| Clone Name | bart18f11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC113133.5| Homo sapiens chromosome 8, clone RP11-930P14, complete sequence Length = 137390 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 1 acctctcctctctccccatta 21 ||||||||||||||||||||| Sbjct: 104705 acctctcctctctccccatta 104725
>dbj|AK058036.1| Homo sapiens cDNA FLJ25307 fis, clone SYN00302 Length = 2213 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 acctctcctctctccccatta 21 ||||||||||||||||||||| Sbjct: 172 acctctcctctctccccatta 152
>emb|AL137850.12| Human DNA sequence from clone RP11-56P10 on chromosome 9q31.3-33.3 Contains the 3' end of the gene for a novel C2H2 type zinc finger protein, the AMBP gene for alpha-1-microglobulin/bikunin precursor, the gene for a novel protein similar to mouse kinesin 12 (LOC113220) and two CpG islands, complete sequence Length = 125842 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 8 ctctctccccattagcgtg 26 ||||||||||||||||||| Sbjct: 22140 ctctctccccattagcgtg 22122
>emb|CR861438.1| Pongo pygmaeus mRNA; cDNA DKFZp459K212 (from clone DKFZp459K212) Length = 4091 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 3250 cctctcctctctccccatt 3268
>emb|CR860731.1| Pongo pygmaeus mRNA; cDNA DKFZp459J0327 (from clone DKFZp459J0327) Length = 4137 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 3291 cctctcctctctccccatt 3309
>emb|CR860453.1| Pongo pygmaeus mRNA; cDNA DKFZp459P201 (from clone DKFZp459P201) Length = 4094 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 3251 cctctcctctctccccatt 3269
>gb|AC010051.9| Drosophila melanogaster 3L BAC RP98-3J2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 184424 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 47 tttggatcgccgcggatcggatt 69 ||||||||||||||||| ||||| Sbjct: 125245 tttggatcgccgcggattggatt 125267
>gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, complete sequence Length = 163533 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 132687 cctctcctctctccccatt 132669
>gb|AC011797.8| Homo sapiens, clone RP11-17L5, complete sequence Length = 158389 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 33357 cctctcctctctccccatt 33339
>gb|AC153932.10| Mus musculus 10 BAC RP24-266J23 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 162628 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 156370 cctctcctctctccccatt 156388
>gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 201801 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 169668 cctctcctctctccccatt 169650
>gb|AC154595.2| Mus musculus BAC clone RP23-353D15 from 13, complete sequence Length = 180529 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 cctctcctctctccccatt 20 ||||||||||||||||||| Sbjct: 21823 cctctcctctctccccatt 21841
>gb|AE003593.2| Drosophila melanogaster chromosome 3L, section 74 of 83 of the complete sequence Length = 313157 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 47 tttggatcgccgcggatcggatt 69 ||||||||||||||||| ||||| Sbjct: 23436 tttggatcgccgcggattggatt 23414 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 617,168 Number of Sequences: 3902068 Number of extensions: 617168 Number of successful extensions: 49170 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 49152 Number of HSP's gapped (non-prelim): 18 length of query: 76 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 55 effective length of database: 17,151,101,840 effective search space: 943310601200 effective search space used: 943310601200 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)