| Clone Name | bart20e11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U82965.2|STU82965 Streptomcyes toyocaensis strain NRRL 15009 biosynthetic gene cluster A47934, complete sequence Length = 69301 Score = 48.1 bits (24), Expect = 0.030 Identities = 24/24 (100%) Strand = Plus / Minus Query: 430 gcgaagctcccggcgccgcagcgc 453 |||||||||||||||||||||||| Sbjct: 59008 gcgaagctcccggcgccgcagcgc 58985
>ref|XM_818154.1| Trypanosoma brucei TREU927 EP1 procyclin precursor (Tb10.6k15.0020) partial mRNA Length = 426 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 |||||||| |||||||||||||||||| Sbjct: 347 ggttcaggttcgggttcaggttccggc 321
>gb|AF353627.1|AF353627 Trypanosoma brucei brucei surface protein EP2-1 procyclin precursor (EP2-1) gene, EP2-1-EP/PAG1 allele, complete cds Length = 718 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 |||||||| |||||||||||||||||| Sbjct: 324 ggttcaggttcgggttcaggttccggc 298
>dbj|BA000022.2| Synechocystis sp. PCC 6803 DNA, complete genome Length = 3573470 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 528013 ggttccggctcgggttcaggttccggc 527987 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527983 ggttccggctcgggttcaggttccggc 527957 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527953 ggttccggctcgggttcaggttccggc 527927 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527935 ggttccggctcgggttcaggttccggc 527909 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527905 ggttccggctcgggttcaggttccggc 527879 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527875 ggttccggctcgggttcaggttccggc 527849 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527857 ggttccggctcgggttcaggttccggc 527831 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527827 ggttccggctcgggttcaggttccggc 527801 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527797 ggttccggctcgggttcaggttccggc 527771 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527767 ggttccggctcgggttcaggttccggc 527741 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527749 ggttccggctcgggttcaggttccggc 527723 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527731 ggttccggctcgggttcaggttccggc 527705 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527701 ggttccggctcgggttcaggttccggc 527675 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527671 ggttccggctcgggttcaggttccggc 527645 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527641 ggttccggctcgggttcaggttccggc 527615 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||||||||| ||||||||||||||| Sbjct: 527599 ggttcaggctcaggttcaggttccggc 527573 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527581 ggttccggctcgggttcaggttccggc 527555 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527563 ggttccggctcgggttcaggttccggc 527537 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527545 ggttccggctcgggttcaggttccggc 527519 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527527 ggttccggctcgggttcaggttccggc 527501 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527509 ggttccggctcgggttcaggttccggc 527483 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527491 ggttccggctcgggttcaggttccggc 527465 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527461 ggttccggctcgggttcaggttccggc 527435 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggc 414 ||||| ||||||||||||||||||||| Sbjct: 527431 ggttccggctcgggttcaggttccggc 527405
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Minus Query: 425 ccccggcgaagctcccggcgccgcag 450 |||||||||||||||||||| ||||| Sbjct: 80159 ccccggcgaagctcccggcggcgcag 80134
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 425 ccccggcgaagctcccggcgccgcag 450 |||||||||||||||||||| ||||| Sbjct: 107512 ccccggcgaagctcccggcggcgcag 107537
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 425 ccccggcgaagctcccggcgccgcag 450 |||||||||||||||||||| ||||| Sbjct: 28924217 ccccggcgaagctcccggcggcgcag 28924242
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 44.1 bits (22), Expect = 0.46 Identities = 25/26 (96%) Strand = Plus / Plus Query: 425 ccccggcgaagctcccggcgccgcag 450 |||||||||||||||||||| ||||| Sbjct: 29015639 ccccggcgaagctcccggcggcgcag 29015664
>gb|AC009910.5|AC009910 Drosophila melanogaster, chromosome 2L, region 25D-25E, BAC clone BACR35L07, complete sequence Length = 193924 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 212 aaggaggagtcggaggaggatg 233 |||||||||||||||||||||| Sbjct: 142780 aaggaggagtcggaggaggatg 142759
>gb|AE003610.3| Drosophila melanogaster chromosome 2L, section 19 of 83 of the complete sequence Length = 260249 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 212 aaggaggagtcggaggaggatg 233 |||||||||||||||||||||| Sbjct: 185887 aaggaggagtcggaggaggatg 185866
>gb|AC004721.1|AC004721 Drosophila melanogaster DNA sequence (P1 DS03308 (D285)), complete sequence Length = 80628 Score = 44.1 bits (22), Expect = 0.46 Identities = 22/22 (100%) Strand = Plus / Minus Query: 212 aaggaggagtcggaggaggatg 233 |||||||||||||||||||||| Sbjct: 2701 aaggaggagtcggaggaggatg 2680
>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence Length = 1618915 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 218698 ccggttcaggttcgggttcaggttc 218674 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 211291 ccggttcaggttcgggttcaggttc 211267
>gb|AC084046.13| Trypanosoma brucei chromosome 6 clone RPCI93-3D8, complete sequence Length = 154240 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 11892 ccggttcaggttcgggttcaggttc 11868 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 4507 ccggttcaggttcgggttcaggttc 4483
>gb|AC092199.8| Trypanosoma brucei chromosome 6 clone RPCI93-28F21, complete sequence Length = 152762 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 25294 ccggttcaggttcgggttcaggttc 25318 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 17887 ccggttcaggttcgggttcaggttc 17911
>ref|XM_323965.1| Neurospora crassa OR74A hypothetical protein (NCU04610.1) partial mRNA Length = 2961 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 364 ggctccaacgccagcagaacg 384 ||||||||||||||||||||| Sbjct: 499 ggctccaacgccagcagaacg 519
>ref|XM_953760.1| Neurospora crassa OR74A hypothetical protein (NCU04610.1) partial mRNA Length = 2961 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 364 ggctccaacgccagcagaacg 384 ||||||||||||||||||||| Sbjct: 499 ggctccaacgccagcagaacg 519
>ref|XM_820648.1| Trypanosoma brucei TREU927 clone RPCI93-28F21 EP3-2 procyclin (Tb927.6.480) partial mRNA Length = 372 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 271 ccggttcaggttcgggttcaggttc 247
>ref|XM_820626.1| Trypanosoma brucei TREU927 clone RPCI93-28F21 EP3-2 procyclin (Tb927.6.450) partial mRNA Length = 384 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 |||||||||| |||||||||||||| Sbjct: 283 ccggttcaggttcgggttcaggttc 259
>emb|AL591791.1|SME591791 Sinorhizobium meliloti 1021 complete chromosome; segment 10/12 Length = 340900 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 449 agcgcacgccgtccttcatgc 469 ||||||||||||||||||||| Sbjct: 88030 agcgcacgccgtccttcatgc 88010
>emb|Z70686.1|CER10H10 Caenorhabditis elegans Cosmid R10H10, complete sequence Length = 35056 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccggc 414 |||||||||| || ||||||||||||||| Sbjct: 1929 ccggttcaggttcaggttcaggttccggc 1901
>gb|U00051.1| Caenorhabditis elegans cosmid F42G9, complete sequence Length = 34008 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 12840 ccggttcaggctccggttcaggttc 12816 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 12852 ccggttcaggctccggttcaggctccgg 12825
>gb|CP000284.1| Methylobacillus flagellatus KT, complete genome Length = 2971517 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 499 ggaggcggcagcttcaagtcg 519 ||||||||||||||||||||| Sbjct: 1732863 ggaggcggcagcttcaagtcg 1732843
>emb|AL022311.5|HS1014D13 Human DNA sequence from clone RP5-1014D13 on chromosome 22q13.1-13.2, complete sequence Length = 71263 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 ccagctttgcacacacctccc 74 ||||||||||||||||||||| Sbjct: 37365 ccagctttgcacacacctccc 37345
>emb|BX640417.1| Bordetella pertussis strain Tohama I, complete genome; segment 7/12 Length = 348934 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 440 cggcgccgcagcgcacgccgtcctt 464 |||||||||||||| |||||||||| Sbjct: 103188 cggcgccgcagcgctcgccgtcctt 103212
>emb|AL807374.1|NCB13H18 Neurospora crassa DNA linkage group V BAC contig B13H18 Length = 122576 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 364 ggctccaacgccagcagaacg 384 ||||||||||||||||||||| Sbjct: 7830 ggctccaacgccagcagaacg 7810
>ref|NM_069514.1| Caenorhabditis elegans R11A8.7a (R11A8.7) mRNA, complete cds Length = 7821 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccggc 414 |||||||||| || ||||||||||||||| Sbjct: 4930 ccggttcaggttcaggttcaggttccggc 4902
>ref|NM_069515.2| Caenorhabditis elegans R11A8.7b (R11A8.7) mRNA, complete cds Length = 8309 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccggc 414 |||||||||| || ||||||||||||||| Sbjct: 4930 ccggttcaggttcaggttcaggttccggc 4902
>ref|NM_001027408.2| Caenorhabditis elegans Protein with Tau-Like repeats family member (ptl-1) (ptl-1) mRNA, complete cds Length = 1208 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 168 ccggttcaggctccggttcaggttc 144 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 180 ccggttcaggctccggttcaggctccgg 153
>ref|NM_001027405.2| Caenorhabditis elegans Protein with Tau-Like repeats family member (ptl-1) (ptl-1) mRNA, complete cds Length = 1504 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 231 ccggttcaggctccggttcaggttc 207 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 243 ccggttcaggctccggttcaggctccgg 216
>ref|NM_001027406.2| Caenorhabditis elegans Protein with Tau-Like repeats family member (ptl-1) (ptl-1) mRNA, complete cds Length = 1610 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 231 ccggttcaggctccggttcaggttc 207 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 243 ccggttcaggctccggttcaggctccgg 216
>ref|NM_001027407.2| Caenorhabditis elegans Protein with Tau-Like repeats family member (ptl-1) (ptl-1) mRNA, complete cds Length = 1633 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 231 ccggttcaggctccggttcaggttc 207 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 243 ccggttcaggctccggttcaggctccgg 216
>emb|AL593846.15| Mouse DNA sequence from clone RP23-171H16 on chromosome 11, complete sequence Length = 213263 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 tccacttcccacccccagctt 60 ||||||||||||||||||||| Sbjct: 137645 tccacttcccacccccagctt 137625
>gb|AC148877.2| Chlamydomonas reinhardtii clone cr-11B1, complete sequence Length = 52591 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 333 ggcagaggcggaagcagtagcagca 357 ||||| ||||||||||||||||||| Sbjct: 38202 ggcagcggcggaagcagtagcagca 38178
>gb|U67967.1|CEU67967 Caenorhabditis elegans PTL-1B protein mRNA, complete cds Length = 1595 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 177 ccggttcaggctccggttcaggttc 153 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 189 ccggttcaggctccggttcaggctccgg 162
>gb|U20824.1|EHVU20824 Equine herpesvirus 2, complete genome Length = 184427 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 151548 ccggttcaggctctggttcaggttc 151572
>gb|U67966.1|CEU67966 Caenorhabditis elegans PTL-1A protein mRNA, complete cds Length = 1483 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 177 ccggttcaggctccggttcaggttc 153 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 189 ccggttcaggctccggttcaggctccgg 162
>gb|U38983.1|CEU38983 Caenorhabditis elegans microtubule-associated protein (tau-1b) mRNA, partial cds Length = 1526 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 97 ccggttcaggctccggttcaggttc 73 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 109 ccggttcaggctccggttcaggctccgg 82
>gb|U38982.1|CEU38982 Caenorhabditis elegans microtubule-associated protein (tau-1a) mRNA, partial cds Length = 1403 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttc 410 ||||||||||||| ||||||||||| Sbjct: 97 ccggttcaggctccggttcaggttc 73 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 386 ccggttcaggctcgggttcaggttccgg 413 ||||||||||||| |||||||| ||||| Sbjct: 109 ccggttcaggctccggttcaggctccgg 82
>emb|AL831766.3| Mouse DNA sequence from clone RP23-209N3 on chromosome 2, complete sequence Length = 178227 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 93 gaggcagagggagagggaagg 113 ||||||||||||||||||||| Sbjct: 11924 gaggcagagggagagggaagg 11904
>ref|NM_190423.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1914 Score = 40.1 bits (20), Expect = 7.2 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 153 gatggagcaggag-agcagcggcggcgg 179 ||||||||||||| |||||||||||||| Sbjct: 397 gatggagcaggagcagcagcggcggcgg 424
>gb|AC109268.10| Mus musculus chromosome 1, clone RP23-305F24, complete sequence Length = 160975 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 212 aaggaggagtcggaggagga 231 |||||||||||||||||||| Sbjct: 71582 aaggaggagtcggaggagga 71563
>gb|AY363107.1| Gallus gallus zinc finger protein 183 mRNA, complete cds Length = 1048 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ggagcaggagagcagcggcg 175 |||||||||||||||||||| Sbjct: 107 ggagcaggagagcagcggcg 126
>gb|DQ486030.1| Antheraea pernyi nucleopolyhedrovirus, complete genome Length = 126479 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 387 cggttcaggctcgggttcaggttc 410 |||||| ||||||||||||||||| Sbjct: 66273 cggttcgggctcgggttcaggttc 66296
>ref|NM_001003675.1| Homo sapiens chromosome 18 open reading frame 1 (C18orf1), transcript variant c2, mRNA Length = 8890 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 tgaggcagagggagagggaa 111 |||||||||||||||||||| Sbjct: 75 tgaggcagagggagagggaa 94
>ref|NM_001003674.1| Homo sapiens chromosome 18 open reading frame 1 (C18orf1), transcript variant c1, mRNA Length = 8944 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 tgaggcagagggagagggaa 111 |||||||||||||||||||| Sbjct: 75 tgaggcagagggagagggaa 94
>gb|AC164972.2| Mus musculus BAC clone RP23-143M15 from chromosome 9, complete sequence Length = 237322 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 93 gaggcagagggagagggaaggagtgtct 120 |||| |||| |||||||||||||||||| Sbjct: 191949 gagggagagagagagggaaggagtgtct 191976
>gb|AC094950.6| Rattus norvegicus 14 BAC CH230-6H12 (Children's Hospital Oakland Research Institute) complete sequence Length = 237532 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 57 gctttgcacacacctcccac 76 |||||||||||||||||||| Sbjct: 99517 gctttgcacacacctcccac 99498
>ref|XM_749369.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g11570) partial mRNA Length = 2568 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcagg 407 |||||||||||||||||||| Sbjct: 803 ggttcaggctcgggttcagg 784
>ref|XM_386100.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05924.1) partial mRNA Length = 2259 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 tcaggctcgggttcaggttc 410 |||||||||||||||||||| Sbjct: 638 tcaggctcgggttcaggttc 619
>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence Length = 224181 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 209 tgcaaggaggagtcggaggaggatgccc 236 ||||||||| ||||||||||||| |||| Sbjct: 24285 tgcaaggagcagtcggaggaggaggccc 24258
>gb|AC122285.4| Mus musculus BAC clone RP23-251G4 from 14, complete sequence Length = 155087 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 62 gcacacacctcccaccattt 81 |||||||||||||||||||| Sbjct: 32871 gcacacacctcccaccattt 32890
>gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete sequence Length = 206570 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 209 tgcaaggaggagtcggaggaggatgccc 236 ||||||||| ||||||||||||| |||| Sbjct: 137620 tgcaaggagcagtcggaggaggaggccc 137647
>ref|XM_723381.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01066) partial mRNA Length = 1251 Score = 40.1 bits (20), Expect = 7.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttcc 411 ||||||||||| |||||||||||| Sbjct: 569 ggttcaggctcaggttcaggttcc 546
>emb|AL139330.17| Human DNA sequence from clone RP11-266C7 on chromosome 6q25.2-26 Contains the SYNJ2 gene for synaptojanin 2 (inositol phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714 and DKFZp761E1512), a novel gene and the 3' end of the SNX9 gene for sorting nexin 9 (SH3 and PX domain-containing protein (SH3PX1, SDP1), FLJ22984). Contains two CpG islands, complete sequence Length = 160974 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 cggaggaggatgccccgcgc 241 |||||||||||||||||||| Sbjct: 118132 cggaggaggatgccccgcgc 118151
>ref|NM_001004396.1| Gallus gallus zinc finger protein 183 (LOC419956), mRNA Length = 1048 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ggagcaggagagcagcggcg 175 |||||||||||||||||||| Sbjct: 107 ggagcaggagagcagcggcg 126
>emb|BX640441.1| Bordetella bronchiseptica strain RB50, complete genome; segment 5/16 Length = 348624 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcagg 407 |||||||||||||||||||| Sbjct: 144988 ggttcaggctcgggttcagg 144969
>emb|BX640426.1| Bordetella parapertussis strain 12822, complete genome; segment 4/14 Length = 348866 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcagg 407 |||||||||||||||||||| Sbjct: 257442 ggttcaggctcgggttcagg 257423 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcagg 407 |||||||||||||||||||| Sbjct: 257430 ggttcaggctcgggttcagg 257411 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcagg 407 |||||||||||||||||||| Sbjct: 257418 ggttcaggctcgggttcagg 257399 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcagg 407 |||||||||||||||||||| Sbjct: 257406 ggttcaggctcgggttcagg 257387
>emb|AL603913.14| Mouse DNA sequence from clone RP23-103H9 on chromosome 11 Contains the gene for a novel protein (3732413I11Rik), a novel gene (4930597A21Rik), the 5' end of the Ebf1 gene for early B-cell factor 1, a novel gene and a CpG island, complete sequence Length = 215524 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 94 aggcagagggagagggaagg 113 |||||||||||||||||||| Sbjct: 148501 aggcagagggagagggaagg 148520
>gb|AC092909.6| Homo sapiens 3q BAC RP11-620O17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 165589 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 gaggcagagggagagggaag 112 |||||||||||||||||||| Sbjct: 53358 gaggcagagggagagggaag 53339
>dbj|AK055028.1| Homo sapiens cDNA FLJ30466 fis, clone BRAWH1000001, moderately similar to Homo sapiens PMEPA1 protein (PMEPA1) mRNA Length = 2170 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 tgaggcagagggagagggaa 111 |||||||||||||||||||| Sbjct: 278 tgaggcagagggagagggaa 297
>dbj|AB226290.1| Aspergillus oryzae cDNA, contig sequence: AoEST3151 Length = 2131 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 341 cggaagcagtagcagcaacg 360 |||||||||||||||||||| Sbjct: 938 cggaagcagtagcagcaacg 919
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 341 cggaagcagtagcagcaacg 360 |||||||||||||||||||| Sbjct: 1612966 cggaagcagtagcagcaacg 1612985
>ref|XM_702284.1| PREDICTED: Danio rerio similar to O-acyltransferase (membrane bound) domain containing 1, transcript variant 4 (LOC572841), mRNA Length = 1395 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gggctccaacgccagcagaa 382 |||||||||||||||||||| Sbjct: 1374 gggctccaacgccagcagaa 1355
>ref|XM_702282.1| PREDICTED: Danio rerio similar to O-acyltransferase (membrane bound) domain containing 1, transcript variant 2 (LOC572841), mRNA Length = 1479 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gggctccaacgccagcagaa 382 |||||||||||||||||||| Sbjct: 1458 gggctccaacgccagcagaa 1439
>ref|XM_678433.1| PREDICTED: Danio rerio similar to O-acyltransferase (membrane bound) domain containing 1, transcript variant 1 (LOC572792), mRNA Length = 1479 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gggctccaacgccagcagaa 382 |||||||||||||||||||| Sbjct: 1458 gggctccaacgccagcagaa 1439
>ref|XM_701966.1| PREDICTED: Danio rerio similar to O-acyltransferase (membrane bound) domain containing 1, transcript variant 2 (LOC572792), mRNA Length = 1395 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 363 gggctccaacgccagcagaa 382 |||||||||||||||||||| Sbjct: 1374 gggctccaacgccagcagaa 1355
>emb|BX322605.4| Zebrafish DNA sequence from clone RP71-80A19 in linkage group 10, complete sequence Length = 131830 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 388 ggttcaggctcgggttcaggttccggca 415 ||||||||||| ||||||||||| |||| Sbjct: 109290 ggttcaggctcaggttcaggttcaggca 109263
>gb|AC159901.2| Mus musculus BAC clone RP23-100I17 from chromosome 9, complete sequence Length = 200181 Score = 40.1 bits (20), Expect = 7.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 93 gaggcagagggagagggaaggagtgtct 120 |||| |||| |||||||||||||||||| Sbjct: 81764 gagggagagagagagggaaggagtgtct 81791
>gb|AC000134.14| Homo sapiens Chromosome 11q13 BAC Clone 137c7, complete sequence Length = 203300 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 gcagagggagagggaaggag 115 |||||||||||||||||||| Sbjct: 189833 gcagagggagagggaaggag 189852
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 atcccggcggcgagcccaag 305 |||||||||||||||||||| Sbjct: 42073 atcccggcggcgagcccaag 42092
>emb|BX950701.2| Gallus gallus finished cDNA, clone ChEST194p4 Length = 1149 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ggagcaggagagcagcggcg 175 |||||||||||||||||||| Sbjct: 77 ggagcaggagagcagcggcg 96
>emb|BX933024.2| Gallus gallus finished cDNA, clone ChEST993a2 Length = 1029 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ggagcaggagagcagcggcg 175 |||||||||||||||||||| Sbjct: 91 ggagcaggagagcagcggcg 110
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 167 gcagcggcggcggtactggt 186 |||||||||||||||||||| Sbjct: 20473001 gcagcggcggcggtactggt 20473020
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 7.2 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 153 gatggagcaggag-agcagcggcggcgg 179 ||||||||||||| |||||||||||||| Sbjct: 35430539 gatggagcaggagcagcagcggcggcgg 35430566
>emb|BX932242.1| Gallus gallus finished cDNA, clone ChEST352h7 Length = 957 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ggagcaggagagcagcggcg 175 |||||||||||||||||||| Sbjct: 157 ggagcaggagagcagcggcg 176
>emb|BX929588.1| Gallus gallus finished cDNA, clone ChEST748c6 Length = 1037 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 156 ggagcaggagagcagcggcg 175 |||||||||||||||||||| Sbjct: 99 ggagcaggagagcagcggcg 118
>dbj|AP003734.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1088C09 Length = 154084 Score = 40.1 bits (20), Expect = 7.2 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 153 gatggagcaggag-agcagcggcggcgg 179 ||||||||||||| |||||||||||||| Sbjct: 54488 gatggagcaggagcagcagcggcggcgg 54515
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 443 cgccgcagcgcacgccgtcc 462 |||||||||||||||||||| Sbjct: 5538056 cgccgcagcgcacgccgtcc 5538075
>emb|AL935025.11| Zebrafish DNA sequence from clone CH211-160K2 in linkage group 16, complete sequence Length = 147313 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gggctccaacgccagcagaa 382 |||||||||||||||||||| Sbjct: 88589 gggctccaacgccagcagaa 88608
>dbj|AP005169.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0077J18 Length = 180944 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 167 gcagcggcggcggtactggt 186 |||||||||||||||||||| Sbjct: 54111 gcagcggcggcggtactggt 54130
>emb|AJ340358.1|HSA340358 Homo sapiens genomic sequence surrounding NotI site, clone NR1-QN23R Length = 747 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 cggaggaggatgccccgcgc 241 |||||||||||||||||||| Sbjct: 420 cggaggaggatgccccgcgc 439
>emb|AJ327575.1|HSA327575 Homo sapiens genomic sequence surrounding NotI site, clone NR1-EO20R Length = 711 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 222 cggaggaggatgccccgcgc 241 |||||||||||||||||||| Sbjct: 420 cggaggaggatgccccgcgc 439
>dbj|AK069906.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023034H23, full insert sequence Length = 2449 Score = 40.1 bits (20), Expect = 7.2 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Plus Query: 153 gatggagcaggag-agcagcggcggcgg 179 ||||||||||||| |||||||||||||| Sbjct: 522 gatggagcaggagcagcagcggcggcgg 549
>gb|AY105942.1| Zea mays PCO060537 mRNA sequence Length = 487 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 caggagagcagcggcggcgg 179 |||||||||||||||||||| Sbjct: 187 caggagagcagcggcggcgg 206
>emb|AL844171.13| Zebrafish DNA sequence from clone DKEY-237G17, complete sequence Length = 172321 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 363 gggctccaacgccagcagaa 382 |||||||||||||||||||| Sbjct: 4240 gggctccaacgccagcagaa 4259
>dbj|AP001187.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-665N17, complete sequence Length = 171793 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 gcagagggagagggaaggag 115 |||||||||||||||||||| Sbjct: 43965 gcagagggagagggaaggag 43984
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 316 cccacaccgacggcgtcggc 335 |||||||||||||||||||| Sbjct: 244927 cccacaccgacggcgtcggc 244908
>dbj|AB215131.1| Equus caballus DNA, microsatellite TKY1188 Length = 319 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 462 cttcatgctcaggcagacgg 481 |||||||||||||||||||| Sbjct: 108 cttcatgctcaggcagacgg 127
>dbj|AP001010.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-701H16, complete sequence Length = 173709 Score = 40.1 bits (20), Expect = 7.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 tgaggcagagggagagggaa 111 |||||||||||||||||||| Sbjct: 116934 tgaggcagagggagagggaa 116953 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,296,845 Number of Sequences: 3902068 Number of extensions: 4296845 Number of successful extensions: 162867 Number of sequences better than 10.0: 89 Number of HSP's better than 10.0 without gapping: 85 Number of HSP's successfully gapped in prelim test: 4 Number of HSP's that attempted gapping in prelim test: 162136 Number of HSP's gapped (non-prelim): 783 length of query: 535 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 512 effective length of database: 17,143,297,704 effective search space: 8777368424448 effective search space used: 8777368424448 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)