831 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 67890 Query: 365 atgtcctcacaaacttctggg 385 | || ||||| ||||| |||| Sbjct: 67891 acgtgctcaccaacttttggg 67911 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Plus Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || Sbjct: 68002 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 68061 Query: 466 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525 ||||| ||| |||||||| || |||| || |||||||||||| | || || ||| Sbjct: 68062 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 68121 Query: 526 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570 ||||| ||| | ||||||||||||||||| ||||||||||||||| Sbjct: 68122 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 68166 Score = 67.9 bits (34), Expect = 4e-08 Identities = 34/34 (100%) Strand = Plus / Plus Query: 209 tcggcaagaccctcgtgtccaggacacagggtac 242 |||||||||||||||||||||||||||||||||| Sbjct: 66928 tcggcaagaccctcgtgtccaggacacagggtac 66961 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 66671 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 66730 Query: 130 aagaagaag 138 ||||||||| Sbjct: 66731 aagaagaag 66739
>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0091J11, from chromosome 3, complete sequence Length = 181163 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || |||||||| ||||| | |||||||| || || |||||||||| |||| Sbjct: 12149 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 12090 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| || Sbjct: 12089 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 12030 Query: 365 atgtcctcacaaacttctggg 385 | || ||||| ||||| |||| Sbjct: 12029 acgtgctcaccaacttttggg 12009 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Minus Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || Sbjct: 11918 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 11859 Query: 466 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525 ||||| ||| |||||||| || |||| || |||||||||||| | || || ||| Sbjct: 11858 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 11799 Query: 526 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570 ||||| ||| | ||||||||||||||||| ||||||||||||||| Sbjct: 11798 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 11754 Score = 67.9 bits (34), Expect = 4e-08 Identities = 34/34 (100%) Strand = Plus / Minus Query: 209 tcggcaagaccctcgtgtccaggacacagggtac 242 |||||||||||||||||||||||||||||||||| Sbjct: 12992 tcggcaagaccctcgtgtccaggacacagggtac 12959 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 13249 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 13190 Query: 130 aagaagaag 138 ||||||||| Sbjct: 13189 aagaagaag 13181
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| ||||||||||| |||||||| |||||||| || || | ||||||||||||| Sbjct: 12316009 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12315950 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| |||| | Sbjct: 12315949 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12315890 Query: 365 atgtcctcacaaacttctggg 385 |||| || ||||||||||||| Sbjct: 12315889 atgttcttacaaacttctggg 12315869 Score = 87.7 bits (44), Expect = 4e-14 Identities = 146/180 (81%) Strand = Plus / Minus Query: 384 gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443 ||||||| |||||| || ||||||||||| || | || | ||| |||||||| || || Sbjct: 12315798 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12315739 Query: 444 tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 503 ||||||||||| ||||| ||||||||||| || |||||||| || | || |||||| Sbjct: 12315738 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12315679 Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 |||||||||||| | ||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 12315678 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12315619 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| ||||||||||||||||| ||||| ||||||| |||||| | Sbjct: 12318599 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 12318540 Query: 130 aagaagaag 138 ||||||||| Sbjct: 12318539 aagaagaag 12318531 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 205 aacgtcggcaagaccctcgtgtccaggacacaggg 239 |||||||| ||||| |||||||||||||||||||| Sbjct: 12318352 aacgtcgggaagacgctcgtgtccaggacacaggg 12318318 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 39 ctccacccgccgcagcgccgccac 62 ||||||||||||| |||||||||| Sbjct: 18425138 ctccacccgccgccgcgccgccac 18425115 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 568 cagatccgccggaagatggttgagatcatggt 599 |||||||| || |||||||| ||||||||||| Sbjct: 12315503 cagatccgtcgcaagatggtggagatcatggt 12315472
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Plus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || |||||||| ||||| | |||||||| || || |||||||||| |||| Sbjct: 5243584 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5243643 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| || Sbjct: 5243644 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5243703 Query: 365 atgtcctcacaaacttctggg 385 | || ||||| ||||| |||| Sbjct: 5243704 acgtgctcaccaacttttggg 5243724 Score = 97.6 bits (49), Expect = 4e-17 Identities = 136/165 (82%) Strand = Plus / Plus Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || Sbjct: 5243815 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5243874 Query: 466 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525 ||||| ||| |||||||| || |||| || |||||||||||| | || || ||| Sbjct: 5243875 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5243934 Query: 526 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570 ||||| ||| | ||||||||||||||||| ||||||||||||||| Sbjct: 5243935 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5243979 Score = 67.9 bits (34), Expect = 4e-08 Identities = 34/34 (100%) Strand = Plus / Plus Query: 209 tcggcaagaccctcgtgtccaggacacagggtac 242 |||||||||||||||||||||||||||||||||| Sbjct: 5242741 tcggcaagaccctcgtgtccaggacacagggtac 5242774 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| || || ||||||||||||||||||||||||| |||||| | Sbjct: 5242484 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5242543 Query: 130 aagaagaag 138 ||||||||| Sbjct: 5242544 aagaagaag 5242552
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| ||||||||||| |||||||| |||||||| || || | ||||||||||||| Sbjct: 12270379 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12270320 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| |||| | Sbjct: 12270319 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12270260 Query: 365 atgtcctcacaaacttctggg 385 |||| || ||||||||||||| Sbjct: 12270259 atgttcttacaaacttctggg 12270239 Score = 87.7 bits (44), Expect = 4e-14 Identities = 146/180 (81%) Strand = Plus / Minus Query: 384 gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443 ||||||| |||||| || ||||||||||| || | || | ||| |||||||| || || Sbjct: 12270168 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12270109 Query: 444 tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 503 ||||||||||| ||||| ||||||||||| || |||||||| || | || |||||| Sbjct: 12270108 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12270049 Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 |||||||||||| | ||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 12270048 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12269989 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| ||||||||||||||||| ||||| ||||||| |||||| | Sbjct: 12272969 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 12272910 Query: 130 aagaagaag 138 ||||||||| Sbjct: 12272909 aagaagaag 12272901 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 205 aacgtcggcaagaccctcgtgtccaggacacaggg 239 |||||||| ||||| |||||||||||||||||||| Sbjct: 12272722 aacgtcgggaagacgctcgtgtccaggacacaggg 12272688 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 39 ctccacccgccgcagcgccgccac 62 ||||||||||||| |||||||||| Sbjct: 18351364 ctccacccgccgccgcgccgccac 18351341 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 568 cagatccgccggaagatggttgagatcatggt 599 |||||||| || |||||||| ||||||||||| Sbjct: 12269873 cagatccgtcgcaagatggtggagatcatggt 12269842
>emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa0009F05 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 163702 Score = 129 bits (65), Expect = 1e-26 Identities = 122/141 (86%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| ||||||||||| |||||||| |||||||| || || | ||||||||||||| Sbjct: 30374 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 30315 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| |||| | Sbjct: 30314 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 30255 Query: 365 atgtcctcacaaacttctggg 385 |||| || ||||||||||||| Sbjct: 30254 atgttcttacaaacttctggg 30234 Score = 87.7 bits (44), Expect = 4e-14 Identities = 146/180 (81%) Strand = Plus / Minus Query: 384 gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443 ||||||| |||||| || ||||||||||| || | || | ||| |||||||| || || Sbjct: 30163 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 30104 Query: 444 tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 503 ||||||||||| ||||| ||||||||||| || |||||||| || | || |||||| Sbjct: 30103 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 30044 Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 |||||||||||| | ||||| || ||||| || || ||||||||||||||||| ||||| Sbjct: 30043 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 29984 Score = 65.9 bits (33), Expect = 1e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 70 gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129 |||||| || ||||||| ||||||||||||||||| ||||| ||||||| |||||| | Sbjct: 32964 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 32905 Query: 130 aagaagaag 138 ||||||||| Sbjct: 32904 aagaagaag 32896 Score = 54.0 bits (27), Expect = 5e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 205 aacgtcggcaagaccctcgtgtccaggacacaggg 239 |||||||| ||||| |||||||||||||||||||| Sbjct: 32717 aacgtcgggaagacgctcgtgtccaggacacaggg 32683 Score = 40.1 bits (20), Expect = 8.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 568 cagatccgccggaagatggttgagatcatggt 599 |||||||| || |||||||| ||||||||||| Sbjct: 29868 cagatccgtcgcaagatggtggagatcatggt 29837
>gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRNA, partial cds Length = 571 Score = 123 bits (62), Expect = 7e-25 Identities = 143/170 (84%) Strand = Plus / Plus Query: 307 gatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaat 366 ||||||||||| ||| |||||||||| | | | ||||| ||||| || || | |||| Sbjct: 67 gatgaggaccactccttcaggaagatccgtttgagagctgaagatgttcagggaaagaat 126 Query: 367 gtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgagg 426 || |||||||||||||||||||||||||||||||| |||||||| || ||||| |||||| Sbjct: 127 gttctcacaaacttctggggcatggatttcaccaccgacaagctgagatctctcgtgagg 186 Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaa 476 || |||||| | || |||||||||||||| ||||| ||||| || ||||| Sbjct: 187 aaatggcagtcactaattgaggctcatgttgatgtcaagactaccgacaa 236
>emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal protein S3a (rs3a gene) Length = 1026 Score = 121 bits (61), Expect = 3e-24 Identities = 193/237 (81%) Strand = Plus / Plus Query: 363 gaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgt 422 |||||||||||| ||||| | || |||||||||||||||||||||||||||||| | || Sbjct: 332 gaatgtcctcaccaacttttatggtatggatttcaccactgacaagctcaggtctttggt 391 Query: 423 gaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacat 482 | || ||||| || |||||||| |||||||| ||||| ||||||||||| ||||| | Sbjct: 392 ccgtaaatggcaaactctcattgaagctcatgtggatgttaagaccactgataattatac 451 Query: 483 gctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttg 542 | | ||||| ||||||||| |||||||||||| ||||| || ||| | || || Sbjct: 452 cttgagaatgttctgcattggctttaccaagagacgcagtaaccaagtgaagagaacctg 511 Query: 543 ctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggt 599 ||||||||| | || |||||||||||||||||| |||||||| ||||||||||| Sbjct: 512 ttatgctcaatccagccagatcagacagatccgcaggaagatgagggagatcatggt 568 Score = 83.8 bits (42), Expect = 6e-13 Identities = 90/106 (84%) Strand = Plus / Plus Query: 77 caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136 |||||||||||||||||||||||||| | || |||||||| | |||||| ||||||||| Sbjct: 46 caaccatggcggtcggcaagaacaagagaatttccaagggaaagaagggaggcaagaaga 105 Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 | |||| ||||| || |||||||| | |||||||| |||||||| Sbjct: 106 aagccgccgatcccttttccaagaaggattggtatgatatcaaggc 151
>dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds Length = 1050 Score = 119 bits (60), Expect = 1e-23 Identities = 282/356 (79%) Strand = Plus / Plus Query: 235 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 294 ||||||||||||||||| || || || || || ||||| ||||| || || | || ||| Sbjct: 175 cagggtaccaagattgcttctgaaggactcaaacaccgagtgttcgaggtttgccttgct 234 Query: 295 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 354 || |||||| |||||||||||||| || |||||||| | || | || ||||||||| Sbjct: 235 gaccttcagggagatgaggaccaggcttataggaagattcgcctgagagcagaggatgtg 294 Query: 355 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 414 ||||||| |||||| || |||||||||| || ||||| ||||| ||||||||| | ||| Sbjct: 295 caagggaagaatgtgcttacaaacttctatggaatggacttcacaactgacaagttgagg 354 Query: 415 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 474 ||||| || | ||||||||||| || ||||| |||||||| ||||||||||| ||||| Sbjct: 355 tctctggtacgcaagtggcagacactgattgaagctcatgtagatgtgaagacaactgat 414 Query: 475 aattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaag 534 | ||| | || || |||||| |||||| || ||||||| ||| |||| ||| ||| Sbjct: 415 agttatactctgcgaatgttttgcattggatttaccaagaaacgtgcaaatcagcagaag 474 Query: 535 cgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttga 590 | || |||||||| ||| | || |||||| | ||||| ||||| ||||||||||| Sbjct: 475 agaacctgctatgcccaatctagccagatccggcagattcgccgtaagatggttga 530 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 76 gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 135 ||||||||||| ||||||||||||||| | ||||| ||||| | |||||| |||||||| Sbjct: 16 gcaaccatggctgtcggcaagaacaagaggatctcgaagggaaagaagggaggcaagaag 75 Query: 136 aaggc 140 ||||| Sbjct: 76 aaggc 80
>gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal protein S3a-like mRNA, complete cds Length = 1118 Score = 117 bits (59), Expect = 4e-23 Identities = 212/263 (80%) Strand = Plus / Plus Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264 ||||||||||| ||||| || ||||||| ||||||||||||||||| ||||||||||| Sbjct: 210 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagagggccta 269 Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324 || ||| | || |||||||| || |||||||||||||| |||||||| ||||| | | Sbjct: 270 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 329 Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384 ||||| ||| | | | || || ||||||||||||| |||||| |||||||||||| Sbjct: 330 aggaaaatccgtttgagagcagaagatgtgcaagggaggaatgttctcacaaacttccat 389 Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444 || ||||||||||| || || ||| | |||||||| || | || |||||||| | ||| Sbjct: 390 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 449 Query: 445 gaggctcatgtcgatgtgaagac 467 ||||| ||||| ||||| ||||| Sbjct: 450 gaggcccatgttgatgtcaagac 472 Score = 52.0 bits (26), Expect = 0.002 Identities = 83/102 (81%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140 |||||| ||||||||||||||| | || |||||||| | |||||| | ||||||||||| Sbjct: 86 catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 145 Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 | |||||| | | |||||| | ||||| ||||||||||| Sbjct: 146 ggcggatccttatgcaaagaaggactggtacgacatcaaggc 187 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 568 cagatccgccggaagatggttgagat 593 ||||||||| |||||||||||||||| Sbjct: 573 cagatccgcaggaagatggttgagat 598
>gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds Length = 342 Score = 115 bits (58), Expect = 2e-22 Identities = 64/66 (96%) Strand = Plus / Plus Query: 534 gcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagat 593 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 3 gcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatggttgagat 62 Query: 594 catggt 599 |||||| Sbjct: 63 catggt 68
>gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BAC 519K7 hardness locus region Length = 12998 Score = 113 bits (57), Expect = 7e-22 Identities = 81/89 (91%) Strand = Plus / Plus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 491 ||||||||||||||||||||||| ||||| ||||| |||||||| |||||||||||||| Sbjct: 3401 gcagaccctcattgaggctcatgcagatgtcaagacaactgacaactacatgctccgcat 3460 Query: 492 gtttgccattggcttcaccaagagacgcc 520 |||| ||| |||||||||||||| ||||| Sbjct: 3461 gtttcccactggcttcaccaagaaacgcc 3489
>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus region Length = 160897 Score = 111 bits (56), Expect = 3e-21 Identities = 80/88 (90%) Strand = Plus / Minus Query: 433 cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 492 |||||||||| ||||||||||| ||||| ||||| ||||||||||||||||| |||||| Sbjct: 128530 cagaccctcagtgaggctcatgcagatgtcaagacaactgacaattacatgcttcgcatg 128471 Query: 493 tttgccattggcttcaccaagagacgcc 520 ||||||||||||||||| |||| ||||| Sbjct: 128470 tttgccattggcttcacaaagaaacgcc 128443 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 ||||| |||||||||||||||||| ||||| ||||| ||||||||||||||| Sbjct: 128702 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 128651 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 |||||||| |||||| |||||||| ||||| ||||| ||||||||||||||| Sbjct: 128814 gcagacccacattgaagctcatgtagatgtcaagacaactgacaattacatg 128763 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 ||||| |||||||||| ||||||| ||||| ||||| ||||||||||||||| Sbjct: 128758 gcagaacctcattgagactcatgtagatgtcaagacaactgacaattacatg 128707
>gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA, complete cds Length = 899 Score = 105 bits (53), Expect = 2e-19 Identities = 143/173 (82%) Strand = Plus / Plus Query: 301 cagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaaggg 360 |||||||||||||||||||| | | | ||||||| || | || ||||||||||| || Sbjct: 238 cagaacgatgaggaccaggctttccgcaagatcaagctgagggcggaggatgtgcagggc 297 Query: 361 atgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctctt 420 | ||| || ||||| ||||||||||||||||| |||||||| |||||||| ||||||| Sbjct: 298 aagaacgtgctcaccaacttctggggcatggacttcaccacggacaagctgcggtctctg 357 Query: 421 gtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactga 473 ||| | |||||||||| | || ||||||| |||||||||||||||||||| Sbjct: 358 gtgcgcaagtggcagagtttgatccaggctcacgtcgatgtgaagaccactga 410 Score = 75.8 bits (38), Expect = 1e-10 Identities = 89/106 (83%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| ||||| ||| | |||||||| |||||||| | |||||| |||||||||| Sbjct: 20 ccatggccgtcggaaaggataagcgcatttccaagggcaagaagggcggcaagaagaaaa 79 Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc 185 || ||||||||| |||||||| | |||||||||||||||||||| Sbjct: 80 ttgtcgatccgttctccaagaaggactggtatgacatcaaggcgcc 125
>gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein mRNA, complete cds Length = 1045 Score = 93.7 bits (47), Expect = 6e-16 Identities = 209/263 (79%) Strand = Plus / Plus Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264 ||||||||||| ||||| || ||||||| ||||||||||||||||| ||||| ||||| Sbjct: 197 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 256 Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324 || ||| | || |||||||| || |||||||||||||| |||||||| ||||| | | Sbjct: 257 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 316 Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384 ||||| ||| | | | || || ||||||||||||| ||||| |||||||| ||| Sbjct: 317 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 376 Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444 || ||||||||||| || || ||| | |||||||| || | || |||||||| | ||| Sbjct: 377 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 436 Query: 445 gaggctcatgtcgatgtgaagac 467 ||||| ||||| ||||| ||||| Sbjct: 437 gaggcccatgttgatgtaaagac 459 Score = 60.0 bits (30), Expect = 9e-06 Identities = 84/102 (82%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140 |||||| ||||||||||||||| | || |||||||| | |||||| | ||||||||||| Sbjct: 73 catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 132 Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 | |||||| | | | |||||| | ||||| ||||||||||| Sbjct: 133 ggcggatccttacgcaaagaaggactggtacgacatcaaggc 174 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 568 cagatccgccggaagatggttgagat 593 ||||||||| |||||||||||||||| Sbjct: 560 cagatccgcaggaagatggttgagat 585
>gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein mRNA, complete cds Length = 1038 Score = 93.7 bits (47), Expect = 6e-16 Identities = 209/263 (79%) Strand = Plus / Plus Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264 ||||||||||| ||||| || ||||||| ||||||||||||||||| ||||| ||||| Sbjct: 181 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 240 Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324 || ||| | || |||||||| || |||||||||||||| |||||||| ||||| | | Sbjct: 241 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 300 Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384 ||||| ||| | | | || || ||||||||||||| ||||| |||||||| ||| Sbjct: 301 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 360 Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444 || ||||||||||| || || ||| | |||||||| || | || |||||||| | ||| Sbjct: 361 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 420 Query: 445 gaggctcatgtcgatgtgaagac 467 ||||| ||||| ||||| ||||| Sbjct: 421 gaggcccatgttgatgtaaagac 443 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 568 cagatccgccggaagatggttgagat 593 ||||||||| |||||||||||||||| Sbjct: 544 cagatccgcaggaagatggttgagat 569
>gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, complete cds Length = 998 Score = 93.7 bits (47), Expect = 6e-16 Identities = 209/263 (79%) Strand = Plus / Plus Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264 ||||||||||| ||||| || ||||||| ||||||||||||||||| ||||| ||||| Sbjct: 157 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 216 Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324 || ||| | || |||||||| || |||||||||||||| |||||||| ||||| | | Sbjct: 217 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 276 Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384 ||||| ||| | | | || || ||||||||||||| ||||| |||||||| ||| Sbjct: 277 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 336 Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444 || ||||||||||| || || ||| | |||||||| || | || |||||||| | ||| Sbjct: 337 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 396 Query: 445 gaggctcatgtcgatgtgaagac 467 ||||| ||||| ||||| ||||| Sbjct: 397 gaggcccatgttgatgtaaagac 419 Score = 60.0 bits (30), Expect = 9e-06 Identities = 84/102 (82%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140 |||||| ||||||||||||||| | || |||||||| | |||||| | ||||||||||| Sbjct: 33 catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 92 Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 | |||||| | | | |||||| | ||||| ||||||||||| Sbjct: 93 ggcggatccttacgcaaagaaggactggtacgacatcaaggc 134 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 568 cagatccgccggaagatggttgagat 593 ||||||||| |||||||||||||||| Sbjct: 520 cagatccgcaggaagatggttgagat 545
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 89.7 bits (45), Expect = 1e-14 Identities = 117/141 (82%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || ||||| || ||||| || || |||||||| || | || |||||||||| Sbjct: 10823785 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 10823726 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| || Sbjct: 10823725 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 10823666 Query: 365 atgtcctcacaaacttctggg 385 |||||||||| || ||||||| Sbjct: 10823665 atgtcctcacgaatttctggg 10823645 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 10824694 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 10824636 Score = 69.9 bits (35), Expect = 9e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 442 attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 501 ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| |||| Sbjct: 10823493 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 10823434 Query: 502 ggcttcaccaagagacgcccaaaccaggtcaagcg 536 || ||||||||| | |||||||| ||||| ||||| Sbjct: 10823433 ggtttcaccaagcgccgcccaaatcaggtgaagcg 10823399 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 155 ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 214 |||||||| | ||||| ||||||||||||||| | ||| || ||||||| |||||| Sbjct: 10824487 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 10824428 Query: 215 agaccctcgtgtccaggacacagggtaccaag 246 |||||||||| |||||||| ||||| |||||| Sbjct: 10824427 agaccctcgtctccaggacccaggggaccaag 10824396 Score = 60.0 bits (30), Expect = 9e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 569 agatccgccggaagatggttgagatcatgg 598 |||||||||||||||||||||||||||||| Sbjct: 10823258 agatccgccggaagatggttgagatcatgg 10823229
>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1756_H07 Length = 217205 Score = 89.7 bits (45), Expect = 1e-14 Identities = 117/141 (82%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || ||||| || ||||| || || |||||||| || | || |||||||||| Sbjct: 29984 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 29925 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| || Sbjct: 29924 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 29865 Query: 365 atgtcctcacaaacttctggg 385 |||||||||| || ||||||| Sbjct: 29864 atgtcctcacgaatttctggg 29844 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 30893 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 30835 Score = 69.9 bits (35), Expect = 9e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 442 attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 501 ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| |||| Sbjct: 29692 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 29633 Query: 502 ggcttcaccaagagacgcccaaaccaggtcaagcg 536 || ||||||||| | |||||||| ||||| ||||| Sbjct: 29632 ggtttcaccaagcgccgcccaaatcaggtgaagcg 29598 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 155 ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 214 |||||||| | ||||| ||||||||||||||| | ||| || ||||||| |||||| Sbjct: 30686 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 30627 Query: 215 agaccctcgtgtccaggacacagggtaccaag 246 |||||||||| |||||||| ||||| |||||| Sbjct: 30626 agaccctcgtctccaggacccaggggaccaag 30595 Score = 60.0 bits (30), Expect = 9e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 569 agatccgccggaagatggttgagatcatgg 598 |||||||||||||||||||||||||||||| Sbjct: 29457 agatccgccggaagatggttgagatcatgg 29428
>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1115_D03 Length = 169378 Score = 89.7 bits (45), Expect = 1e-14 Identities = 117/141 (82%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 ||||||| || ||||| || ||||| || || |||||||| || | || |||||||||| Sbjct: 163266 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 163207 Query: 305 acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364 | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| || Sbjct: 163206 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 163147 Query: 365 atgtcctcacaaacttctggg 385 |||||||||| || ||||||| Sbjct: 163146 atgtcctcacgaatttctggg 163126 Score = 69.9 bits (35), Expect = 9e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138 ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| Sbjct: 164175 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 164117 Score = 69.9 bits (35), Expect = 9e-09 Identities = 80/95 (84%) Strand = Plus / Minus Query: 442 attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 501 ||||| || ||||| ||||| |||||||| || || |||||||||||| ||||| |||| Sbjct: 162974 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 162915 Query: 502 ggcttcaccaagagacgcccaaaccaggtcaagcg 536 || ||||||||| | |||||||| ||||| ||||| Sbjct: 162914 ggtttcaccaagcgccgcccaaatcaggtgaagcg 162880 Score = 63.9 bits (32), Expect = 6e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 155 ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 214 |||||||| | ||||| ||||||||||||||| | ||| || ||||||| |||||| Sbjct: 163968 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 163909 Query: 215 agaccctcgtgtccaggacacagggtaccaag 246 |||||||||| |||||||| ||||| |||||| Sbjct: 163908 agaccctcgtctccaggacccaggggaccaag 163877 Score = 60.0 bits (30), Expect = 9e-06 Identities = 30/30 (100%) Strand = Plus / Minus Query: 569 agatccgccggaagatggttgagatcatgg 598 |||||||||||||||||||||||||||||| Sbjct: 162739 agatccgccggaagatggttgagatcatgg 162710
>dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS1 gene Length = 10603 Score = 83.8 bits (42), Expect = 6e-13 Identities = 67/74 (90%), Gaps = 1/74 (1%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 491 ||||||||||| ||||||||||| ||||| ||||| |||||||||| ||||||| |||| Sbjct: 4956 gcagaccctcagtgaggctcatgcagatgtcaagacaactgacaatt-catgctctgcat 4898 Query: 492 gtttgccattggct 505 |||||||||||||| Sbjct: 4897 gtttgccattggct 4884 Score = 71.9 bits (36), Expect = 2e-09 Identities = 48/52 (92%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 ||||| |||||||||||||||||| ||||| ||||| ||||||||||||||| Sbjct: 5127 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 5076 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 432 gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483 |||||||||||||||| ||||||| ||||| ||||| |||||||| |||||| Sbjct: 5183 gcagaccctcattgagcctcatgtagatgtcaagacaactgacaaatacatg 5132
>gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete sequence Length = 145314 Score = 81.8 bits (41), Expect = 2e-12 Identities = 140/173 (80%) Strand = Plus / Plus Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 |||||||| ||||| |||||||| ||||| | ||| | ||||||||||| |||||||| Sbjct: 48503 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 48562 Query: 448 gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 507 |||||||| ||||| ||||||||||| || || | | | ||||| |||||| ||| Sbjct: 48563 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 48622 Query: 508 accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 560 |||||||| ||| |||||||||| ||| | ||||| ||||| ||| ||||||| Sbjct: 48623 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 48675 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137 |||||||||||| ||||||||| | || || ||||| | ||||||| |||||||||| Sbjct: 47391 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 47447
>gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete sequence Length = 108644 Score = 81.8 bits (41), Expect = 2e-12 Identities = 140/173 (80%) Strand = Plus / Minus Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 |||||||| ||||| |||||||| ||||| | ||| | ||||||||||| |||||||| Sbjct: 42408 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 42349 Query: 448 gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 507 |||||||| ||||| ||||||||||| || || | | | ||||| |||||| ||| Sbjct: 42348 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 42289 Query: 508 accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 560 |||||||| ||| |||||||||| ||| | ||||| ||||| ||| ||||||| Sbjct: 42288 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 42236 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137 |||||||||||| ||||||||| | || || ||||| | ||||||| |||||||||| Sbjct: 43520 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 43464
>dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-phase specific ribosomal protein cyc07, complete cds Length = 980 Score = 77.8 bits (39), Expect = 4e-11 Identities = 75/87 (86%) Strand = Plus / Plus Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 |||||||||||| | |||||||| | ||||| || |||| |||||||| |||||||| Sbjct: 367 atggatttcacctccgacaagctgcgatctctcgtacggaaatggcagactctcattgaa 426 Query: 448 gctcatgtcgatgtgaagaccactgac 474 || |||||||||||||||||||||||| Sbjct: 427 gcccatgtcgatgtgaagaccactgac 453 Score = 52.0 bits (26), Expect = 0.002 Identities = 86/106 (81%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140 |||||| || || |||||||||||| | || ||||| | |||||||| |||||| |||| Sbjct: 60 catggctgttggaaagaacaagcgcctttcgaagggcaagaagggtatcaagaaaaaggt 119 Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccg 186 ||| ||||||||| ||| ||| | ||||| || ||||| |||||| Sbjct: 120 cgtcgatccgttctccagaaaggactggtacgatatcaaagcgccg 165
>gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal protein S3a-like protein mRNA, complete cds Length = 1059 Score = 75.8 bits (38), Expect = 1e-10 Identities = 191/242 (78%) Strand = Plus / Plus Query: 232 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 291 ||||||||||| |||||||| ||||| ||||||||||| || ||||||||||| || | Sbjct: 182 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgtttgaagtgtcattg 241 Query: 292 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 351 |||||||||||||| || || || || ||| ||||||||| | || | ||||| ||| Sbjct: 242 gctgatcttcagaatgacgaagatcactccttcaggaagattcgtcttagagctgaagat 301 Query: 352 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 411 || ||||| | |||||| | ||||||||| || ||||| |||||||| || || | Sbjct: 302 gtccaaggaagaaatgtcttgacaaacttccatggtatggacttcaccacagataaattg 361 Query: 412 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 471 ||||| ||||| | ||| ||||| | | |||||||||||||| ||||| ||||| ||| Sbjct: 362 aggtcacttgtaaagaaatggcaatcattgattgaggctcatgttgatgttaagacaact 421 Query: 472 ga 473 || Sbjct: 422 ga 423 Score = 40.1 bits (20), Expect = 8.2 Identities = 50/60 (83%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140 |||||| ||||| ||||||||||| || ||||| || | |||||| | ||||||||||| Sbjct: 31 catggccgtcggtaagaacaagcgaatttccaaaggcaagaagggaggaaagaagaaggc 90
>gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA, complete cds Length = 982 Score = 75.8 bits (38), Expect = 1e-10 Identities = 191/242 (78%) Strand = Plus / Plus Query: 235 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 294 |||||||| |||||||| || ||||| |||| || ||||||||||| || ||| | ||| Sbjct: 223 cagggtactaagattgcttccgagggattgaaacatcgggtgtttgaggtgtctttggct 282 Query: 295 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 354 ||||| ||||| ||||| || || ||||||| |||||| | | | ||||| || || Sbjct: 283 gatctccagaatgatgaagatcattcctacagaaagatccggttgagagctgaagacgtt 342 Query: 355 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 414 ||||||| |||||| | || || |||||||| |||||| | ||||| || ||||||||| Sbjct: 343 caagggaagaatgttttgaccaatttctggggtatggatgttaccacagataagctcagg 402 Query: 415 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 474 || ||||||| ||| |||||| | | || || || ||||||||||| ||||| || ||| Sbjct: 403 tcgcttgtgaagaaatggcagtctttgatcgaagcacatgtcgatgttaagacaaccgac 462 Query: 475 aa 476 || Sbjct: 463 aa 464
>ref|XM_774945.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein S3a, transcript variant 1 (LOC575056), mRNA Length = 1003 Score = 73.8 bits (37), Expect = 6e-10 Identities = 94/113 (83%) Strand = Plus / Plus Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260 ||||||| |||||||||| ||||| ||||||||||||| || || || ||||| || || Sbjct: 130 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 189 Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313 |||||| || |||||||| || ||||| |||||||| ||||||||||||| Sbjct: 190 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 242 Score = 40.1 bits (20), Expect = 8.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 atccgccggaagatggttgagatcatgg 598 |||||| |||||||| |||||||||||| Sbjct: 497 atccgcaggaagatgattgagatcatgg 524
>ref|XM_796644.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein S3a, transcript variant 2 (LOC575056), mRNA Length = 749 Score = 73.8 bits (37), Expect = 6e-10 Identities = 94/113 (83%) Strand = Plus / Plus Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260 ||||||| |||||||||| ||||| ||||||||||||| || || || ||||| || || Sbjct: 130 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 189 Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313 |||||| || |||||||| || ||||| |||||||| ||||||||||||| Sbjct: 190 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 242 Score = 40.1 bits (20), Expect = 8.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 571 atccgccggaagatggttgagatcatgg 598 |||||| |||||||| |||||||||||| Sbjct: 497 atccgcaggaagatgattgagatcatgg 524
>ref|XM_785062.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC585229), partial mRNA Length = 327 Score = 73.8 bits (37), Expect = 6e-10 Identities = 94/113 (83%) Strand = Plus / Plus Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260 ||||||| |||||||||| ||||| ||||||||||||| || || || ||||| || || Sbjct: 96 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 155 Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313 |||||| || |||||||| || ||||| |||||||| ||||||||||||| Sbjct: 156 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 208
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82 Length = 195165 Score = 73.8 bits (37), Expect = 6e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || | Sbjct: 4117 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 4176 Query: 305 acgatgaggaccaggcctacaggaagatc 333 | |||||||| | ||||||||||||||| Sbjct: 4177 atgatgaggataatgcctacaggaagatc 4205 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 ||||||||||| || |||||||| ||||| | |||| |||||||||||| | ||||| Sbjct: 4330 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 4389 Query: 448 gctcatgtcgatgtgaagaccac 470 || |||||||||||||| ||||| Sbjct: 4390 gcccatgtcgatgtgaaaaccac 4412
>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81 Length = 195921 Score = 73.8 bits (37), Expect = 6e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || | Sbjct: 195038 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 195097 Query: 305 acgatgaggaccaggcctacaggaagatc 333 | |||||||| | ||||||||||||||| Sbjct: 195098 atgatgaggataatgcctacaggaagatc 195126 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 ||||||||||| || |||||||| ||||| | |||| |||||||||||| | ||||| Sbjct: 195251 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 195310 Query: 448 gctcatgtcgatgtgaagaccac 470 || |||||||||||||| ||||| Sbjct: 195311 gcccatgtcgatgtgaaaaccac 195333
>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project) Length = 125502 Score = 73.8 bits (37), Expect = 6e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304 |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || | Sbjct: 85349 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 85408 Query: 305 acgatgaggaccaggcctacaggaagatc 333 | |||||||| | ||||||||||||||| Sbjct: 85409 atgatgaggataatgcctacaggaagatc 85437 Score = 61.9 bits (31), Expect = 2e-06 Identities = 70/83 (84%) Strand = Plus / Plus Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447 ||||||||||| || |||||||| ||||| | |||| |||||||||||| | ||||| Sbjct: 85562 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 85621 Query: 448 gctcatgtcgatgtgaagaccac 470 || |||||||||||||| ||||| Sbjct: 85622 gcccatgtcgatgtgaaaaccac 85644
>ref|NM_111356.3| Arabidopsis thaliana structural constituent of ribosome AT3G04840 mRNA, complete cds Length = 1004 Score = 71.9 bits (36), Expect = 2e-09 Identities = 201/256 (78%) Strand = Plus / Plus Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 ||||| ||||||||||| |||||||| | || |||||||||||| | ||| | ||| Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 || ||||| || || | ||| || || | |||||||||||||| |||||||| || Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 || || ||||| | || | |||||||||||| | |||||||||||||| ||||| || Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442 Query: 466 accactgacaattaca 481 ||||| |||| ||||| Sbjct: 443 accaccgacagttaca 458 Score = 60.0 bits (30), Expect = 9e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 ||||||||||||||| | |||||||||||| | |||||||| |||||| | || || || Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540 Query: 564 cagacagatccgccggaagatg 585 | | ||||||||| |||||||| Sbjct: 541 ccgtcagatccgcaggaagatg 562 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| ||||| || |||||| | ||||| ||||| |||||||| | |||||||||| Sbjct: 57 ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116 Query: 140 ccgtggatccgttcaccaagaa 161 | || ||||| ||| ||||||| Sbjct: 117 ctgttgatcctttctccaagaa 138
>gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence Length = 1229 Score = 71.9 bits (36), Expect = 2e-09 Identities = 81/96 (84%) Strand = Plus / Minus Query: 498 cattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaag 557 |||||| || |||||||| |||||||||||||||||| | || ||||||||||| ||| Sbjct: 603 cattggttttaccaagaggcgcccaaaccaggtcaagagaacctgctatgctcaggcatc 544 Query: 558 tcagatcagacagatccgccggaagatggttgagat 593 ||||| | ||||| ||||| |||||||||||||| Sbjct: 543 ccagattcggcagattcgccgcaagatggttgagat 508
>gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase specific) (At3g04840) mRNA, complete cds Length = 870 Score = 71.9 bits (36), Expect = 2e-09 Identities = 201/256 (78%) Strand = Plus / Plus Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || Sbjct: 145 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 204 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 ||||| ||||||||||| |||||||| | || |||||||||||| | ||| | ||| Sbjct: 205 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 264 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 || ||||| || || | ||| || || | |||||||||||||| |||||||| || Sbjct: 265 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 324 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 || || ||||| | || | |||||||||||| | |||||||||||||| ||||| || Sbjct: 325 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 384 Query: 466 accactgacaattaca 481 ||||| |||| ||||| Sbjct: 385 accaccgacagttaca 400 Score = 60.0 bits (30), Expect = 9e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 ||||||||||||||| | |||||||||||| | |||||||| |||||| | || || || Sbjct: 423 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 482 Query: 564 cagacagatccgccggaagatg 585 | | ||||||||| |||||||| Sbjct: 483 ccgtcagatccgcaggaagatg 504 Score = 48.1 bits (24), Expect = 0.033 Identities = 66/80 (82%) Strand = Plus / Plus Query: 82 atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 141 ||||| ||||| || |||||| | ||||| ||||| |||||||| | ||||||||||| Sbjct: 1 atggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaaggct 60 Query: 142 gtggatccgttcaccaagaa 161 || ||||| ||| ||||||| Sbjct: 61 gttgatcctttctccaagaa 80
>gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase specific) (At3g04840; T9J14.21) mRNA, complete cds Length = 1000 Score = 71.9 bits (36), Expect = 2e-09 Identities = 201/256 (78%) Strand = Plus / Plus Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || Sbjct: 202 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 261 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 ||||| ||||||||||| |||||||| | || |||||||||||| | ||| | ||| Sbjct: 262 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 321 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 || ||||| || || | ||| || || | |||||||||||||| |||||||| || Sbjct: 322 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 381 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 || || ||||| | || | |||||||||||| | |||||||||||||| ||||| || Sbjct: 382 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 441 Query: 466 accactgacaattaca 481 ||||| |||| ||||| Sbjct: 442 accaccgacagttaca 457 Score = 60.0 bits (30), Expect = 9e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 ||||||||||||||| | |||||||||||| | |||||||| |||||| | || || || Sbjct: 480 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 539 Query: 564 cagacagatccgccggaagatg 585 | | ||||||||| |||||||| Sbjct: 540 ccgtcagatccgcaggaagatg 561 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| ||||| || |||||| | ||||| ||||| |||||||| | |||||||||| Sbjct: 56 ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 115 Query: 140 ccgtggatccgttcaccaagaa 161 | || ||||| ||| ||||||| Sbjct: 116 ctgttgatcctttctccaagaa 137
>emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH51ZC05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 927 Score = 71.9 bits (36), Expect = 2e-09 Identities = 201/256 (78%) Strand = Plus / Plus Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || Sbjct: 135 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 194 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 ||||| ||||||||||| |||||||| | || |||||||||||| | ||| | ||| Sbjct: 195 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 254 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 || ||||| || || | ||| || || | |||||||||||||| |||||||| || Sbjct: 255 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 314 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 || || ||||| | || | |||||||||||| | |||||||||||||| ||||| || Sbjct: 315 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 374 Query: 466 accactgacaattaca 481 ||||| |||| ||||| Sbjct: 375 accaccgacagttaca 390 Score = 60.0 bits (30), Expect = 9e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 ||||||||||||||| | |||||||||||| | |||||||| |||||| | || || || Sbjct: 413 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 472 Query: 564 cagacagatccgccggaagatg 585 | | ||||||||| |||||||| Sbjct: 473 ccgtcagatccgcaggaagatg 494 Score = 42.1 bits (21), Expect = 2.1 Identities = 54/65 (83%) Strand = Plus / Plus Query: 97 aacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcacc 156 |||||| | ||||| ||||| |||||||| | ||||||||||| || ||||| ||| || Sbjct: 6 aacaagagaatctctaagggtaggaagggaggaaagaagaaggctgttgatcctttctcc 65 Query: 157 aagaa 161 ||||| Sbjct: 66 aagaa 70
>gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete sequence Length = 1001 Score = 71.9 bits (36), Expect = 2e-09 Identities = 201/256 (78%) Strand = Plus / Plus Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285 ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262 Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345 ||||| ||||||||||| |||||||| | || |||||||||||| | ||| | ||| Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322 Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405 || ||||| || || | ||| || || | |||||||||||||| |||||||| || Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382 Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465 || || ||||| | || | |||||||||||| | |||||||||||||| ||||| || Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442 Query: 466 accactgacaattaca 481 ||||| |||| ||||| Sbjct: 443 accaccgacagttaca 458 Score = 60.0 bits (30), Expect = 9e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 ||||||||||||||| | |||||||||||| | |||||||| |||||| | || || || Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540 Query: 564 cagacagatccgccggaagatg 585 | | ||||||||| |||||||| Sbjct: 541 ccgtcagatccgcaggaagatg 562 Score = 52.0 bits (26), Expect = 0.002 Identities = 68/82 (82%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139 ||||||| ||||| || |||||| | ||||| ||||| |||||||| | |||||||||| Sbjct: 57 ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116 Query: 140 ccgtggatccgttcaccaagaa 161 | || ||||| ||| ||||||| Sbjct: 117 ctgttgatcctttctccaagaa 138
>dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds Length = 1100 Score = 71.9 bits (36), Expect = 2e-09 Identities = 84/100 (84%) Strand = Plus / Plus Query: 376 aacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcag 435 ||||||||||| ||||| ||||| || || ||| | ||||||||||||||||||||||| Sbjct: 366 aacttctggggtatggacttcactacagataagttgaggtctcttgtgaggaagtggcaa 425 Query: 436 accctcattgaggctcatgtcgatgtgaagaccactgaca 475 || | || || |||||||| ||||| ||||| ||||||| Sbjct: 426 tccttgatagaagctcatgttgatgttaagacaactgaca 465 Score = 52.0 bits (26), Expect = 0.002 Identities = 86/106 (81%) Strand = Plus / Plus Query: 77 caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136 |||||||||| ||||| ||||||||| | || || ||||| | ||| || | ||||||| Sbjct: 67 caaccatggccgtcggtaagaacaagaggatatcgaagggtaagaaaggaggaaagaaga 126 Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 |||| | |||||| || |||||||| | |||||||| |||||||| Sbjct: 127 aggcagcggatccatttgccaagaaggattggtatgatatcaaggc 172
>gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence Length = 1053 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/74 (86%) Strand = Plus / Plus Query: 232 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 291 ||||||||||| |||||||| ||||| ||||||||||| || ||||| ||||| || | Sbjct: 222 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgttcgaagtgtcattg 281 Query: 292 gctgatcttcagaa 305 |||||||||||||| Sbjct: 282 gctgatcttcagaa 295
>ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 40s ribosomal protein s3ae-a (s1-a) (CNB04880) partial mRNA Length = 826 Score = 63.9 bits (32), Expect = 6e-07 Identities = 86/104 (82%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138 |||||||| ||||||||||||||| | | || ||||| | |||||| | ||||||||| Sbjct: 10 accatggctgtcggcaagaacaagaggctttcaaagggaaagaagggaattaagaagaag 69 Query: 139 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 | ||| || || ||||||| |||| ||||||| ||||||||||| Sbjct: 70 gtcgtcgaccccttcaccaggaaggagtggtacgacatcaaggc 113
>emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB10ZB01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 716 Score = 61.9 bits (31), Expect = 2e-06 Identities = 85/103 (82%) Strand = Plus / Plus Query: 379 ttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagacc 438 |||||||||||||| |||||||| || || || ||||| | || | |||||||||||| Sbjct: 68 ttctggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagact 127 Query: 439 ctcattgaggctcatgtcgatgtgaagaccactgacaattaca 481 | |||||||||||||| ||||| || ||||| |||| ||||| Sbjct: 128 ttgattgaggctcatgttgatgttaaaaccaccgacagttaca 170 Score = 60.0 bits (30), Expect = 9e-06 Identities = 69/82 (84%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563 ||||||||||||||| | |||||||||||| | |||||||| |||||| | || || || Sbjct: 193 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 252 Query: 564 cagacagatccgccggaagatg 585 | | ||||||||| |||||||| Sbjct: 253 ccgtcagatccgcaggaagatg 274
>ref|XM_420443.1| PREDICTED: Gallus gallus similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC422477), mRNA Length = 1423 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgcatctccaaggg 116 ||||||||||||||||||||||||||| || ||||||| Sbjct: 661 accatggcggtcggcaagaacaagcgcctcaccaaggg 698
>emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical protein, clone 13j13 Length = 107 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgcatctccaaggg 116 ||||||||||||||||||||||||||| || ||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgcctcaccaaggg 60
>gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRNA, complete cds Length = 858 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgcatctccaaggg 116 ||||||||||||||||||||||||||| || ||||||| Sbjct: 4 accatggcggtcggcaagaacaagcgcctcaccaaggg 41
>gb|AY373965.1| Hyaloperonospora parasitica clone 72T-2G4 mRNA sequence Length = 157 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 76 gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 135 |||| |||||| ||||| |||||||||||| |||| ||||| | |||||||| ||||||| Sbjct: 69 gcaatcatggctgtcggaaagaacaagcgcctctcaaagggaaagaagggtatcaagaag 128 Query: 136 a 136 | Sbjct: 129 a 129
>gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds Length = 759 Score = 58.0 bits (29), Expect = 3e-05 Identities = 65/77 (84%) Strand = Plus / Plus Query: 397 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 456 ||||| ||||| |||||| | ||||| | ||| |||||||| || |||||||| ||||| Sbjct: 313 accacagacaaactcagggcacttgtaaagaaatggcagactctgattgaggccaatgtc 372 Query: 457 gatgtgaagaccactga 473 ||||||||||| ||||| Sbjct: 373 gatgtgaagacaactga 389
>dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, complete cds Length = 4798 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 412 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 471 ||||||||||||||||||||||| || | || || |||||||| ||||| ||||| ||| Sbjct: 3458 aggtctcttgtgaggaagtggcaatccttgatagaagctcatgttgatgttaagacaact 3517 Query: 472 gaca 475 |||| Sbjct: 3518 gaca 3521
>gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:117914 IMAGE:2599128), complete cds Length = 870 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 12 accatggcggtcggcaagaacaagcgc 38
>gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosome 13, complete sequence Length = 196911 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 22654 accatggcggtcggcaagaacaagcgc 22628
>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence Length = 212613 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 81045 accatggcggtcggcaagaacaagcgc 81019
>gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102469 IMAGE:5319512), complete cds Length = 869 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 14 accatggcggtcggcaagaacaagcgc 40
>gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102070 IMAGE:6820218), complete cds Length = 861 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 3 accatggcggtcggcaagaacaagcgc 29
>ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript variant 4 (LOC613340), mRNA Length = 872 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 31 accatggcggtcggcaagaacaagcgc 57
>ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript variant 1 (LOC613340), mRNA Length = 910 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 32 accatggcggtcggcaagaacaagcgc 58
>ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript variant 3 (LOC613340), mRNA Length = 587 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 17 accatggcggtcggcaagaacaagcgc 43
>ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript variant 2 (LOC613340), mRNA Length = 717 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 6 accatggcggtcggcaagaacaagcgc 32
>ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 6 (LOC613460), mRNA Length = 918 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 33 accatggcggtcggcaagaacaagcgc 59
>ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 5 (LOC613460), mRNA Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 17 accatggcggtcggcaagaacaagcgc 43
>ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 2 (LOC613460), mRNA Length = 876 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 33 accatggcggtcggcaagaacaagcgc 59
>ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 4 (LOC613460), mRNA Length = 584 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 17 accatggcggtcggcaagaacaagcgc 43
>ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 3 (LOC613460), mRNA Length = 714 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 6 accatggcggtcggcaagaacaagcgc 32
>gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosome 3, complete sequence Length = 192136 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 21193 accatggcggtcggcaagaacaagcgc 21219
>ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA Length = 863 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (LOC674452), mRNA Length = 889 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 21 accatggcggtcggcaagaacaagcgc 47
>ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (LOC668144), mRNA Length = 889 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 21 accatggcggtcggcaagaacaagcgc 47
>ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (LOC544977), mRNA Length = 895 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 21 accatggcggtcggcaagaacaagcgc 47
>ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC668799), mRNA Length = 847 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 8 accatggcggtcggcaagaacaagcgc 34
>ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC677290), mRNA Length = 853 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 8 accatggcggtcggcaagaacaagcgc 34
>emb|Z83368.1|MMRPS3A M.musculus RPS3a gene Length = 5695 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 842 accatggcggtcggcaagaacaagcgc 868
>gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102071 IMAGE:6824188), complete cds Length = 872 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 10 accatggcggtcggcaagaacaagcgc 36
>dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730048K19 product:ribosomal protein S3a, full insert sequence Length = 871 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 31 accatggcggtcggcaagaacaagcgc 57
>dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720473N01 product:ribosomal protein S3a, full insert sequence Length = 864 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 24 accatggcggtcggcaagaacaagcgc 50
>dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830044H24 product:ribosomal protein S3a, full insert sequence Length = 873 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 33 accatggcggtcggcaagaacaagcgc 59
>dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830015K17 product:ribosomal protein S3a, full insert sequence Length = 863 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830015H22 product:ribosomal protein S3a, full insert sequence Length = 873 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 33 accatggcggtcggcaagaacaagcgc 59
>dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RIKEN full-length enriched library, clone:C820015M15 product:ribosomal protein S3a, full insert sequence Length = 863 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830030B03 product:ribosomal protein S3a, full insert sequence Length = 864 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 24 accatggcggtcggcaagaacaagcgc 50
>dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830007K16 product:ribosomal protein S3a, full insert sequence Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0005O17 product:40S ribosomal protein S3a homolog [Mus musculus], full insert sequence Length = 865 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 21 accatggcggtcggcaagaacaagcgc 47
>dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830165N20 product:ribosomal protein S3a, full insert sequence Length = 863 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>dbj|AK167562.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530022H01 product:ribosomal protein S3a, full insert sequence Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 22 accatggcggtcggcaagaacaagcgc 48
>dbj|AK167512.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN full-length enriched library, clone:I530018C11 product:ribosomal protein S3a, full insert sequence Length = 870 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 24 accatggcggtcggcaagaacaagcgc 50
>dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420030N20 product:ribosomal protein S3a, full insert sequence Length = 869 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730070G06 product:ribosomal protein S3a, full insert sequence Length = 868 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 21 accatggcggtcggcaagaacaagcgc 47
>dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410029J05 product:ribosomal protein S3a, full insert sequence Length = 860 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 20 accatggcggtcggcaagaacaagcgc 46
>dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1100001E09 product:ribosomal protein S3a, full insert sequence Length = 863 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430004H05 product:ribosomal protein S3a, full insert sequence Length = 860 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 20 accatggcggtcggcaagaacaagcgc 46
>dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:C920016J02 product:ribosomal protein S3a, full insert sequence Length = 862 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 23 accatggcggtcggcaagaacaagcgc 49
>gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:49186 IMAGE:5025347), complete cds Length = 877 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 22 accatggcggtcggcaagaacaagcgc 48
>dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700038N16 product:ribosomal protein S3a, full insert sequence Length = 860 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 20 accatggcggtcggcaagaacaagcgc 46
>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence Length = 164201 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 92495 accatggcggtcggcaagaacaagcgc 92469
>dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minus, reference:ENSEMBL:Mouse-Transcript- ENST:ENSMUST00000029722, based on BLAT search Length = 282 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 9 accatggcggtcggcaagaacaagcgc 35
>emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chromosome 14, complete sequence Length = 142749 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 34612 accatggcggtcggcaagaacaagcgc 34586
>emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chromosome 2, complete sequence Length = 208363 Score = 54.0 bits (27), Expect = 5e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||||||| Sbjct: 155043 accatggcggtcggcaagaacaagcgc 155017
>ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 13 (RPS3A), mRNA Length = 1051 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 7 ccatggcggtcggcaagaacaagcgc 32
>ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 12 (RPS3A), mRNA Length = 1051 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 7 ccatggcggtcggcaagaacaagcgc 32
>ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 11 (RPS3A), mRNA Length = 852 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 51 ccatggcggtcggcaagaacaagcgc 76
>ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 10 (RPS3A), mRNA Length = 1065 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 19 ccatggcggtcggcaagaacaagcgc 44
>ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 9 (RPS3A), mRNA Length = 1056 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 50 ccatggcggtcggcaagaacaagcgc 75
>ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 8 (RPS3A), mRNA Length = 982 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43
>ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 7 (RPS3A), mRNA Length = 912 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43
>ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 6 (RPS3A), mRNA Length = 876 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 20 ccatggcggtcggcaagaacaagcgc 45
>ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 1 (RPS3A), mRNA Length = 1106 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 62 ccatggcggtcggcaagaacaagcgc 87
>ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 4 (RPS3A), mRNA Length = 769 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 17 ccatggcggtcggcaagaacaagcgc 42
>ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 3 (RPS3A), mRNA Length = 774 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 50 ccatggcggtcggcaagaacaagcgc 75
>ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript variant 2 (RPS3A), mRNA Length = 553 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 19 ccatggcggtcggcaagaacaagcgc 44
>ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 7 (LOC609500), mRNA Length = 875 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46
>ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 6 (LOC609500), mRNA Length = 857 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46
>ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 5 (LOC609500), mRNA Length = 866 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43
>ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 4 (LOC609500), mRNA Length = 1072 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46
>ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 3 (LOC609500), mRNA Length = 879 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 21 ccatggcggtcggcaagaacaagcgc 46
>ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 1 (LOC609500), mRNA Length = 1069 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43
>ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 2 (LOC609500), mRNA Length = 760 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 16 ccatggcggtcggcaagaacaagcgc 41
>ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 12 (LOC608454), mRNA Length = 874 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 11 (LOC608454), mRNA Length = 875 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 10 (LOC608454), mRNA Length = 879 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 9 (LOC608454), mRNA Length = 883 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 8 (LOC608454), mRNA Length = 883 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 7 (LOC608454), mRNA Length = 882 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 6 (LOC608454), mRNA Length = 1042 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 10 ccatggcggtcggcaagaacaagcgc 35
>ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 5 (LOC608454), mRNA Length = 1047 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 15 ccatggcggtcggcaagaacaagcgc 40
>ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 4 (LOC608454), mRNA Length = 1080 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 33 ccatggcggtcggcaagaacaagcgc 58
>ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 2 (LOC608454), mRNA Length = 1058 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 26 ccatggcggtcggcaagaacaagcgc 51
>ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 3 (LOC608454), mRNA Length = 901 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 19 ccatggcggtcggcaagaacaagcgc 44
>ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 1 (LOC608454), mRNA Length = 759 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||||||||| Sbjct: 18 ccatggcggtcggcaagaacaagcgc 43
>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete sequence Length = 93234 Score = 52.0 bits (26), Expect = 0.002 Identities = 80/98 (81%) Strand = Plus / Minus Query: 384 gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443 ||||||||| |||||||| || || || ||||| | || | |||||||||||| | || Sbjct: 74315 gggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttgat 74256 Query: 444 tgaggctcatgtcgatgtgaagaccactgacaattaca 481 |||||||||||| ||||| || ||||| |||| ||||| Sbjct: 74255 tgaggctcatgttgatgttaaaaccaccgacagttaca 74218 Score = 50.1 bits (25), Expect = 0.008 Identities = 43/49 (87%) Strand = Plus / Minus Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 552 ||||||||||||||| | |||||||||||| | |||||||| |||||| Sbjct: 74195 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaa 74147 Score = 44.1 bits (22), Expect = 0.52 Identities = 49/58 (84%) Strand = Plus / Minus Query: 245 agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttca 302 ||||||||||||| ||| |||| ||| | || ||||| || ||||| ||||||||||| Sbjct: 74563 agattgcctcagaaggcttgaaacacagagtttttgaggtttctcttgctgatcttca 74506
>emb|X68555.1|ACKRPA A.californica KRP-A gene Length = 849 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 402 tgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgt 461 |||||||||| | ||| | |||| |||||||||||| || |||||||| |||| ||||| Sbjct: 330 tgacaagctctgctctatggtgaagaagtggcagactcttattgaggccaatgttgatgt 389 Query: 462 gaagac 467 |||||| Sbjct: 390 gaagac 395 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 292 gctgatcttcagaacgatgagg 313 |||||||||||||||||||||| Sbjct: 223 gctgatcttcagaacgatgagg 244
>gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds Length = 893 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 232 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 291 |||||||| || |||||||| |||||||| ||||| || | ||||||||||| ||||| Sbjct: 162 acacagggcacaaagattgcgtcagagggtttgaagtacagagtgtttgaagtgtctctg 221 Query: 292 gctgat 297 |||||| Sbjct: 222 gctgat 227
>gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cDNA clone MGC:72868 IMAGE:6887884), complete cds Length = 896 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Plus Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 |||||||||||| | ||||| |||||||| ||||||||||| Sbjct: 375 aagtggcagaccatgattgaagctcatgttgatgtgaagac 415 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||| |||||||||||| Sbjct: 27 accatggcggtcgggaagaacaagcgc 53
>ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a), mRNA Length = 880 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Plus Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 |||||||||||| | ||||| |||||||| ||||||||||| Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||| |||||||||||| Sbjct: 22 accatggcggtcgggaagaacaagcgc 48
>gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like protein mRNA, partial cds Length = 489 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Plus Query: 426 gaagtggcagaccctcattgaggctcatgtcgatgtgaagaccac 470 ||||||||||||||| || ||||| ||||| || ||||||||||| Sbjct: 36 gaagtggcagaccctgatcgaggcccatgtggacgtgaagaccac 80
>emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for ribosomal protein S3a Length = 880 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Plus Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 |||||||||||| | ||||| |||||||| ||||||||||| Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||| |||||||||||| Sbjct: 22 accatggcggtcgggaagaacaagcgc 48
>gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal protein S3a-like mRNA, complete sequence Length = 922 Score = 48.1 bits (24), Expect = 0.033 Identities = 33/36 (91%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggg 116 |||||||||||| |||||||||||| || ||||||| Sbjct: 43 catggcggtcgggaagaacaagcgcctcaccaaggg 78
>gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal protein S3a-like mRNA, complete sequence Length = 893 Score = 48.1 bits (24), Expect = 0.033 Identities = 33/36 (91%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggg 116 |||||||||||| |||||||||||| || ||||||| Sbjct: 40 catggcggtcgggaagaacaagcgcctcaccaaggg 75
>gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal protein S3a-like mRNA, complete sequence Length = 630 Score = 48.1 bits (24), Expect = 0.033 Identities = 33/36 (91%) Strand = Plus / Plus Query: 81 catggcggtcggcaagaacaagcgcatctccaaggg 116 |||||||||||| |||||||||||| || ||||||| Sbjct: 24 catggcggtcgggaagaacaagcgcctcaccaaggg 59
>ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 8 (LOC613769), mRNA Length = 900 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 49 accatggcggtcggcaagaacaag 72
>ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 7 (LOC613769), mRNA Length = 879 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 39 accatggcggtcggcaagaacaag 62
>ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 6 (LOC613769), mRNA Length = 884 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 39 accatggcggtcggcaagaacaag 62
>ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 5 (LOC613769), mRNA Length = 871 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 20 accatggcggtcggcaagaacaag 43
>ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 4 (LOC613769), mRNA Length = 890 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 39 accatggcggtcggcaagaacaag 62
>ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 3 (LOC613769), mRNA Length = 878 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 39 accatggcggtcggcaagaacaag 62
>ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein), transcript variant 2 (LOC613769), mRNA Length = 876 Score = 48.1 bits (24), Expect = 0.033 Identities = 24/24 (100%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaag 102 |||||||||||||||||||||||| Sbjct: 39 accatggcggtcggcaagaacaag 62
>ref|XM_519223.1| PREDICTED: Pan troglodytes similar to ribosomal protein S3a; 40S ribosomal protein S3a; v-fos transformation effector protein 1 (LOC463560), mRNA Length = 649 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 5 accatggcggttggcaagaacaagcgc 31
>ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mRNA Length = 865 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||| |||||| Sbjct: 24 accatggcggtcggcaagaataagcgc 50
>ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC607868), mRNA Length = 1106 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 83 tggcggtcggcaagaacaagcgc 105 ||||||||||||||||||||||| Sbjct: 75 tggcggtcggcaagaacaagcgc 97
>gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, complete sequence Length = 156195 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 74343 accatggcggttggcaagaacaagcgc 74317
>ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (LOC670633), mRNA Length = 893 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 33 accatggcggttggcaagaacaagcgc 59
>gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:3160242), **** WARNING: chimeric clone **** Length = 2436 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 1578 accatggcggttggcaagaacaagcgc 1604
>gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:5022252), **** WARNING: chimeric clone **** Length = 1551 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 670 accatggcggttggcaagaacaagcgc 696
>gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNING: chimeric clone **** Length = 1415 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 555 accatggcggttggcaagaacaagcgc 581
>gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNING: chimeric clone **** Length = 2186 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 1325 accatggcggttggcaagaacaagcgc 1351
>gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNING: chimeric clone **** Length = 2268 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 1407 accatggcggttggcaagaacaagcgc 1433
>gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNING: chimeric clone **** Length = 1553 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 670 accatggcggttggcaagaacaagcgc 696
>emb|BX039677.1|CNS092S1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10AD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 923 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 133 aagaaggccgtggatccgttcac 155 ||||||||||||||||||||||| Sbjct: 80 aagaaggccgtggatccgttcac 102
>gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3883 IMAGE:2906117), complete cds Length = 891 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 10 accatggcggttggcaagaacaagcgc 36
>emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clone DKFZp469E172) Length = 923 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 38 accatggcggttggcaagaacaagcgc 64
>gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, complete sequence Length = 183478 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 36381 accatggcggttggcaagaacaagcgc 36407
>gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clone MGC:127088 IMAGE:7943245), complete cds Length = 899 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||| |||||| Sbjct: 20 accatggcggtcggcaagaataagcgc 46
>ref|XR_001455.1| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC641829), mRNA Length = 731 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 15 accatggcggttggcaagaacaagcgc 41
>ref|XR_001456.1| PREDICTED: Homo sapiens similar to ribosomal protein S3a (LOC649582), mRNA Length = 731 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 15 accatggcggttggcaagaacaagcgc 41
>ref|XR_001449.1| PREDICTED: Homo sapiens similar to ribosomal protein S3a (LOC644972), mRNA Length = 731 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 15 accatggcggttggcaagaacaagcgc 41
>dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-15704, similar to human ribosomal protein S3A (RPS3A), mRNA, RefSeq: NM_001006.2 Length = 915 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 55 accatggcggttggcaagaacaagcgc 81
>gb|AY911372.1| Bos taurus clone IMAGE:7961511 ribosomal protein S3a mRNA, complete cds Length = 865 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||| |||||| Sbjct: 24 accatggcggtcggcaagaataagcgc 50
>gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:1626 IMAGE:3544072), complete cds Length = 906 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 40 accatggcggttggcaagaacaagcgc 66
>gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88598 IMAGE:6285242), complete cds Length = 868 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 10 accatggcggttggcaagaacaagcgc 36
>gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:18002 IMAGE:3922810), complete cds Length = 869 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 10 accatggcggttggcaagaacaagcgc 36
>gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29710 IMAGE:5020904), complete cds Length = 921 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 61 accatggcggttggcaagaacaagcgc 87
>gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29668 IMAGE:5020581), complete cds Length = 925 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 61 accatggcggttggcaagaacaagcgc 87
>gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3109 IMAGE:3350750), complete cds Length = 866 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 10 accatggcggttggcaagaacaagcgc 36
>gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:16359 IMAGE:3927639), complete cds Length = 869 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 10 accatggcggttggcaagaacaagcgc 36
>gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:15425 IMAGE:4308955), complete cds Length = 873 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 12 accatggcggttggcaagaacaagcgc 38
>dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, highly similar to 40S ribosomal protein S3A Length = 861 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 21 accatggcggttggcaagaacaagcgc 47
>gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q21.2-q31.1, complete sequence Length = 132072 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 85736 accatggcggttggcaagaacaagcgc 85710
>ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA Length = 930 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 49 accatggcggttggcaagaacaagcgc 75
>emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene Length = 5107 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 118 accatggcggttggcaagaacaagcgc 144
>dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein S3a, partial cds, clone: ORCS12387 Length = 644 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||||||||| |||||| Sbjct: 4 accatggcggtcggcaagaataagcgc 30
>gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, complete sequence Length = 176092 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 48107 accatggcggttggcaagaacaagcgc 48133
>gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88192 IMAGE:5809691), complete cds Length = 892 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 23 accatggcggttggcaagaacaagcgc 49
>gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:4136755) Length = 890 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 12 accatggcggttggcaagaacaagcgc 38
>gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:13266 IMAGE:4079651), complete cds Length = 871 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 3 accatggcggttggcaagaacaagcgc 29
>emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chromosome 2, complete sequence Length = 207718 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 62194 accatggcggttggcaagaacaagcgc 62220
>gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein (Fte-1), mRNA complete cds Length = 874 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 34 accatggcggttggcaagaacaagcgc 60
>emb|X87373.1|HSRPS3AGE Homo sapiens RPS3a gene for ribosomal protein S3a Length = 5529 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 384 accatggcggttggcaagaacaagcgc 410
>gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation effector protein (Fte-1) mRNA, complete cds Length = 860 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 |||||||||||||| |||||||||||| Sbjct: 16 accatggcggtcgggaagaacaagcgc 42 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 |||||||||||| | ||||| |||||||| || |||||||| Sbjct: 364 aagtggcagaccatgattgaagctcatgttgacgtgaagac 404
>gb|L13802.1|HUMCH13C3A Homo sapiens (clone 03) liver expessed ribosomal protein S3 homologue mRNA, complete cds Length = 845 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Plus Query: 79 accatggcggtcggcaagaacaagcgc 105 ||||||||||| ||||||||||||||| Sbjct: 4 accatggcggttggcaagaacaagcgc 30
>ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos transformation effector protein) (LOC515006), mRNA Length = 531 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Plus Query: 82 atggcggtcggcaagaacaagc 103 |||||||||||||||||||||| Sbjct: 1 atggcggtcggcaagaacaagc 22
>ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 4 (LOC608684), mRNA Length = 875 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 10 ccatggtggtcggcaagaacaagcgc 35
>ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 1 (LOC608684), mRNA Length = 886 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 21 ccatggtggtcggcaagaacaagcgc 46
>ref|XM_855510.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 3 (LOC608684), mRNA Length = 717 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 7 ccatggtggtcggcaagaacaagcgc 32
>ref|XM_855476.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 2 (LOC608684), mRNA Length = 579 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 10 ccatggtggtcggcaagaacaagcgc 35
>ref|XM_851147.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 5 (LOC607193), mRNA Length = 857 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 10 ccatggtggtcggcaagaacaagcgc 35
>ref|XM_851102.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 4 (LOC607193), mRNA Length = 866 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 10 ccatggtggtcggcaagaacaagcgc 35
>ref|XM_851056.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 3 (LOC607193), mRNA Length = 718 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 8 ccatggtggtcggcaagaacaagcgc 33
>ref|XM_843347.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 2 (LOC607193), mRNA Length = 579 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||| ||||||||||||||||||| Sbjct: 10 ccatggtggtcggcaagaacaagcgc 35
>ref|XM_843648.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 2 (LOC478437), mRNA Length = 891 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||| ||||||||| Sbjct: 6 ccatggcggtcggcaaaaacaagcgc 31
>ref|XM_535614.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 1 (LOC478437), mRNA Length = 755 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||||||| ||||||||| Sbjct: 11 ccatggcggtcggcaaaaacaagcgc 36
>ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 1 (LOC608748), mRNA Length = 886 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||| ||||||||||||||| Sbjct: 27 ccatggcggtaggcaagaacaagcgc 52 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467 |||||||||||| | ||||| |||||||| ||||| ||||| Sbjct: 374 aagtggcagaccatgattgaagctcatgttgatgtaaagac 414
>ref|XM_859165.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 4 (LOC608748), mRNA Length = 720 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||| ||||||||||||||| Sbjct: 22 ccatggcggtaggcaagaacaagcgc 47
>ref|XM_859142.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 3 (LOC608748), mRNA Length = 573 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||| ||||||||||||||| Sbjct: 16 ccatggcggtaggcaagaacaagcgc 41
>ref|XM_534259.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 1 (LOC477063), mRNA Length = 579 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||| ||||||||||||| Sbjct: 16 ccatggcggtcgacaagaacaagcgc 41
>ref|XM_846199.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 2 (LOC477063), mRNA Length = 772 Score = 44.1 bits (22), Expect = 0.52 Identities = 25/26 (96%) Strand = Plus / Plus Query: 80 ccatggcggtcggcaagaacaagcgc 105 |||||||||||| ||||||||||||| Sbjct: 3 ccatggcggtcgacaagaacaagcgc 28
>ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 6 (LOC607824), mRNA Length = 844 Score = 44.1 bits (22), Expect = 0.52 Identities = 34/38 (89%) Strand = Plus / Plus Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagac 467 ||||||||| | ||||| |||||||| ||||||||||| Sbjct: 355 tggcagaccatgattgaagctcatgttgatgtgaagac 392 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 82 atggcggtcggcaagaacaagcgc 105 |||||||| ||||||||||||||| Sbjct: 8 atggcggttggcaagaacaagcgc 31
>ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 5 (LOC607824), mRNA Length = 1060 Score = 44.1 bits (22), Expect = 0.52 Identities = 34/38 (89%) Strand = Plus / Plus Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagac 467 ||||||||| | ||||| |||||||| ||||||||||| Sbjct: 355 tggcagaccatgattgaagctcatgttgatgtgaagac 392 Score = 40.1 bits (20), Expect = 8.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 82 atggcggtcggcaagaacaagcgc 105 |||||||| ||||||||||||||| Sbjct: 8 atggcggttggcaagaacaagcgc 31
>ref|XM_855221.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a, transcript variant 4 (LOC607824), mRNA Length = 1042 Score = 44.1 bits (22), Expect = 0.52 Identities = 34/38 (89%) Strand = Plus / Plus Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagac 467 ||||||||| | ||||| |||||||| ||||||||||| Sbjct: 337 tggcagaccatgattgaagctcatgttgatgtgaagac 374
>emb|BX546465.7| Mouse DNA sequence from clone RP23-167N13 on chromosome 2, complete sequence Length = 81064 Score = 44.1 bits (22), Expect = 0.52 Identities = 22/22 (100%) Strand = Plus / Minus Query: 79 accatggcggtcggcaagaaca 100 |||||||||||||||||||||| Sbjct: 43557 accatggcggtcggcaagaaca 43536
>gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, complete sequence Length = 167652 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 404 acaagctcaggtctcttgtgaggaagtgg 432 |||||| ||||||||||| |||||||||| Sbjct: 146589 acaagcccaggtctcttgagaggaagtgg 146617
>gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500, complete sequence Length = 132678 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 216 gaccctcgtgtccaggacaca 236 ||||||||||||||||||||| Sbjct: 26758 gaccctcgtgtccaggacaca 26738
>gb|AC158967.5| Mus musculus chromosome 1, clone RP23-39N17, complete sequence Length = 244130 Score = 42.1 bits (21), Expect = 2.1 Identities = 27/29 (93%) Strand = Plus / Plus Query: 404 acaagctcaggtctcttgtgaggaagtgg 432 |||||| ||||||||||| |||||||||| Sbjct: 238451 acaagcccaggtctcttgagaggaagtgg 238479
>ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D10395g) partial mRNA Length = 771 Score = 42.1 bits (21), Expect = 2.1 Identities = 45/53 (84%) Strand = Plus / Plus Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 |||||||||| | | || || |||||||||||| | |||| |||||||||||| Sbjct: 49 aagaagaaggtcatcgaccctttcaccaagaaggaatggtttgacatcaaggc 101
>ref|XM_950881.1| Neurospora crassa OR74A hypothetical protein (NCU01452.1) partial mRNA Length = 1014 Score = 42.1 bits (21), Expect = 2.1 Identities = 108/137 (78%) Strand = Plus / Plus Query: 394 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 453 |||||| | ||||||||| | || ||||| | ||||||||||| ||||||||||| | Sbjct: 556 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 615 Query: 454 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 513 || || |||||||| ||| | ||| | |||||| | || ||||||| |||||||||| Sbjct: 616 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 675 Query: 514 agacgcccaaaccaggt 530 | ||||| |||||||| Sbjct: 676 cgccgccctaaccaggt 692
>ref|XM_327890.1| Neurospora crassa OR74A hypothetical protein (NCU01452.1) partial mRNA Length = 1014 Score = 42.1 bits (21), Expect = 2.1 Identities = 108/137 (78%) Strand = Plus / Plus Query: 394 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 453 |||||| | ||||||||| | || ||||| | ||||||||||| ||||||||||| | Sbjct: 556 ttcacctccgacaagctccgctcgcttgtccgcaagtggcagactctcattgaggccaac 615 Query: 454 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 513 || || |||||||| ||| | ||| | |||||| | || ||||||| |||||||||| Sbjct: 616 atcaccgtcaagaccaccgacgactacctcctccgcctcttcgccattgccttcaccaag 675 Query: 514 agacgcccaaaccaggt 530 | ||||| |||||||| Sbjct: 676 cgccgccctaaccaggt 692
>ref|XM_677047.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8870.2), mRNA Length = 771 Score = 42.1 bits (21), Expect = 2.1 Identities = 57/69 (82%) Strand = Plus / Plus Query: 94 aagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttc 153 |||||||||||| | || ||||| | |||||||| |||||||| | | || ||||| ||| Sbjct: 13 aagaacaagcgcttgtcgaagggcaagaagggtatcaagaagaggactgttgatcccttc 72 Query: 154 accaagaag 162 |||| |||| Sbjct: 73 accaggaag 81
>ref|XM_748992.1| Aspergillus fumigatus Af293 ribosomal protein S0.e.B, cytosolic (Afu5g05450) partial mRNA Length = 771 Score = 42.1 bits (21), Expect = 2.1 Identities = 24/25 (96%) Strand = Plus / Plus Query: 504 cttcaccaagagacgcccaaaccag 528 |||||||||||||||||| |||||| Sbjct: 423 cttcaccaagagacgcccgaaccag 447
>ref|XM_446571.1| Candida glabrata CBS138, CAGL0G04851g partial mRNA Length = 1101 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 120 gaagggtagcaagaagaaggc 140 ||||||||||||||||||||| Sbjct: 990 gaagggtagcaagaagaaggc 1010
>emb|Z32681.1|CEF56F3 Caenorhabditis elegans Cosmid F56F3, complete sequence Length = 29039 Score = 42.1 bits (21), Expect = 2.1 Identities = 45/53 (84%) Strand = Plus / Plus Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 |||||||||||||||||||| ||| || ||| | ||||| ||||||||||| Sbjct: 23554 aagaagaaggccgtggatccattctcccgcaaggaatggtacgacatcaaggc 23606
>gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA clone MGC:53968 IMAGE:5570910), complete cds Length = 867 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 470 ||||||||| | ||||| || ||||| |||||||||||||| Sbjct: 360 tggcagaccatgattgaagcccatgttgatgtgaagaccac 400
>ref|NM_001008074.1| Xenopus tropicalis rps3a protein (rps3a), mRNA Length = 922 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 470 ||||||||| | ||||| || ||||| |||||||||||||| Sbjct: 356 tggcagaccatgattgaagcacatgttgatgtgaagaccac 396
>gb|BC080969.1| Xenopus tropicalis rps3a protein, mRNA (cDNA clone MGC:79742 IMAGE:6983416), complete cds Length = 922 Score = 42.1 bits (21), Expect = 2.1 Identities = 36/41 (87%) Strand = Plus / Plus Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccac 470 ||||||||| | ||||| || ||||| |||||||||||||| Sbjct: 356 tggcagaccatgattgaagcacatgttgatgtgaagaccac 396
>emb|BX067685.1|CNS09OE1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51BH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 gaaggccgtggatccgttcac 155 ||||||||||||||||||||| Sbjct: 68 gaaggccgtggatccgttcac 88
>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces hansenii Length = 1602771 Score = 42.1 bits (21), Expect = 2.1 Identities = 45/53 (84%) Strand = Plus / Minus Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182 |||||||||| | | || || |||||||||||| | |||| |||||||||||| Sbjct: 772733 aagaagaaggtcatcgaccctttcaccaagaaggaatggtttgacatcaaggc 772681
>emb|CR380953.1| Candida glabrata strain CBS138 chromosome G complete sequence Length = 992211 Score = 42.1 bits (21), Expect = 2.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gaagggtagcaagaagaaggc 140 ||||||||||||||||||||| Sbjct: 462782 gaagggtagcaagaagaaggc 462762 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,440,739 Number of Sequences: 3902068 Number of extensions: 4440739 Number of successful extensions: 81770 Number of sequences better than 10.0: 334 Number of HSP's better than 10.0 without gapping: 333 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 80596 Number of HSP's gapped (non-prelim): 1134 length of query: 599 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 576 effective length of database: 17,143,297,704 effective search space: 9874539477504 effective search space used: 9874539477504 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)