| Clone Name | baet99e07 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 523 bits (264), Expect = e-145 Identities = 315/332 (94%) Strand = Plus / Plus Query: 51 agctttccaatggcggcagccaccatgtccatctcctcctcgacctttgccggcaaggcg 110 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 1 agctttccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcg 60 Query: 111 gtgaagaatgtaccatctttggctctctttggagatgcccgagtcaccatgcgcaagacc 170 ||||||||||||||||||||||||||||| || || ||||| |||||||||||||||||| Sbjct: 61 gtgaagaatgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagacc 120 Query: 171 gcagcaaaggcgaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctc 230 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gcagcaaaggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctc 180 Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290 |||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| Sbjct: 181 tacctcggcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgac 240 Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350 ||||||||||||||||| |||||||| |||||||| |||||||| |||||||||||||| Sbjct: 241 tatgggtgggacactgctggactttcggctgacccggagaccttctccaagaaccgggag 300 Query: 351 ctggaggtgatccattgccgatgggccatgct 382 |||||||||||||| || || ||||||||||| Sbjct: 301 ctggaggtgatccactgtcgctgggccatgct 332
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 268 bits (135), Expect = 1e-68 Identities = 279/327 (85%) Strand = Plus / Plus Query: 56 tccaatggcggcagccaccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115 |||||||||||| ||||||||| | ||||||| ||||| || ||||| ||||||||||| Sbjct: 15 tccaatggcggccaccaccatgtacctctcctcatcgacattcgccggaaaggcggtgaa 74 Query: 116 gaatgtaccatctttggctctctttggagatgcccgagtcaccatgcgcaagaccgcagc 175 |||||| |||| | ||||||||| || || || || |||||||||||||||||||| || Sbjct: 75 gaatgtcccattatcggctctcttcggtgaggctcgcgtcaccatgcgcaagaccgcggc 134 Query: 176 aaaggcgaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacct 235 || || ||||| ||||||||| |||||||||||||||| ||||| |||||||||||||| Sbjct: 135 gaaagctaagcaagtttcctccagcagcccatggtacggagctgatcgtgtgctctacct 194 Query: 236 cggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatgg 295 |||||||||||| | |||||||| ||||||||||| ||||| ||||| || ||||| || Sbjct: 195 cggcccactctctcgcgagcccccaagctacctcaccggtgatttccccggtgactacgg 254 Query: 296 gtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctgga 355 ||||||||| || ||||| || |||||||| |||||||| | |||||||| ||| |||| Sbjct: 255 gtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgcgagttgga 314 Query: 356 ggtgatccattgccgatgggccatgct 382 |||||| || ||||| ||||| ||||| Sbjct: 315 ggtgatacactgccgctgggctatgct 341
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 252 bits (127), Expect = 7e-64 Identities = 277/327 (84%) Strand = Plus / Plus Query: 58 caatggcggcagccaccatgtccatctcctcctcgacctttgccggcaaggcggtgaaga 117 |||||||||| |||||||||| | ||||| ||| |||| ||||||||||| || |||| Sbjct: 199 caatggcggccaccaccatgtctctttcctcttcgtccttcgccggcaaggccgtcaaga 258 Query: 118 atgtaccatctttggctctctttggagatgcccgagtcaccatgcgcaagaccgcagcaa 177 | | || || | ||||||| |||| || || || || | |||||||||||| || || | Sbjct: 259 acttgccctcgtcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcga 318 Query: 178 aggcgaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcg 237 |||| || || ||||| || ||||||| |||||||| ||||||||||||||||||||| Sbjct: 319 aggccaaacaagtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcg 378 Query: 238 gcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggt 297 |||| || ||||| |||||||| |||||| | |||||||||||||| || |||||||||| Sbjct: 379 gcccgctttccggcgagccccccagctacttgactggtgagttccccggtgactatgggt 438 Query: 298 gggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggagg 357 ||||||| ||||| || || ||||||||||||||||| ||||||||||||||||| |||| Sbjct: 439 gggacaccgccgggctctcggctgaccctgagaccttcgccaagaaccgggagctcgagg 498 Query: 358 tgatccattgccgatgggccatgctcg 384 ||||||| ||||||||||||||||||| Sbjct: 499 tgatccactgccgatgggccatgctcg 525
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 234 bits (118), Expect = 2e-58 Identities = 202/230 (87%) Strand = Plus / Plus Query: 153 gtcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagcccatggtac 212 |||||||||||||||||||| || ||||| |||| ||| || ||||||||||| |||||| Sbjct: 157 gtcaccatgcgcaagaccgcggccaaggccaagccggtgtcgtccggcagcccgtggtac 216 Query: 213 ggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcact 272 || | ||||| ||||||||||||||||| |||||||| || ||||||||||||||||| Sbjct: 217 gggtccgaccgcgtgctctacctcggcccgctctccggcgaccccccgagctacctcacc 276 Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 || |||||||| |||||||| ||||||||||| || || || || || ||||| |||||| Sbjct: 277 ggcgagttccccggcgactacgggtgggacaccgcggggctgtcggccgaccccgagacc 336 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 337 ttcgccaagaaccgggagctggaggtgatccactgccggtgggccatgct 386
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 224 bits (113), Expect = 2e-55 Identities = 254/301 (84%) Strand = Plus / Plus Query: 84 tcctcctcgacctttgccggcaaggcggtgaagaatgtaccatctttggctctctttgga 143 ||||| ||| |||| ||||||||||| || ||||| | || || | ||||||| |||| Sbjct: 20 tcctcttcgtccttcgccggcaaggccgtcaagaacttgccctcgtcggctctcattggt 79 Query: 144 gatgcccgagtcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagc 203 || || || || | |||||||||||| || || ||||| || || ||||| || ||||| Sbjct: 80 gacgcacgtgtgaacatgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagc 139 Query: 204 ccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagc 263 || |||||||| ||||||||||||||||||||||| | || ||||| || ||||| ||| Sbjct: 140 ccgtggtacggctctgaccgtgtgctctacctcggctcgctttccggcgaaccccccagc 199 Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||| | |||||||||||||| || ||||||||||||||||| ||||| || || |||||| Sbjct: 200 tacttgactggtgagttccccggtgactatgggtgggacaccgccgggctctcggctgac 259 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 383 ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| Sbjct: 260 cctgagaccttcgccaagaaccgggagctcgaggtgatccactgccgatgggccatgctc 319 Query: 384 g 384 | Sbjct: 320 g 320
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318 Query: 381 ct 382 || Sbjct: 319 ct 320
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Minus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356 Query: 381 ct 382 || Sbjct: 14355 ct 14354
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655 Query: 381 ct 382 || Sbjct: 30024656 ct 30024657 Score = 159 bits (80), Expect = 8e-36 Identities = 143/164 (87%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||| || || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 23603833
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645 Query: 381 ct 382 || Sbjct: 20646 ct 20647
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399 Query: 381 ct 382 || Sbjct: 400 ct 401
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399 Query: 381 ct 382 || Sbjct: 400 ct 401
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401 Query: 381 ct 382 || Sbjct: 402 ct 403
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 170 bits (86), Expect = 2e-39 Identities = 158/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401 Query: 381 ct 382 || Sbjct: 402 ct 403
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 10793302 Query: 381 ct 382 || Sbjct: 10793303 ct 10793304
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 17025 Query: 381 ct 382 || Sbjct: 17026 ct 17027
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 129920 Query: 381 ct 382 || Sbjct: 129921 ct 129922
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 370 Query: 381 ct 382 || Sbjct: 371 ct 372
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375 Query: 381 ct 382 || Sbjct: 376 ct 377
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 377 Query: 381 ct 382 || Sbjct: 378 ct 379
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375 Query: 381 ct 382 || Sbjct: 376 ct 377
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||| || |||||| | |||||||| || |||||||| ||||| || || || Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360 Query: 381 ct 382 || Sbjct: 361 ct 362
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 163 bits (82), Expect = 5e-37 Identities = 157/182 (86%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || ||||||||||||||||||||| ||||||| | ||||||||| ||| Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356 Query: 381 ct 382 || Sbjct: 357 ct 358
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 161 bits (81), Expect = 2e-36 Identities = 162/189 (85%) Strand = Plus / Plus Query: 194 ctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtga 253 |||||||||||| |||||||| | ||||| ||||||||||| |||||||| ||||| || Sbjct: 144 ctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccggcga 203 Query: 254 gcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggact 313 ||||||||||||||| || || |||||||| |||||||| || |||||||| || || || Sbjct: 204 gcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggct 263 Query: 314 ttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatg 373 || || ||||| ||||| || ||||||||||||||||||||||| ||||| | ||| || Sbjct: 264 gtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatccactcccgctg 323 Query: 374 ggccatgct 382 ||||||||| Sbjct: 324 ggccatgct 332
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 159 bits (80), Expect = 8e-36 Identities = 143/164 (87%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||| || || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 290
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 159 bits (80), Expect = 8e-36 Identities = 143/164 (87%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||| || || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 66532
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 159 bits (80), Expect = 8e-36 Identities = 143/164 (87%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||| || || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 361
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 159 bits (80), Expect = 8e-36 Identities = 143/164 (87%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| ||| Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||| || || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 360
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein Length = 1080 Score = 155 bits (78), Expect = 1e-34 Identities = 156/182 (85%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||| ||| |||||||||| ||| | |||||| |||| |||||| |||| Sbjct: 208 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtcccca 267 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||| | ||||||||||||||||| ||||| |||||||||||||| |||||||||||| Sbjct: 268 agctacttgactggtgagttccctggtgactacgggtgggacactgctggactttcagct 327 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 || || || || ||||||||||| || ||| ||||||||||||| ||| ||||||||||| Sbjct: 328 gatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcagatgggccatg 387 Query: 381 ct 382 || Sbjct: 388 ct 389
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 155 bits (78), Expect = 1e-34 Identities = 156/182 (85%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| ||| Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| | ||||||||||||||||||||||||||||| | ||| ||||| ||| Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375 Query: 381 ct 382 || Sbjct: 376 ct 377
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 151 bits (76), Expect = 2e-33 Identities = 160/188 (85%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 ||||| ||||| |||||||| | ||||| ||||| ||||| |||||||| ||||| ||| Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||| || || |||||||| |||||||| || |||||||| || || || Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || ||||| ||||| || ||||||||||||||||||||||||||||| ||||| ||| Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376 Query: 375 gccatgct 382 |||||||| Sbjct: 377 gccatgct 384 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 71 caccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115 ||||||| || |||||||| || |||| ||||||||||| ||||| Sbjct: 76 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 120
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 147 bits (74), Expect = 3e-32 Identities = 146/170 (85%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | |||||||| ||| | |||||| ||||||||||| Sbjct: 142 tccggcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgag 201 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 ||||| |||||| | || ||||| ||||| || |||||||| ||||||||||||||||| Sbjct: 202 cccccaagctacttgaccggtgaattccccggtgactatggctgggacactgccggactc 261 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||||||||| || ||||||||||||||||| ||||| || |||||||| Sbjct: 262 tcagctgacccagaaacctttgccaagaaccgtgagctcgaagtgatcca 311
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 147 bits (74), Expect = 3e-32 Identities = 134/154 (87%) Strand = Plus / Plus Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290 ||||||||||| ||||||| |||||||||||||||||||| || |||||||| |||||| Sbjct: 1051 tacctcggccccttctccggcgagcccccgagctacctcaccggcgagttccccggcgac 1110 Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350 || || |||||||| ||||| || || || ||||| ||||| || ||||||||||| ||| Sbjct: 1111 tacggctgggacaccgccgggctgtccgccgaccccgagacattcgccaagaaccgcgag 1170 Query: 351 ctggaggtgatccattgccgatgggccatgctcg 384 |||||||||||||| | ||| ||||||||||||| Sbjct: 1171 ctggaggtgatccactcccgctgggccatgctcg 1204
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 145 bits (73), Expect = 1e-31 Identities = 148/173 (85%) Strand = Plus / Plus Query: 208 ggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacc 267 |||||||||| ||||| | |||||||| |||||| |||| ||| ||||| ||||| Sbjct: 667 ggtacggtgccgaccgccttctctacctgggcccattctctggttctcccccatcctacc 726 Query: 268 tcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctg 327 ||||||||||||||||||| ||||||||||||||||| || || || || || ||||| | Sbjct: 727 tcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcagacccag 786 Query: 328 agacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||||| ||||||||| ||||||||||||||||||||| | ||||||||||| Sbjct: 787 agaccttcgccaagaacagggagctggaggtgatccattccagatgggccatg 839
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 145 bits (73), Expect = 1e-31 Identities = 157/185 (84%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||| ||||||||||| |||||||||| ||| | |||||| |||| |||||| || Sbjct: 1592 ggcagtccatggtacggccctgaccgtgtcaagtacttgggcccattctctggtgagtcc 1651 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 || |||||| | || |||||||||||||| || ||||| ||||||||||| ||||||||| Sbjct: 1652 ccaagctacttgacgggtgagttccctggtgattatggatgggacactgctggactttca 1711 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 ||||| || || || ||||| |||||||| ||| ||||||||||||||||| |||||||| Sbjct: 1712 gctgatccagaaacttttgctaagaaccgtgagttggaggtgatccattgcagatgggcc 1771 Query: 378 atgct 382 ||||| Sbjct: 1772 atgct 1776
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 145 bits (73), Expect = 1e-31 Identities = 157/185 (84%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 |||||||||||||||||| | |||||||| ||| | |||||| |||| |||||| | Sbjct: 2532 ggcagcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggtgagtct 2473 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 || |||||| | ||||||||||| || || |||||||| ||||||||||| ||||||||| Sbjct: 2472 ccaagctacttgactggtgagtttccaggtgactatggatgggacactgctggactttca 2413 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 ||||| || || || |||||||||||||| ||| ||||||||||||| ||| |||||||| Sbjct: 2412 gctgatccagaaacttttgccaagaaccgtgagttggaggtgatccactgcagatgggcc 2353 Query: 378 atgct 382 ||||| Sbjct: 2352 atgct 2348 Score = 123 bits (62), Expect = 4e-25 Identities = 125/146 (85%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| |||| |||||| | || |||||| | |||||||| |||||||| ||||| ||| Sbjct: 4540 ggcccattctctggtgagtctccaagctacttgactggtgaattccctggtgactacggg 4599 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||||||||| |||||||||||||| || || || ||||| |||||||| ||| ||||| Sbjct: 4600 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 4659 Query: 357 gtgatccattgccgatgggccatgct 382 |||||||| ||| ||||||| ||||| Sbjct: 4660 gtgatccactgcagatgggcaatgct 4685
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 143 bits (72), Expect = 5e-31 Identities = 159/188 (84%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 ||||| ||||| |||||||| | ||||| ||||| ||||| |||||||| ||||| ||| Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||| || || |||||||| |||||||| || |||||||| || || || Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||| Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324 Query: 375 gccatgct 382 |||||||| Sbjct: 1325 gccatgct 1332 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 71 caccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115 ||||||| || |||||||| || |||| ||||||||||| ||||| Sbjct: 1024 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 1068
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 143 bits (72), Expect = 5e-31 Identities = 159/188 (84%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 ||||| ||||| |||||||| | ||||| ||||| ||||| |||||||| ||||| ||| Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||| || || |||||||| |||||||| || |||||||| || || || Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||| Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324 Query: 375 gccatgct 382 |||||||| Sbjct: 1325 gccatgct 1332 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 71 caccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115 ||||||| || |||||||| || |||| ||||||||||| ||||| Sbjct: 1024 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 1068
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 141 bits (71), Expect = 2e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| || ||||||||||| ||| |||||||||| ||| | |||||| |||| ||| Sbjct: 171 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggt 230 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 || |||| |||||| | ||||||||||| ||||| ||||| || ||||||||||| ||| Sbjct: 231 gaagccccaagctacttgactggtgagtttcctggtgactacggatgggacactgctgga 290 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 371 ||||||||||||||||| || || || |||||||| ||||| ||||||||||| ||| || Sbjct: 291 ctttcagctgaccctgaaacattcgctaagaaccgtgagcttgaggtgatccactgcaga 350 Query: 372 tgggccatgct 382 ||||||||||| Sbjct: 351 tgggccatgct 361
>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA, partial cds Length = 780 Score = 139 bits (70), Expect = 7e-30 Identities = 163/194 (84%) Strand = Plus / Plus Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248 |||||||| || |||||||||||||| | |||||||| ||| | |||||| |||| Sbjct: 115 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 174 Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308 ||||||||||| ||||| |||||||| |||||||| |||||||| ||||||||||| Sbjct: 175 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 234 Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368 || |||||||||||||| || ||||||||||||||||| ||||| || |||||||| | | Sbjct: 235 gggctttcagctgacccagaaacctttgccaagaaccgtgagcttgaagtgatccactcc 294 Query: 369 cgatgggccatgct 382 ||||||||||||| Sbjct: 295 agatgggccatgct 308
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 139 bits (70), Expect = 7e-30 Identities = 187/226 (82%) Strand = Plus / Plus Query: 154 tcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagcccatggtacg 213 ||||||||||||||||||| || ||| | |||| || |||||||||||| ||||||| Sbjct: 2015 tcaccatgcgcaagaccgccgccaagcccaagccggcgcgctccggcagcccctggtacg 2074 Query: 214 gtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcactg 273 |||| ||||| || || ||||| ||||| || ||||| || ||||||||||| || | Sbjct: 2075 gtgccgaccgcgtcctgtacctgggcccgctgtccggctcacctccgagctacctgaccg 2134 Query: 274 gtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacct 333 | |||||||| |||||||| ||||||||||| | || || || || ||||| ||||||| Sbjct: 2135 gcgagttccccggcgactacgggtgggacaccgaggggctgtcggcggacccggagacct 2194 Query: 334 ttgccaagaaccgggagctggaggtgatccattgccgatgggccat 379 | ||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 2195 tcgccaagaaccgcgagctggaggtgatccactgccgctgggccat 2240
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 139 bits (70), Expect = 7e-30 Identities = 154/182 (84%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||||||| |||||||||| ||| | |||||| |||||||||| |||| Sbjct: 375 agcccatggtacggtcctgaccgtgtcaagtacttgggcccattctccggtgaagcccca 434 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||| | || |||||||||||||| |||||||| |||||||| || | |||||||||| Sbjct: 435 agctacttgaccggtgagttccctggtgactatggttgggacaccgctgaactttcagct 494 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 || || || || || ||||||||||| ||| ||||||||||||| ||| ||||||||||| Sbjct: 495 gatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 554 Query: 381 ct 382 || Sbjct: 555 ct 556
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 139 bits (70), Expect = 7e-30 Identities = 154/182 (84%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||| ||| |||| ||||| ||| | |||||| | || |||||| |||| Sbjct: 372 agcccatggtatggtcctgatcgtgtcaagtacttgggcccattttctggtgaggcccca 431 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||| | ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| Sbjct: 432 agctacttgactggtgagtttcctggtgactatgggtgggatactgctggactttcagca 491 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| || || || ||||||||||||||| ||||||||||||| ||| ||||||||||| Sbjct: 492 gacccagaaactttcgccaagaaccgggagttggaggtgatccactgcagatgggccatg 551 Query: 381 ct 382 || Sbjct: 552 ct 553
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds Length = 1815 Score = 139 bits (70), Expect = 7e-30 Identities = 154/182 (84%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||| ||| |||||||||| ||| | |||||| |||| |||||| | || Sbjct: 1120 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 1179 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||| | ||||||||||| ||||| || || ||||||||||||||||||||||||||| Sbjct: 1180 agctacttgactggtgagtttcctggtgattacgggtgggacactgccggactttcagct 1239 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 || || || || || ||||||||||| ||| ||||||||||||| ||| ||||||||||| Sbjct: 1240 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 1299 Query: 381 ct 382 || Sbjct: 1300 ct 1301
>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L Length = 1187 Score = 137 bits (69), Expect = 3e-29 Identities = 156/185 (84%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 |||||||||||||| ||| |||| ||||| ||| | || ||| |||| |||||| || Sbjct: 372 ggcagcccatggtatggtcctgatcgtgtcaagtacttgggtccattctctggtgaggcc 431 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 || |||||| | ||||||||||||||||| || ||||||||||||||||| ||||||||| Sbjct: 432 ccaagctacttgactggtgagttccctggtgattatgggtgggacactgctggactttca 491 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 ||||| || || || || |||||||| || ||| ||||||||||||| ||| |||||||| Sbjct: 492 gctgatccagaaactttcgccaagaatcgtgagttggaggtgatccactgcagatgggcc 551 Query: 378 atgct 382 ||||| Sbjct: 552 atgct 556
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 137 bits (69), Expect = 3e-29 Identities = 143/167 (85%), Gaps = 3/167 (1%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt---gagccc 257 ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| Sbjct: 624 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| |||||||| ||||||||||| || || || || Sbjct: 684 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 || ||||| ||||| || ||||||||||||||||||||||||||||| Sbjct: 744 gccgacccggagacgttcgccaagaaccgggagctggaggtgatcca 790
>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 135 bits (68), Expect = 1e-28 Identities = 155/184 (84%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| || |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 196 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | |||||||| |||||||| ||||| |||||||| || || |||||||||| Sbjct: 197 caagctacttgactggtgaattccctggtgactacgggtgggataccgctggactttcag 256 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||| ||||||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 316 Query: 379 tgct 382 |||| Sbjct: 317 tgct 320
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 135 bits (68), Expect = 1e-28 Identities = 155/184 (84%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| || |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 196 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | || ||| | |||||||| |||||||| |||||||| ||||| || || |||||||||| Sbjct: 197 caagttacttgactggtgaattccctggtgactatggatgggataccgctggactttcag 256 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||||||||||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 257 cagaccctgagacctttgccaagaaccgtgaacttgaggtgatccactgcagatgggcta 316 Query: 379 tgct 382 |||| Sbjct: 317 tgct 320
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds Length = 1240 Score = 135 bits (68), Expect = 1e-28 Identities = 155/184 (84%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||| ||||||||| || ||||||| ||| | || ||| |||| |||||| | | Sbjct: 579 gcagcccgtggtacggtcctaaccgtgtcaagtacttgggtccattctctggtgagtctc 638 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | ||||||||||||||||| |||||||| ||||| ||||| |||||||||| Sbjct: 639 caagctacttgactggtgagttccctggtgactatggatgggatactgctggactttcag 698 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 |||| ||||| || |||||||||||||| ||| ||||||||||||| || ||||||||| Sbjct: 699 ctgatcctgaaacttttgccaagaaccgtgagttggaggtgatccactgtagatgggcca 758 Query: 379 tgct 382 |||| Sbjct: 759 tgct 762
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 135 bits (68), Expect = 1e-28 Identities = 155/184 (84%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||||||| | |||||||| ||| | |||||| ||||||||||| ||| Sbjct: 4471 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattctccggtgagtccc 4530 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| || || || |||||||||||||| ||||| |||||||||| Sbjct: 4531 caagctacttgaccggtgaatttcccggtgactatgggtgggatactgctggactttcag 4590 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | || || || ||||||||||||||||| ||||| ||||||||||| ||| ||||||| | Sbjct: 4591 cagatccagaaacctttgccaagaaccgtgagctcgaggtgatccactgcagatgggcta 4650 Query: 379 tgct 382 |||| Sbjct: 4651 tgct 4654 Score = 111 bits (56), Expect = 2e-21 Identities = 152/184 (82%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 |||||||||||||||| | |||||||| ||| | |||||| ||||||||||| ||| Sbjct: 7011 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgaggccc 7070 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| ||||| || || || |||||||| ||||| |||||||||| Sbjct: 7071 caagctacttgaccggtgaattcccaggtgattacgggtgggatactgctggactttcag 7130 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | || || || ||||||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 7131 cggatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 7190 Query: 379 tgct 382 |||| Sbjct: 7191 tgct 7194 Score = 111 bits (56), Expect = 2e-21 Identities = 152/184 (82%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||||||| | |||||||| ||| | |||||| | || |||||| | | Sbjct: 2018 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattttctggtgagtctc 2077 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | ||||| | |||||||| |||||||| |||||||||||||| ||||| |||||||||| Sbjct: 2078 caagctatttgactggtgaattccctggtgactatgggtgggatactgctggactttcag 2137 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | ||||| || || |||||||||||||| || || |||||||| || ||| ||||||| | Sbjct: 2138 ccgacccagaaacttttgccaagaaccgtgaactcgaggtgattcactgcagatgggcta 2197 Query: 379 tgct 382 |||| Sbjct: 2198 tgct 2201
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 133 bits (67), Expect = 5e-28 Identities = 156/185 (84%), Gaps = 3/185 (1%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt---gagccc 257 ||||| |||||||| || ||||| || |||||||||||||| ||||| || ||||| Sbjct: 585 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 |||||||||||||| || |||||||| |||||||| ||||||||||| || || || || Sbjct: 645 ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| Sbjct: 705 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcg 764 Query: 378 atgct 382 ||||| Sbjct: 765 atgct 769
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 133 bits (67), Expect = 5e-28 Identities = 121/139 (87%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||||||| ||||||||||| | || ||||||||||| || ||||| || ||||||| Sbjct: 74 tctccggtgagtccccgagctacttgaccggtgagttccccggtgactacggctgggaca 133 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 |||| ||||| ||||||||||| |||||||| ||||||||||| ||||| |||||||||| Sbjct: 134 ctgctggactctcagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatcc 193 Query: 364 attgccgatgggccatgct 382 | | ||||||||||||| Sbjct: 194 actcaagatgggccatgct 212
>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein, complete cds Length = 935 Score = 133 bits (67), Expect = 5e-28 Identities = 106/119 (89%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| || ||||| |||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 224 tacctgaccggtgaattccctggagactatgggtgggacactgctggactttcagctgac 283 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| |||||||||||||| ||||| || |||||||| || ||||||||||||| Sbjct: 284 ccagagacatttgccaagaaccgtgagctcgaagtgatccacagcagatgggccatgct 342
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein Length = 1025 Score = 131 bits (66), Expect = 2e-27 Identities = 153/182 (84%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||| ||| |||||||||| ||| | |||||| |||| |||||| | || Sbjct: 200 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 259 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||| | ||||||||||| ||||| || || |||||||||||||| |||||||||||| Sbjct: 260 agctacttgactggtgagtttcctggtgattacgggtgggacactgctggactttcagct 319 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 || || || || || ||||||||||| ||| ||||||||||||| ||| ||||||||||| Sbjct: 320 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 379 Query: 381 ct 382 || Sbjct: 380 ct 381
>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene, nuclear gene encoding chloroplast protein, partial cds Length = 405 Score = 131 bits (66), Expect = 2e-27 Identities = 126/146 (86%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| |||| |||||| |||| |||||| | || ||||| |||||||| ||||| || Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || || ||| Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294 Query: 357 gtgatccattgccgatgggccatgct 382 |||||||||||| ||||||| ||||| Sbjct: 295 gtgatccattgcagatgggctatgct 320
>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 878 Score = 131 bits (66), Expect = 2e-27 Identities = 162/194 (83%) Strand = Plus / Plus Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248 ||||| ||||||||||| ||||| ||| |||||||||| ||| | |||||| |||| Sbjct: 97 gtttcttccggcagcccgtggtatggtcctgaccgtgtcaagtacttgggcccattctct 156 Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308 |||||||| || |||||| || || ||||||||||| ||||| || ||||||||||| Sbjct: 157 ggtgagccaccatcctaccttaccggagagttccctggtgactacggttgggacactgct 216 Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368 |||||||||||||| || |||||||| ||||||||||| ||| |||| |||||||| | | Sbjct: 217 ggactttcagctgatcccgagaccttcgccaagaaccgtgagttggaagtgatccactcc 276 Query: 369 cgatgggccatgct 382 ||||||||||||| Sbjct: 277 agatgggccatgct 290
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 mRNA, complete cds Length = 859 Score = 129 bits (65), Expect = 7e-27 Identities = 188/229 (82%) Strand = Plus / Plus Query: 154 tcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagcccatggtacg 213 |||| |||||||||||||| || ||| | ||| ||| || ||||||||||| ||||||| Sbjct: 149 tcacgatgcgcaagaccgccgccaagcccaagacggtctcgtccggcagcccgtggtacg 208 Query: 214 gtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcactg 273 | | |||||||| ||||||||||| ||||||| ||| |||| |||||||| | Sbjct: 209 gcccggaccgtgtcaagtacctcggcccgttctccggcgaggccccatcatacctcaccg 268 Query: 274 gtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacct 333 | || ||||| |||||||| ||||||||||| ||||| || || || ||||| ||||||| Sbjct: 269 gcgaattccccggcgactacgggtgggacaccgccgggctctccgccgaccccgagacct 328 Query: 334 ttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 | |||||||||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 329 tctccaagaaccgggagctcgaggtgatccactgccggtgggccatgct 377
>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I Length = 3529 Score = 129 bits (65), Expect = 7e-27 Identities = 101/113 (89%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 ||||||||||||||||| ||||| || ||||||||||| ||||| ||||||||||||||| Sbjct: 2319 actggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctgag 2378 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| | ||||| |||||| |||||||||||||| || ||||||||||| Sbjct: 2379 acatttgctaggaacctggagcttgaggtgatccattgtcgttgggccatgct 2431
>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 (LHCP) mRNA, partial cds Length = 712 Score = 127 bits (64), Expect = 3e-26 Identities = 157/188 (83%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 ||||||||||| |||||||| | |||||||| ||||||||||| ||||||||||| Sbjct: 94 tccggcagcccctggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgag 153 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 | || |||||||| ||||||||||| |||||||| || |||||||| ||||| || Sbjct: 154 gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 213 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 214 tccgcggaccccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgg 273 Query: 375 gccatgct 382 || ||||| Sbjct: 274 gcaatgct 281
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 127 bits (64), Expect = 3e-26 Identities = 166/200 (83%) Strand = Plus / Plus Query: 183 aagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggccca 242 ||||||||||||||||| |||||||||||||| | |||||||| ||| | |||||| Sbjct: 173 aagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggccca 232 Query: 243 ctctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggac 302 ||||||| ||||||||| ||||||||| || |||||||| || ||||| || |||||| Sbjct: 233 ttctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggac 292 Query: 303 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 362 ||||| || ||||| |||||||| |||||||| |||| |||||| ||| |||| || ||| Sbjct: 293 actgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtcatc 352 Query: 363 cattgccgatgggccatgct 382 || | | | ||||||||||| Sbjct: 353 cactccaggtgggccatgct 372
>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R Length = 1187 Score = 127 bits (64), Expect = 3e-26 Identities = 154/184 (83%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| ||| |||||||||| ||| | || ||| |||| |||||| | | Sbjct: 373 gcagcccatggtatggtcctgaccgtgtcaagtacttgggaccattctctggtgaggcac 432 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | ||||||||||||||| | |||||||| ||||| ||||| |||||||| | Sbjct: 433 caagctacttgactggtgagttccctagtgactatggatgggatactgctggactttcgg 492 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 |||| ||||| || |||||||||||||| ||||||||||| ||||| || ||||||||| Sbjct: 493 ctgatcctgaaacttttgccaagaaccgtgagctggaggtcatccactgtagatgggcca 552 Query: 379 tgct 382 |||| Sbjct: 553 tgct 556
>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 127 bits (64), Expect = 3e-26 Identities = 154/184 (83%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| || |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttaggcccattctctggtgagtccc 196 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| |||||||| ||||| |||||||| || || |||||||||| Sbjct: 197 caagctacttgaccggtgaattccctggtgactacgggtgggataccgctggactttcag 256 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||| ||||||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcaa 316 Query: 379 tgct 382 |||| Sbjct: 317 tgct 320
>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 127 bits (64), Expect = 3e-26 Identities = 154/184 (83%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| ||| |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 137 gcagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggtgagtccc 196 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | || ||| | || ||||| |||||||| |||||||| ||||| ||||| |||||||||| Sbjct: 197 caagttacttgaccggtgaattccctggtgactatggctgggatactgctggactttcag 256 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||| ||||||||||||||||| || || ||||||||||| ||| | ||||| | Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactagaggtgatccactgcaggtgggcta 316 Query: 379 tgct 382 |||| Sbjct: 317 tgct 320
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 127 bits (64), Expect = 3e-26 Identities = 154/184 (83%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| || |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttaggcccattctctggtgagtccc 196 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| |||||||| ||||| |||||||| || || |||||||||| Sbjct: 197 caagctacttgaccggtgaattccctggtgactacgggtgggataccgctggactttcag 256 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||| ||||||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcaa 316 Query: 379 tgct 382 |||| Sbjct: 317 tgct 320
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 123 bits (62), Expect = 4e-25 Identities = 101/114 (88%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 ||||||||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||| Sbjct: 231 ctacctcactggtgaattccctggtgactacgggtgggacactgctggactctctgctga 290 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggc 376 ||| ||||||||||| |||||||| || || ||||||||||| ||| ||||||| Sbjct: 291 cccagagacctttgctaagaaccgcgaacttgaggtgatccactgcagatgggc 344
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete cds Length = 1010 Score = 123 bits (62), Expect = 4e-25 Identities = 161/194 (82%) Strand = Plus / Plus Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248 |||||||| || |||||||||||||| | |||||||| ||| | |||||| |||| Sbjct: 171 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 230 Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308 ||||||||||| ||||| |||||||| |||||||| |||||||| ||||||||||| Sbjct: 231 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 290 Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368 || || ||||||||||| || |||||||| |||||||| ||||| || |||||||| | | Sbjct: 291 gggctatcagctgacccagaaacctttgctaagaaccgtgagcttgaagtgatccactcc 350 Query: 369 cgatgggccatgct 382 ||||||||||||| Sbjct: 351 agatgggccatgct 364
>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein Length = 1986 Score = 121 bits (61), Expect = 2e-24 Identities = 100/113 (88%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 |||||||||||||| || || || |||||||||||||| ||||||||||||||||| ||| Sbjct: 942 actggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccagag 1001 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || || || | |||||| ||||| ||||||||||||||||| ||||||||||| Sbjct: 1002 acattcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgct 1054
>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding protein (ABC) mRNA, complete cds; nuclear gene for chloroplast product Length = 993 Score = 119 bits (60), Expect = 7e-24 Identities = 105/120 (87%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 ||||||||| || || || |||||||||||||| ||||||||||||||||| |||||||| Sbjct: 207 ctacctcacaggagaatttcctggcgactatggttgggacactgccggactctcagctga 266 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||| ||||| || || |||||||| ||||| || |||||||||| |||||||||||||| Sbjct: 267 cccggagacattcgctaagaaccgtgagctcgaagtgatccattcacgatgggccatgct 326
>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene, partial cds; nuclear gene for chloroplast product Length = 647 Score = 119 bits (60), Expect = 7e-24 Identities = 123/144 (85%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| |||| || |||||||| |||||| | || |||||||||||||||||||| || Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 |||||||| ||||| |||||||||||||| || |||||||||||||| || || || || Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctttgccaagaatcgtgaactcgaa 291 Query: 357 gtgatccattgccgatgggccatg 380 || ||||| ||| ||||||||||| Sbjct: 292 gtcatccactgcagatgggccatg 315
>emb|X16535.1|GMCAB4 G.max DNA for Cab4 Length = 1470 Score = 119 bits (60), Expect = 7e-24 Identities = 123/144 (85%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| |||| ||||||||||| ||||||||||||||| ||||| || |||||||| Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||||||||| || ||||| |||||||| |||||||||||||| ||||| || ||||| Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaaaaaccgtgaactggaa 621 Query: 357 gtgatccattgccgatgggccatg 380 || ||||| | | ||||||||||| Sbjct: 622 gtcatccactccagatgggccatg 645
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 119 bits (60), Expect = 7e-24 Identities = 138/164 (84%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 |||||||||||||| | |||||||| ||||| |||||| ||||||||||| | || Sbjct: 201 agcccatggtacggcccagaccgtgtcaagtacctaggcccattctccggtgaggcacca 260 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||||||||| |||||||| |||||||| ||||||||||| || || |||||| Sbjct: 261 tcttacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagct 320 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| ||||| |||||||| ||||| ||||||||||| Sbjct: 321 gaccccgagacttttgctaagaaccgtgagcttgaggtgatcca 364
>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII) mRNA, 3' end Length = 911 Score = 119 bits (60), Expect = 7e-24 Identities = 150/180 (83%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 |||||||||||||| | |||||||| ||| | |||||| |||| ||||||||||| Sbjct: 81 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 140 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||||||||||||||| ||||| || |||||||| ||||||||||| || ||||| ||| Sbjct: 141 tcctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 200 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| |||||||||||||||||||| || || || || ||||| | | ||||||||||| Sbjct: 201 gacccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatg 260
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 117 bits (59), Expect = 3e-23 Identities = 119/139 (85%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||| |||||||| ||||||||||| || |||||||| || ||||| || ||||||| Sbjct: 224 tctccggagagcccccaagctacctcacaggagagttccccggtgactacggatgggaca 283 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 | ||||| ||||| |||||||| |||||||| |||| |||||| ||||| || || |||| Sbjct: 284 ccgccggtctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatcc 343 Query: 364 attgccgatgggccatgct 382 | ||| ||||||||||||| Sbjct: 344 actgcagatgggccatgct 362
>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA, partial cds Length = 226 Score = 117 bits (59), Expect = 3e-23 Identities = 119/139 (85%) Strand = Plus / Plus Query: 246 tccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacact 305 ||||| |||||||||||||||||||| || |||||||| || ||||| || |||||||| Sbjct: 1 tccggagagcccccgagctacctcaccggagagttccccggagactacggatgggacacc 60 Query: 306 gccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccat 365 ||||| || || |||||||| |||||||| |||| |||||| ||||| || || ||||| Sbjct: 61 gccggtctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccac 120 Query: 366 tgccgatgggccatgctcg 384 ||| ||||||||||||||| Sbjct: 121 tgcagatgggccatgctcg 139
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein Length = 964 Score = 117 bits (59), Expect = 3e-23 Identities = 158/191 (82%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| |||||||||||||| ||| |||||||||| ||| | || ||| |||| ||| Sbjct: 203 tcctctggcagcccatggtatggtcctgaccgtgtcaagtacttggggccattctctggt 262 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||| | || || ||| | || ||||| |||||||| |||||||| ||||||||||| ||| Sbjct: 263 gagtctccaagttacttgacgggtgaattccctggtgactatggatgggacactgctgga 322 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 371 ||||||||||| || || || ||||||||||| || ||| ||||||||||||| ||| || Sbjct: 323 ctttcagctgatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcaga 382 Query: 372 tgggccatgct 382 ||||| ||||| Sbjct: 383 tgggctatgct 393
>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase catalytic subunit B (ftrbpot gene) Length = 701 Score = 115 bits (58), Expect = 1e-22 Identities = 118/138 (85%) Strand = Plus / Minus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| |||| |||||| |||| |||||| | || ||||| |||||||| ||||| ||| Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||| || || ||||||||||| |||||||| ||||||||||||||||| || || ||| Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499 Query: 357 gtgatccattgccgatgg 374 |||||||| ||| ||||| Sbjct: 498 gtgatccactgcagatgg 481
>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein Length = 1470 Score = 113 bits (57), Expect = 4e-22 Identities = 99/113 (87%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 ||||| ||||||||||| |||||||| ||||| ||||| ||||| ||||| |||||||| Sbjct: 556 actggcgagttccctggtgactatggatgggatactgctggactctcagccgaccctgaa 615 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||||| |||||| ||||| ||||||||||||||||| ||||| ||||| Sbjct: 616 acatttgccaggaaccgtgagcttgaggtgatccattgccgttgggcaatgct 668
>gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-binding protein, 3' end Length = 810 Score = 113 bits (57), Expect = 4e-22 Identities = 99/113 (87%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 ||||||||||| || || |||||||| ||||||||||||||||| ||||||||||||||| Sbjct: 126 actggtgagtttccaggtgactatggatgggacactgccggactctcagctgaccctgag 185 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| | |||||| ||||| |||||||| ||||| || ||||| ||||| Sbjct: 186 acatttgcaaggaaccgtgagcttgaggtgatacattgtcgttgggctatgct 238
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein (CAB) mRNA, partial cds Length = 720 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Plus Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290 ||||||||||| ||||||||||| | || |||||||| ||||||||||| |||||| Sbjct: 210 tacctcggcccgttctccggtgaggcaccatcatacctcaccggtgagttccccggcgac 269 Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350 || || |||||||| ||||| || ||||| ||||| ||||| || ||||||||||||||| Sbjct: 270 tacggctgggacaccgccgggctctcagcggaccccgagacattcgccaagaaccgggag 329 Query: 351 ctggaggtgatccattgccgatgggccatgct 382 || ||||||||||| ||| | ||||| ||||| Sbjct: 330 ctcgaggtgatccactgcaggtgggcaatgct 361
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 111 bits (56), Expect = 2e-21 Identities = 128/152 (84%) Strand = Plus / Plus Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290 ||||||||||| ||||||||||| | || |||||||| ||||||||||| |||||| Sbjct: 45 tacctcggcccgttctccggtgaggcaccatcatacctcaccggtgagttccccggcgac 104 Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350 || || |||||||| ||||| || ||||| ||||| ||||| || ||||||||||||||| Sbjct: 105 tacggctgggacaccgccgggctctcagcggaccccgagacattcgccaagaaccgggag 164 Query: 351 ctggaggtgatccattgccgatgggccatgct 382 || ||||||||||| ||| | ||||| ||||| Sbjct: 165 ctcgaggtgatccactgcaggtgggcaatgct 196
>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial cds, nuclear gene for chloroplast product Length = 507 Score = 111 bits (56), Expect = 2e-21 Identities = 77/84 (91%) Strand = Plus / Plus Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||||||||| ||||| ||||||||||| || ||||||||||||||||| ||||| ||| Sbjct: 12 tgggacactgctggactctcagctgacccagaaacctttgccaagaaccgtgagcttgag 71 Query: 357 gtgatccattgccgatgggccatg 380 |||||||||||| ||||||||||| Sbjct: 72 gtgatccattgcagatgggccatg 95
>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein Length = 953 Score = 111 bits (56), Expect = 2e-21 Identities = 152/184 (82%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 |||||||||||||||| | |||||||| ||| | || ||| ||||||||||| ||| Sbjct: 199 gcagcccatggtacggcccagaccgtgttaagtacttgggtccattctccggtgagtccc 258 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| ||||| || || || |||||||| ||||| |||||||||| Sbjct: 259 caagctacttgaccggtgaattccccggtgattacgggtgggatactgctggactttcag 318 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | ||||| || ||||||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 319 cagacccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 378 Query: 379 tgct 382 |||| Sbjct: 379 tgct 382
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 111 bits (56), Expect = 2e-21 Identities = 110/128 (85%) Strand = Plus / Minus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| ||||||||||||||||| |||| | || ||||||||||| || ||||| || Sbjct: 66182 ggcccattctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggc 66123 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||||||||| || ||||| |||||||| ||||| || ||||||||||| ||||| ||| Sbjct: 66122 tgggacactgctgggctttctgctgaccccgagacattcgccaagaaccgtgagcttgag 66063 Query: 357 gtgatcca 364 |||||||| Sbjct: 66062 gtgatcca 66055
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 111 bits (56), Expect = 2e-21 Identities = 158/192 (82%) Strand = Plus / Plus Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248 |||||||| || |||||||||||||| | |||||||| ||| | |||||| |||| Sbjct: 881 gtttcctcaggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctca 940 Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308 ||||||||||| ||| ||||||||||| ||||| || |||||||| ||||||||||| Sbjct: 941 ggtgagcccccctcctatctcactggtgaattcccaggtgactatggttgggacactgct 1000 Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368 || ||||| |||||||| ||||| |||||||| ||||| || ||||| || ||||| | | Sbjct: 1001 gggctttctgctgacccagagacttttgccaaaaaccgtgaactggaagtcatccactcc 1060 Query: 369 cgatgggccatg 380 ||||||||||| Sbjct: 1061 agatgggccatg 1072
>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA, partial cds Length = 446 Score = 109 bits (55), Expect = 7e-21 Identities = 103/119 (86%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| |||||||| ||||| | |||||||| ||||||||||| ||| | || || ||| Sbjct: 288 taccttactggtgaattcccggaggactatggctgggacactgctggattatccgcagac 347 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 |||||||| ||||| |||||||| ||||||||||||||||| |||||||||||||||| Sbjct: 348 cctgagacatttgctaagaaccgtgagctggaggtgatccacagccgatgggccatgct 406
>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 409 Score = 109 bits (55), Expect = 7e-21 Identities = 154/187 (82%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| ||| ||| | || ||| ||||||| |||||| Sbjct: 285 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 226 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 166 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 165 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 106 Query: 378 atgctcg 384 ||||||| Sbjct: 105 atgctcg 99
>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete cds Length = 946 Score = 109 bits (55), Expect = 7e-21 Identities = 103/119 (86%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 |||||||| ||||||||||| || |||||||| ||||||||||| ||||| ||||||||| Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| || || | ||||| || || ||||||||||||||||| ||||||||||| Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgct 379
>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I Length = 2432 Score = 109 bits (55), Expect = 7e-21 Identities = 121/143 (84%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| |||| ||||| |||| |||||| | ||||||||| ||||| ||||| || Sbjct: 1081 ggcccattctctggtgaagccccaagctacttgactggtgagaaacctggtgactacgga 1140 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||||||||| |||||||||||||| || || || |||||||||||||| ||| ||||| Sbjct: 1141 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 1200 Query: 357 gtgatccattgccgatgggccat 379 ||||||||||| |||||||||| Sbjct: 1201 gtgatccattgtagatgggccat 1223
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein Length = 963 Score = 109 bits (55), Expect = 7e-21 Identities = 103/119 (86%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| ||||||||||| || || |||||||| ||||||||||| || ||||| |||||| Sbjct: 241 taccttactggtgagtttccaggtgactatggctgggacactgctgggctttcggctgac 300 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 |||||||| |||||||||||||| || || || |||||||| | | ||||||||||||| Sbjct: 301 cctgagacttttgccaagaaccgtgaacttgaagtgatccactccagatgggccatgct 359
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 375 gccatgctcg 384
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 313 gccatgctcg 322
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 375 gccatgctcg 384
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 375 gccatgctcg 384
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 95437 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 95496 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 95497 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 95556 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 95557 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 95616 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 95617 gccatgctcg 95626 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 93868 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 93809 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 93808 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 93749 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 93748 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 93689 Query: 378 atgctcg 384 ||||||| Sbjct: 93688 atgctcg 93682
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Minus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 78765 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 78706 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 78705 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 78646 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 78645 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 78586 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 78585 gccatgctcg 78576 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 80334 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 80393 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 80394 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 80453 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 80454 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 80513 Query: 378 atgctcg 384 ||||||| Sbjct: 80514 atgctcg 80520
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 375 gccatgctcg 384
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 375 gccatgctcg 384
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 107 bits (54), Expect = 3e-20 Identities = 150/182 (82%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||| ||| |||| ||||| ||| | |||||| |||| |||||| |||| Sbjct: 263 agcccatggtatggtcctgatcgtgtcaagtacttgggcccattctctggtgaggcccca 322 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||| | ||||||||||||||||| |||||||| ||||| ||||| ||||||||||| Sbjct: 323 agctacttgactggtgagttccctggtgactatggatgggatactgctggactttcagcc 382 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| | || || |||||||||||| | |||||||| ||||| || ||||| ||||| Sbjct: 383 gacccagcaactttcgccaagaaccggaaactggaggtaatccactgtagatggaccatg 442 Query: 381 ct 382 || Sbjct: 443 ct 444
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 433 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 492 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 493 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 552 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 553 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 612 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 613 gccatgctcg 622
>emb|X16536.1|GMCAB5 G.max DNA for Cab5 Length = 1467 Score = 107 bits (54), Expect = 3e-20 Identities = 149/180 (82%), Gaps = 3/180 (1%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 |||||||||||||| | |||||||| ||| | |||||| |||| ||||||||| Sbjct: 466 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccc--- 522 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 | ||||||||||||||| ||||| || |||||||| ||||||||||| || ||||| ||| Sbjct: 523 atctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 582 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| |||||||||||||||||||| || || || || ||||| | | ||||||||||| Sbjct: 583 gacccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatg 642
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 107 bits (54), Expect = 3e-20 Identities = 156/190 (82%) Strand = Plus / Plus Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254 |||||||||||||||||||| | ||||| || ||| | || ||| ||||||||||| Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192 Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314 || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252 Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374 || || || || |||||||| || | |||||| ||||| || || ||||| || ||||| Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312 Query: 375 gccatgctcg 384 |||||||||| Sbjct: 313 gccatgctcg 322
>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3659 Score = 107 bits (54), Expect = 3e-20 Identities = 123/146 (84%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| ||||||||||| | || |||||| | || |||| |||||||| || |||||| Sbjct: 311 ggcccattctccggtgagtctccaagctacttgaccagtgaattccctggtgattatggg 370 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||| ||||| ||||||||||| || || || ||||||||||||||||| || || ||| Sbjct: 371 tgggatactgctggactttcagcagatccagaaacctttgccaagaaccgtgaactcgag 430 Query: 357 gtgatccattgccgatgggccatgct 382 |||||||| ||| ||||||| ||||| Sbjct: 431 gtgatccactgcagatgggctatgct 456
>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein Length = 1656 Score = 105 bits (53), Expect = 1e-19 Identities = 98/113 (86%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 ||||||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 715 actggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaa 774 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| |||||||| ||||| |||||||| || || ||||||| ||||| Sbjct: 775 acttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgct 827
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 105 bits (53), Expect = 1e-19 Identities = 95/109 (87%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| ||||| || || || ||||| |||||||| Sbjct: 950 gagttccccggcgactacgggtgggacacggccggcctctccgccgacccggagaccttc 1009 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 ||||||||||| ||||||||||| ||||| |||| ||||||||||||| Sbjct: 1010 gccaagaaccgcgagctggaggtcatccacagccggtgggccatgctcg 1058
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 105 bits (53), Expect = 1e-19 Identities = 122/145 (84%) Strand = Plus / Plus Query: 238 gcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggt 297 ||||| |||| |||||||| || |||||| || || ||||||||||| ||||| || | Sbjct: 1 gcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggtt 60 Query: 298 gggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggagg 357 |||||||||| |||||||||||||| || |||||||| ||||||||||| ||| |||| | Sbjct: 61 gggacactgctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaag 120 Query: 358 tgatccattgccgatgggccatgct 382 ||||||| | | |||||||||||| Sbjct: 121 tgatccactccacatgggccatgct 145
>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3102 Score = 105 bits (53), Expect = 1e-19 Identities = 98/113 (86%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 ||||||||||||||||| || ||||||||||||||||| |||||||||||||| || || Sbjct: 2118 actggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaa 2177 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| |||||||| ||||| |||||||| || || ||||||| ||||| Sbjct: 2178 acttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgct 2230
>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence Length = 958 Score = 103 bits (52), Expect = 4e-19 Identities = 151/184 (82%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| || |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 181 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 240 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| || ||||| || || |||||||| || || |||||||||| Sbjct: 241 caagctacttgaccggtgaatttcctggtgattacgggtgggataccgctggactttcag 300 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||| || |||||||||||||| || || ||||||||||| ||| ||||||| | Sbjct: 301 cagaccctgaaacttttgccaagaaccgtgaacttgaggtgatccactgcagatgggcta 360 Query: 379 tgct 382 |||| Sbjct: 361 tgct 364
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 103 bits (52), Expect = 4e-19 Identities = 148/180 (82%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||||||| ||||||| || | ||| | || ||||| ||||||||||| || Sbjct: 333 agcccatggtacggtcctgaccgagttttgtacttgggtccactttccggtgagccacca 392 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||| | || |||||||||||||| |||||||| ||||||||||| ||||| |||||| Sbjct: 393 tcttacttgaccggtgagttccctggtgactatggttgggacactgctggactctcagct 452 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 || || ||||||||||| | |||||| ||||| || || || || ||| ||||||||||| Sbjct: 453 gatcccgagacctttgctaggaaccgtgagctcgaagtcattcactgcagatgggccatg 512
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 3111 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 3052 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 3051 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 2992 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 2991 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 2932 Query: 378 atgctcg 384 ||||||| Sbjct: 2931 atgctcg 2925
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 3150 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 3091 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 3090 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 3031 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 3030 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 2971 Query: 378 atgctcg 384 ||||||| Sbjct: 2970 atgctcg 2964
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367 Query: 378 atgctcg 384 ||||||| Sbjct: 368 atgctcg 374
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367 Query: 378 atgctcg 384 ||||||| Sbjct: 368 atgctcg 374
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312 Query: 378 atgctcg 384 ||||||| Sbjct: 313 atgctcg 319
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367 Query: 378 atgctcg 384 ||||||| Sbjct: 368 atgctcg 374
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312 Query: 378 atgctcg 384 ||||||| Sbjct: 313 atgctcg 319
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312 Query: 378 atgctcg 384 ||||||| Sbjct: 313 atgctcg 319
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312 Query: 378 atgctcg 384 ||||||| Sbjct: 313 atgctcg 319
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363 Query: 378 atgctcg 384 ||||||| Sbjct: 364 atgctcg 370
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363 Query: 378 atgctcg 384 ||||||| Sbjct: 364 atgctcg 370
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363 Query: 378 atgctcg 384 ||||||| Sbjct: 364 atgctcg 370
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363 Query: 378 atgctcg 384 ||||||| Sbjct: 364 atgctcg 370
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363 Query: 378 atgctcg 384 ||||||| Sbjct: 364 atgctcg 370
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363 Query: 378 atgctcg 384 ||||||| Sbjct: 364 atgctcg 370
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 165 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 224 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 284 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 285 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 344 Query: 378 atgctcg 384 ||||||| Sbjct: 345 atgctcg 351
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 168 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 227 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 288 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 347 Query: 378 atgctcg 384 ||||||| Sbjct: 348 atgctcg 354
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 101 bits (51), Expect = 2e-18 Identities = 153/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 433 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 492 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 493 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 552 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 553 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 612 Query: 378 atgctcg 384 ||||||| Sbjct: 613 atgctcg 619
>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b binding protein (Lhcb-Pp1) gene, complete cds Length = 1912 Score = 101 bits (51), Expect = 2e-18 Identities = 102/119 (85%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||||||||| || |||||||| || || || ||||||||||| || || ||||||||| Sbjct: 543 tacctcactggagaattccctggtgattacggttgggacactgctgggctctcagctgac 602 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || |||||||||||||||||||| ||||| || || ||||||| ||||||||||||| Sbjct: 603 ccagagacctttgccaagaaccgtgagcttgaagttatccattcaagatgggccatgct 661
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 101 bits (51), Expect = 2e-18 Identities = 156/191 (81%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| || ||||||||||| ||| |||||||||| ||| | || ||| |||| || Sbjct: 338 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggtccattctctggg 397 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||| |||| |||||| | || |||||||| ||||| || || || ||||||||||| ||| Sbjct: 398 gagtccccaagctacttgaccggtgagtttcctggtgattacggatgggacactgctgga 457 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 371 ||||||||||||||||| || || || |||||||| ||| ||||||| || ||||| || Sbjct: 458 ctttcagctgaccctgaaacattcgctaagaaccgtgagttggaggttattcattgtaga 517 Query: 372 tgggccatgct 382 ||||||||||| Sbjct: 518 tgggccatgct 528
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 99.6 bits (50), Expect = 6e-18 Identities = 164/202 (81%) Strand = Plus / Plus Query: 183 aagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggccca 242 |||||||| ||||| || |||||||||||||| | ||||| || ||| | |||||| Sbjct: 365 aagcaggtctcctcaggaagcccatggtacggcccagaccgagtcaagtacttgggccca 424 Query: 243 ctctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggac 302 |||| || ||||||||| |||||| || ||||||||||| |||||||| || |||||| Sbjct: 425 ttctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggctgggac 484 Query: 303 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 362 ||||| || ||||| || ||||| || ||||| ||||||||||| || || || |||||| Sbjct: 485 actgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaagtgatc 544 Query: 363 cattgccgatgggccatgctcg 384 || | | | ||||||||||||| Sbjct: 545 cactccaggtgggccatgctcg 566
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 97.6 bits (49), Expect = 3e-17 Identities = 118/141 (83%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||| ||||| ||||||||||| || || |||||||| || |||||||| ||||||| Sbjct: 13 tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 | ||||| || || ||||| || |||||||| |||| |||||| ||||| || || |||| Sbjct: 73 ccgccggtctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatcc 132 Query: 364 attgccgatgggccatgctcg 384 | || ||||||||||||||| Sbjct: 133 acagcagatgggccatgctcg 153
>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein Length = 1746 Score = 97.6 bits (49), Expect = 3e-17 Identities = 88/101 (87%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| || ||||| |||||||| ||||| |||||||| ||||| ||| | ||||||||| Sbjct: 745 tacctgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgac 804 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatcca 364 || ||||| |||||||||||||| ||||| ||||||||||| Sbjct: 805 ccagagacatttgccaagaaccgtgagcttgaggtgatcca 845
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 97.6 bits (49), Expect = 3e-17 Identities = 118/141 (83%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||| |||||||| |||||||| ||||| |||||||| || |||||||| ||||||| Sbjct: 1757 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1816 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 | || || || ||||||||||| ||||| || || | ||||| ||||| || || |||| Sbjct: 1817 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1876 Query: 364 attgccgatgggccatgctcg 384 | ||| ||||||||||||||| Sbjct: 1877 actgcagatgggccatgctcg 1897
>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein (Lhcb-Pp2) mRNA, complete cds Length = 955 Score = 97.6 bits (49), Expect = 3e-17 Identities = 97/113 (85%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 |||||||| |||||||| ||||| || ||||||||||| ||||| || || ||||||||| Sbjct: 208 actggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctgag 267 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| || ||| | ||||| ||||||||||| |||||||||||||||| Sbjct: 268 acatttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgct 320
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 97.6 bits (49), Expect = 3e-17 Identities = 88/101 (87%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| ||||||||||| |||| |||||||||||||| ||||| || |||||||| Sbjct: 227 ggcccattctccggtgaggccccatcttacctcactggtgaattcccaggtgactatggt 286 Query: 297 tgggacactgccggactttcagctgaccctgagacctttgc 337 |||||||||||||| ||||| |||||||||||||| ||||| Sbjct: 287 tgggacactgccgggctttctgctgaccctgagacttttgc 327
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 97.6 bits (49), Expect = 3e-17 Identities = 88/101 (87%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| ||||| ||||||||||| ||||| || ||||||||||| ||||| ||||| ||| Sbjct: 277 taccttactggagagttccctggtgactacggttgggacactgctggactatcagcagac 336 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| || |||||||| ||||| ||||||||||| Sbjct: 337 cctgaaaccttcgctaagaaccgtgagctcgaggtgatcca 377
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 97.6 bits (49), Expect = 3e-17 Identities = 118/141 (83%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||| |||||||| |||||||| ||||| |||||||| || |||||||| ||||||| Sbjct: 1758 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1817 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 | || || || ||||||||||| ||||| || || | ||||| ||||| || || |||| Sbjct: 1818 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1877 Query: 364 attgccgatgggccatgctcg 384 | ||| ||||||||||||||| Sbjct: 1878 actgcagatgggccatgctcg 1898
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 97.6 bits (49), Expect = 3e-17 Identities = 142/173 (82%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 |||||||||||||| |||||||| | ||||| || ||||| ||||| ||||||| Sbjct: 527 tcctccggcagcccctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggc 586 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||| | ||| |||||| || || |||||| | |||||||| || |||||||| ||||| Sbjct: 587 gaggcgccgtcctacctgaccggcgagttcgccggcgactacggctgggacaccgccggg 646 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 || || || ||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 647 ctctcggccgaccccgagaccttcgccaagaaccgggagctggaggtgatcca 699
>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding protein b, partial cds Length = 461 Score = 97.6 bits (49), Expect = 3e-17 Identities = 82/93 (88%) Strand = Plus / Plus Query: 288 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 347 ||||| |||||||||||||| || |||||||||||||| || |||||||| |||||||| Sbjct: 1 gactacgggtgggacactgctgggctttcagctgacccggaaacctttgctaagaaccgt 60 Query: 348 gagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || || ||||||||||||||| Sbjct: 61 gagcttgaggtcattcactgccgatgggccatg 93
>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene, complete cds; nuclear gene for chloroplast product Length = 1322 Score = 95.6 bits (48), Expect = 1e-16 Identities = 90/104 (86%) Strand = Plus / Plus Query: 279 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 338 ||||| || ||||| || ||||||||||| ||||| ||||||||||| || ||||| ||| Sbjct: 532 ttccccggtgactacggatgggacactgctggactatcagctgacccggaaaccttcgcc 591 Query: 339 aagaaccgggagctggaggtgatccattgccgatgggccatgct 382 | ||||||||||||||||||||| || || ||||||||||||| Sbjct: 592 aggaaccgggagctggaggtgattcacagcagatgggccatgct 635
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 95.6 bits (48), Expect = 1e-16 Identities = 135/164 (82%) Strand = Plus / Plus Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260 ||||||||||||||| | ||||||||| ||| | || ||| |||| |||||||||||| Sbjct: 156 agcccatggtacggtccagaccgtgtgaagtacttagggccattctctggtgagcccccg 215 Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 ||| | ||||| |||||||| || |||||||| ||||||||||| || ||||| ||| Sbjct: 216 tcgtacttgactggagagttcccaggtgactatggttgggacactgctgggctttctgct 275 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||||| ||||| ||||| || ||||| || |||||||| ||||| Sbjct: 276 gacccagagacatttgcgaaaaaccgtgaactggaggtaatcca 319
>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA Length = 1152 Score = 95.6 bits (48), Expect = 1e-16 Identities = 90/104 (86%) Strand = Plus / Plus Query: 279 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 338 |||||||| |||||||| ||||||||||| ||||||||||| ||||| || ||||||||| Sbjct: 383 ttccctggtgactatggttgggacactgctggactttcagcagacccagaaacctttgcc 442 Query: 339 aagaaccgggagctggaggtgatccattgccgatgggccatgct 382 | ||||| ||||| ||||||||||| || | ||||||||||| Sbjct: 443 agaaaccgtgagcttgaggtgatccacagcaggtgggccatgct 486
>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds Length = 1253 Score = 95.6 bits (48), Expect = 1e-16 Identities = 150/184 (81%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 ||||||||||||| || |||||||||| ||| | |||||| |||| |||||| ||| Sbjct: 327 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 386 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||| | || ||||| || ||||| || || |||||||| || || |||||||||| Sbjct: 387 caagctacttgaccggtgaatttcctggtgattacgggtgggataccgctggactttcag 446 Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378 | |||||||| || |||||||||||||| || || || |||||||| ||| ||||||| | Sbjct: 447 cagaccctgaaacttttgccaagaaccgtgaacttgaagtgatccactgcagatgggcta 506 Query: 379 tgct 382 |||| Sbjct: 507 tgct 510
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 93.7 bits (47), Expect = 4e-16 Identities = 152/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 175 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 234 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 235 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 294 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| || ||||| |||| |||||| ||||| || || ||||| || |||||||| Sbjct: 295 gccgacccagaaaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 354 Query: 378 atgctcg 384 ||||||| Sbjct: 355 atgctcg 361
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 93.7 bits (47), Expect = 4e-16 Identities = 152/187 (81%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| ||| ||| | || ||| ||||||| |||||| Sbjct: 168 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 227 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| || ||||| |||| |||||| |||| || || ||||| || |||||||| Sbjct: 288 gccgacccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggcc 347 Query: 378 atgctcg 384 ||||||| Sbjct: 348 atgctcg 354
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 93.7 bits (47), Expect = 4e-16 Identities = 152/187 (81%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| ||||||| || ||| | || ||| ||||||| |||||| Sbjct: 751 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 692 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || Sbjct: 691 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 632 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 || ||||| |||||||| |||| | |||| ||||| || || ||||| || |||||||| Sbjct: 631 gccgacccagagaccttcgccagggaccgtgagctagaagttatccacagcagatgggcc 572 Query: 378 atgctcg 384 ||||||| Sbjct: 571 atgctcg 565
>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein (CipLhcb2) mRNA, complete cds; nuclear gene for chloroplast product Length = 1033 Score = 93.7 bits (47), Expect = 4e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| || ||||| |||||||| ||||| || |||||||| || ||| | ||||||||| Sbjct: 258 tacctgaccggtgaattccctggtgactacggatgggacacagctggattatcagctgac 317 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||||||| |||||| ||| |||||||||| || || ||||||||||||| Sbjct: 318 cctgaaacctttgccaggaaccgtgagttggaggtgattcacagcagatgggccatgct 376
>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a, complete sequence Length = 48924 Score = 93.7 bits (47), Expect = 4e-16 Identities = 101/119 (84%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| |||||||| |||||||| ||||| || |||||||| || ||| | ||||||||| Sbjct: 40107 tacctgactggtgaattccctggtgactacggatgggacacagctggattatcagctgac 40166 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || || ||||| ||||||||||| ||||| |||||||| || || ||||||||||||| Sbjct: 40167 cccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgct 40225
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 91.7 bits (46), Expect = 2e-15 Identities = 112/134 (83%) Strand = Plus / Plus Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290 ||||||||||| ||||||| ||| |||| |||||||| || |||||| | |||||| Sbjct: 80 tacctcggccccttctccggcgaggccccctcatacctcaccggcgagttcgccggcgac 139 Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350 || || |||||||| ||||| || || || ||||| |||||||| ||||||||||| ||| Sbjct: 140 tacggctgggacaccgccgggctctccgccgaccccgagaccttcgccaagaaccgcgag 199 Query: 351 ctggaggtgatcca 364 |||||||||||||| Sbjct: 200 ctggaggtgatcca 213
>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni Length = 312 Score = 91.7 bits (46), Expect = 2e-15 Identities = 70/78 (89%) Strand = Plus / Plus Query: 193 cctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtg 252 ||||| ||||||| |||||||| | ||||| ||||||||||||||||| |||||||| | Sbjct: 172 cctccagcagcccgtggtacggccccgaccgcgtgctctacctcggcccgctctccggcg 231 Query: 253 agcccccgagctacctca 270 |||||||||||||||||| Sbjct: 232 agcccccgagctacctca 249 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 154 tcaccatgcgcaagaccgcagcaaaggc 181 ||||||||||||||||||| || ||||| Sbjct: 139 tcaccatgcgcaagaccgcggccaaggc 166
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 91.7 bits (46), Expect = 2e-15 Identities = 97/114 (85%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| || ||||| || || || ||||| || ||||||||||| || ||||| ||||| Sbjct: 219 ctaccttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctga 278 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggc 376 ||||||||| ||| | |||||||| ||||| |||||||| |||||||||||||| Sbjct: 279 ccctgagacttttactaagaaccgtgagctcgaggtgattcattgccgatgggc 332
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 91.7 bits (46), Expect = 2e-15 Identities = 127/154 (82%) Strand = Plus / Plus Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258 |||||||||||||||| | |||||||| ||| | |||||| ||||||||||| || Sbjct: 192 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgagagcc 251 Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318 | |||||||| |||||||||||||| ||||| || ||||||||||| || ||||||| Sbjct: 252 catcatacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcag 311 Query: 319 ctgaccctgagacctttgccaagaaccgggagct 352 ||||||| || ||||| || |||||||| ||||| Sbjct: 312 ctgacccagaaaccttcgctaagaaccgtgagct 345
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 89.7 bits (45), Expect = 6e-15 Identities = 132/161 (81%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| || |||||||||||||| | |||||||| ||| | |||||| |||| ||| Sbjct: 185 tcctctggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 244 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||||||||| ||| | ||||| |||||||| || ||||| || ||||||||||| ||| Sbjct: 245 gagcccccgtcttacttgactggagagttcccaggtgactacggttgggacactgctgga 304 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagct 352 ||||| |||||||| ||||| || ||||||||||| ||||| Sbjct: 305 ctttctgctgacccagagacattcgccaagaaccgtgagct 345
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 89.7 bits (45), Expect = 6e-15 Identities = 144/177 (81%) Strand = Plus / Plus Query: 188 ggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctc 247 ||||||||| || |||||||||||||| | ||||||||| ||||| |||||| |||| Sbjct: 179 ggtttcctctggaagcccatggtacggcccagaccgtgtgaagtacctgggcccattctc 238 Query: 248 cggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgc 307 |||||| | || ||||| || || || ||||| || |||||||||||||||||||| Sbjct: 239 gggtgaggctccttcttacctgacgggggaattcccaggtgactatgggtgggacactgc 298 Query: 308 cggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||| ||||| |||||||| ||||| ||||| |||||| || ||||| |||||||| Sbjct: 299 cgggctttcggctgacccggagacatttgctcggaaccgtgaactggaagtgatcca 355
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 87.7 bits (44), Expect = 2e-14 Identities = 83/96 (86%) Strand = Plus / Plus Query: 285 ggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaac 344 |||||||| ||||||||||| ||||| || || || |||||||||||||| ||||| ||| Sbjct: 300 ggcgactacgggtgggacaccgccgggctctctgccgaccctgagaccttcgccaaaaac 359 Query: 345 cgggagctggaggtgatccattgccgatgggccatg 380 | ||||||||||||||||| || ||||||||||| Sbjct: 360 agagagctggaggtgatccacagcagatgggccatg 395
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 85.7 bits (43), Expect = 1e-13 Identities = 127/155 (81%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| || |||||||||||||| | |||||||| ||| | |||||| |||| ||| Sbjct: 184 tcctcaggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 243 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||||||||| ||| | ||||| |||||||| || ||||| || ||||||||||| ||| Sbjct: 244 gagcccccgtcttacttgactggagagttcccaggtgactacggatgggacactgctgga 303 Query: 312 ctttcagctgaccctgagacctttgccaagaaccg 346 ||||| |||||||| ||||| || ||||||||||| Sbjct: 304 ctttctgctgacccagagacattcgccaagaaccg 338
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 85.7 bits (43), Expect = 1e-13 Identities = 100/119 (84%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||||||||||||||| || || || || || ||||||||||| || ||||| ||||| Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| || ||||||||||| ||||| |||||||| || || ||||||||||||| Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgct 346
>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein (LHCP), complete cds Length = 905 Score = 85.7 bits (43), Expect = 1e-13 Identities = 145/179 (81%) Strand = Plus / Plus Query: 204 ccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagc 263 ||||||||||| |||||||||| ||||| |||||| ||||||| ||| | || Sbjct: 189 ccatggtacggccctgaccgtgtcaagtacctaggcccattctccggcgaggctccatca 248 Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| || ||||| ||||| || ||||| || |||||||| ||||||||||| ||||| Sbjct: 249 tacctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgat 308 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || ||||| ||| |||||||||| ||||| ||||| ||||| ||| ||||||| ||||| Sbjct: 309 ccagagacattttccaagaaccgtgagcttgaggtcatccactgcagatgggcaatgct 367
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 83.8 bits (42), Expect = 4e-13 Identities = 162/202 (80%) Strand = Plus / Plus Query: 183 aagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggccca 242 ||||||| |||||||| |||||||||||||| | ||||| || ||| | |||||| Sbjct: 146 aagcaggcctcctccggaagcccatggtacggcccagaccgcgtcaagtacttgggccca 205 Query: 243 ctctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggac 302 |||| || ||||||||| |||||||||||| |||||||| || ||||| || |||||| Sbjct: 206 ttctctggcgagcccccgtcctacctcactggcgagttcccaggtgactacggctgggac 265 Query: 303 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 362 ||||| || ||||| || ||||| || ||||| |||| |||| ||||| || |||||| Sbjct: 266 actgctgggctttcggccgacccagaaaccttcgccagaaaccctgagctcgaagtgatc 325 Query: 363 cattgccgatgggccatgctcg 384 || | | | ||||||||||||| Sbjct: 326 cactccaggtgggccatgctcg 347
>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein, complete cds Length = 895 Score = 83.8 bits (42), Expect = 4e-13 Identities = 75/86 (87%) Strand = Plus / Plus Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356 ||||||||||| ||||| ||||||||||| ||||| ||||| | ||||| ||||| ||| Sbjct: 293 tgggacactgctggactctcagctgaccccgagacatttgctagaaaccgtgagcttgag 352 Query: 357 gtgatccattgccgatgggccatgct 382 ||||| |||||||| ||||||||||| Sbjct: 353 gtgattcattgccgttgggccatgct 378
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 81.8 bits (41), Expect = 2e-12 Identities = 116/141 (82%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||| ||||| |||||||||||||| || |||||||| || ||||| || ||||||| Sbjct: 13 tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 | || || || || |||||||| ||||| ||||| | |||||| ||||| || || |||| Sbjct: 73 cagctggcctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatcc 132 Query: 364 attgccgatgggccatgctcg 384 | || | ||||||||||||| Sbjct: 133 acagcaggtgggccatgctcg 153
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 81.8 bits (41), Expect = 2e-12 Identities = 116/141 (82%) Strand = Plus / Plus Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303 ||||||| ||||||||||||||||| || ||||||||||| || ||||| || ||||||| Sbjct: 209 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 268 Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363 | || | || || || ||||| |||||||| |||| |||||| ||||| || || |||| Sbjct: 269 ccgcttgtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 328 Query: 364 attgccgatgggccatgctcg 384 | || || |||||||||||| Sbjct: 329 acagcagaagggccatgctcg 349
>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding protein Length = 2236 Score = 81.8 bits (41), Expect = 2e-12 Identities = 131/161 (81%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| || |||||||||||||| | |||||||| ||| | |||||| |||||||| Sbjct: 1449 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 1508 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||| | ||| |||| | ||||| |||||||| || ||||| || ||||||||||||||| Sbjct: 1509 gagtctccgtcctacttgactggagagttccccggtgactacggttgggacactgccgga 1568 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagct 352 || || |||||||| ||||| || |||||||||| ||||| Sbjct: 1569 ctctctgctgacccagagacattctccaagaaccgtgagct 1609
>gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA Length = 454 Score = 81.8 bits (41), Expect = 2e-12 Identities = 78/89 (87%), Gaps = 1/89 (1%) Strand = Plus / Plus Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296 |||||| ||||||||||||||||| ||||||||||||||||||||| || ||||| | Sbjct: 265 ggcccattctccggtgagcccccgtcctacctcactggtgagttcccaggtgacta-cgc 323 Query: 297 tgggacactgccggactttcagctgaccc 325 ||||||||||| || ||||| |||||||| Sbjct: 324 tgggacactgctgggctttccgctgaccc 352
>emb|X61915.1|PTCABP P.thunbergii cab gene Length = 5419 Score = 79.8 bits (40), Expect = 6e-12 Identities = 82/96 (85%) Strand = Plus / Plus Query: 285 ggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaac 344 |||||||| ||||||||||||||||| || || || || || |||||||| || || ||| Sbjct: 2494 ggcgactacgggtgggacactgccggcctctcggcggatccagagaccttcgcaaaaaac 2553 Query: 345 cgggagctggaggtgatccattgccgatgggccatg 380 | ||||||||||||||||| ||| ||||||||||| Sbjct: 2554 agagagctggaggtgatccactgcagatgggccatg 2589
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384 Query: 378 atgctcg 384 ||||||| Sbjct: 385 atgctcg 391
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 77.8 bits (39), Expect = 2e-11 Identities = 72/83 (86%) Strand = Plus / Plus Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| Sbjct: 186 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 245 Query: 312 ctttcagctgaccctgagacctt 334 || || |||||||| |||||||| Sbjct: 246 ctgtccgctgacccggagacctt 268
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 139 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 198 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318 Query: 378 atgctcg 384 ||||||| Sbjct: 319 atgctcg 325
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384 Query: 378 atgctcg 384 ||||||| Sbjct: 385 atgctcg 391
>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin Length = 2336 Score = 77.8 bits (39), Expect = 2e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| Sbjct: 236 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggc 177 Query: 312 ctttcagctgaccctgagacctt 334 || || |||||||| |||||||| Sbjct: 176 ctgtccgctgacccggagacctt 154
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 77.8 bits (39), Expect = 2e-11 Identities = 72/83 (86%) Strand = Plus / Plus Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| Sbjct: 184 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 243 Query: 312 ctttcagctgaccctgagacctt 334 || || |||||||| |||||||| Sbjct: 244 ctgtccgctgacccggagacctt 266
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384 Query: 378 atgctcg 384 ||||||| Sbjct: 385 atgctcg 391
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384 Query: 378 atgctcg 384 ||||||| Sbjct: 385 atgctcg 391
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384 Query: 378 atgctcg 384 ||||||| Sbjct: 385 atgctcg 391
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 174 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 233 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353 Query: 378 atgctcg 384 ||||||| Sbjct: 354 atgctcg 360
>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 994 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 189 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 248 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368 Query: 378 atgctcg 384 ||||||| Sbjct: 369 atgctcg 375
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 85 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 144 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264 Query: 378 atgctcg 384 ||||||| Sbjct: 265 atgctcg 271
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 77.8 bits (39), Expect = 2e-11 Identities = 150/187 (80%) Strand = Plus / Minus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 16776 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 16717 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 |||||||| ||||| || || | |||||| || || || || ||||| || | |||||| Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597 Query: 378 atgctcg 384 ||||||| Sbjct: 16596 atgctcg 16590 Score = 61.9 bits (31), Expect = 1e-06 Identities = 79/95 (83%) Strand = Plus / Plus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| || ||||||||| Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996 Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352 ||||| || ||||| || || | |||||| ||||| Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgtgagct 22031 Score = 56.0 bits (28), Expect = 9e-05 Identities = 100/124 (80%) Strand = Plus / Plus Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320 |||||||| || || ||||||||||| ||||| || |||||||| || || || || ||| Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353 Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380 ||||| ||||| || || | |||||| ||||| || || ||||| || | ||||||||| Sbjct: 19354 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 19413 Query: 381 ctcg 384 |||| Sbjct: 19414 ctcg 19417
>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA, partial cds Length = 642 Score = 77.8 bits (39), Expect = 2e-11 Identities = 99/119 (83%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| || ||||| ||||| || || || || ||||||||||| ||||| ||||||||| Sbjct: 226 taccttacaggtgaattccccggtgattacggttgggacactgctggactctcagctgac 285 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || || || || || |||||||| ||||| ||||||||||| ||| ||||||| ||||| Sbjct: 286 ccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatgct 344
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 77.8 bits (39), Expect = 2e-11 Identities = 72/83 (86%) Strand = Plus / Plus Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| Sbjct: 170 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 229 Query: 312 ctttcagctgaccctgagacctt 334 || || |||||||| |||||||| Sbjct: 230 ctgtccgctgacccggagacctt 252
>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 763 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagacg 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 |||||||||||| | |||||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 340
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| |||||||||||||| || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340
>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340
>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340
>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 762 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 277 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 336 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 337 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 386
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 75.8 bits (38), Expect = 9e-11 Identities = 110/134 (82%) Strand = Plus / Plus Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257 ||||||||||||||||| |||||||||| ||| | || ||| |||| || || | Sbjct: 356 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 415 Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| |||||||||||| Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475 Query: 318 gctgaccctgagac 331 |||||||| ||||| Sbjct: 476 gctgaccccgagac 489
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1050 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 265 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagacg 324 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 |||||||||||| | |||||||| |||||||| |||| ||||| ||||| Sbjct: 325 tttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 374
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1062 Score = 75.8 bits (38), Expect = 9e-11 Identities = 92/110 (83%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 262 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagacg 321 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 |||||||||||| | |||||||| |||||||| |||| ||||| ||||| Sbjct: 322 tttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 371
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 75.8 bits (38), Expect = 9e-11 Identities = 86/102 (84%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| || || |||||||| || ||||| ||||||||||| ||||| || || || Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||| |||||||| ||||||||||| ||||||||||||||||| Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatcca 479
>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll a/b-binding protein (polypeptide 15) complex precursor, complete coding sequence Length = 1993 Score = 75.8 bits (38), Expect = 9e-11 Identities = 131/162 (80%) Strand = Plus / Plus Query: 191 ttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccgg 250 |||||| || |||||||||||||| | |||||||| ||| | |||||| ||||||| Sbjct: 1151 ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 1210 Query: 251 tgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgg 310 |||| | || |||| | ||||| |||||||| || ||||| || |||||||||||||| Sbjct: 1211 tgagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgg 1270 Query: 311 actttcagctgaccctgagacctttgccaagaaccgggagct 352 ||| || |||||||| ||||| || |||||||||| ||||| Sbjct: 1271 actctctgctgacccagagacattctccaagaaccgtgagct 1312
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 73.8 bits (37), Expect = 4e-10 Identities = 130/161 (80%) Strand = Plus / Plus Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251 ||||| || |||||||||||||| | |||||||| ||| | |||||| |||||||| Sbjct: 133 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 192 Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311 ||| | || |||| | ||||| |||||||| || ||||| || ||||||||||||||| Sbjct: 193 gagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgga 252 Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagct 352 || || |||||||| ||||| || |||||||||| ||||| Sbjct: 253 ctctctgctgacccagagacattctccaagaaccgtgagct 293
>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA Length = 699 Score = 73.8 bits (37), Expect = 4e-10 Identities = 67/77 (87%) Strand = Plus / Plus Query: 300 gacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtg 359 |||||||| ||||| |||||||||||||| || ||||| |||||||| ||| |||| ||| Sbjct: 1 gacactgctggactgtcagctgaccctgaaacttttgctaagaaccgtgagttggaagtg 60 Query: 360 atccattgccgatgggc 376 ||||| ||| ||||||| Sbjct: 61 atccactgcagatgggc 77
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 73.8 bits (37), Expect = 4e-10 Identities = 79/93 (84%) Strand = Plus / Plus Query: 288 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 347 ||||| ||||||||||| ||||| || || || ||||| |||||||| ||||| || | Sbjct: 18 gactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaaaaataga 77 Query: 348 gagctggaggtgatccattgccgatgggccatg 380 ||||||||||||||||| ||| ||||||||||| Sbjct: 78 gagctggaggtgatccactgcagatgggccatg 110
>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein mRNA, complete sequence; nuclear gene for chloroplast product Length = 643 Score = 73.8 bits (37), Expect = 4e-10 Identities = 100/121 (82%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| || |||| |||||| || ||||| || ||||||||||| || || || ||||| Sbjct: 33 tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 383 ||||| || || ||||||||||| ||||| ||||| ||||| || |||||||||||||| Sbjct: 93 cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgctc 152 Query: 384 g 384 | Sbjct: 153 g 153
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 73.8 bits (37), Expect = 4e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| || ||||||||||| || || || || ||||| ||||| || Sbjct: 265 gagttccccggcgactacggatgggacactgctgggctgtcggcggacccagagactttc 324 Query: 336 gccaagaaccgggagctggaggtgatcca 364 |||| |||||| ||||||||||||||||| Sbjct: 325 gccaggaaccgtgagctggaggtgatcca 353
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m9 (Lhcbm9) mRNA, complete cds Length = 1221 Score = 71.9 bits (36), Expect = 1e-09 Identities = 63/72 (87%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| ||||| |||||||| |||||||| || |||||||||||||| || || ||||| Sbjct: 196 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 255 Query: 323 ccctgagacctt 334 ||| |||||||| Sbjct: 256 cccggagacctt 267
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 759 Score = 71.9 bits (36), Expect = 1e-09 Identities = 91/110 (82%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 220 ggtgagttcccgggtgactacgggtgggacacwgcggggctttcggcggatccggagact 279 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| ||||| ||||| ||||| Sbjct: 280 tttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 71.9 bits (36), Expect = 1e-09 Identities = 63/72 (87%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| ||||| |||||||| |||||||| || |||||||||||||| || || ||||| Sbjct: 201 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 260 Query: 323 ccctgagacctt 334 ||| |||||||| Sbjct: 261 cccggagacctt 272
>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA, partial cds; nuclear gene for chloroplast product Length = 732 Score = 69.9 bits (35), Expect = 6e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| |||||||| ||||| || || ||||| ||||||||||| || | || || || Sbjct: 136 taccttactggtgaattccccggtgattatggatgggacactgctggtttatctgcagat 195 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| || |||||||||||||| ||||| || |||||||| ||| ||||||| ||||| Sbjct: 196 cctgaaacatttgccaagaaccgtgagcttgaagtgatccactgcagatgggctatgct 254
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 69.9 bits (35), Expect = 6e-09 Identities = 104/127 (81%) Strand = Plus / Plus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| || ||||||||| Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216 Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377 ||||| || ||||| || || | |||||| ||||| || || ||||| || | |||||| Sbjct: 217 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggcc 276 Query: 378 atgctcg 384 ||||||| Sbjct: 277 atgctcg 283
>gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb2 mRNA, complete cds Length = 798 Score = 67.9 bits (34), Expect = 2e-08 Identities = 76/90 (84%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| |||||||| || ||||| |||||||| |||||||| || ||| | |||||||| Sbjct: 201 ctacctgactggtgaatttcctggtgactatggatgggacacagctggattatcagctga 260 Query: 323 ccctgagacctttgccaagaaccgggagct 352 |||||| || ||||| | |||||| ||||| Sbjct: 261 ccctgaaacatttgcaaggaaccgtgagct 290
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 67.9 bits (34), Expect = 2e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 301 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 360 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| |||| ||||| ||||| Sbjct: 361 tttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 410
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 2e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| |||||||||||||| || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || |||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340
>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 67.9 bits (34), Expect = 2e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 340
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 67.9 bits (34), Expect = 2e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 1379 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 1438 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| |||| ||||| ||||| Sbjct: 1439 tttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 1488
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 67.9 bits (34), Expect = 2e-08 Identities = 91/110 (82%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || |||| Sbjct: 286 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagaat 345 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | |||||||| |||||||| ||||| ||||| ||||| Sbjct: 346 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 395
>emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-binding protein Length = 2368 Score = 67.9 bits (34), Expect = 2e-08 Identities = 76/90 (84%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| |||||||| || ||||| |||||||| |||||||| || ||| | |||||||| Sbjct: 1104 ctacctgactggtgaatttcctggtgactatggatgggacacagctggattatcagctga 1163 Query: 323 ccctgagacctttgccaagaaccgggagct 352 |||||| || ||||| | |||||| ||||| Sbjct: 1164 ccctgaaacatttgcaaggaaccgtgagct 1193
>gb|M64619.1|PEACAB66 Pea cab gene, complete cds Length = 1666 Score = 67.9 bits (34), Expect = 2e-08 Identities = 130/162 (80%) Strand = Plus / Plus Query: 191 ttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccgg 250 |||||| || |||||||||||||| | |||||||| ||| | |||||| ||||||| Sbjct: 850 ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 909 Query: 251 tgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgg 310 |||| | || |||| | || || |||||||| || ||||| || |||||||||||||| Sbjct: 910 tgagtctccatcctacttgacaggagagttccccggtgactacggttgggacactgccgg 969 Query: 311 actttcagctgaccctgagacctttgccaagaaccgggagct 352 ||| || |||||||| ||||| || |||||||||| ||||| Sbjct: 970 actctctgctgacccagagacattctccaagaaccgtgagct 1011
>gb|AF526508.1| Vicia faba A-B binding protein (CHLOR1) mRNA, partial cds; nuclear gene for chloroplast product Length = 412 Score = 65.9 bits (33), Expect = 9e-08 Identities = 75/89 (84%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||| ||||||||||| ||||| || ||||| |||||||| || ||| | ||||||||| Sbjct: 194 taccttactggtgagtttcctggtgattatggatgggacacagctggattatcagctgac 253 Query: 324 cctgagacctttgccaagaaccgggagct 352 ||||| || ||||| | |||||| ||||| Sbjct: 254 cctgaaacatttgcaaggaaccgtgagct 282
>gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlorophyll a/b-binding protein (ChBP) mRNA, complete cds Length = 411 Score = 65.9 bits (33), Expect = 9e-08 Identities = 60/69 (86%) Strand = Plus / Plus Query: 278 gttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgc 337 ||||||||| ||||| || ||||||||||| || || ||||| ||||| || |||||||| Sbjct: 47 gttccctggtgactacggatgggacactgctgggctatcagcagaccccgaaacctttgc 106 Query: 338 caagaaccg 346 ||||||||| Sbjct: 107 caagaaccg 115
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 65.9 bits (33), Expect = 9e-08 Identities = 90/109 (82%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||||||||||||||| || || || || || ||||| ||| | || Sbjct: 274 gagttcccgggcgactatgggtgggacacggcggggctctccgcggacccggaggcgttc 333 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 382
>emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 gene for chlorophyll a/b-binding protein Length = 741 Score = 65.9 bits (33), Expect = 9e-08 Identities = 57/64 (89%), Gaps = 2/64 (3%) Strand = Plus / Plus Query: 1 atctccacactcactcctct--ttgagaacccatacagcggagacttcacttagctttcc 58 |||||||||||||||| ||| ||||||||||||| ||| || ||||| ||||||||||| Sbjct: 678 atctccacactcactcatctccttgagaacccatatagcagacacttcgcttagctttcc 737 Query: 59 aatg 62 |||| Sbjct: 738 aatg 741
>emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20, COMPLETE SEQUENCE Length = 127003 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 |||||||| || ||||| || ||||| |||||||| || ||| | |||||||||||||| Sbjct: 51329 actggtgaatttcctggtgattatggatgggacacagctggattatcagctgaccctgaa 51388 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 |||||||| | |||||| ||||| || || || || || ||||||||||||| Sbjct: 51389 acctttgcaaggaaccgtgagcttgaagtaattcacagcagatgggccatgct 51441
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 65.9 bits (33), Expect = 9e-08 Identities = 78/93 (83%) Strand = Plus / Plus Query: 288 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 347 ||||| ||||||||||| ||||| || || || || || |||||||| ||||| ||| | Sbjct: 169 gactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaaaaacaga 228 Query: 348 gagctggaggtgatccattgccgatgggccatg 380 ||||||||||||||||| | | ||||||||||| Sbjct: 229 gagctggaggtgatccactccagatgggccatg 261
>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide 15) mRNA, clone pAB96 Length = 822 Score = 65.9 bits (33), Expect = 9e-08 Identities = 66/77 (85%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| || ||||| || ||||||||||| |||||||| || || || ||||| ||| Sbjct: 104 gagttcccaggtgactacggttgggacactgctggactttctgccgatccagagacattt 163 Query: 336 gccaagaaccgggagct 352 ||||||||||| ||||| Sbjct: 164 gccaagaaccgtgagct 180
>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3663 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Plus Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329 |||||||| || ||||| || ||||| ||||| ||||| |||||||| || || || || Sbjct: 2759 actggtgaatttcctggtgattatggttgggatactgctggactttcggccgatccagaa 2818 Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 || |||||||| ||||| ||||| ||||| || || ||| ||||||||||||| Sbjct: 2819 acttttgccaaaaaccgtgagctagaggttattcactgcagatgggccatgct 2871
>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b binding protein Length = 978 Score = 63.9 bits (32), Expect = 4e-07 Identities = 80/96 (83%) Strand = Plus / Plus Query: 285 ggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaac 344 |||||||| |||||||||||||||| | || || || || |||||||| || || ||| Sbjct: 275 ggcgactacgggtgggacactgccgccgtctcggcggatccagagaccttcgcaaaaaac 334 Query: 345 cgggagctggaggtgatccattgccgatgggccatg 380 | ||||||||||||||||| ||| ||||||||||| Sbjct: 335 agagagctggaggtgatccactgcagatgggccatg 370
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 63.9 bits (32), Expect = 4e-07 Identities = 98/120 (81%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||||| ||||||||| |||| || || || ||||||||||| ||||| ||| | || Sbjct: 249 ctacctcaacggtgagttcgctggtgattacggctgggacactgctggactctcatccga 308 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||| |||||||| ||| ||||| ||||| ||||||||||| |||||||||||||| Sbjct: 309 ccccgagaccttcgcccgcaaccgcgagctcgaggtgatccacgctcgatgggccatgct 368 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 147 gcccgagtcaccatgcgcaagaccg 171 ||||| ||||||||||||||||||| Sbjct: 139 gcccgcgtcaccatgcgcaagaccg 163
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 61.9 bits (31), Expect = 1e-06 Identities = 79/95 (83%) Strand = Plus / Plus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| || ||||||||| Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311 Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352 ||||| || ||||| || || | |||||| ||||| Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagct 346
>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA, complete cds; nuclear gene for plastid product Length = 1284 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||||||||||||||||||||| ||||| || ||||| ||| |||||||| ||||| Sbjct: 448 ctacctcactggtgagttccctggagactacggatgggatactcagggactttccgctga 507 Query: 323 ccc 325 ||| Sbjct: 508 ccc 510
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 61.9 bits (31), Expect = 1e-06 Identities = 79/95 (83%) Strand = Plus / Plus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| || ||||||||| Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258 Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352 ||||| || ||||| || || | |||||| ||||| Sbjct: 259 gctgatcccgagacattcgcaaggaaccgtgagct 293
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 61.9 bits (31), Expect = 1e-06 Identities = 79/95 (83%) Strand = Plus / Plus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| || ||||||||| Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311 Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352 ||||| || ||||| || || | |||||| ||||| Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagct 346
>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA, complete cds Length = 1191 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||||||||||||||||||||| ||||| || ||||| ||| |||||||| ||||| Sbjct: 443 ctacctcactggtgagttccctggagactacggatgggatactcagggactttccgctga 502 Query: 323 ccc 325 ||| Sbjct: 503 ccc 505
>emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b binding polypeptide of photosystem II (LHCP-II AB10) Length = 1306 Score = 61.9 bits (31), Expect = 1e-06 Identities = 85/103 (82%) Strand = Plus / Plus Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323 ||||||||||| || |||||||| || || || ||||||||||| || || ||||| || Sbjct: 555 tacctcactggagaattccctggtgattacggttgggacactgctggcctctcagcctac 614 Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccatt 366 || |||||||| || |||||||| ||||| || || ||||||| Sbjct: 615 ccagagaccttcgctaagaaccgtgagcttgaagtcatccatt 657
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 61.9 bits (31), Expect = 1e-06 Identities = 79/95 (83%) Strand = Plus / Plus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || |||||||| || ||||||||| Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464 Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352 ||||| || ||||| || || | |||||| ||||| Sbjct: 465 gctgatcccgagacattcgcaaggaaccgtgagct 499
>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding protein of photosystem II Length = 772 Score = 61.9 bits (31), Expect = 1e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 294 gggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctg 353 ||||||||||| |||||||| || || ||||| |||||||| ||||| || | |||||| Sbjct: 141 gggtgggacaccgccggactctcggccgacccagagaccttcgccaaaaatagagagctg 200 Query: 354 gaggtgatcca 364 ||||||||||| Sbjct: 201 gaggtgatcca 211
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 760 Score = 60.0 bits (30), Expect = 6e-06 Identities = 90/110 (81%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| |||||||| || || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcggatccggagaca 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| ||||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 60.0 bits (30), Expect = 6e-06 Identities = 90/110 (81%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 60.0 bits (30), Expect = 6e-06 Identities = 90/110 (81%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 60.0 bits (30), Expect = 6e-06 Identities = 90/110 (81%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 60.0 bits (30), Expect = 6e-06 Identities = 90/110 (81%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagaca 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 60.0 bits (30), Expect = 6e-06 Identities = 90/110 (81%) Strand = Plus / Plus Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332 ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290 Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 ||||| |||||| | || ||||| |||||||| |||| ||||| ||||| Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||| || || |||||||| || ||||| || ||||||||||| || || || ||||| Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||| |||||||| ||| |||| ||||||||||||||||| Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatcca 304
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 60.0 bits (30), Expect = 6e-06 Identities = 129/162 (79%) Strand = Plus / Plus Query: 219 gaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcactggtgag 278 ||||||||||| || | || ||| ||||||| ||||| ||| ||||| || ||||| Sbjct: 197 gaccgtgtgctgtatttgggtccattctccggggagccaccgtcgtacctaaccggtgaa 256 Query: 279 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 338 ||||| || ||||| ||||||||||| || || || || || || || ||||| || || Sbjct: 257 ttcccgggtgactacgggtgggacacggcggggctgtcggcagatccggagacgttcgcg 316 Query: 339 aagaaccgggagctggaggtgatccattgccgatgggccatg 380 |||||| | |||||||| |||||||| |||||||||||||| Sbjct: 317 aagaacagagagctggaagtgatccacggccgatgggccatg 358
>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding protein mRNA, complete cds Length = 1118 Score = 60.0 bits (30), Expect = 6e-06 Identities = 84/102 (82%) Strand = Plus / Plus Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322 |||||||||||| |||||||| || || || || ||||||||||| || | || || || Sbjct: 290 ctacctcactggcgagttccccggtgattacggctgggacactgctggcttgtcggcgga 349 Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatcca 364 ||| || ||||| || ||||| |||||||||||||| ||||| Sbjct: 350 cccagaaaccttcgctaagaatcgggagctggaggtcatcca 391
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 60.0 bits (30), Expect = 6e-06 Identities = 87/106 (82%) Strand = Plus / Plus Query: 277 agttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttg 336 ||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || | Sbjct: 256 agttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttcg 315 Query: 337 ccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382 | | |||| ||||||||||||||||||| | ||| ||||| ||||| Sbjct: 316 cgaggaacagggagctggaggtgatccactcccggtgggcaatgct 361
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 245 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 304 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 305 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 353
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 377
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 377
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 271 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 330 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 331 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 379
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 382
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 382
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 276 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 335 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 336 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 384
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 309 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 368 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 369 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 417
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 58.0 bits (29), Expect = 2e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || Sbjct: 79556 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 79497 Query: 336 gccaagaaccgggagctggaggtgatcca 364 || | |||| ||||||||||||||||||| Sbjct: 79496 gcgaggaacagggagctggaggtgatcca 79468
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 58.0 bits (29), Expect = 2e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || Sbjct: 21808260 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 21808319 Query: 336 gccaagaaccgggagctggaggtgatcca 364 || | |||| ||||||||||||||||||| Sbjct: 21808320 gcgaggaacagggagctggaggtgatcca 21808348
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 58.0 bits (29), Expect = 2e-05 Identities = 89/109 (81%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || Sbjct: 22434282 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 22434341 Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384 || | |||| ||| ||||||||||||||| |||| ||||| ||||||| Sbjct: 22434342 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 22434390
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 58.0 bits (29), Expect = 2e-05 Identities = 74/89 (83%) Strand = Plus / Plus Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335 |||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || Sbjct: 21801289 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 21801348 Query: 336 gccaagaaccgggagctggaggtgatcca 364 || | |||| ||||||||||||||||||| Sbjct: 21801349 gcgaggaacagggagctggaggtgatcca 21801377
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317 ||||||||||| || || |||||||| || ||||| || ||||||||||| | ||||||| Sbjct: 677 ccgagctaccttaccggagagttccccggagactacggatgggacactgctgtactttca 618 Query: 318 gctga 322 ||||| Sbjct: 617 gctga 613 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,794,918 Number of Sequences: 3902068 Number of extensions: 2794918 Number of successful extensions: 49819 Number of sequences better than 10.0: 322 Number of HSP's better than 10.0 without gapping: 322 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 49096 Number of HSP's gapped (non-prelim): 634 length of query: 384 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 362 effective length of database: 17,147,199,772 effective search space: 6207286317464 effective search space used: 6207286317464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)