ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet99e07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 523 e-145
2emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 268 1e-68
3gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 252 7e-64
4gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 234 2e-58
5emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 224 2e-55
6ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 170 2e-39
7gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 170 2e-39
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 170 2e-39
9dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 170 2e-39
10dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 2e-39
11dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 2e-39
12dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 2e-39
13dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 2e-39
14dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 163 5e-37
15dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 163 5e-37
16dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 163 5e-37
17dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 5e-37
18dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 5e-37
19dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 5e-37
20dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 163 5e-37
21gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 163 5e-37
22dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 163 5e-37
23emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 161 2e-36
24ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 159 8e-36
25dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 159 8e-36
26dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
27dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 8e-36
28emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 155 1e-34
29dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 1e-34
30emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 151 2e-33
31gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 147 3e-32
32emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 147 3e-32
33dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 145 1e-31
34dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 145 1e-31
35dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 145 1e-31
36emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 143 5e-31
37gb|AY109324.1| Zea mays CL187_1 mRNA sequence 143 5e-31
38gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 141 2e-30
39gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 139 7e-30
40emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 139 7e-30
41emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 139 7e-30
42emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 139 7e-30
43gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 139 7e-30
44emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 137 3e-29
45emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 137 3e-29
46gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 135 1e-28
47gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 135 1e-28
48gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 135 1e-28
49dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 135 1e-28
50emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 133 5e-28
51emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 133 5e-28
52dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 133 5e-28
53emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 131 2e-27
54gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 131 2e-27
55gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 131 2e-27
56gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 129 7e-27
57emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 129 7e-27
58gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 127 3e-26
59gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 127 3e-26
60emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 127 3e-26
61gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 127 3e-26
62gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 127 3e-26
63gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 127 3e-26
64gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 123 4e-25
65dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 123 4e-25
66emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 121 2e-24
67gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 119 7e-24
68gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 119 7e-24
69emb|X16535.1|GMCAB4 G.max DNA for Cab4 119 7e-24
70gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 119 7e-24
71gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 119 7e-24
72gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 117 3e-23
73gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 117 3e-23
74emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 117 3e-23
75emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 115 1e-22
76emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 113 4e-22
77gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-... 113 4e-22
78gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 111 2e-21
79gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 111 2e-21
80gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 111 2e-21
81emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 111 2e-21
82dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 111 2e-21
83gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 111 2e-21
84gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 109 7e-21
85emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 109 7e-21
86gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 109 7e-21
87emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 109 7e-21
88emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 109 7e-21
89ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 107 3e-20
90gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 107 3e-20
91gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 107 3e-20
92gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 107 3e-20
93gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 107 3e-20
94gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 107 3e-20
95gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 107 3e-20
96gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 107 3e-20
97emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 107 3e-20
98emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 107 3e-20
99emb|X16536.1|GMCAB5 G.max DNA for Cab5 107 3e-20
100gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 107 3e-20
101dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 107 3e-20
102emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 105 1e-19
103gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 105 1e-19
104gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 105 1e-19
105dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 105 1e-19
106gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 103 4e-19
107gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 103 4e-19
108ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 101 2e-18
109ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 101 2e-18
110ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 101 2e-18
111ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 101 2e-18
112gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 101 2e-18
113gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 101 2e-18
114gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 101 2e-18
115gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 101 2e-18
116gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 101 2e-18
117gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 101 2e-18
118gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 101 2e-18
119gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 101 2e-18
120gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 101 2e-18
121gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 101 2e-18
122gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 101 2e-18
123emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 101 2e-18
124emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 101 2e-18
125emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 101 2e-18
126gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 101 2e-18
127gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 101 2e-18
128emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 100 6e-18
129gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 98 3e-17
130emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 98 3e-17
131emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 98 3e-17
132gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 98 3e-17
133gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 98 3e-17
134emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 98 3e-17
135emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 98 3e-17
136gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 98 3e-17
137dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro... 98 3e-17
138gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 96 1e-16
139emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 96 1e-16
140emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 96 1e-16
141gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 96 1e-16
142emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 94 4e-16
143emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 94 4e-16
144emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 94 4e-16
145gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 94 4e-16
146dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 94 4e-16
147dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 92 2e-15
148emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 92 2e-15
149gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 92 2e-15
150emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 92 2e-15
151gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 90 6e-15
152gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 90 6e-15
153gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 88 2e-14
154gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 86 1e-13
155gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 86 1e-13
156dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 86 1e-13
157gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 84 4e-13
158gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 84 4e-13
159gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 82 2e-12
160emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
161emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 82 2e-12
162gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA 82 2e-12
163emb|X61915.1|PTCABP P.thunbergii cab gene 80 6e-12
164ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 78 2e-11
165gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 78 2e-11
166gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 78 2e-11
167gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 78 2e-11
168emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 78 2e-11
169gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 78 2e-11
170gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 78 2e-11
171gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 78 2e-11
172gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 78 2e-11
173emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 78 2e-11
174emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 78 2e-11
175gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 78 2e-11
176gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 78 2e-11
177gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 78 2e-11
178dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 78 2e-11
179gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 76 9e-11
180gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 76 9e-11
181gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 76 9e-11
182gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 76 9e-11
183gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 76 9e-11
184gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 76 9e-11
185gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 76 9e-11
186gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 76 9e-11
187emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 76 9e-11
188emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 76 9e-11
189emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 76 9e-11
190emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 76 9e-11
191gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 76 9e-11
192gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 74 4e-10
193emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 74 4e-10
194emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 74 4e-10
195gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 74 4e-10
196gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 74 4e-10
197gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 72 1e-09
198gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 72 1e-09
199gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 72 1e-09
200gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 70 6e-09
201gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 70 6e-09
202gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 68 2e-08
203emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 68 2e-08
204gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 68 2e-08
205gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 68 2e-08
206emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 68 2e-08
207emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 68 2e-08
208emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 68 2e-08
209gb|M64619.1|PEACAB66 Pea cab gene, complete cds 68 2e-08
210gb|AF526508.1| Vicia faba A-B binding protein (CHLOR1) mRNA, par... 66 9e-08
211gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor... 66 9e-08
212dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 9e-08
213emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 ... 66 9e-08
214emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20... 66 9e-08
215gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 66 9e-08
216gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 66 9e-08
217dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 66 9e-08
218emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 64 4e-07
219dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 64 4e-07
220ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 62 1e-06
221gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 62 1e-06
222gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 62 1e-06
223gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 62 1e-06
224gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 62 1e-06
225emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 62 1e-06
226emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 62 1e-06
227emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 62 1e-06
228gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 60 6e-06
229gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 60 6e-06
230gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 60 6e-06
231gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 60 6e-06
232gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 60 6e-06
233gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 60 6e-06
234emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 60 6e-06
235emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 60 6e-06
236gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 60 6e-06
237gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 60 6e-06
238ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 58 2e-05
239ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
240ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
241ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
242ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
243ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
244ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
245ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 58 2e-05
246gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 58 2e-05
247gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 58 2e-05
248dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
249dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
250emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
251dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
252dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
253dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
254dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
255emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 58 2e-05
256emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 58 2e-05
257dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
258dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
259dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
260dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
261dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
262dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
263dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
264gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 58 2e-05
265gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 58 2e-05
266dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 58 2e-05
267ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 56 9e-05
268gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 56 9e-05
269gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 56 9e-05
270gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 9e-05
271gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 56 9e-05
272gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 9e-05
273gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 9e-05
274gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 56 9e-05
275emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 56 9e-05
276gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 56 9e-05
277dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 56 9e-05
278emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 56 9e-05
279gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 56 9e-05
280dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 54 3e-04
281emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 54 3e-04
282emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 54 3e-04
283ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH... 52 0.001
284gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi... 52 0.001
285gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 52 0.001
286gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 52 0.001
287gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 52 0.001
288gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 52 0.001
289gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN... 52 0.001
290emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co... 52 0.001
291emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co... 52 0.001
292gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (... 52 0.001
293gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 52 0.001
294gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll... 52 0.001
295gb|AY845255.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 50 0.005
296ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA... 50 0.005
297gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 50 0.005
298dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 50 0.005
299emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 50 0.005
300dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.005
301emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 50 0.005
302gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 50 0.005
303dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 50 0.005
304gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 48 0.021
305gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 48 0.021
306gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 48 0.021
307dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 48 0.021
308gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 48 0.021
309dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 48 0.021
310dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro... 48 0.021
311gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin... 46 0.083
312gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 46 0.083
313gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end 46 0.083
314dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 46 0.083
315dbj|AB050126.1| Amaranthus tricolor cab3 mRNA for type III chlor... 46 0.083
316emb|BX817733.1|CNS0AE6W Arabidopsis thaliana Full-length cDNA Co... 44 0.33
317gb|L07120.1|COTIIABINB Gossypium hirsutum chloroplast photosyste... 44 0.33
318dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 44 0.33
319dbj|D78207.1|PHNCABBP Japanese morning glory mRNA for chlorophyl... 44 0.33
320emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl... 42 1.3
321gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 1.3
322gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 42 1.3

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  523 bits (264), Expect = e-145
 Identities = 315/332 (94%)
 Strand = Plus / Plus

                                                                       
Query: 51  agctttccaatggcggcagccaccatgtccatctcctcctcgacctttgccggcaaggcg 110
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 1   agctttccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcg 60

                                                                       
Query: 111 gtgaagaatgtaccatctttggctctctttggagatgcccgagtcaccatgcgcaagacc 170
           ||||||||||||||||||||||||||||| || || ||||| ||||||||||||||||||
Sbjct: 61  gtgaagaatgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagacc 120

                                                                       
Query: 171 gcagcaaaggcgaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctc 230
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 gcagcaaaggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctc 180

                                                                       
Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290
           |||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||
Sbjct: 181 tacctcggcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgac 240

                                                                       
Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350
           ||||||||||||||||| |||||||| |||||||| ||||||||  ||||||||||||||
Sbjct: 241 tatgggtgggacactgctggactttcggctgacccggagaccttctccaagaaccgggag 300

                                           
Query: 351 ctggaggtgatccattgccgatgggccatgct 382
           |||||||||||||| || || |||||||||||
Sbjct: 301 ctggaggtgatccactgtcgctgggccatgct 332



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  268 bits (135), Expect = 1e-68
 Identities = 279/327 (85%)
 Strand = Plus / Plus

                                                                       
Query: 56  tccaatggcggcagccaccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115
           ||||||||||||  ||||||||| | ||||||| ||||| || ||||| |||||||||||
Sbjct: 15  tccaatggcggccaccaccatgtacctctcctcatcgacattcgccggaaaggcggtgaa 74

                                                                       
Query: 116 gaatgtaccatctttggctctctttggagatgcccgagtcaccatgcgcaagaccgcagc 175
           |||||| ||||  | ||||||||| || || || || |||||||||||||||||||| ||
Sbjct: 75  gaatgtcccattatcggctctcttcggtgaggctcgcgtcaccatgcgcaagaccgcggc 134

                                                                       
Query: 176 aaaggcgaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacct 235
            || || ||||| ||||||||| |||||||||||||||| ||||| ||||||||||||||
Sbjct: 135 gaaagctaagcaagtttcctccagcagcccatggtacggagctgatcgtgtgctctacct 194

                                                                       
Query: 236 cggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatgg 295
           ||||||||||||  | |||||||| ||||||||||| ||||| ||||| || ||||| ||
Sbjct: 195 cggcccactctctcgcgagcccccaagctacctcaccggtgatttccccggtgactacgg 254

                                                                       
Query: 296 gtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctgga 355
           ||||||||| || ||||| || |||||||| ||||||||  | |||||||| ||| ||||
Sbjct: 255 gtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgcgagttgga 314

                                      
Query: 356 ggtgatccattgccgatgggccatgct 382
           |||||| || ||||| ||||| |||||
Sbjct: 315 ggtgatacactgccgctgggctatgct 341



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  252 bits (127), Expect = 7e-64
 Identities = 277/327 (84%)
 Strand = Plus / Plus

                                                                       
Query: 58  caatggcggcagccaccatgtccatctcctcctcgacctttgccggcaaggcggtgaaga 117
           ||||||||||  ||||||||||  | ||||| ||| |||| ||||||||||| || ||||
Sbjct: 199 caatggcggccaccaccatgtctctttcctcttcgtccttcgccggcaaggccgtcaaga 258

                                                                       
Query: 118 atgtaccatctttggctctctttggagatgcccgagtcaccatgcgcaagaccgcagcaa 177
           |  | || || | ||||||| |||| || || || || | |||||||||||| || || |
Sbjct: 259 acttgccctcgtcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcga 318

                                                                       
Query: 178 aggcgaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcg 237
           |||| || || ||||| ||  ||||||| ||||||||  |||||||||||||||||||||
Sbjct: 319 aggccaaacaagtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcg 378

                                                                       
Query: 238 gcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggt 297
           |||| || ||||| |||||||| |||||| | |||||||||||||| || ||||||||||
Sbjct: 379 gcccgctttccggcgagccccccagctacttgactggtgagttccccggtgactatgggt 438

                                                                       
Query: 298 gggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggagg 357
           ||||||| ||||| || || ||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 439 gggacaccgccgggctctcggctgaccctgagaccttcgccaagaaccgggagctcgagg 498

                                      
Query: 358 tgatccattgccgatgggccatgctcg 384
           ||||||| |||||||||||||||||||
Sbjct: 499 tgatccactgccgatgggccatgctcg 525



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  234 bits (118), Expect = 2e-58
 Identities = 202/230 (87%)
 Strand = Plus / Plus

                                                                       
Query: 153 gtcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagcccatggtac 212
           |||||||||||||||||||| || ||||| |||| ||| || ||||||||||| ||||||
Sbjct: 157 gtcaccatgcgcaagaccgcggccaaggccaagccggtgtcgtccggcagcccgtggtac 216

                                                                       
Query: 213 ggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcact 272
           ||  | ||||| ||||||||||||||||| |||||||| || ||||||||||||||||| 
Sbjct: 217 gggtccgaccgcgtgctctacctcggcccgctctccggcgaccccccgagctacctcacc 276

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           || |||||||| |||||||| ||||||||||| || || || || || ||||| ||||||
Sbjct: 277 ggcgagttccccggcgactacgggtgggacaccgcggggctgtcggccgaccccgagacc 336

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 337 ttcgccaagaaccgggagctggaggtgatccactgccggtgggccatgct 386



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  224 bits (113), Expect = 2e-55
 Identities = 254/301 (84%)
 Strand = Plus / Plus

                                                                       
Query: 84  tcctcctcgacctttgccggcaaggcggtgaagaatgtaccatctttggctctctttgga 143
           ||||| ||| |||| ||||||||||| || |||||  | || || | ||||||| |||| 
Sbjct: 20  tcctcttcgtccttcgccggcaaggccgtcaagaacttgccctcgtcggctctcattggt 79

                                                                       
Query: 144 gatgcccgagtcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagc 203
           || || || || | |||||||||||| || || ||||| || || ||||| ||  |||||
Sbjct: 80  gacgcacgtgtgaacatgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagc 139

                                                                       
Query: 204 ccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagc 263
           || ||||||||  ||||||||||||||||||||||| | || ||||| || ||||| |||
Sbjct: 140 ccgtggtacggctctgaccgtgtgctctacctcggctcgctttccggcgaaccccccagc 199

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||| | |||||||||||||| || ||||||||||||||||| ||||| || || ||||||
Sbjct: 200 tacttgactggtgagttccccggtgactatgggtgggacaccgccgggctctcggctgac 259

                                                                       
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 383
           ||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||
Sbjct: 260 cctgagaccttcgccaagaaccgggagctcgaggtgatccactgccgatgggccatgctc 319

            
Query: 384 g 384
           |
Sbjct: 320 g 320



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318

             
Query: 381 ct 382
           ||
Sbjct: 319 ct 320



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Minus

                                                                         
Query: 201   agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
             ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476

                                                                         
Query: 261   agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
               ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416

                                                                         
Query: 321   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
             ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356

               
Query: 381   ct 382
             ||
Sbjct: 14355 ct 14354



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                            
Query: 201      agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
                ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535

                                                                            
Query: 261      agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
                  ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595

                                                                            
Query: 321      gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
                ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655

                  
Query: 381      ct 382
                ||
Sbjct: 30024656 ct 30024657



 Score =  159 bits (80), Expect = 8e-36
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                            
Query: 201      agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
                ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729

                                                                            
Query: 261      agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
                |||||||| || || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789

                                                            
Query: 321      gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
                ||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 23603833



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                         
Query: 201   agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
             ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525

                                                                         
Query: 261   agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
               ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585

                                                                         
Query: 321   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
             ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645

               
Query: 381   ct 382
             ||
Sbjct: 20646 ct 20647



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

             
Query: 381 ct 382
           ||
Sbjct: 400 ct 401



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

             
Query: 381 ct 382
           ||
Sbjct: 400 ct 401



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

             
Query: 381 ct 382
           ||
Sbjct: 402 ct 403



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||| || |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

             
Query: 381 ct 382
           ||
Sbjct: 402 ct 403



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                            
Query: 201      agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
                ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182

                                                                            
Query: 261      agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
                ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242

                                                                            
Query: 321      gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
                ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 10793302

                  
Query: 381      ct 382
                ||
Sbjct: 10793303 ct 10793304



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                         
Query: 201   agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
             ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905

                                                                         
Query: 261   agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965

                                                                         
Query: 321   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
             ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 17025

               
Query: 381   ct 382
             ||
Sbjct: 17026 ct 17027



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                          
Query: 201    agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
              ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800

                                                                          
Query: 261    agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
              ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860

                                                                          
Query: 321    gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
              ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 129920

                
Query: 381    ct 382
              ||
Sbjct: 129921 ct 129922



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 370

             
Query: 381 ct 382
           ||
Sbjct: 371 ct 372



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

             
Query: 381 ct 382
           ||
Sbjct: 376 ct 377



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 377

             
Query: 381 ct 382
           ||
Sbjct: 378 ct 379



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

             
Query: 381 ct 382
           ||
Sbjct: 376 ct 377



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||| || |||||| | |||||||| || |||||||| ||||| || || || 
Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360

             
Query: 381 ct 382
           ||
Sbjct: 361 ct 362



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  163 bits (82), Expect = 5e-37
 Identities = 157/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || ||||||||||||||||||||| ||||||| | ||||||||| |||
Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356

             
Query: 381 ct 382
           ||
Sbjct: 357 ct 358



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  161 bits (81), Expect = 2e-36
 Identities = 162/189 (85%)
 Strand = Plus / Plus

                                                                       
Query: 194 ctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtga 253
           |||||||||||| ||||||||  | ||||| ||||||||||| |||||||| ||||| ||
Sbjct: 144 ctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccggcga 203

                                                                       
Query: 254 gcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggact 313
           ||||||||||||||| || || |||||||| |||||||| || |||||||| || || ||
Sbjct: 204 gcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggct 263

                                                                       
Query: 314 ttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatg 373
            || || ||||| ||||| || ||||||||||||||||||||||| ||||| | ||| ||
Sbjct: 264 gtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatccactcccgctg 323

                    
Query: 374 ggccatgct 382
           |||||||||
Sbjct: 324 ggccatgct 332



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  159 bits (80), Expect = 8e-36
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||||| || || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246

                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 290



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  159 bits (80), Expect = 8e-36
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                         
Query: 201   agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
             ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428

                                                                         
Query: 261   agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             |||||||| || || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488

                                                         
Query: 321   gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
             ||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 66532



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  159 bits (80), Expect = 8e-36
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||||| || || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317

                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 361



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  159 bits (80), Expect = 8e-36
 Identities = 143/164 (87%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||||| || || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316

                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 360



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  155 bits (78), Expect = 1e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 208 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtcccca 267

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||| | ||||||||||||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 268 agctacttgactggtgagttccctggtgactacgggtgggacactgctggactttcagct 327

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           || || || || ||||||||||| || ||| ||||||||||||| ||| |||||||||||
Sbjct: 328 gatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcagatgggccatg 387

             
Query: 381 ct 382
           ||
Sbjct: 388 ct 389



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  155 bits (78), Expect = 1e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||| |||||||| || ||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           ||||||||||| || |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| |||||  | ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

             
Query: 381 ct 382
           ||
Sbjct: 376 ct 377



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||| ||||| ||||||||  | ||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||
Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376

                   
Query: 375 gccatgct 382
           ||||||||
Sbjct: 377 gccatgct 384



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 71  caccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115
           ||||||| || |||||||| || |||| ||||||||||| |||||
Sbjct: 76  caccatggccctctcctccacggccttcgccggcaaggccgtgaa 120



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score =  147 bits (74), Expect = 3e-32
 Identities = 146/170 (85%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||||||    ||| | |||||| |||||||||||
Sbjct: 142 tccggcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgag 201

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           ||||| |||||| | || ||||| ||||| || |||||||| ||||||||||||||||| 
Sbjct: 202 cccccaagctacttgaccggtgaattccccggtgactatggctgggacactgccggactc 261

                                                             
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||||||||| || ||||||||||||||||| ||||| || ||||||||
Sbjct: 262 tcagctgacccagaaacctttgccaagaaccgtgagctcgaagtgatcca 311



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  147 bits (74), Expect = 3e-32
 Identities = 134/154 (87%)
 Strand = Plus / Plus

                                                                        
Query: 231  tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290
            |||||||||||  ||||||| |||||||||||||||||||| || |||||||| ||||||
Sbjct: 1051 tacctcggccccttctccggcgagcccccgagctacctcaccggcgagttccccggcgac 1110

                                                                        
Query: 291  tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350
            || || |||||||| ||||| || || || ||||| ||||| || ||||||||||| |||
Sbjct: 1111 tacggctgggacaccgccgggctgtccgccgaccccgagacattcgccaagaaccgcgag 1170

                                              
Query: 351  ctggaggtgatccattgccgatgggccatgctcg 384
            |||||||||||||| | ||| |||||||||||||
Sbjct: 1171 ctggaggtgatccactcccgctgggccatgctcg 1204



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
           protein, complete cds
          Length = 1500

 Score =  145 bits (73), Expect = 1e-31
 Identities = 148/173 (85%)
 Strand = Plus / Plus

                                                                       
Query: 208 ggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacc 267
           |||||||||| |||||  | |||||||| |||||| |||| |||   |||||   |||||
Sbjct: 667 ggtacggtgccgaccgccttctctacctgggcccattctctggttctcccccatcctacc 726

                                                                       
Query: 268 tcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctg 327
           ||||||||||||||||||| ||||||||||||||||| || || || || || ||||| |
Sbjct: 727 tcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcagacccag 786

                                                                
Query: 328 agacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||||| ||||||||| ||||||||||||||||||||| | |||||||||||
Sbjct: 787 agaccttcgccaagaacagggagctggaggtgatccattccagatgggccatg 839



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  145 bits (73), Expect = 1e-31
 Identities = 157/185 (84%)
 Strand = Plus / Plus

                                                                        
Query: 198  ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
            ||||| |||||||||||  ||||||||||    ||| | |||||| |||| |||||| ||
Sbjct: 1592 ggcagtccatggtacggccctgaccgtgtcaagtacttgggcccattctctggtgagtcc 1651

                                                                        
Query: 258  ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
            || |||||| | || |||||||||||||| || ||||| ||||||||||| |||||||||
Sbjct: 1652 ccaagctacttgacgggtgagttccctggtgattatggatgggacactgctggactttca 1711

                                                                        
Query: 318  gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
            ||||| || || || ||||| |||||||| ||| ||||||||||||||||| ||||||||
Sbjct: 1712 gctgatccagaaacttttgctaagaaccgtgagttggaggtgatccattgcagatgggcc 1771

                 
Query: 378  atgct 382
            |||||
Sbjct: 1772 atgct 1776



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  145 bits (73), Expect = 1e-31
 Identities = 157/185 (84%)
 Strand = Plus / Minus

                                                                        
Query: 198  ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
            |||||||||||||||||| | ||||||||    ||| | |||||| |||| |||||| | 
Sbjct: 2532 ggcagcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggtgagtct 2473

                                                                        
Query: 258  ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
            || |||||| | ||||||||||| || || |||||||| ||||||||||| |||||||||
Sbjct: 2472 ccaagctacttgactggtgagtttccaggtgactatggatgggacactgctggactttca 2413

                                                                        
Query: 318  gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
            ||||| || || || |||||||||||||| ||| ||||||||||||| ||| ||||||||
Sbjct: 2412 gctgatccagaaacttttgccaagaaccgtgagttggaggtgatccactgcagatgggcc 2353

                 
Query: 378  atgct 382
            |||||
Sbjct: 2352 atgct 2348



 Score =  123 bits (62), Expect = 4e-25
 Identities = 125/146 (85%)
 Strand = Plus / Plus

                                                                        
Query: 237  ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
            |||||| |||| |||||| | || |||||| | |||||||| |||||||| ||||| |||
Sbjct: 4540 ggcccattctctggtgagtctccaagctacttgactggtgaattccctggtgactacggg 4599

                                                                        
Query: 297  tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
            ||||||||||| |||||||||||||| || || || ||||| |||||||| ||| |||||
Sbjct: 4600 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 4659

                                      
Query: 357  gtgatccattgccgatgggccatgct 382
            |||||||| ||| ||||||| |||||
Sbjct: 4660 gtgatccactgcagatgggcaatgct 4685



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Plus

                                                                        
Query: 195  tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
            ||||| ||||| ||||||||  | ||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 255  cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
            || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 315  tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
            || || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                    
Query: 375  gccatgct 382
            ||||||||
Sbjct: 1325 gccatgct 1332



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 71   caccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115
            ||||||| || |||||||| || |||| ||||||||||| |||||
Sbjct: 1024 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 1068



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Plus

                                                                        
Query: 195  tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
            ||||| ||||| ||||||||  | ||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 255  cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
            || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 315  tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
            || || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                    
Query: 375  gccatgct 382
            ||||||||
Sbjct: 1325 gccatgct 1332



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 71   caccatgtccatctcctcctcgacctttgccggcaaggcggtgaa 115
            ||||||| || |||||||| || |||| ||||||||||| |||||
Sbjct: 1024 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 1068



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  141 bits (71), Expect = 2e-30
 Identities = 161/191 (84%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           ||||| || ||||||||||| ||| ||||||||||    ||| | |||||| |||| |||
Sbjct: 171 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggt 230

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||  |||| |||||| | ||||||||||| ||||| ||||| || ||||||||||| |||
Sbjct: 231 gaagccccaagctacttgactggtgagtttcctggtgactacggatgggacactgctgga 290

                                                                       
Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 371
           ||||||||||||||||| || || || |||||||| ||||| ||||||||||| ||| ||
Sbjct: 291 ctttcagctgaccctgaaacattcgctaagaaccgtgagcttgaggtgatccactgcaga 350

                      
Query: 372 tgggccatgct 382
           |||||||||||
Sbjct: 351 tgggccatgct 361



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score =  139 bits (70), Expect = 7e-30
 Identities = 163/194 (84%)
 Strand = Plus / Plus

                                                                       
Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248
           |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 115 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 174

                                                                       
Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308
           |||||||||||    ||||| |||||||| |||||||| |||||||| ||||||||||| 
Sbjct: 175 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 234

                                                                       
Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368
           || |||||||||||||| || ||||||||||||||||| ||||| || |||||||| | |
Sbjct: 235 gggctttcagctgacccagaaacctttgccaagaaccgtgagcttgaagtgatccactcc 294

                         
Query: 369 cgatgggccatgct 382
            |||||||||||||
Sbjct: 295 agatgggccatgct 308



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  139 bits (70), Expect = 7e-30
 Identities = 187/226 (82%)
 Strand = Plus / Plus

                                                                        
Query: 154  tcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagcccatggtacg 213
            ||||||||||||||||||| || ||| | |||| ||    |||||||||||| |||||||
Sbjct: 2015 tcaccatgcgcaagaccgccgccaagcccaagccggcgcgctccggcagcccctggtacg 2074

                                                                        
Query: 214  gtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcactg 273
            |||| ||||| || || ||||| ||||| || |||||    || ||||||||||| || |
Sbjct: 2075 gtgccgaccgcgtcctgtacctgggcccgctgtccggctcacctccgagctacctgaccg 2134

                                                                        
Query: 274  gtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacct 333
            | |||||||| |||||||| ||||||||||| |  || || || || ||||| |||||||
Sbjct: 2135 gcgagttccccggcgactacgggtgggacaccgaggggctgtcggcggacccggagacct 2194

                                                          
Query: 334  ttgccaagaaccgggagctggaggtgatccattgccgatgggccat 379
            | ||||||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 2195 tcgccaagaaccgcgagctggaggtgatccactgccgctgggccat 2240



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  139 bits (70), Expect = 7e-30
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||||||| ||||||||||    ||| | |||||| ||||||||||  |||| 
Sbjct: 375 agcccatggtacggtcctgaccgtgtcaagtacttgggcccattctccggtgaagcccca 434

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||| | || |||||||||||||| |||||||| |||||||| || | ||||||||||
Sbjct: 435 agctacttgaccggtgagttccctggtgactatggttgggacaccgctgaactttcagct 494

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           || || || || || ||||||||||| ||| ||||||||||||| ||| |||||||||||
Sbjct: 495 gatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 554

             
Query: 381 ct 382
           ||
Sbjct: 555 ct 556



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  139 bits (70), Expect = 7e-30
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||| ||| |||| |||||    ||| | |||||| | || |||||| |||| 
Sbjct: 372 agcccatggtatggtcctgatcgtgtcaagtacttgggcccattttctggtgaggcccca 431

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||| | ||||||||||| ||||| |||||||||||||| ||||| ||||||||||| 
Sbjct: 432 agctacttgactggtgagtttcctggtgactatgggtgggatactgctggactttcagca 491

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| || || || ||||||||||||||| ||||||||||||| ||| |||||||||||
Sbjct: 492 gacccagaaactttcgccaagaaccgggagttggaggtgatccactgcagatgggccatg 551

             
Query: 381 ct 382
           ||
Sbjct: 552 ct 553



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  139 bits (70), Expect = 7e-30
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                        
Query: 201  agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
            ||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 1120 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 1179

                                                                        
Query: 261  agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
            |||||| | ||||||||||| ||||| || || |||||||||||||||||||||||||||
Sbjct: 1180 agctacttgactggtgagtttcctggtgattacgggtgggacactgccggactttcagct 1239

                                                                        
Query: 321  gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
            || || || || || ||||||||||| ||| ||||||||||||| ||| |||||||||||
Sbjct: 1240 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 1299

              
Query: 381  ct 382
            ||
Sbjct: 1300 ct 1301



to top

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  137 bits (69), Expect = 3e-29
 Identities = 156/185 (84%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||| ||| |||| |||||    ||| | || ||| |||| |||||| ||
Sbjct: 372 ggcagcccatggtatggtcctgatcgtgtcaagtacttgggtccattctctggtgaggcc 431

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           || |||||| | ||||||||||||||||| || ||||||||||||||||| |||||||||
Sbjct: 432 ccaagctacttgactggtgagttccctggtgattatgggtgggacactgctggactttca 491

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           ||||| || || || || |||||||| || ||| ||||||||||||| ||| ||||||||
Sbjct: 492 gctgatccagaaactttcgccaagaatcgtgagttggaggtgatccactgcagatgggcc 551

                
Query: 378 atgct 382
           |||||
Sbjct: 552 atgct 556



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  137 bits (69), Expect = 3e-29
 Identities = 143/167 (85%), Gaps = 3/167 (1%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt---gagccc 257
           ||||| |||||||| || ||||| ||||||||||||||||| ||||||||    ||||| 
Sbjct: 624 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 684 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743

                                                          
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           || ||||| ||||| || |||||||||||||||||||||||||||||
Sbjct: 744 gccgacccggagacgttcgccaagaaccgggagctggaggtgatcca 790



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  135 bits (68), Expect = 1e-28
 Identities = 155/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 196

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | |||||||| |||||||| ||||| |||||||| || || ||||||||||
Sbjct: 197 caagctacttgactggtgaattccctggtgactacgggtgggataccgctggactttcag 256

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||| ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 316

               
Query: 379 tgct 382
           ||||
Sbjct: 317 tgct 320



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  135 bits (68), Expect = 1e-28
 Identities = 155/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 196

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | || ||| | |||||||| |||||||| |||||||| ||||| || || ||||||||||
Sbjct: 197 caagttacttgactggtgaattccctggtgactatggatgggataccgctggactttcag 256

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||||||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 257 cagaccctgagacctttgccaagaaccgtgaacttgaggtgatccactgcagatgggcta 316

               
Query: 379 tgct 382
           ||||
Sbjct: 317 tgct 320



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  135 bits (68), Expect = 1e-28
 Identities = 155/184 (84%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||| ||||||||| || |||||||    ||| | || ||| |||| |||||| | |
Sbjct: 579 gcagcccgtggtacggtcctaaccgtgtcaagtacttgggtccattctctggtgagtctc 638

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | ||||||||||||||||| |||||||| ||||| ||||| ||||||||||
Sbjct: 639 caagctacttgactggtgagttccctggtgactatggatgggatactgctggactttcag 698

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           |||| ||||| || |||||||||||||| ||| ||||||||||||| ||  |||||||||
Sbjct: 699 ctgatcctgaaacttttgccaagaaccgtgagttggaggtgatccactgtagatgggcca 758

               
Query: 379 tgct 382
           ||||
Sbjct: 759 tgct 762



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  135 bits (68), Expect = 1e-28
 Identities = 155/184 (84%)
 Strand = Plus / Plus

                                                                        
Query: 199  gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
            ||||||||||||||||| | ||||||||    ||| | |||||| ||||||||||| |||
Sbjct: 4471 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattctccggtgagtccc 4530

                                                                        
Query: 259  cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
            | |||||| | || ||||| || || || |||||||||||||| ||||| ||||||||||
Sbjct: 4531 caagctacttgaccggtgaatttcccggtgactatgggtgggatactgctggactttcag 4590

                                                                        
Query: 319  ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
            | || || || ||||||||||||||||| ||||| ||||||||||| ||| ||||||| |
Sbjct: 4591 cagatccagaaacctttgccaagaaccgtgagctcgaggtgatccactgcagatgggcta 4650

                
Query: 379  tgct 382
            ||||
Sbjct: 4651 tgct 4654



 Score =  111 bits (56), Expect = 2e-21
 Identities = 152/184 (82%)
 Strand = Plus / Plus

                                                                        
Query: 199  gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
            ||||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| |||
Sbjct: 7011 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgaggccc 7070

                                                                        
Query: 259  cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
            | |||||| | || ||||| ||||| || || || |||||||| ||||| ||||||||||
Sbjct: 7071 caagctacttgaccggtgaattcccaggtgattacgggtgggatactgctggactttcag 7130

                                                                        
Query: 319  ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
            | || || || ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 7131 cggatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 7190

                
Query: 379  tgct 382
            ||||
Sbjct: 7191 tgct 7194



 Score =  111 bits (56), Expect = 2e-21
 Identities = 152/184 (82%)
 Strand = Plus / Plus

                                                                        
Query: 199  gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
            ||||||||||||||||| | ||||||||    ||| | |||||| | || |||||| | |
Sbjct: 2018 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattttctggtgagtctc 2077

                                                                        
Query: 259  cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
            | |||||  | |||||||| |||||||| |||||||||||||| ||||| ||||||||||
Sbjct: 2078 caagctatttgactggtgaattccctggtgactatgggtgggatactgctggactttcag 2137

                                                                        
Query: 319  ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
            | ||||| || || |||||||||||||| || || |||||||| || ||| ||||||| |
Sbjct: 2138 ccgacccagaaacttttgccaagaaccgtgaactcgaggtgattcactgcagatgggcta 2197

                
Query: 379  tgct 382
            ||||
Sbjct: 2198 tgct 2201



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  133 bits (67), Expect = 5e-28
 Identities = 156/185 (84%), Gaps = 3/185 (1%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt---gagccc 257
           ||||| |||||||| || ||||| || |||||||||||||| ||||| ||    ||||| 
Sbjct: 585 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           |||||||||||||| || |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 645 ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| 
Sbjct: 705 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcg 764

                
Query: 378 atgct 382
           |||||
Sbjct: 765 atgct 769



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  133 bits (67), Expect = 5e-28
 Identities = 121/139 (87%)
 Strand = Plus / Plus

                                                                       
Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
           ||||||||||| ||||||||||| | || ||||||||||| || ||||| || |||||||
Sbjct: 74  tctccggtgagtccccgagctacttgaccggtgagttccccggtgactacggctgggaca 133

                                                                       
Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
           |||| ||||| ||||||||||| |||||||| ||||||||||| ||||| ||||||||||
Sbjct: 134 ctgctggactctcagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatcc 193

                              
Query: 364 attgccgatgggccatgct 382
           | |   |||||||||||||
Sbjct: 194 actcaagatgggccatgct 212



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  133 bits (67), Expect = 5e-28
 Identities = 106/119 (89%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| || ||||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 224 tacctgaccggtgaattccctggagactatgggtgggacactgctggactttcagctgac 283

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| |||||||||||||| ||||| || ||||||||  || |||||||||||||
Sbjct: 284 ccagagacatttgccaagaaccgtgagctcgaagtgatccacagcagatgggccatgct 342



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  131 bits (66), Expect = 2e-27
 Identities = 153/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 200 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 259

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||| | ||||||||||| ||||| || || |||||||||||||| ||||||||||||
Sbjct: 260 agctacttgactggtgagtttcctggtgattacgggtgggacactgctggactttcagct 319

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           || || || || || ||||||||||| ||| ||||||||||||| ||| |||||||||||
Sbjct: 320 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 379

             
Query: 381 ct 382
           ||
Sbjct: 380 ct 381



to top

>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 405

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| |||| |||||| |||| |||||| | || ||||| |||||||| ||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           ||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 357 gtgatccattgccgatgggccatgct 382
           |||||||||||| ||||||| |||||
Sbjct: 295 gtgatccattgcagatgggctatgct 320



to top

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  131 bits (66), Expect = 2e-27
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                       
Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248
           ||||| ||||||||||| ||||| ||| ||||||||||    ||| | |||||| |||| 
Sbjct: 97  gtttcttccggcagcccgtggtatggtcctgaccgtgtcaagtacttgggcccattctct 156

                                                                       
Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308
           |||||||| ||   |||||| || || ||||||||||| ||||| || ||||||||||| 
Sbjct: 157 ggtgagccaccatcctaccttaccggagagttccctggtgactacggttgggacactgct 216

                                                                       
Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368
           |||||||||||||| || |||||||| ||||||||||| ||| |||| |||||||| | |
Sbjct: 217 ggactttcagctgatcccgagaccttcgccaagaaccgtgagttggaagtgatccactcc 276

                         
Query: 369 cgatgggccatgct 382
            |||||||||||||
Sbjct: 277 agatgggccatgct 290



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  129 bits (65), Expect = 7e-27
 Identities = 188/229 (82%)
 Strand = Plus / Plus

                                                                       
Query: 154 tcaccatgcgcaagaccgcagcaaaggcgaagcaggtttcctccggcagcccatggtacg 213
           |||| |||||||||||||| || ||| | |||  ||| || ||||||||||| |||||||
Sbjct: 149 tcacgatgcgcaagaccgccgccaagcccaagacggtctcgtccggcagcccgtggtacg 208

                                                                       
Query: 214 gtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcactg 273
           |  | ||||||||    |||||||||||  ||||||| ||| ||||    |||||||| |
Sbjct: 209 gcccggaccgtgtcaagtacctcggcccgttctccggcgaggccccatcatacctcaccg 268

                                                                       
Query: 274 gtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacct 333
           | || ||||| |||||||| ||||||||||| ||||| || || || ||||| |||||||
Sbjct: 269 gcgaattccccggcgactacgggtgggacaccgccgggctctccgccgaccccgagacct 328

                                                            
Query: 334 ttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |  |||||||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 329 tctccaagaaccgggagctcgaggtgatccactgccggtgggccatgct 377



to top

>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score =  129 bits (65), Expect = 7e-27
 Identities = 101/113 (89%)
 Strand = Plus / Plus

                                                                        
Query: 270  actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
            ||||||||||||||||| ||||| || ||||||||||| ||||| |||||||||||||||
Sbjct: 2319 actggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctgag 2378

                                                                 
Query: 330  acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
            || ||||| | ||||| |||||| |||||||||||||| || |||||||||||
Sbjct: 2379 acatttgctaggaacctggagcttgaggtgatccattgtcgttgggccatgct 2431



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  127 bits (64), Expect = 3e-26
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||| ||||||||  | ||||||||    |||||||||||  |||||||||||
Sbjct: 94  tccggcagcccctggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgag 153

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
            | ||    |||||||| ||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 154 gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 213

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||
Sbjct: 214 tccgcggaccccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgg 273

                   
Query: 375 gccatgct 382
           || |||||
Sbjct: 274 gcaatgct 281



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  127 bits (64), Expect = 3e-26
 Identities = 166/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 183 aagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggccca 242
           ||||||||||||||||| ||||||||||||||  | ||||||||    ||| | ||||||
Sbjct: 173 aagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggccca 232

                                                                       
Query: 243 ctctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggac 302
            ||||||| |||||||||  ||||||||| || |||||||| || ||||| || ||||||
Sbjct: 233 ttctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggac 292

                                                                       
Query: 303 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 362
           ||||| || ||||| |||||||| |||||||| |||| |||||| ||| |||| || |||
Sbjct: 293 actgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtcatc 352

                               
Query: 363 cattgccgatgggccatgct 382
           || | | | |||||||||||
Sbjct: 353 cactccaggtgggccatgct 372



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||| ||||||||||    ||| | || ||| |||| |||||| | |
Sbjct: 373 gcagcccatggtatggtcctgaccgtgtcaagtacttgggaccattctctggtgaggcac 432

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | ||||||||||||||| | |||||||| ||||| ||||| |||||||| |
Sbjct: 433 caagctacttgactggtgagttccctagtgactatggatgggatactgctggactttcgg 492

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           |||| ||||| || |||||||||||||| ||||||||||| ||||| ||  |||||||||
Sbjct: 493 ctgatcctgaaacttttgccaagaaccgtgagctggaggtcatccactgtagatgggcca 552

               
Query: 379 tgct 382
           ||||
Sbjct: 553 tgct 556



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttaggcccattctctggtgagtccc 196

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | || ||||| |||||||| ||||| |||||||| || || ||||||||||
Sbjct: 197 caagctacttgaccggtgaattccctggtgactacgggtgggataccgctggactttcag 256

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||| ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcaa 316

               
Query: 379 tgct 382
           ||||
Sbjct: 317 tgct 320



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggtgagtccc 196

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | || ||| | || ||||| |||||||| |||||||| ||||| ||||| ||||||||||
Sbjct: 197 caagttacttgaccggtgaattccctggtgactatggctgggatactgctggactttcag 256

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||| ||||||||||||||||| || || ||||||||||| ||| | ||||| |
Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactagaggtgatccactgcaggtgggcta 316

               
Query: 379 tgct 382
           ||||
Sbjct: 317 tgct 320



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggccctgaccgtgttaagtacttaggcccattctctggtgagtccc 196

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | || ||||| |||||||| ||||| |||||||| || || ||||||||||
Sbjct: 197 caagctacttgaccggtgaattccctggtgactacgggtgggataccgctggactttcag 256

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||| ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcaa 316

               
Query: 379 tgct 382
           ||||
Sbjct: 317 tgct 320



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  123 bits (62), Expect = 4e-25
 Identities = 101/114 (88%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           ||||||||||||||| |||||||| ||||| |||||||||||||| ||||| || |||||
Sbjct: 231 ctacctcactggtgaattccctggtgactacgggtgggacactgctggactctctgctga 290

                                                                 
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggc 376
           ||| ||||||||||| |||||||| || || ||||||||||| ||| |||||||
Sbjct: 291 cccagagacctttgctaagaaccgcgaacttgaggtgatccactgcagatgggc 344



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score =  123 bits (62), Expect = 4e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 189 gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248
           |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 171 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 230

                                                                       
Query: 249 ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308
           |||||||||||    ||||| |||||||| |||||||| |||||||| ||||||||||| 
Sbjct: 231 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 290

                                                                       
Query: 309 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368
           || || ||||||||||| || |||||||| |||||||| ||||| || |||||||| | |
Sbjct: 291 gggctatcagctgacccagaaacctttgctaagaaccgtgagcttgaagtgatccactcc 350

                         
Query: 369 cgatgggccatgct 382
            |||||||||||||
Sbjct: 351 agatgggccatgct 364



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score =  121 bits (61), Expect = 2e-24
 Identities = 100/113 (88%)
 Strand = Plus / Plus

                                                                        
Query: 270  actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
            |||||||||||||| || || || |||||||||||||| ||||||||||||||||| |||
Sbjct: 942  actggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccagag 1001

                                                                 
Query: 330  acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
            || || || | |||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1002 acattcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgct 1054



to top

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score =  119 bits (60), Expect = 7e-24
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           ||||||||| || || || |||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 207 ctacctcacaggagaatttcctggcgactatggttgggacactgccggactctcagctga 266

                                                                       
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||| ||||| || || |||||||| ||||| || ||||||||||  ||||||||||||||
Sbjct: 267 cccggagacattcgctaagaaccgtgagctcgaagtgatccattcacgatgggccatgct 326



to top

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score =  119 bits (60), Expect = 7e-24
 Identities = 123/144 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| |||| || |||||||| |||||| | || |||||||||||||||||||| || 
Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           |||||||| ||||| |||||||||||||| || |||||||||||||| || || || || 
Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctttgccaagaatcgtgaactcgaa 291

                                   
Query: 357 gtgatccattgccgatgggccatg 380
           || ||||| ||| |||||||||||
Sbjct: 292 gtcatccactgcagatgggccatg 315



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score =  119 bits (60), Expect = 7e-24
 Identities = 123/144 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| |||| |||||||||||   ||||||||||||||| ||||| || |||||||| 
Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           ||||||||||| || ||||| |||||||| |||||||||||||| ||||| || ||||| 
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaaaaaccgtgaactggaa 621

                                   
Query: 357 gtgatccattgccgatgggccatg 380
           || ||||| | | |||||||||||
Sbjct: 622 gtcatccactccagatgggccatg 645



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score =  119 bits (60), Expect = 7e-24
 Identities = 138/164 (84%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||||||  | ||||||||    ||||| |||||| ||||||||||| | || 
Sbjct: 201 agcccatggtacggcccagaccgtgtcaagtacctaggcccattctccggtgaggcacca 260

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
              |||||||||||||| |||||||| |||||||| ||||||||||| || || ||||||
Sbjct: 261 tcttacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagct 320

                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||| ||||| ||||| |||||||| ||||| |||||||||||
Sbjct: 321 gaccccgagacttttgctaagaaccgtgagcttgaggtgatcca 364



to top

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score =  119 bits (60), Expect = 7e-24
 Identities = 150/180 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 81  agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 140

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             ||||||||||||||| ||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 141 tcctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 200

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| |||||||||||||||||||| || || || || ||||| | | |||||||||||
Sbjct: 201 gacccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatg 260



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
           ||||||| |||||||| ||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 224 tctccggagagcccccaagctacctcacaggagagttccccggtgactacggatgggaca 283

                                                                       
Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
           | ||||| ||||| |||||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 284 ccgccggtctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatcc 343

                              
Query: 364 attgccgatgggccatgct 382
           | ||| |||||||||||||
Sbjct: 344 actgcagatgggccatgct 362



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Plus

                                                                       
Query: 246 tccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacact 305
           ||||| |||||||||||||||||||| || |||||||| || ||||| || |||||||| 
Sbjct: 1   tccggagagcccccgagctacctcaccggagagttccccggagactacggatgggacacc 60

                                                                       
Query: 306 gccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccat 365
           ||||| || || |||||||| |||||||| |||| |||||| ||||| || || ||||| 
Sbjct: 61  gccggtctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccac 120

                              
Query: 366 tgccgatgggccatgctcg 384
           ||| |||||||||||||||
Sbjct: 121 tgcagatgggccatgctcg 139



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score =  117 bits (59), Expect = 3e-23
 Identities = 158/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           ||||| |||||||||||||| ||| ||||||||||    ||| | || ||| |||| |||
Sbjct: 203 tcctctggcagcccatggtatggtcctgaccgtgtcaagtacttggggccattctctggt 262

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||| | || || ||| | || ||||| |||||||| |||||||| ||||||||||| |||
Sbjct: 263 gagtctccaagttacttgacgggtgaattccctggtgactatggatgggacactgctgga 322

                                                                       
Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 371
           ||||||||||| || || || ||||||||||| || ||| ||||||||||||| ||| ||
Sbjct: 323 ctttcagctgatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcaga 382

                      
Query: 372 tgggccatgct 382
           ||||| |||||
Sbjct: 383 tgggctatgct 393



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score =  115 bits (58), Expect = 1e-22
 Identities = 118/138 (85%)
 Strand = Plus / Minus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| |||| |||||| |||| |||||| | || ||||| |||||||| ||||| |||
Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           ||||| || || ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499

                             
Query: 357 gtgatccattgccgatgg 374
           |||||||| ||| |||||
Sbjct: 498 gtgatccactgcagatgg 481



to top

>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score =  113 bits (57), Expect = 4e-22
 Identities = 99/113 (87%)
 Strand = Plus / Plus

                                                                       
Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
           ||||| ||||||||||| |||||||| ||||| ||||| ||||| ||||| |||||||| 
Sbjct: 556 actggcgagttccctggtgactatggatgggatactgctggactctcagccgaccctgaa 615

                                                                
Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||||| |||||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 616 acatttgccaggaaccgtgagcttgaggtgatccattgccgttgggcaatgct 668



to top

>gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-binding protein, 3' end
          Length = 810

 Score =  113 bits (57), Expect = 4e-22
 Identities = 99/113 (87%)
 Strand = Plus / Plus

                                                                       
Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
           ||||||||||| || || |||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 126 actggtgagtttccaggtgactatggatgggacactgccggactctcagctgaccctgag 185

                                                                
Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| | |||||| ||||| |||||||| ||||| || ||||| |||||
Sbjct: 186 acatttgcaaggaaccgtgagcttgaggtgatacattgtcgttgggctatgct 238



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  111 bits (56), Expect = 2e-21
 Identities = 128/152 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290
           |||||||||||  ||||||||||| | ||    |||||||| ||||||||||| ||||||
Sbjct: 210 tacctcggcccgttctccggtgaggcaccatcatacctcaccggtgagttccccggcgac 269

                                                                       
Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350
           || || |||||||| ||||| || ||||| ||||| ||||| || |||||||||||||||
Sbjct: 270 tacggctgggacaccgccgggctctcagcggaccccgagacattcgccaagaaccgggag 329

                                           
Query: 351 ctggaggtgatccattgccgatgggccatgct 382
           || ||||||||||| ||| | ||||| |||||
Sbjct: 330 ctcgaggtgatccactgcaggtgggcaatgct 361



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  111 bits (56), Expect = 2e-21
 Identities = 128/152 (84%)
 Strand = Plus / Plus

                                                                       
Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290
           |||||||||||  ||||||||||| | ||    |||||||| ||||||||||| ||||||
Sbjct: 45  tacctcggcccgttctccggtgaggcaccatcatacctcaccggtgagttccccggcgac 104

                                                                       
Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350
           || || |||||||| ||||| || ||||| ||||| ||||| || |||||||||||||||
Sbjct: 105 tacggctgggacaccgccgggctctcagcggaccccgagacattcgccaagaaccgggag 164

                                           
Query: 351 ctggaggtgatccattgccgatgggccatgct 382
           || ||||||||||| ||| | ||||| |||||
Sbjct: 165 ctcgaggtgatccactgcaggtgggcaatgct 196



to top

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           ||||||||||| ||||| ||||||||||| || ||||||||||||||||| ||||| |||
Sbjct: 12  tgggacactgctggactctcagctgacccagaaacctttgccaagaaccgtgagcttgag 71

                                   
Query: 357 gtgatccattgccgatgggccatg 380
           |||||||||||| |||||||||||
Sbjct: 72  gtgatccattgcagatgggccatg 95



to top

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score =  111 bits (56), Expect = 2e-21
 Identities = 152/184 (82%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||||||  | ||||||||    ||| | || ||| ||||||||||| |||
Sbjct: 199 gcagcccatggtacggcccagaccgtgttaagtacttgggtccattctccggtgagtccc 258

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | || ||||| ||||| || || || |||||||| ||||| ||||||||||
Sbjct: 259 caagctacttgaccggtgaattccccggtgattacgggtgggatactgctggactttcag 318

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | ||||| || ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 319 cagacccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 378

               
Query: 379 tgct 382
           ||||
Sbjct: 379 tgct 382



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Minus

                                                                         
Query: 237   ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
             |||||| |||||||||||||||||  |||| | || ||||||||||| || ||||| || 
Sbjct: 66182 ggcccattctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggc 66123

                                                                         
Query: 297   tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
             ||||||||||| || ||||| |||||||| ||||| || ||||||||||| ||||| |||
Sbjct: 66122 tgggacactgctgggctttctgctgaccccgagacattcgccaagaaccgtgagcttgag 66063

                     
Query: 357   gtgatcca 364
             ||||||||
Sbjct: 66062 gtgatcca 66055



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score =  111 bits (56), Expect = 2e-21
 Identities = 158/192 (82%)
 Strand = Plus / Plus

                                                                        
Query: 189  gtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctcc 248
            |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 881  gtttcctcaggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctca 940

                                                                        
Query: 249  ggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgcc 308
            |||||||||||   ||| ||||||||||| ||||| || |||||||| ||||||||||| 
Sbjct: 941  ggtgagcccccctcctatctcactggtgaattcccaggtgactatggttgggacactgct 1000

                                                                        
Query: 309  ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 368
            || ||||| |||||||| ||||| |||||||| ||||| || ||||| || ||||| | |
Sbjct: 1001 gggctttctgctgacccagagacttttgccaaaaaccgtgaactggaagtcatccactcc 1060

                        
Query: 369  cgatgggccatg 380
             |||||||||||
Sbjct: 1061 agatgggccatg 1072



to top

>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA,
           partial cds
          Length = 446

 Score =  109 bits (55), Expect = 7e-21
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| |||||||| ||||| |  |||||||| ||||||||||| ||| | || || |||
Sbjct: 288 taccttactggtgaattcccggaggactatggctgggacactgctggattatccgcagac 347

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |||||||| ||||| |||||||| |||||||||||||||||  ||||||||||||||||
Sbjct: 348 cctgagacatttgctaagaaccgtgagctggaggtgatccacagccgatgggccatgct 406



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score =  109 bits (55), Expect = 7e-21
 Identities = 154/187 (82%)
 Strand = Plus / Minus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| |||   ||| | || ||| ||||||| ||||||
Sbjct: 285 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 226

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 166

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 165 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 106

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 105 atgctcg 99



to top

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score =  109 bits (55), Expect = 7e-21
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           |||||||| ||||||||||| || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| || || |  ||||| || || ||||||||||||||||| |||||||||||
Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgct 379



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score =  109 bits (55), Expect = 7e-21
 Identities = 121/143 (84%)
 Strand = Plus / Plus

                                                                        
Query: 237  ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
            |||||| |||| |||||  |||| |||||| | |||||||||   ||||| ||||| || 
Sbjct: 1081 ggcccattctctggtgaagccccaagctacttgactggtgagaaacctggtgactacgga 1140

                                                                        
Query: 297  tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
            ||||||||||| |||||||||||||| || || || |||||||||||||| ||| |||||
Sbjct: 1141 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 1200

                                   
Query: 357  gtgatccattgccgatgggccat 379
            |||||||||||  ||||||||||
Sbjct: 1201 gtgatccattgtagatgggccat 1223



to top

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score =  109 bits (55), Expect = 7e-21
 Identities = 103/119 (86%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| ||||||||||| || || |||||||| ||||||||||| || ||||| ||||||
Sbjct: 241 taccttactggtgagtttccaggtgactatggctgggacactgctgggctttcggctgac 300

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |||||||| |||||||||||||| || || || |||||||| | | |||||||||||||
Sbjct: 301 cctgagacttttgccaagaaccgtgaacttgaagtgatccactccagatgggccatgct 359



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 375 gccatgctcg 384



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 313 gccatgctcg 322



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 375 gccatgctcg 384



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 375 gccatgctcg 384



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                         
Query: 195   tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
             ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 95437 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 95496

                                                                         
Query: 255   cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
             || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 95497 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 95556

                                                                         
Query: 315   tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
             || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 95557 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 95616

                       
Query: 375   gccatgctcg 384
             ||||||||||
Sbjct: 95617 gccatgctcg 95626



 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                         
Query: 198   ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
             |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 93868 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 93809

                                                                         
Query: 258   ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
             ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 93808 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 93749

                                                                         
Query: 318   gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
             || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 93748 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 93689

                    
Query: 378   atgctcg 384
             |||||||
Sbjct: 93688 atgctcg 93682



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Minus

                                                                         
Query: 195   tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
             ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 78765 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 78706

                                                                         
Query: 255   cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
             || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 78705 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 78646

                                                                         
Query: 315   tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
             || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 78645 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 78586

                       
Query: 375   gccatgctcg 384
             ||||||||||
Sbjct: 78585 gccatgctcg 78576



 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                         
Query: 198   ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
             |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 80334 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 80393

                                                                         
Query: 258   ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
             ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 80394 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 80453

                                                                         
Query: 318   gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
             || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 80454 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 80513

                    
Query: 378   atgctcg 384
             |||||||
Sbjct: 80514 atgctcg 80520



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 375 gccatgctcg 384



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 375 gccatgctcg 384



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score =  107 bits (54), Expect = 3e-20
 Identities = 150/182 (82%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||| ||| |||| |||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 263 agcccatggtatggtcctgatcgtgtcaagtacttgggcccattctctggtgaggcccca 322

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           |||||| | ||||||||||||||||| |||||||| ||||| ||||| ||||||||||| 
Sbjct: 323 agctacttgactggtgagttccctggtgactatggatgggatactgctggactttcagcc 382

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| |  || || |||||||||||| | |||||||| ||||| ||  ||||| |||||
Sbjct: 383 gacccagcaactttcgccaagaaccggaaactggaggtaatccactgtagatggaccatg 442

             
Query: 381 ct 382
           ||
Sbjct: 443 ct 444



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 433 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 492

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 493 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 552

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 553 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 612

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 613 gccatgctcg 622



to top

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score =  107 bits (54), Expect = 3e-20
 Identities = 149/180 (82%), Gaps = 3/180 (1%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||||||  | ||||||||    ||| | |||||| |||| |||||||||   
Sbjct: 466 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccc--- 522

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
           | ||||||||||||||| ||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 523 atctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 582

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           ||||| |||||||||||||||||||| || || || || ||||| | | |||||||||||
Sbjct: 583 gacccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatg 642



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score =  107 bits (54), Expect = 3e-20
 Identities = 156/190 (82%)
 Strand = Plus / Plus

                                                                       
Query: 195 tccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgag 254
           ||||||||||||||||||||  | ||||| ||    ||| | || ||| |||||||||||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 255 cccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactt 314
           || ||||||||||||||||| |||||||| || || || ||||||||||||||||| || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 315 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 374
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                     
Query: 375 gccatgctcg 384
           ||||||||||
Sbjct: 313 gccatgctcg 322



to top

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score =  107 bits (54), Expect = 3e-20
 Identities = 123/146 (84%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| ||||||||||| | || |||||| | ||  |||| |||||||| || ||||||
Sbjct: 311 ggcccattctccggtgagtctccaagctacttgaccagtgaattccctggtgattatggg 370

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           ||||| ||||| ||||||||||| || || || ||||||||||||||||| || || |||
Sbjct: 371 tgggatactgctggactttcagcagatccagaaacctttgccaagaaccgtgaactcgag 430

                                     
Query: 357 gtgatccattgccgatgggccatgct 382
           |||||||| ||| ||||||| |||||
Sbjct: 431 gtgatccactgcagatgggctatgct 456



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score =  105 bits (53), Expect = 1e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                       
Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
           ||||||||||||||||| || ||||||||||||||||| |||||||||||||| || || 
Sbjct: 715 actggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaa 774

                                                                
Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| |||||||| ||||| |||||||| || ||  ||||||| |||||
Sbjct: 775 acttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgct 827



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  105 bits (53), Expect = 1e-19
 Identities = 95/109 (87%)
 Strand = Plus / Plus

                                                                        
Query: 276  gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
            |||||||| |||||||| ||||||||||| ||||| || || || ||||| |||||||| 
Sbjct: 950  gagttccccggcgactacgggtgggacacggccggcctctccgccgacccggagaccttc 1009

                                                             
Query: 336  gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
            ||||||||||| ||||||||||| |||||  |||| |||||||||||||
Sbjct: 1010 gccaagaaccgcgagctggaggtcatccacagccggtgggccatgctcg 1058



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  105 bits (53), Expect = 1e-19
 Identities = 122/145 (84%)
 Strand = Plus / Plus

                                                                       
Query: 238 gcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggt 297
           ||||| |||| |||||||| ||   |||||| || || ||||||||||| ||||| || |
Sbjct: 1   gcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggtt 60

                                                                       
Query: 298 gggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggagg 357
           |||||||||| |||||||||||||| || |||||||| ||||||||||| ||| |||| |
Sbjct: 61  gggacactgctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaag 120

                                    
Query: 358 tgatccattgccgatgggccatgct 382
           ||||||| | |  ||||||||||||
Sbjct: 121 tgatccactccacatgggccatgct 145



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score =  105 bits (53), Expect = 1e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                        
Query: 270  actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
            ||||||||||||||||| || ||||||||||||||||| |||||||||||||| || || 
Sbjct: 2118 actggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaa 2177

                                                                 
Query: 330  acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
            || ||||| |||||||| ||||| |||||||| || ||  ||||||| |||||
Sbjct: 2178 acttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgct 2230



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score =  103 bits (52), Expect = 4e-19
 Identities = 151/184 (82%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 181 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 240

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | || ||||| || ||||| || || |||||||| || || ||||||||||
Sbjct: 241 caagctacttgaccggtgaatttcctggtgattacgggtgggataccgctggactttcag 300

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||| || |||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 301 cagaccctgaaacttttgccaagaaccgtgaacttgaggtgatccactgcagatgggcta 360

               
Query: 379 tgct 382
           ||||
Sbjct: 361 tgct 364



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score =  103 bits (52), Expect = 4e-19
 Identities = 148/180 (82%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||||||| ||||||| ||  | ||| | || ||||| ||||||||||| || 
Sbjct: 333 agcccatggtacggtcctgaccgagttttgtacttgggtccactttccggtgagccacca 392

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
              ||| | || |||||||||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 393 tcttacttgaccggtgagttccctggtgactatggttgggacactgctggactctcagct 452

                                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
           || || ||||||||||| | |||||| ||||| || || || || ||| |||||||||||
Sbjct: 453 gatcccgagacctttgctaggaaccgtgagctcgaagtcattcactgcagatgggccatg 512



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                        
Query: 198  ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
            |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 3111 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 3052

                                                                        
Query: 258  ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
            ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 3051 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 2992

                                                                        
Query: 318  gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
            || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 2991 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 2932

                   
Query: 378  atgctcg 384
            |||||||
Sbjct: 2931 atgctcg 2925



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Minus

                                                                        
Query: 198  ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
            |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 3150 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 3091

                                                                        
Query: 258  ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
            ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 3090 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 3031

                                                                        
Query: 318  gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
            || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 3030 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 2971

                   
Query: 378  atgctcg 384
            |||||||
Sbjct: 2970 atgctcg 2964



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 368 atgctcg 374



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 368 atgctcg 374



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 313 atgctcg 319



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 188 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 247

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 248 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 307

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 308 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 367

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 368 atgctcg 374



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 313 atgctcg 319



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 313 atgctcg 319



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 133 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 192

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 193 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 252

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 253 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 312

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 313 atgctcg 319



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 364 atgctcg 370



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 364 atgctcg 370



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 364 atgctcg 370



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 364 atgctcg 370



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 364 atgctcg 370



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 184 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 243

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 244 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 303

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 304 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 363

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 364 atgctcg 370



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 165 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 224

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 284

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 285 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 344

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 345 atgctcg 351



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 168 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 227

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 288 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 347

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 348 atgctcg 354



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score =  101 bits (51), Expect = 2e-18
 Identities = 153/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 433 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 492

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 493 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 552

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 553 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 612

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 613 atgctcg 619



to top

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||||||||| || |||||||| || || || ||||||||||| || || |||||||||
Sbjct: 543 tacctcactggagaattccctggtgattacggttgggacactgctgggctctcagctgac 602

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || |||||||||||||||||||| ||||| || || |||||||   |||||||||||||
Sbjct: 603 ccagagacctttgccaagaaccgtgagcttgaagttatccattcaagatgggccatgct 661



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  101 bits (51), Expect = 2e-18
 Identities = 156/191 (81%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           ||||| || ||||||||||| ||| ||||||||||    ||| | || ||| |||| || 
Sbjct: 338 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggtccattctctggg 397

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||| |||| |||||| | || |||||||| ||||| || || || ||||||||||| |||
Sbjct: 398 gagtccccaagctacttgaccggtgagtttcctggtgattacggatgggacactgctgga 457

                                                                       
Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 371
           ||||||||||||||||| || || || |||||||| ||| ||||||| || |||||  ||
Sbjct: 458 ctttcagctgaccctgaaacattcgctaagaaccgtgagttggaggttattcattgtaga 517

                      
Query: 372 tgggccatgct 382
           |||||||||||
Sbjct: 518 tgggccatgct 528



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 99.6 bits (50), Expect = 6e-18
 Identities = 164/202 (81%)
 Strand = Plus / Plus

                                                                       
Query: 183 aagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggccca 242
           |||||||| ||||| || ||||||||||||||  | ||||| ||    ||| | ||||||
Sbjct: 365 aagcaggtctcctcaggaagcccatggtacggcccagaccgagtcaagtacttgggccca 424

                                                                       
Query: 243 ctctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggac 302
            |||| || |||||||||  |||||| || ||||||||||| |||||||| || ||||||
Sbjct: 425 ttctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggctgggac 484

                                                                       
Query: 303 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 362
           ||||| || ||||| || ||||| || ||||| ||||||||||| || || || ||||||
Sbjct: 485 actgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaagtgatc 544

                                 
Query: 363 cattgccgatgggccatgctcg 384
           || | | | |||||||||||||
Sbjct: 545 cactccaggtgggccatgctcg 566



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 118/141 (83%)
 Strand = Plus / Plus

                                                                       
Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
           ||||||| ||||| ||||||||||| || || |||||||| || |||||||| |||||||
Sbjct: 13  tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72

                                                                       
Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
           | ||||| || || ||||| || |||||||| |||| |||||| ||||| || || ||||
Sbjct: 73  ccgccggtctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatcc 132

                                
Query: 364 attgccgatgggccatgctcg 384
           |  || |||||||||||||||
Sbjct: 133 acagcagatgggccatgctcg 153



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| || ||||| |||||||| ||||| |||||||| ||||| ||| | |||||||||
Sbjct: 745 tacctgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgac 804

                                                    
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatcca 364
           || ||||| |||||||||||||| ||||| |||||||||||
Sbjct: 805 ccagagacatttgccaagaaccgtgagcttgaggtgatcca 845



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 118/141 (83%)
 Strand = Plus / Plus

                                                                        
Query: 244  tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
            ||||||| |||||||| |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 1757 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1816

                                                                        
Query: 304  ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
            | || || || ||||||||||| ||||| || || |  ||||| ||||| || || ||||
Sbjct: 1817 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1876

                                 
Query: 364  attgccgatgggccatgctcg 384
            | ||| |||||||||||||||
Sbjct: 1877 actgcagatgggccatgctcg 1897



to top

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Plus

                                                                       
Query: 270 actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
           |||||||| |||||||| ||||| || ||||||||||| ||||| || || |||||||||
Sbjct: 208 actggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctgag 267

                                                                
Query: 330 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| || ||| | ||||| |||||||||||  ||||||||||||||||
Sbjct: 268 acatttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgct 320



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| ||||||||||| ||||    |||||||||||||| ||||| || |||||||| 
Sbjct: 227 ggcccattctccggtgaggccccatcttacctcactggtgaattcccaggtgactatggt 286

                                                    
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgc 337
           |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 287 tgggacactgccgggctttctgctgaccctgagacttttgc 327



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| ||||| ||||||||||| ||||| || ||||||||||| ||||| ||||| |||
Sbjct: 277 taccttactggagagttccctggtgactacggttgggacactgctggactatcagcagac 336

                                                    
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||| ||||| || |||||||| ||||| |||||||||||
Sbjct: 337 cctgaaaccttcgctaagaaccgtgagctcgaggtgatcca 377



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 118/141 (83%)
 Strand = Plus / Plus

                                                                        
Query: 244  tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
            ||||||| |||||||| |||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 1758 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1817

                                                                        
Query: 304  ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
            | || || || ||||||||||| ||||| || || |  ||||| ||||| || || ||||
Sbjct: 1818 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1877

                                 
Query: 364  attgccgatgggccatgctcg 384
            | ||| |||||||||||||||
Sbjct: 1878 actgcagatgggccatgctcg 1898



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 142/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           |||||||||||||| ||||||||  | ||||| ||    ||||| |||||  ||||||| 
Sbjct: 527 tcctccggcagcccctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggc 586

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||| | |||  |||||| || || |||||| | |||||||| || |||||||| ||||| 
Sbjct: 587 gaggcgccgtcctacctgaccggcgagttcgccggcgactacggctgggacaccgccggg 646

                                                                
Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           || || || ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 647 ctctcggccgaccccgagaccttcgccaagaaccgggagctggaggtgatcca 699



to top

>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding
           protein b, partial cds
          Length = 461

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Plus

                                                                       
Query: 288 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 347
           ||||| |||||||||||||| || |||||||||||||| || |||||||| |||||||| 
Sbjct: 1   gactacgggtgggacactgctgggctttcagctgacccggaaacctttgctaagaaccgt 60

                                            
Query: 348 gagctggaggtgatccattgccgatgggccatg 380
           ||||| ||||| || || |||||||||||||||
Sbjct: 61  gagcttgaggtcattcactgccgatgggccatg 93



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 279 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 338
           ||||| || ||||| || ||||||||||| ||||| ||||||||||| || ||||| |||
Sbjct: 532 ttccccggtgactacggatgggacactgctggactatcagctgacccggaaaccttcgcc 591

                                                       
Query: 339 aagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           | ||||||||||||||||||||| ||  || |||||||||||||
Sbjct: 592 aggaaccgggagctggaggtgattcacagcagatgggccatgct 635



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 135/164 (82%)
 Strand = Plus / Plus

                                                                       
Query: 201 agcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccg 260
           ||||||||||||||| | |||||||||   ||| | || ||| |||| ||||||||||||
Sbjct: 156 agcccatggtacggtccagaccgtgtgaagtacttagggccattctctggtgagcccccg 215

                                                                       
Query: 261 agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
              ||| | ||||| |||||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 216 tcgtacttgactggagagttcccaggtgactatggttgggacactgctgggctttctgct 275

                                                       
Query: 321 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||||| ||||| ||||| || ||||| || |||||||| |||||
Sbjct: 276 gacccagagacatttgcgaaaaaccgtgaactggaggtaatcca 319



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 279 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 338
           |||||||| |||||||| ||||||||||| ||||||||||| ||||| || |||||||||
Sbjct: 383 ttccctggtgactatggttgggacactgctggactttcagcagacccagaaacctttgcc 442

                                                       
Query: 339 aagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |  ||||| ||||| |||||||||||  || | |||||||||||
Sbjct: 443 agaaaccgtgagcttgaggtgatccacagcaggtgggccatgct 486



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 150/184 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 327 gcagcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtccc 386

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           | |||||| | || ||||| || ||||| || || |||||||| || || ||||||||||
Sbjct: 387 caagctacttgaccggtgaatttcctggtgattacgggtgggataccgctggactttcag 446

                                                                       
Query: 319 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 378
           | |||||||| || |||||||||||||| || || || |||||||| ||| ||||||| |
Sbjct: 447 cagaccctgaaacttttgccaagaaccgtgaacttgaagtgatccactgcagatgggcta 506

               
Query: 379 tgct 382
           ||||
Sbjct: 507 tgct 510



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 152/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 175 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 234

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 235 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 294

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| || ||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 295 gccgacccagaaaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 354

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 355 atgctcg 361



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 152/187 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| |||   ||| | || ||| ||||||| ||||||
Sbjct: 168 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 227

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| || ||||| |||| |||||| ||||  || || |||||  || ||||||||
Sbjct: 288 gccgacccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggcc 347

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 348 atgctcg 354



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 152/187 (81%)
 Strand = Plus / Minus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||| ||    ||| | || ||| ||||||| ||||||
Sbjct: 751 ggcagcccatggtacggatctgaccgagtcaagtacttgggtccattctccggcgagccc 692

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || ||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 691 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 632

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           || ||||| |||||||| |||| | |||| ||||| || || |||||  || ||||||||
Sbjct: 631 gccgacccagagaccttcgccagggaccgtgagctagaagttatccacagcagatgggcc 572

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 571 atgctcg 565



to top

>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein
           (CipLhcb2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1033

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| || ||||| |||||||| ||||| || |||||||| || ||| | |||||||||
Sbjct: 258 tacctgaccggtgaattccctggtgactacggatgggacacagctggattatcagctgac 317

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||||||| |||||| ||| |||||||||| ||  || |||||||||||||
Sbjct: 318 cctgaaacctttgccaggaaccgtgagttggaggtgattcacagcagatgggccatgct 376



to top

>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a,
             complete sequence
          Length = 48924

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                         
Query: 264   tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
             ||||| |||||||| |||||||| ||||| || |||||||| || ||| | |||||||||
Sbjct: 40107 tacctgactggtgaattccctggtgactacggatgggacacagctggattatcagctgac 40166

                                                                        
Query: 324   cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
             || || ||||| ||||||||||| ||||| |||||||| ||  || |||||||||||||
Sbjct: 40167 cccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgct 40225



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Plus

                                                                       
Query: 231 tacctcggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgac 290
           |||||||||||  ||||||| ||| ||||    |||||||| || |||||| | ||||||
Sbjct: 80  tacctcggccccttctccggcgaggccccctcatacctcaccggcgagttcgccggcgac 139

                                                                       
Query: 291 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 350
           || || |||||||| ||||| || || || ||||| |||||||| ||||||||||| |||
Sbjct: 140 tacggctgggacaccgccgggctctccgccgaccccgagaccttcgccaagaaccgcgag 199

                         
Query: 351 ctggaggtgatcca 364
           ||||||||||||||
Sbjct: 200 ctggaggtgatcca 213



to top

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                       
Query: 193 cctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtg 252
           ||||| ||||||| ||||||||  | ||||| ||||||||||||||||| |||||||| |
Sbjct: 172 cctccagcagcccgtggtacggccccgaccgcgtgctctacctcggcccgctctccggcg 231

                             
Query: 253 agcccccgagctacctca 270
           ||||||||||||||||||
Sbjct: 232 agcccccgagctacctca 249



 Score = 40.1 bits (20), Expect = 5.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 154 tcaccatgcgcaagaccgcagcaaaggc 181
           ||||||||||||||||||| || |||||
Sbjct: 139 tcaccatgcgcaagaccgcggccaaggc 166



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||| || ||||| || || || ||||| || ||||||||||| || ||||| |||||
Sbjct: 219 ctaccttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctga 278

                                                                 
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggc 376
           ||||||||| ||| | |||||||| ||||| |||||||| ||||||||||||||
Sbjct: 279 ccctgagacttttactaagaaccgtgagctcgaggtgattcattgccgatgggc 332



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 127/154 (82%)
 Strand = Plus / Plus

                                                                       
Query: 199 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccc 258
           ||||||||||||||||  | ||||||||    ||| | |||||| |||||||||||  ||
Sbjct: 192 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgagagcc 251

                                                                       
Query: 259 cgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcag 318
           |    |||||||| |||||||||||||| ||||| || ||||||||||| || |||||||
Sbjct: 252 catcatacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcag 311

                                             
Query: 319 ctgaccctgagacctttgccaagaaccgggagct 352
           ||||||| || ||||| || |||||||| |||||
Sbjct: 312 ctgacccagaaaccttcgctaagaaccgtgagct 345



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 132/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| |||
Sbjct: 185 tcctctggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 244

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           |||||||||   ||| | ||||| |||||||| || ||||| || ||||||||||| |||
Sbjct: 245 gagcccccgtcttacttgactggagagttcccaggtgactacggttgggacactgctgga 304

                                                    
Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagct 352
           ||||| |||||||| ||||| || ||||||||||| |||||
Sbjct: 305 ctttctgctgacccagagacattcgccaagaaccgtgagct 345



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 144/177 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 ggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctc 247
           ||||||||| || ||||||||||||||  | |||||||||   ||||| |||||| ||||
Sbjct: 179 ggtttcctctggaagcccatggtacggcccagaccgtgtgaagtacctgggcccattctc 238

                                                                       
Query: 248 cggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgc 307
            |||||| | ||    ||||| || || || ||||| || ||||||||||||||||||||
Sbjct: 239 gggtgaggctccttcttacctgacgggggaattcccaggtgactatgggtgggacactgc 298

                                                                    
Query: 308 cggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||| ||||| |||||||| ||||| |||||   |||||| || ||||| ||||||||
Sbjct: 299 cgggctttcggctgacccggagacatttgctcggaaccgtgaactggaagtgatcca 355



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 83/96 (86%)
 Strand = Plus / Plus

                                                                       
Query: 285 ggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaac 344
           |||||||| ||||||||||| ||||| || || || |||||||||||||| ||||| |||
Sbjct: 300 ggcgactacgggtgggacaccgccgggctctctgccgaccctgagaccttcgccaaaaac 359

                                               
Query: 345 cgggagctggaggtgatccattgccgatgggccatg 380
            | |||||||||||||||||  || |||||||||||
Sbjct: 360 agagagctggaggtgatccacagcagatgggccatg 395



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 127/155 (81%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| |||
Sbjct: 184 tcctcaggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 243

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           |||||||||   ||| | ||||| |||||||| || ||||| || ||||||||||| |||
Sbjct: 244 gagcccccgtcttacttgactggagagttcccaggtgactacggatgggacactgctgga 303

                                              
Query: 312 ctttcagctgaccctgagacctttgccaagaaccg 346
           ||||| |||||||| ||||| || |||||||||||
Sbjct: 304 ctttctgctgacccagagacattcgccaagaaccg 338



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||||||||||||||| || || || || || ||||||||||| || ||||| ||||| 
Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| || ||||||||||| ||||| |||||||| ||  || |||||||||||||
Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgct 346



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 145/179 (81%)
 Strand = Plus / Plus

                                                                       
Query: 204 ccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcccccgagc 263
           |||||||||||  ||||||||||    ||||| |||||| ||||||| ||| | ||    
Sbjct: 189 ccatggtacggccctgaccgtgtcaagtacctaggcccattctccggcgaggctccatca 248

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| || ||||| ||||| || ||||| || |||||||| ||||||||||| ||||| 
Sbjct: 249 tacctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgat 308

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || ||||| ||| |||||||||| ||||| ||||| ||||| ||| ||||||| |||||
Sbjct: 309 ccagagacattttccaagaaccgtgagcttgaggtcatccactgcagatgggcaatgct 367



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 162/202 (80%)
 Strand = Plus / Plus

                                                                       
Query: 183 aagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggccca 242
           |||||||  |||||||| ||||||||||||||  | ||||| ||    ||| | ||||||
Sbjct: 146 aagcaggcctcctccggaagcccatggtacggcccagaccgcgtcaagtacttgggccca 205

                                                                       
Query: 243 ctctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggac 302
            |||| || |||||||||  |||||||||||| |||||||| || ||||| || ||||||
Sbjct: 206 ttctctggcgagcccccgtcctacctcactggcgagttcccaggtgactacggctgggac 265

                                                                       
Query: 303 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 362
           ||||| || ||||| || ||||| || ||||| ||||  ||||  ||||| || ||||||
Sbjct: 266 actgctgggctttcggccgacccagaaaccttcgccagaaaccctgagctcgaagtgatc 325

                                 
Query: 363 cattgccgatgggccatgctcg 384
           || | | | |||||||||||||
Sbjct: 326 cactccaggtgggccatgctcg 347



to top

>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein,
           complete cds
          Length = 895

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 297 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 356
           ||||||||||| ||||| ||||||||||| ||||| ||||| |  ||||| ||||| |||
Sbjct: 293 tgggacactgctggactctcagctgaccccgagacatttgctagaaaccgtgagcttgag 352

                                     
Query: 357 gtgatccattgccgatgggccatgct 382
           ||||| |||||||| |||||||||||
Sbjct: 353 gtgattcattgccgttgggccatgct 378



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                       
Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
           ||||||| ||||| |||||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 13  tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72

                                                                       
Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
           | || || || || |||||||| ||||| ||||| | |||||| ||||| || || ||||
Sbjct: 73  cagctggcctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatcc 132

                                
Query: 364 attgccgatgggccatgctcg 384
           |  || | |||||||||||||
Sbjct: 133 acagcaggtgggccatgctcg 153



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                       
Query: 244 tctccggtgagcccccgagctacctcactggtgagttccctggcgactatgggtgggaca 303
           ||||||| ||||||||||||||||| || ||||||||||| || ||||| || |||||||
Sbjct: 209 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 268

                                                                       
Query: 304 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 363
           | ||  | || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 269 ccgcttgtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 328

                                
Query: 364 attgccgatgggccatgctcg 384
           |  || || ||||||||||||
Sbjct: 329 acagcagaagggccatgctcg 349



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                        
Query: 192  tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
            ||||| || ||||||||||||||  | ||||||||    ||| | |||||| ||||||||
Sbjct: 1449 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 1508

                                                                        
Query: 252  gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
            ||| | |||  |||| | ||||| |||||||| || ||||| || |||||||||||||||
Sbjct: 1509 gagtctccgtcctacttgactggagagttccccggtgactacggttgggacactgccgga 1568

                                                     
Query: 312  ctttcagctgaccctgagacctttgccaagaaccgggagct 352
            || || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 1569 ctctctgctgacccagagacattctccaagaaccgtgagct 1609



to top

>gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA
          Length = 454

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 237 ggcccactctccggtgagcccccgagctacctcactggtgagttccctggcgactatggg 296
           |||||| |||||||||||||||||  ||||||||||||||||||||| || |||||  | 
Sbjct: 265 ggcccattctccggtgagcccccgtcctacctcactggtgagttcccaggtgacta-cgc 323

                                        
Query: 297 tgggacactgccggactttcagctgaccc 325
           ||||||||||| || ||||| ||||||||
Sbjct: 324 tgggacactgctgggctttccgctgaccc 352



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 82/96 (85%)
 Strand = Plus / Plus

                                                                        
Query: 285  ggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaac 344
            |||||||| ||||||||||||||||| || || || || || |||||||| || || |||
Sbjct: 2494 ggcgactacgggtgggacactgccggcctctcggcggatccagagaccttcgcaaaaaac 2553

                                                
Query: 345  cgggagctggaggtgatccattgccgatgggccatg 380
             | ||||||||||||||||| ||| |||||||||||
Sbjct: 2554 agagagctggaggtgatccactgcagatgggccatg 2589



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 385 atgctcg 391



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| 
Sbjct: 186 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 245

                                  
Query: 312 ctttcagctgaccctgagacctt 334
           || || |||||||| ||||||||
Sbjct: 246 ctgtccgctgacccggagacctt 268



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 139 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 198

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 319 atgctcg 325



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 385 atgctcg 391



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| 
Sbjct: 236 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggc 177

                                  
Query: 312 ctttcagctgaccctgagacctt 334
           || || |||||||| ||||||||
Sbjct: 176 ctgtccgctgacccggagacctt 154



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| 
Sbjct: 184 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 243

                                  
Query: 312 ctttcagctgaccctgagacctt 334
           || || |||||||| ||||||||
Sbjct: 244 ctgtccgctgacccggagacctt 266



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 385 atgctcg 391



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 385 atgctcg 391



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 205 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 264

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 385 atgctcg 391



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 174 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 233

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 354 atgctcg 360



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 189 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 248

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 369 atgctcg 375



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 85  ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 144

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 265 atgctcg 271



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 150/187 (80%)
 Strand = Plus / Minus

                                                                         
Query: 198   ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
             |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 16776 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 16717

                                                                         
Query: 258   ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
             ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657

                                                                         
Query: 318   gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
             |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597

                    
Query: 378   atgctcg 384
             |||||||
Sbjct: 16596 atgctcg 16590



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                         
Query: 258   ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
             ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996

                                                
Query: 318   gctgaccctgagacctttgccaagaaccgggagct 352
             ||||| || ||||| || || | |||||| |||||
Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgtgagct 22031



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 100/124 (80%)
 Strand = Plus / Plus

                                                                         
Query: 261   agctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagct 320
             |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353

                                                                         
Query: 321   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 380
             ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 19354 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 19413

                 
Query: 381   ctcg 384
             ||||
Sbjct: 19414 ctcg 19417



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| || ||||| ||||| || || || || ||||||||||| ||||| |||||||||
Sbjct: 226 taccttacaggtgaattccccggtgattacggttgggacactgctggactctcagctgac 285

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           || || || || || |||||||| ||||| ||||||||||| ||| ||||||| |||||
Sbjct: 286 ccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatgct 344



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||||||||||||||||| ||||| |||||||| || ||||| || |||||||| ||||| 
Sbjct: 170 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 229

                                  
Query: 312 ctttcagctgaccctgagacctt 334
           || || |||||||| ||||||||
Sbjct: 230 ctgtccgctgacccggagacctt 252



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagacg 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |||||||||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| |||||||||||||| || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 277 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 336

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 337 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 386



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 ggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagccc 257
           |||||||||||||||||  ||||||||||    ||| | || ||| |||| || ||  | 
Sbjct: 356 ggcagcccatggtacggatctgaccgtgtcaagtacttgggtccattctctggcgaatca 415

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475

                         
Query: 318 gctgaccctgagac 331
           |||||||| |||||
Sbjct: 476 gctgaccccgagac 489



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 265 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagacg 324

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |||||||||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 325 tttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 374



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 92/110 (83%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 262 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagacg 321

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           |||||||||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 322 tttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 371



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||| || || |||||||| || ||||| ||||||||||| ||||| ||    || ||
Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437

                                                     
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatcca 479



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 131/162 (80%)
 Strand = Plus / Plus

                                                                        
Query: 191  ttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccgg 250
            |||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||||||
Sbjct: 1151 ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 1210

                                                                        
Query: 251  tgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgg 310
            |||| | ||   |||| | ||||| |||||||| || ||||| || ||||||||||||||
Sbjct: 1211 tgagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgg 1270

                                                      
Query: 311  actttcagctgaccctgagacctttgccaagaaccgggagct 352
            ||| || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 1271 actctctgctgacccagagacattctccaagaaccgtgagct 1312



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 130/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 192 tcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggt 251
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| ||||||||
Sbjct: 133 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 192

                                                                       
Query: 252 gagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgga 311
           ||| | ||   |||| | ||||| |||||||| || ||||| || |||||||||||||||
Sbjct: 193 gagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgga 252

                                                    
Query: 312 ctttcagctgaccctgagacctttgccaagaaccgggagct 352
           || || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 253 ctctctgctgacccagagacattctccaagaaccgtgagct 293



to top

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 300 gacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtg 359
           |||||||| ||||| |||||||||||||| || ||||| |||||||| ||| |||| |||
Sbjct: 1   gacactgctggactgtcagctgaccctgaaacttttgctaagaaccgtgagttggaagtg 60

                            
Query: 360 atccattgccgatgggc 376
           ||||| ||| |||||||
Sbjct: 61  atccactgcagatgggc 77



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 79/93 (84%)
 Strand = Plus / Plus

                                                                       
Query: 288 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 347
           ||||| ||||||||||| ||||| || || || ||||| |||||||| ||||| ||  | 
Sbjct: 18  gactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaaaaataga 77

                                            
Query: 348 gagctggaggtgatccattgccgatgggccatg 380
           ||||||||||||||||| ||| |||||||||||
Sbjct: 78  gagctggaggtgatccactgcagatgggccatg 110



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 100/121 (82%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| || |||| |||||| || ||||| || ||||||||||| || || || ||||| 
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92

                                                                       
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 383
           ||||| || || ||||||||||| ||||| ||||| |||||  || ||||||||||||||
Sbjct: 93  cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgctc 152

            
Query: 384 g 384
           |
Sbjct: 153 g 153



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| || ||||||||||| || || || || ||||| ||||| || 
Sbjct: 265 gagttccccggcgactacggatgggacactgctgggctgtcggcggacccagagactttc 324

                                        
Query: 336 gccaagaaccgggagctggaggtgatcca 364
           |||| |||||| |||||||||||||||||
Sbjct: 325 gccaggaaccgtgagctggaggtgatcca 353



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||| ||||| |||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 196 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 255

                       
Query: 323 ccctgagacctt 334
           ||| ||||||||
Sbjct: 256 cccggagacctt 267



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 220 ggtgagttcccgggtgactacgggtgggacacwgcggggctttcggcggatccggagact 279

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 280 tttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||| ||||| |||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 201 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 260

                       
Query: 323 ccctgagacctt 334
           ||| ||||||||
Sbjct: 261 cccggagacctt 272



to top

>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 732

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| |||||||| ||||| || || ||||| ||||||||||| ||  | || || || 
Sbjct: 136 taccttactggtgaattccccggtgattatggatgggacactgctggtttatctgcagat 195

                                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| || |||||||||||||| ||||| || |||||||| ||| ||||||| |||||
Sbjct: 196 cctgaaacatttgccaagaaccgtgagcttgaagtgatccactgcagatgggctatgct 254



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 104/127 (81%)
 Strand = Plus / Plus

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216

                                                                       
Query: 318 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 377
           ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||||
Sbjct: 217 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggcc 276

                  
Query: 378 atgctcg 384
           |||||||
Sbjct: 277 atgctcg 283



to top

>gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb2 mRNA, complete cds
          Length = 798

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||| |||||||| || ||||| |||||||| |||||||| || ||| | ||||||||
Sbjct: 201 ctacctgactggtgaatttcctggtgactatggatgggacacagctggattatcagctga 260

                                         
Query: 323 ccctgagacctttgccaagaaccgggagct 352
           |||||| || ||||| | |||||| |||||
Sbjct: 261 ccctgaaacatttgcaaggaaccgtgagct 290



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 301 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 360

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 361 tttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 410



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| |||||||||||||| || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | ||  |||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 340



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                        
Query: 273  ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
            ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 1379 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagact 1438

                                                              
Query: 333  tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
            ||||| |||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 1439 tttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 1488



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||  
Sbjct: 286 ggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagagaat 345

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 346 tttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 395



to top

>emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-binding protein
          Length = 2368

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 76/90 (84%)
 Strand = Plus / Plus

                                                                        
Query: 263  ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
            |||||| |||||||| || ||||| |||||||| |||||||| || ||| | ||||||||
Sbjct: 1104 ctacctgactggtgaatttcctggtgactatggatgggacacagctggattatcagctga 1163

                                          
Query: 323  ccctgagacctttgccaagaaccgggagct 352
            |||||| || ||||| | |||||| |||||
Sbjct: 1164 ccctgaaacatttgcaaggaaccgtgagct 1193



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                        
Query: 191  ttcctccggcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccgg 250
            |||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||||||
Sbjct: 850  ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 909

                                                                        
Query: 251  tgagcccccgagctacctcactggtgagttccctggcgactatgggtgggacactgccgg 310
            |||| | ||   |||| | || || |||||||| || ||||| || ||||||||||||||
Sbjct: 910  tgagtctccatcctacttgacaggagagttccccggtgactacggttgggacactgccgg 969

                                                      
Query: 311  actttcagctgaccctgagacctttgccaagaaccgggagct 352
            ||| || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 970  actctctgctgacccagagacattctccaagaaccgtgagct 1011



to top

>gb|AF526508.1| Vicia faba A-B binding protein (CHLOR1) mRNA, partial cds; nuclear
           gene for chloroplast product
          Length = 412

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||| ||||||||||| ||||| || ||||| |||||||| || ||| | |||||||||
Sbjct: 194 taccttactggtgagtttcctggtgattatggatgggacacagctggattatcagctgac 253

                                        
Query: 324 cctgagacctttgccaagaaccgggagct 352
           ||||| || ||||| | |||||| |||||
Sbjct: 254 cctgaaacatttgcaaggaaccgtgagct 282



to top

>gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlorophyll a/b-binding protein
           (ChBP) mRNA, complete cds
          Length = 411

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                       
Query: 278 gttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgc 337
           ||||||||| ||||| || ||||||||||| || || ||||| ||||| || ||||||||
Sbjct: 47  gttccctggtgactacggatgggacactgctgggctatcagcagaccccgaaacctttgc 106

                    
Query: 338 caagaaccg 346
           |||||||||
Sbjct: 107 caagaaccg 115



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 90/109 (82%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||||||||||||||| || || || || || ||||| ||| | || 
Sbjct: 274 gagttcccgggcgactatgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 382



to top

>emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 gene for chlorophyll
           a/b-binding protein
          Length = 741

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 57/64 (89%), Gaps = 2/64 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   atctccacactcactcctct--ttgagaacccatacagcggagacttcacttagctttcc 58
           |||||||||||||||| |||  ||||||||||||| ||| || ||||| |||||||||||
Sbjct: 678 atctccacactcactcatctccttgagaacccatatagcagacacttcgcttagctttcc 737

               
Query: 59  aatg 62
           ||||
Sbjct: 738 aatg 741



to top

>emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20, COMPLETE SEQUENCE
          Length = 127003

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                         
Query: 270   actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
             |||||||| || ||||| || ||||| |||||||| || ||| | |||||||||||||| 
Sbjct: 51329 actggtgaatttcctggtgattatggatgggacacagctggattatcagctgaccctgaa 51388

                                                                  
Query: 330   acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
             |||||||| | |||||| ||||| || || || ||  || |||||||||||||
Sbjct: 51389 acctttgcaaggaaccgtgagcttgaagtaattcacagcagatgggccatgct 51441



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 288 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 347
           ||||| ||||||||||| ||||| || || || || || |||||||| ||||| ||| | 
Sbjct: 169 gactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaaaaacaga 228

                                            
Query: 348 gagctggaggtgatccattgccgatgggccatg 380
           ||||||||||||||||| | | |||||||||||
Sbjct: 229 gagctggaggtgatccactccagatgggccatg 261



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| || ||||| || ||||||||||| |||||||| || || || ||||| |||
Sbjct: 104 gagttcccaggtgactacggttgggacactgctggactttctgccgatccagagacattt 163

                            
Query: 336 gccaagaaccgggagct 352
           ||||||||||| |||||
Sbjct: 164 gccaagaaccgtgagct 180



to top

>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                        
Query: 270  actggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 329
            |||||||| || ||||| || ||||| ||||| ||||| |||||||| || || || || 
Sbjct: 2759 actggtgaatttcctggtgattatggttgggatactgctggactttcggccgatccagaa 2818

                                                                 
Query: 330  acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
            || |||||||| ||||| ||||| ||||| || || ||| |||||||||||||
Sbjct: 2819 acttttgccaaaaaccgtgagctagaggttattcactgcagatgggccatgct 2871



to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 80/96 (83%)
 Strand = Plus / Plus

                                                                       
Query: 285 ggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaac 344
           |||||||| ||||||||||||||||   | || || || || |||||||| || || |||
Sbjct: 275 ggcgactacgggtgggacactgccgccgtctcggcggatccagagaccttcgcaaaaaac 334

                                               
Query: 345 cgggagctggaggtgatccattgccgatgggccatg 380
            | ||||||||||||||||| ||| |||||||||||
Sbjct: 335 agagagctggaggtgatccactgcagatgggccatg 370



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           ||||||||  ||||||||| |||| || || || ||||||||||| ||||| ||| | ||
Sbjct: 249 ctacctcaacggtgagttcgctggtgattacggctgggacactgctggactctcatccga 308

                                                                       
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||| |||||||| |||   ||||| ||||| |||||||||||    ||||||||||||||
Sbjct: 309 ccccgagaccttcgcccgcaaccgcgagctcgaggtgatccacgctcgatgggccatgct 368



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 147 gcccgagtcaccatgcgcaagaccg 171
           ||||| |||||||||||||||||||
Sbjct: 139 gcccgcgtcaccatgcgcaagaccg 163



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                              
Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352
           ||||| || ||||| || || | |||||| |||||
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagct 346



to top

>gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding protein II 1 mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1284

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||||||||||||||||||||| ||||| || ||||| |||   |||||||| |||||
Sbjct: 448 ctacctcactggtgagttccctggagactacggatgggatactcagggactttccgctga 507

              
Query: 323 ccc 325
           |||
Sbjct: 508 ccc 510



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258

                                              
Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352
           ||||| || ||||| || || | |||||| |||||
Sbjct: 259 gctgatcccgagacattcgcaaggaaccgtgagct 293



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                              
Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352
           ||||| || ||||| || || | |||||| |||||
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagct 346



to top

>gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting complex protein LHCG4 mRNA,
           complete cds
          Length = 1191

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||||||||||||||||||||| ||||| || ||||| |||   |||||||| |||||
Sbjct: 443 ctacctcactggtgagttccctggagactacggatgggatactcagggactttccgctga 502

              
Query: 323 ccc 325
           |||
Sbjct: 503 ccc 505



to top

>emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b binding polypeptide of
           photosystem II (LHCP-II AB10)
          Length = 1306

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 264 tacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 323
           ||||||||||| || |||||||| || || || ||||||||||| || || |||||  ||
Sbjct: 555 tacctcactggagaattccctggtgattacggttgggacactgctggcctctcagcctac 614

                                                      
Query: 324 cctgagacctttgccaagaaccgggagctggaggtgatccatt 366
           || |||||||| || |||||||| ||||| || || |||||||
Sbjct: 615 ccagagaccttcgctaagaaccgtgagcttgaagtcatccatt 657



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464

                                              
Query: 318 gctgaccctgagacctttgccaagaaccgggagct 352
           ||||| || ||||| || || | |||||| |||||
Sbjct: 465 gctgatcccgagacattcgcaaggaaccgtgagct 499



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 294 gggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctg 353
           ||||||||||| |||||||| || || ||||| |||||||| ||||| ||  | ||||||
Sbjct: 141 gggtgggacaccgccggactctcggccgacccagagaccttcgccaaaaatagagagctg 200

                      
Query: 354 gaggtgatcca 364
           |||||||||||
Sbjct: 201 gaggtgatcca 211



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| |||||||| || || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcggatccggagaca 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggagaca 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 273 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 332
           ||||||||||| || ||||| ||||||||||| || || ||||| || || || ||||| 
Sbjct: 231 ggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggagaca 290

                                                             
Query: 333 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 291 tttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||| || || |||||||| || ||||| || ||||||||||| || || || |||||
Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262

                                                     
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||| ||||||||    ||| |||| |||||||||||||||||
Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatcca 304



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 129/162 (79%)
 Strand = Plus / Plus

                                                                       
Query: 219 gaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcactggtgag 278
           ||||||||||| ||  | || ||| ||||||| ||||| |||   ||||| || ||||| 
Sbjct: 197 gaccgtgtgctgtatttgggtccattctccggggagccaccgtcgtacctaaccggtgaa 256

                                                                       
Query: 279 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 338
           ||||| || ||||| ||||||||||| || || || || || || || ||||| || || 
Sbjct: 257 ttcccgggtgactacgggtgggacacggcggggctgtcggcagatccggagacgttcgcg 316

                                                     
Query: 339 aagaaccgggagctggaggtgatccattgccgatgggccatg 380
           |||||| | |||||||| ||||||||  ||||||||||||||
Sbjct: 317 aagaacagagagctggaagtgatccacggccgatgggccatg 358



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 ctacctcactggtgagttccctggcgactatgggtgggacactgccggactttcagctga 322
           |||||||||||| |||||||| || || || || ||||||||||| ||  | || || ||
Sbjct: 290 ctacctcactggcgagttccccggtgattacggctgggacactgctggcttgtcggcgga 349

                                                     
Query: 323 ccctgagacctttgccaagaaccgggagctggaggtgatcca 364
           ||| || ||||| || ||||| |||||||||||||| |||||
Sbjct: 350 cccagaaaccttcgctaagaatcgggagctggaggtcatcca 391



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 87/106 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 agttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttg 336
           ||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || |
Sbjct: 256 agttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttcg 315

                                                         
Query: 337 ccaagaaccgggagctggaggtgatccattgccgatgggccatgct 382
           | | |||| ||||||||||||||||||| | ||| ||||| |||||
Sbjct: 316 cgaggaacagggagctggaggtgatccactcccggtgggcaatgct 361



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 245 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 304

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 305 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 353



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 377



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 269 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 328

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 329 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 377



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 271 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 330

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 331 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 379



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 382



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 274 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 382



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 276 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 335

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 336 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 384



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                       
Query: 276 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
           |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 309 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 368

                                                            
Query: 336 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
           || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 369 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 417



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                         
Query: 276   gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
             |||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || 
Sbjct: 79556 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 79497

                                          
Query: 336   gccaagaaccgggagctggaggtgatcca 364
             || | |||| |||||||||||||||||||
Sbjct: 79496 gcgaggaacagggagctggaggtgatcca 79468



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                            
Query: 276      gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
                |||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || 
Sbjct: 21808260 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 21808319

                                             
Query: 336      gccaagaaccgggagctggaggtgatcca 364
                || | |||| |||||||||||||||||||
Sbjct: 21808320 gcgaggaacagggagctggaggtgatcca 21808348



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 89/109 (81%)
 Strand = Plus / Plus

                                                                            
Query: 276      gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
                |||||||| |||||||| ||||||||||| || || || || || ||||| ||| | || 
Sbjct: 22434282 gagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcgttc 22434341

                                                                 
Query: 336      gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcg 384
                || | |||| ||| |||||||||||||||  |||| ||||| |||||||
Sbjct: 22434342 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcg 22434390



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                            
Query: 276      gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 335
                |||||||| || ||||| ||||||||||| || || || || || ||||| ||||| || 
Sbjct: 21801289 gagttcccgggagactacgggtgggacacggcggggctatcggccgacccggagacgttc 21801348

                                             
Query: 336      gccaagaaccgggagctggaggtgatcca 364
                || | |||| |||||||||||||||||||
Sbjct: 21801349 gcgaggaacagggagctggaggtgatcca 21801377



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 258 ccgagctacctcactggtgagttccctggcgactatgggtgggacactgccggactttca 317
           ||||||||||| || || |||||||| || ||||| || ||||||||||| | |||||||
Sbjct: 677 ccgagctaccttaccggagagttccccggagactacggatgggacactgctgtactttca 618

                
Query: 318 gctga 322
           |||||
Sbjct: 617 gctga 613


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,794,918
Number of Sequences: 3902068
Number of extensions: 2794918
Number of successful extensions: 49819
Number of sequences better than 10.0: 322
Number of HSP's better than 10.0 without gapping: 322
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 49096
Number of HSP's gapped (non-prelim): 634
length of query: 384
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 362
effective length of database: 17,147,199,772
effective search space: 6207286317464
effective search space used: 6207286317464
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top