ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet97g06 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 291 bits (147), Expect = 8e-76 Identities = 195/211 (92%) Strand = Plus / Plus Query: 169 ccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgt 228 |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| Sbjct: 956 ccttcggcgagggccgcatcaccatgcgcaagaccgtgggcaagcccaaggtggcggcgt 1015 Query: 229 ccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacc 288 || ||||||| ||||||||| |||||||||| ||||||||||| |||||||||| | Sbjct: 1016 ccggcagcccctggtacggccccgaccgcgtcaagtacctcggccccttctccggcgagc 1075 Query: 289 ccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgt 348 |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| Sbjct: 1076 ccccgagctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgt 1135 Query: 349 ccgctgaccccgagaccttcgccaagaaccg 379 |||| ||||||||||| |||||||||||||| Sbjct: 1136 ccgccgaccccgagacattcgccaagaaccg 1166 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 108 accatggcgctctcctccccggcgatggccggcacccc 145 ||||||||| |||||||| ||||||||||||||||||| Sbjct: 904 accatggcgatctcctccacggcgatggccggcacccc 941
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 287 bits (145), Expect = 1e-74 Identities = 199/217 (91%) Strand = Plus / Plus Query: 163 cggcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtgg 222 |||||| |||||| |||| ||| |||||||||||||||| |||| |||| ||||| || Sbjct: 134 cggcgctcttcggggaggcgcgcgtcaccatgcgcaagaccgcggccaaggccaagccgg 193 Query: 223 cggcgtccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccg 282 | ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 194 tgtcgtccggcagcccgtggtacgggtccgaccgcgtgctctacctcggcccgctctccg 253 Query: 283 gcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcgg 342 |||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| Sbjct: 254 gcgaccccccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcgg 313 Query: 343 ggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||||| || |||||||||||||||||||||||||| Sbjct: 314 ggctgtcggccgaccccgagaccttcgccaagaaccg 350
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 248 bits (125), Expect = 1e-62 Identities = 188/209 (89%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtcc 230 ||||||||||| |||||||||||||||||| |||||| ||||||||| || ||||| Sbjct: 64 ttcggcgaggggcgcatcaccatgcgcaagtcggcggcgaagcccaagcccgccgcgtcg 123 Query: 231 agcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccc 290 | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 124 gggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccg 183 Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| ||| Sbjct: 184 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 243 Query: 351 gctgaccccgagaccttcgccaagaaccg 379 || ||||| ||||| |||||||||||||| Sbjct: 244 gccgacccggagacgttcgccaagaaccg 272
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 248 bits (125), Expect = 1e-62 Identities = 188/209 (89%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtcc 230 ||||||||||| |||||||||||||||||| |||||| ||||||||| || ||||| Sbjct: 23603607 ttcggcgaggggcgcatcaccatgcgcaagtcggcggcgaagcccaagcccgccgcgtcg 23603666 Query: 231 agcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccc 290 | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 23603667 gggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccg 23603726 Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| ||| Sbjct: 23603727 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 23603786 Query: 351 gctgaccccgagaccttcgccaagaaccg 379 || ||||| ||||| |||||||||||||| Sbjct: 23603787 gccgacccggagacgttcgccaagaaccg 23603815 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 30024410 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 30024469 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 30024470 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 30024529 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 30024530 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 30024589 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 30024590 tcggccgacccggagacgttcgccaagaaccg 30024621 Score = 63.9 bits (32), Expect = 3e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 236 cccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||||||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 37443416 cccgtggtacggccccgaccgcgtcatctacctccgcccgctctccgg 37443369
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 248 bits (125), Expect = 1e-62 Identities = 188/209 (89%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtcc 230 ||||||||||| |||||||||||||||||| |||||| ||||||||| || ||||| Sbjct: 66306 ttcggcgaggggcgcatcaccatgcgcaagtcggcggcgaagcccaagcccgccgcgtcg 66365 Query: 231 agcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccc 290 | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 66366 gggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccg 66425 Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| ||| Sbjct: 66426 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 66485 Query: 351 gctgaccccgagaccttcgccaagaaccg 379 || ||||| ||||| |||||||||||||| Sbjct: 66486 gccgacccggagacgttcgccaagaaccg 66514
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 248 bits (125), Expect = 1e-62 Identities = 188/209 (89%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtcc 230 ||||||||||| |||||||||||||||||| |||||| ||||||||| || ||||| Sbjct: 135 ttcggcgaggggcgcatcaccatgcgcaagtcggcggcgaagcccaagcccgccgcgtcg 194 Query: 231 agcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccc 290 | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 195 gggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccg 254 Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| ||| Sbjct: 255 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 314 Query: 351 gctgaccccgagaccttcgccaagaaccg 379 || ||||| ||||| |||||||||||||| Sbjct: 315 gccgacccggagacgttcgccaagaaccg 343
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 248 bits (125), Expect = 1e-62 Identities = 188/209 (89%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtcc 230 ||||||||||| |||||||||||||||||| |||||| ||||||||| || ||||| Sbjct: 134 ttcggcgaggggcgcatcaccatgcgcaagtcggcggcgaagcccaagcccgccgcgtcg 193 Query: 231 agcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccc 290 | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| || Sbjct: 194 gggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccg 253 Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| ||| Sbjct: 254 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 313 Query: 351 gctgaccccgagaccttcgccaagaaccg 379 || ||||| ||||| |||||||||||||| Sbjct: 314 gccgacccggagacgttcgccaagaaccg 342
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 73 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 132 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 133 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 192 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 193 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 252 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 253 tcggccgacccggagacgttcgccaagaaccg 284
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Minus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 14601 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 14542 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 14541 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 14482 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 14481 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 14422 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 14421 tcggccgacccggagacgttcgccaagaaccg 14390
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 20400 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 20459 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 20460 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 20519 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 20520 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 20579 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 20580 tcggccgacccggagacgttcgccaagaaccg 20611
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 154 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 213 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 214 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 273 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 274 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 333 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 334 tcggccgacccggagacgttcgccaagaaccg 365
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 154 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 213 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 214 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 273 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 274 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 333 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 334 tcggccgacccggagacgttcgccaagaaccg 365
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 156 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 215 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 216 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 275 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 276 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 335 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 336 tcggccgacccggagacgttcgccaagaaccg 367
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 234 bits (118), Expect = 2e-58 Identities = 189/212 (89%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 156 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 215 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 216 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 275 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||| Sbjct: 276 ccgccgtcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 335 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 336 tcggccgacccggagacgttcgccaagaaccg 367
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 226 bits (114), Expect = 4e-56 Identities = 188/212 (88%), Gaps = 3/212 (1%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||||||| |||| ||||||||| |||||| |||||||||| | |||||| Sbjct: 115 ttcggcgagggccgcgtcacgatgcgcaagtcggcggccaagcccaagcccgccgcggcg 174 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 175 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgag 234 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 || ||| ||||||||||||||||||| ||| ||||||||||||||||||||| |||||| Sbjct: 235 ccgccgtcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctg 294 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || || ||||| ||||| |||||||||||||| Sbjct: 295 tcggccgacccggagacgttcgccaagaaccg 326
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 10793051 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 10793110 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 10793111 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 10793170 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 10793171 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 10793230 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 10793231 gggctctccgccgacccggagacgttcgccaagaaccg 10793268 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 10792987 ggccgcggccaccatggcgctctcctccccggtgatggcc 10793026
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 16774 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 16833 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 16834 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 16893 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 16894 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 16953 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 16954 gggctctccgccgacccggagacgttcgccaagaaccg 16991 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 16710 ggccgcggccaccatggcgctctcctccccggtgatggcc 16749
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 129669 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 129728 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 129729 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 129788 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 129789 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 129848 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 129849 gggctctccgccgacccggagacgttcgccaagaaccg 129886 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 129605 ggccgcggccaccatggcgctctcctccccggtgatggcc 129644
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 119 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 178 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 179 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 238 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 239 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 298 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 299 gggctctccgccgacccggagacgttcgccaagaaccg 336 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 55 ggccgcggccaccatggcgctctcctccccggtgatggcc 94
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 124 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 183 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 184 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 243 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 244 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 303 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 304 gggctctccgccgacccggagacgttcgccaagaaccg 341 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 60 ggccgcggccaccatggcgctctcctccccggtgatggcc 99
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 126 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 185 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 186 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 245 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 246 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 305 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 306 gggctctccgccgacccggagacgttcgccaagaaccg 343 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 62 ggccgcggccaccatggcgctctcctccccggtgatggcc 101
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 124 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 183 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 184 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 243 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 244 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 303 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 304 gggctctccgccgacccggagacgttcgccaagaaccg 341 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 60 ggccgcggccaccatggcgctctcctccccggtgatggcc 99
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 214 bits (108), Expect = 2e-52 Identities = 191/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 105 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 164 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 165 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 224 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 225 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 284 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 285 gggctctccgccgacccggagacgttcgccaagaaccg 322 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 41 ggccgcggccaccatggcgctctcctccccggtgatggcc 80
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 212 bits (107), Expect = 6e-52 Identities = 189/215 (87%), Gaps = 6/215 (2%) Strand = Plus / Plus Query: 171 ttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcggcg 227 ||||||||||| |||||||||||||||||| |||||| ||||||||| | ||| || Sbjct: 558 ttcggcgaggggcgcatcaccatgcgcaagtcggcggcgaagcccaagcccgccgcgtcg 617 Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggc--- 284 || | ||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 618 tcggggagcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgc 677 Query: 285 gaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcgggg 344 || || ||||||||||| |||||||||||||||| ||||||||| ||||||||||||||| Sbjct: 678 gagccgccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcgggg 737 Query: 345 ctgtccgctgaccccgagaccttcgccaagaaccg 379 || ||||| ||||| ||||| |||||||||||||| Sbjct: 738 ctctccgccgacccggagacgttcgccaagaaccg 772
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 206 bits (104), Expect = 4e-50 Identities = 190/218 (87%), Gaps = 3/218 (1%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 124 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 183 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| ||||||||||||||||||||| Sbjct: 184 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcc 243 Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||||| Sbjct: 244 ggcgagccgccgagctacctcaccggcgagttcccgggcgactacgggtgggacaccgcg 303 Query: 342 gggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||| ||||| ||||| ||||| ||||||||||||| Sbjct: 304 gggctctccgccgacccggagacgctcgccaagaaccg 341 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 60 ggccgcggccaccatggcgctctcctccccggtgatggcc 99
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 204 bits (103), Expect = 1e-49 Identities = 186/213 (87%), Gaps = 3/213 (1%) Strand = Plus / Plus Query: 170 cttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcg-- 227 ||||||||||| |||| | || |||||||||||||||| ||| | ||| ||||||| Sbjct: 84 cttcggcgaggcccgcgtgacgatgcgcaagacggcggcgaaggcaaagccggcggcgag 143 Query: 228 -tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcga 286 ||| ||||||||||||||||| ||||||||||||||||||| ||||| || |||||||| Sbjct: 144 ctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccggcga 203 Query: 287 ccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggct 346 |||||||||||||| || ||||||||||| | ||||||||||||||||||||||||||| Sbjct: 204 gcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggct 263 Query: 347 gtccgctgaccccgagaccttcgccaagaaccg 379 ||| || ||||| ||||| |||||||||||||| Sbjct: 264 gtcggcggacccggagacgttcgccaagaaccg 296
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 202 bits (102), Expect = 6e-49 Identities = 183/210 (87%) Strand = Plus / Plus Query: 170 cttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtc 229 ||||||||||||||||||||||||||||||||| || | |||||||||| |||| || Sbjct: 1998 cttcggcgagggccgcatcaccatgcgcaagaccgccgccaagcccaagccggcgcgctc 2057 Query: 230 cagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgaccc 289 | ||||||| |||||||| |||||||||| || ||||| |||||||| |||||| || Sbjct: 2058 cggcagcccctggtacggtgccgaccgcgtcctgtacctgggcccgctgtccggctcacc 2117 Query: 290 cccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtc 349 ||||||||||| |||||||||||||||| ||||||||| |||||||||| ||||||||| Sbjct: 2118 tccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgaggggctgtc 2177 Query: 350 cgctgaccccgagaccttcgccaagaaccg 379 || ||||| |||||||||||||||||||| Sbjct: 2178 ggcggacccggagaccttcgccaagaaccg 2207
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 198 bits (100), Expect = 9e-48 Identities = 186/214 (86%), Gaps = 3/214 (1%) Strand = Plus / Plus Query: 169 ccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaag---gtggcgg 225 |||||||||||| |||| | || |||||||||||||||| ||| ||||| | ||||| Sbjct: 135 ccttcggcgaggcccgcgtgacgatgcgcaagacggcggcgaaggccaagccagcggcgg 194 Query: 226 cgtccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcg 285 ||||| | ||||||||||||||| ||||||||||||| ||||| ||||| || ||||||| Sbjct: 195 cgtccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcg 254 Query: 286 accccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggc 345 | || ||||||||||| || ||||||||||| | |||||||||||||||||||||||||| Sbjct: 255 agccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggc 314 Query: 346 tgtccgctgaccccgagaccttcgccaagaaccg 379 |||| || ||||| ||||| |||||||||||||| Sbjct: 315 tgtcggcggacccggagacgttcgccaagaaccg 348
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 192 bits (97), Expect = 6e-46 Identities = 191/221 (86%), Gaps = 6/221 (2%) Strand = Plus / Plus Query: 165 gcgcccttcggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcg 224 |||| ||||||||||| || ||||||||||||||||| || | ||||||||| |||| Sbjct: 513 gcgctcttcggcgaggcgcggatcaccatgcgcaagaccgccgcgaagcccaagccggcg 572 Query: 225 gcgtcca---gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctcc 281 ||||| | ||||||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 573 gcgtcgtcggggagcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcg 632 Query: 282 ggc---gaccccccgagctacctcaccggcgagttccccgacgactacggctgggacacc 338 ||| || || |||||||||||||||||||||||||||| ||||||||| ||||||||| Sbjct: 633 ggccgcgagccgccgagctacctcaccggcgagttccccggcgactacgggtgggacacc 692 Query: 339 gcggggctgtccgctgaccccgagaccttcgccaagaaccg 379 |||||||| ||||| ||||| ||||| |||||||||||||| Sbjct: 693 gcggggctctccgccgacccggagacgttcgccaagaaccg 733 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Plus Query: 98 ggccgcggcgaccatggcgctctcctccccggcgatggcc 137 ||||||||| |||||||||||||||||||||| ||||||| Sbjct: 449 ggccgcggccaccatggcgctctcctccccggtgatggcc 488
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 184 bits (93), Expect = 1e-43 Identities = 167/191 (87%), Gaps = 3/191 (1%) Strand = Plus / Plus Query: 192 atgcgcaagacggcgggcaagcccaag---gtggcggcgtccagcagcccgtggtacggc 248 |||||||||||||||| ||| ||||| | |||||||||| | ||||||||||||||| Sbjct: 1106 atgcgcaagacggcggcgaaggccaagccagcggcggcgtccgggagcccgtggtacggc 1165 Query: 249 tccgaccgcgtgctctacctcggcccgctctccggcgaccccccgagctacctcaccggc 308 ||||||||||||| ||||| ||||| || |||||||| || ||||||||||| || ||| Sbjct: 1166 cccgaccgcgtgctgtacctgggcccactgtccggcgagccgccgagctacctgacgggc 1225 Query: 309 gagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||| | |||||||||||||||||||||||||||||| || ||||| ||||| ||| Sbjct: 1226 gagttcccgggcgactacggctgggacaccgcggggctgtcggcggacccggagacgttc 1285 Query: 369 gccaagaaccg 379 ||||||||||| Sbjct: 1286 gccaagaaccg 1296
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 184 bits (93), Expect = 1e-43 Identities = 167/191 (87%), Gaps = 3/191 (1%) Strand = Plus / Plus Query: 192 atgcgcaagacggcgggcaagcccaag---gtggcggcgtccagcagcccgtggtacggc 248 |||||||||||||||| ||| ||||| | |||||||||| | ||||||||||||||| Sbjct: 1106 atgcgcaagacggcggcgaaggccaagccagcggcggcgtccgggagcccgtggtacggc 1165 Query: 249 tccgaccgcgtgctctacctcggcccgctctccggcgaccccccgagctacctcaccggc 308 ||||||||||||| ||||| ||||| || |||||||| || ||||||||||| || ||| Sbjct: 1166 cccgaccgcgtgctgtacctgggcccactgtccggcgagccgccgagctacctgacgggc 1225 Query: 309 gagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||| | |||||||||||||||||||||||||||||| || ||||| ||||| ||| Sbjct: 1226 gagttcccgggcgactacggctgggacaccgcggggctgtcggcggacccggagacgttc 1285 Query: 369 gccaagaaccg 379 ||||||||||| Sbjct: 1286 gccaagaaccg 1296
>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni Length = 312 Score = 176 bits (89), Expect = 3e-41 Identities = 164/188 (87%), Gaps = 7/188 (3%) Strand = Plus / Plus Query: 180 ggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtccagcagcccg 239 ||||||||||||||||||||||| |||| |||||| || | |||||||||||| Sbjct: 132 ggccgcatcaccatgcgcaagaccgcgg------ccaaggctgccacctccagcagcccg 185 Query: 240 tggtacggctccgaccgcgtgctctacctcggcccgctctccggcgaccccccgagctac 299 ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 186 tggtacggccccgaccgcgtgctctacctcggcccgctctccggcgagcccccgagctac 245 Query: 300 ctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgacccc 359 |||| ||||||||| || | ||| ||||||||||||||||| ||| | || |||||||| Sbjct: 246 ctcagcggcgagtt-ccgggcgattacggctgggacaccgcaggggtctctgctgacccg 304 Query: 360 gagacctt 367 |||||||| Sbjct: 305 gagacctt 312 Score = 50.1 bits (25), Expect = 0.005 Identities = 28/29 (96%) Strand = Plus / Plus Query: 106 cgaccatggcgctctcctccccggcgatg 134 |||||||||||||||||||||| |||||| Sbjct: 70 cgaccatggcgctctcctcccccgcgatg 98
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 163 bits (82), Expect = 5e-37 Identities = 136/154 (88%) Strand = Plus / Plus Query: 226 cgtccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcg 285 |||| |||||||||||||||||||| ||||| |||||||||||||||||||| ||||||| Sbjct: 334 cgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcggcccgctttccggcg 393 Query: 286 accccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggc 345 | ||||| |||||| | || || |||||||||| ||||| || ||||||||||| |||| Sbjct: 394 agccccccagctacttgactggtgagttccccggtgactatgggtgggacaccgccgggc 453 Query: 346 tgtccgctgaccccgagaccttcgccaagaaccg 379 | || |||||||| |||||||||||||||||||| Sbjct: 454 tctcggctgaccctgagaccttcgccaagaaccg 487
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 155 bits (78), Expect = 1e-34 Identities = 135/154 (87%) Strand = Plus / Plus Query: 226 cgtccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcg 285 |||| |||||||||||||||||||| ||||| ||||||||||||||| |||| ||||||| Sbjct: 129 cgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcggctcgctttccggcg 188 Query: 286 accccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggc 345 | ||||| |||||| | || || |||||||||| ||||| || ||||||||||| |||| Sbjct: 189 aaccccccagctacttgactggtgagttccccggtgactatgggtgggacaccgccgggc 248 Query: 346 tgtccgctgaccccgagaccttcgccaagaaccg 379 | || |||||||| |||||||||||||||||||| Sbjct: 249 tctcggctgaccctgagaccttcgccaagaaccg 282
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 mRNA, complete cds Length = 859 Score = 141 bits (71), Expect = 2e-30 Identities = 173/207 (83%) Strand = Plus / Plus Query: 173 cggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtccag 232 |||||| || ||| |||| ||||||||||| || | |||||||||| || ||||| | Sbjct: 135 cggcgacggacgcttcacgatgcgcaagaccgccgccaagcccaagacggtctcgtccgg 194 Query: 233 cagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccccc 292 |||||||||||||||| | ||||| || |||||||||||| |||||||||| |||| Sbjct: 195 cagcccgtggtacggcccggaccgtgtcaagtacctcggcccgttctccggcgaggcccc 254 Query: 293 gagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgc 352 |||||||||||||| ||||||| ||||||||| ||||||||||| ||||| ||||| Sbjct: 255 atcatacctcaccggcgaattccccggcgactacgggtgggacaccgccgggctctccgc 314 Query: 353 tgaccccgagaccttcgccaagaaccg 379 ||||||||||||||| |||||||||| Sbjct: 315 cgaccccgagaccttctccaagaaccg 341
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein (CAB) mRNA, partial cds Length = 720 Score = 133 bits (67), Expect = 5e-28 Identities = 172/207 (83%) Strand = Plus / Plus Query: 173 cggcgagggccgcatcaccatgcgcaagacggcgggcaagcccaaggtggcggcgtccag 232 |||||| || ||| |||| ||||||||||| || |||||||||||| || ||||| | Sbjct: 119 cggcgacggacgcttcacgatgcgcaagacagccggcaagcccaagacggtctcgtccgg 178 Query: 233 cagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgacccccc 292 |||||||||||||||| |||| || || |||||||||||| ||||||| || | || Sbjct: 179 cagcccgtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgaggcacc 238 Query: 293 gagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgc 352 ||||||||||| |||||||||| ||||||||||||||||||||| ||||| || || Sbjct: 239 atcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagc 298 Query: 353 tgaccccgagaccttcgccaagaaccg 379 ||||||||||| |||||||||||||| Sbjct: 299 ggaccccgagacattcgccaagaaccg 325
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 127 bits (64), Expect = 3e-26 Identities = 103/116 (88%) Strand = Plus / Plus Query: 264 tacctcggcccgctctccggcgaccccccgagctacctcaccggcgagttccccgacgac 323 ||||||||||| |||||||||| |||| |||||||||||||||||| ||| |||| Sbjct: 80 tacctcggccccttctccggcgaggccccctcatacctcaccggcgagttcgccggcgac 139 Query: 324 tacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccg 379 ||||||||||||||||| ||||| ||||| |||||||||||||||||||||||||| Sbjct: 140 tacggctgggacaccgccgggctctccgccgaccccgagaccttcgccaagaaccg 195
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 127 bits (64), Expect = 3e-26 Identities = 127/148 (85%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgaccccc 291 ||||||| |||||||| |||||||||| ||||| |||||| |||||||||| | | Sbjct: 534 gcagcccctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggcgaggcgc 593 Query: 292 cgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccg 351 || |||||| |||||||||||| ||| ||||||||||||||||||||| ||||| || | Sbjct: 594 cgtcctacctgaccggcgagttcgccggcgactacggctgggacaccgccgggctctcgg 653 Query: 352 ctgaccccgagaccttcgccaagaaccg 379 | |||||||||||||||||||||||||| Sbjct: 654 ccgaccccgagaccttcgccaagaaccg 681
>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA, partial cds Length = 226 Score = 123 bits (62), Expect = 4e-25 Identities = 92/102 (90%) Strand = Plus / Plus Query: 279 tccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacacc 338 ||||| || |||||||||||||||||||| |||||||||| |||||||| ||||||||| Sbjct: 1 tccggagagcccccgagctacctcaccggagagttccccggagactacggatgggacacc 60 Query: 339 gcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 || || || ||||||||||||||||||||||||| ||||||| Sbjct: 61 gccggtctctccgctgaccccgagaccttcgccaggaaccgt 102
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 119 bits (60), Expect = 7e-24 Identities = 129/152 (84%) Strand = Plus / Plus Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 ||||||||||| |||||||| | || || ||||||||||||||||| ||||| |||| Sbjct: 154 tccagcagcccatggtacggagctgatcgtgtgctctacctcggcccactctctcgcgag 213 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 ||||| |||||||||||||| || ||||||| |||||||| |||||||| || || || Sbjct: 214 cccccaagctacctcaccggtgatttccccggtgactacgggtgggacacggctggactc 273 Query: 348 tccgctgaccccgagaccttcgccaagaaccg 379 || |||||||||||||||||| | |||||||| Sbjct: 274 tctgctgaccccgagaccttctcgaagaaccg 305
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 119 bits (60), Expect = 7e-24 Identities = 126/148 (85%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgaccccc 291 ||||||| |||||||| | ||||| ||||||||||||||||| |||||||| || || | Sbjct: 149 gcagcccatggtacggtgctgaccgtgtgctctacctcggcccactctccggtgagcctc 208 Query: 292 cgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccg 351 |||||||||| ||||| |||||||| | |||||| || |||||||| || || || || | Sbjct: 209 cgagctacctgaccggtgagttccctggcgactatgggtgggacactgctggactttcgg 268 Query: 352 ctgaccccgagaccttcgccaagaaccg 379 ||||||| ||||||||| |||||||||| Sbjct: 269 ctgacccggagaccttctccaagaaccg 296
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 115 bits (58), Expect = 1e-22 Identities = 130/154 (84%) Strand = Plus / Plus Query: 226 cgtccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcg 285 ||||| ||||||||||||||||| |||| || || |||||||||||| ||||||| | Sbjct: 7 cgtccggcagcccgtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtg 66 Query: 286 accccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggc 345 | | || ||||||||||| |||||||||| ||||||||||||||||||||| |||| Sbjct: 67 aggcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggc 126 Query: 346 tgtccgctgaccccgagaccttcgccaagaaccg 379 | || || ||||||||||| |||||||||||||| Sbjct: 127 tctcagcggaccccgagacattcgccaagaaccg 160
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 3065 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3006 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 3005 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 2962
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 3104 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3045 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 3044 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 3001
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 337
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 337
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 282
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 337
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 93822 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 93763 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 93762 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 93719 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 95486 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 95545 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 95546 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 95589
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 80380 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 80439 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 80440 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 80483 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 78716 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 78657 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 78656 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 78613
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 282
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 282
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 282
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || ||||| ||||||||||| || |||||||||| |||||||| ||||||| Sbjct: 224 tctccggagagcccccaagctacctcacaggagagttccccggtgactacggatgggaca 283 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||||||||||||||||||||||| ||||||| Sbjct: 284 ccgccggtctttccgctgaccccgagaccttcgccaggaaccgt 327
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 333
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 333
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 333
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 333
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 333
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 333
>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 409 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 239 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 180 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 179 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 136
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 211 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 270 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 271 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 314
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 214 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 273 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 274 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 317
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||| ||||||||||||||||||||| | |||||||| ||||||| Sbjct: 234 tctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggaca 293 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || ||||| ||||||||||| ||||||||||||| ||||||| Sbjct: 294 ctgctgggctttccgctgacccagagaccttcgccaggaaccgt 337
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 111 bits (56), Expect = 2e-21 Identities = 92/104 (88%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 479 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 538 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| ||||||||||||| ||||||| Sbjct: 539 ccgctggtctatccgccgacccagagaccttcgccaggaaccgt 582
>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 (LHCP) mRNA, partial cds Length = 712 Score = 109 bits (55), Expect = 7e-21 Identities = 76/83 (91%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||||||||| |||||||||| ||||||||||||||||||||| ||||| ||||| ||| Sbjct: 163 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctccgcggac 222 Query: 357 cccgagaccttcgccaagaaccg 379 |||||||| || ||||||||||| Sbjct: 223 cccgagacatttgccaagaaccg 245
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 109 bits (55), Expect = 7e-21 Identities = 79/87 (90%) Strand = Plus / Plus Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| |||||||||||||| || ||||||||||||| |||||||||||||||||||| Sbjct: 183 ggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgcc 242 Query: 342 gggctgtccgctgaccccgagaccttc 368 || |||||||||||||| ||||||||| Sbjct: 243 ggtctgtccgctgacccggagaccttc 269
>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin Length = 2336 Score = 109 bits (55), Expect = 7e-21 Identities = 79/87 (90%) Strand = Plus / Minus Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| |||||||||||||| || ||||||||||||| |||||||||||||||||||| Sbjct: 239 ggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgcc 180 Query: 342 gggctgtccgctgaccccgagaccttc 368 || |||||||||||||| ||||||||| Sbjct: 179 ggcctgtccgctgacccggagaccttc 153
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 109 bits (55), Expect = 7e-21 Identities = 79/87 (90%) Strand = Plus / Plus Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| |||||||||||||| || ||||||||||||| |||||||||||||||||||| Sbjct: 181 ggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgcc 240 Query: 342 gggctgtccgctgaccccgagaccttc 368 || |||||||||||||| ||||||||| Sbjct: 241 ggtctgtccgctgacccggagaccttc 267
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 109 bits (55), Expect = 7e-21 Identities = 79/87 (90%) Strand = Plus / Plus Query: 282 ggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcg 341 ||||| |||||||||||||| || ||||||||||||| |||||||||||||||||||| Sbjct: 167 ggcgagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgcc 226 Query: 342 gggctgtccgctgaccccgagaccttc 368 || |||||||||||||| ||||||||| Sbjct: 227 ggtctgtccgctgacccggagaccttc 253
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 105 bits (53), Expect = 1e-19 Identities = 128/153 (83%) Strand = Plus / Plus Query: 228 tccagcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccggcgac 287 ||||||||||||||||||||| | |||||||| ||| | || || ||||||| || Sbjct: 25 tccagcagcccgtggtacggccctgaccgcgttaagtacttggggccattctccggtgag 84 Query: 288 cccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctg 347 ||||||||||| | ||||| |||||||||| ||||||||||||||||| || || || Sbjct: 85 tccccgagctacttgaccggtgagttccccggtgactacggctgggacactgctggactc 144 Query: 348 tccgctgaccccgagaccttcgccaagaaccgt 380 || |||||||| ||||||||||||||||||||| Sbjct: 145 tcagctgacccagagaccttcgccaagaaccgt 177
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 103 bits (52), Expect = 4e-19 Identities = 91/104 (87%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 209 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 268 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| | || ||||| ||||| ||||||||||||| ||||||| Sbjct: 269 ccgcttgtctatccgccgacccagagaccttcgccaggaaccgt 312
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 103 bits (52), Expect = 4e-19 Identities = 91/104 (87%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 221 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 280 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| || |||||||||| ||||||| Sbjct: 281 ccgctggtctatccgccgacccagaaaccttcgccaggaaccgt 324
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 103 bits (52), Expect = 4e-19 Identities = 91/104 (87%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 214 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 273 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || ||||| ||||| || |||||||||| ||||||| Sbjct: 274 ccgctggtctatccgccgacccagaaaccttcgccaggaaccgt 317
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 103 bits (52), Expect = 4e-19 Identities = 85/96 (88%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| |||||||||||||| ||||| |||||||||| |||||||| ||||||| Sbjct: 705 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 646 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgcca 372 |||| || || ||||| ||||| ||||||||||||| Sbjct: 645 ccgctggtctatccgccgacccagagaccttcgcca 610
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 101 bits (51), Expect = 2e-18 Identities = 69/75 (92%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 ||||||||| ||||||||||||| |||||||||||||||||||| || |||||||| || Sbjct: 1146 ctacctcactggcgagttccccggtgactacggctgggacaccgccggcctgtccgccga 1205 Query: 356 ccccgagaccttcgc 370 ||||||||||||||| Sbjct: 1206 ccccgagaccttcgc 1220
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 97.6 bits (49), Expect = 3e-17 Identities = 67/73 (91%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| |||||||||||||||| ||||||||||||||||| || || ||||||||||| Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262 Query: 356 ccccgagaccttc 368 ||||||||||||| Sbjct: 263 ccccgagaccttc 275
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 95.6 bits (48), Expect = 1e-16 Identities = 90/104 (86%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| || ||||||||||| ||||| |||||||||| ||||| || ||||||| Sbjct: 13 tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||| || || |||||||| || ||||||||||||| ||||||| Sbjct: 73 ccgccggtctatccgctgatccagagaccttcgccaggaaccgt 116
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m6 mRNA, complete cds; nuclear gene for chloroplast product Length = 1094 Score = 95.6 bits (48), Expect = 1e-16 Identities = 66/72 (91%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||| || ||||||||||||| ||||||||||||||||||||| || |||||||||||| Sbjct: 205 tacctgactggcgagttccccggcgactacggctgggacaccgccggcctgtccgctgac 264 Query: 357 cccgagaccttc 368 || ||||||||| Sbjct: 265 ccggagaccttc 276
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 95.6 bits (48), Expect = 1e-16 Identities = 90/104 (86%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||| ||||| |||||| |||||| ||||| |||||||| | ||||||||||||||||| Sbjct: 426 tctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggctgggaca 485 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || ||||| ||||| ||||| || |||||||||||||||||| Sbjct: 486 ctgctgggctttccgcagacccagaaaccttcgccaagaaccgt 529
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 95.6 bits (48), Expect = 1e-16 Identities = 90/104 (86%) Strand = Plus / Minus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || |||||| |||| | ||||| |||||||||| |||||||||||||||| Sbjct: 66175 tctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggctgggaca 66116 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || ||||| || |||||||||||||| ||||||||||||||| Sbjct: 66115 ctgctgggctttctgctgaccccgagacattcgccaagaaccgt 66072
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1) gene, complete cds Length = 2290 Score = 95.6 bits (48), Expect = 1e-16 Identities = 66/72 (91%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||| || ||||||||||||| ||||||||||||||||||||| || |||||||||||| Sbjct: 980 tacctgactggcgagttccccggcgactacggctgggacaccgccggcctgtccgctgac 1039 Query: 357 cccgagaccttc 368 || ||||||||| Sbjct: 1040 ccggagaccttc 1051
>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds Length = 1240 Score = 91.7 bits (46), Expect = 2e-15 Identities = 61/66 (92%) Strand = Plus / Plus Query: 303 accggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgag 362 |||||||||||||||| |||||||||||||| ||||| || |||||||||||||||||| Sbjct: 399 accggcgagttccccggtgactacggctgggataccgctggcctgtccgctgaccccgag 458 Query: 363 accttc 368 |||||| Sbjct: 459 accttc 464
>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb3) mRNA, complete cds Length = 1314 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| |||||||||||||||| |||| || ||||| ||||| Sbjct: 246 ctacctgactggcgagttccccggcgactacggctgggactccgccggtctgtcggctga 305 Query: 356 ccccgagaccttc 368 ||||||||||||| Sbjct: 306 ccccgagaccttc 318
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b binding protein (LhcII-1.3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1100 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| |||||||||||||||| |||||||||||||||||||| || ||||| ||||| Sbjct: 189 ctacctgaccggcgagttccccggtgactacggctgggacaccgccggcctgtcggctga 248 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 249 cccggagaccttc 261
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein precursor (cabII-2) mRNA, complete cds Length = 1068 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| ||||||||||||||||||||| || ||||| ||||| Sbjct: 177 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 236 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 237 cccggagaccttc 249
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1256 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| ||||||||||||||||||||| || ||||| ||||| Sbjct: 193 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 252 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 253 cccggagaccttc 265
>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1107 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| ||||||||||||||||||||| || ||||| ||||| Sbjct: 223 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 282 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 283 cccggagaccttc 295
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1508 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| ||||||||||||||||||||| || ||||| ||||| Sbjct: 641 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 700 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 701 cccggagaccttc 713
>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1835 Score = 89.7 bits (45), Expect = 6e-15 Identities = 66/73 (90%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| ||||||||||||||||||||| || ||||| ||||| Sbjct: 851 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 910 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 911 cccggagaccttc 923
>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence Length = 827 Score = 87.7 bits (44), Expect = 2e-14 Identities = 77/88 (87%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| || |||||||||||||| || |||||||||| |||||||| ||||||| Sbjct: 13 tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72 Query: 337 ccgcggggctgtccgctgaccccgagac 364 | || || || ||||||||||||||||| Sbjct: 73 cagctggcctatccgctgaccccgagac 100
>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein Length = 1067 Score = 87.7 bits (44), Expect = 2e-14 Identities = 59/64 (92%) Strand = Plus / Plus Query: 305 cggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagac 364 |||||||||||||| |||||||||||||||||||| || |||||||| ||||||||||| Sbjct: 187 cggcgagttccccggtgactacggctgggacaccgccggcctgtccgccgaccccgagac 246 Query: 365 cttc 368 |||| Sbjct: 247 cttc 250
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 87.7 bits (44), Expect = 2e-14 Identities = 74/84 (88%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| |||||||||||||||| |||||||| |||||||| || ||||| ||| || Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437 Query: 356 ccccgagaccttcgccaagaaccg 379 |||||||||||||||||||||||| Sbjct: 438 ccccgagaccttcgccaagaaccg 461
>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds Length = 1041 Score = 85.7 bits (43), Expect = 1e-13 Identities = 67/75 (89%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 |||||||| ||||||||||||| |||||||||||||| ||||| || ||||| |||||| Sbjct: 202 tacctcactggcgagttccccggtgactacggctgggataccgccggtctgtctgctgac 261 Query: 357 cccgagaccttcgcc 371 ||| ||||||||||| Sbjct: 262 ccccagaccttcgcc 276
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||| || ||||||||||||| ||||||||| |||||||| || || || ||||| ||| Sbjct: 938 tacctgacgggcgagttccccggcgactacgggtgggacacggccggcctctccgccgac 997 Query: 357 cccgagaccttcgccaagaaccg 379 || |||||||||||||||||||| Sbjct: 998 ccggagaccttcgccaagaaccg 1020
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgt 354
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 259 gctgaccccgagacattcgcaaggaaccgt 288
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgt 354
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgt 354
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgt 354
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 325 gctgaccccgagacattcgcaaggaaccgt 354
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 294 gctgaccccgagacattcgcaaggaaccgt 323
>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 994 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 309 gctgaccccgagacattcgcaaggaaccgt 338
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 205 gctgaccccgagacattcgcaaggaaccgt 234
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Minus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgt 16627 Score = 75.8 bits (38), Expect = 9e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| ||||| | ||||||| Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgt 22026 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 19354 gaccccgagacattcgcaaggaaccgt 19380
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 83.8 bits (42), Expect = 4e-13 Identities = 78/90 (86%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||| ||||| | ||||||| Sbjct: 476 gctgaccccgagacattcgcaaggaaccgt 505
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m9 (Lhcbm9) mRNA, complete cds Length = 1221 Score = 81.8 bits (41), Expect = 1e-12 Identities = 65/73 (89%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| |||||||||||||||||| || || ||||| ||||| Sbjct: 196 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 255 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 256 cccggagaccttc 268
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 81.8 bits (41), Expect = 1e-12 Identities = 65/73 (89%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| || ||||||||||||| |||||||||||||||||| || || ||||| ||||| Sbjct: 201 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 260 Query: 356 ccccgagaccttc 368 ||| ||||||||| Sbjct: 261 cccggagaccttc 273
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m7 (Lhcbm7) mRNA, complete cds Length = 1016 Score = 77.8 bits (39), Expect = 2e-11 Identities = 54/59 (91%) Strand = Plus / Plus Query: 310 agttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 ||||||||| ||||||||||||||||||||| || ||||| |||||||| ||||||||| Sbjct: 205 agttccccggcgactacggctgggacaccgccggtctgtcggctgacccggagaccttc 263
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 75.8 bits (38), Expect = 9e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| ||||| | ||||||| Sbjct: 312 gctgatcccgagacattcgcaaggaaccgt 341
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 75.8 bits (38), Expect = 9e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| ||||| | ||||||| Sbjct: 217 gctgatcccgagacattcgcaaggaaccgt 246
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 75.8 bits (38), Expect = 9e-11 Identities = 80/94 (85%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| ||||| |||||||| || || |||||||||| ||||| || ||||||| Sbjct: 1757 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1816 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgc 370 |||| || || || |||||||||||||| ||||| Sbjct: 1817 ccgctggtctatcagctgaccccgagactttcgc 1850
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 75.8 bits (38), Expect = 9e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| ||||| | ||||||| Sbjct: 259 gctgatcccgagacattcgcaaggaaccgt 288
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 75.8 bits (38), Expect = 9e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| ||||| | ||||||| Sbjct: 312 gctgatcccgagacattcgcaaggaaccgt 341
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 75.8 bits (38), Expect = 9e-11 Identities = 65/74 (87%) Strand = Plus / Plus Query: 300 ctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgacccc 359 ||||||||||| || |||| ||||||||| ||||||||||| ||||| || || ||||| Sbjct: 282 ctcaccggcgaatttcccggcgactacgggtgggacaccgccgggctctctgccgaccct 341 Query: 360 gagaccttcgccaa 373 |||||||||||||| Sbjct: 342 gagaccttcgccaa 355
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 75.8 bits (38), Expect = 9e-11 Identities = 80/94 (85%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| ||||| |||||||| || || |||||||||| ||||| || ||||||| Sbjct: 1758 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1817 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgc 370 |||| || || || |||||||||||||| ||||| Sbjct: 1818 ccgctggtctatcagctgaccccgagactttcgc 1851
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 75.8 bits (38), Expect = 9e-11 Identities = 77/90 (85%) Strand = Plus / Plus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtcc 350 ||||||||||| ||||| |||||||||| |||||||| ||||||||||| || || || Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464 Query: 351 gctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| ||||| | ||||||| Sbjct: 465 gctgatcccgagacattcgcaaggaaccgt 494
>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 878 Score = 73.8 bits (37), Expect = 4e-10 Identities = 73/85 (85%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| |||||||| | |||||||| |||||||| || || || || ||||| Sbjct: 171 ctaccttaccggagagttccctggtgactacggttgggacactgctggactttcagctga 230 Query: 356 ccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||||||| Sbjct: 231 tcccgagaccttcgccaagaaccgt 255
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 347
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 182 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 241 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 242 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 285
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 347
>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m1 gene, complete cds; nuclear gene for chloroplast product Length = 1934 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||||||||||||||| || |||||||||||||| ||||||||| Sbjct: 782 gactacggctgggacaccgccggtctgtccgctgacccggagaccttc 829 Score = 50.1 bits (25), Expect = 0.005 Identities = 34/37 (91%) Strand = Plus / Plus Query: 282 ggcgaccccccgagctacctcaccggcgagttccccg 318 ||||| |||||||||||||| || ||||||||||||| Sbjct: 490 ggcgagcccccgagctacctgactggcgagttccccg 526
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 347
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 347
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 347
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 482 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 541 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 542 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 585
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 71.9 bits (36), Expect = 1e-09 Identities = 87/104 (83%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || || |||||||||||||| || |||||||||| || ||||| ||||||| Sbjct: 182 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 241 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || ||||| || |||||||||||||| | ||||||| Sbjct: 242 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgt 285
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 71.9 bits (36), Expect = 1e-09 Identities = 81/96 (84%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||| ||||| |||||| ||||||||| ||||||||||| | |||||||||||||||| Sbjct: 207 tctctggcgagcccccgtcctacctcactggcgagttcccaggtgactacggctgggaca 266 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgcca 372 | || ||||| || || ||||| || |||||||||| Sbjct: 267 ctgctgggctttcggccgacccagaaaccttcgcca 302
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||||||||| |||||||| | |||||||| |||||||| || ||||| || |||||| Sbjct: 257 tacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcagctgac 316 Query: 357 cccgagaccttcgccaagaaccgt 380 || || |||||||| ||||||||| Sbjct: 317 ccagaaaccttcgctaagaaccgt 340
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 71.9 bits (36), Expect = 1e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| |||||||| | |||||||| |||||||| || || || || ||||| Sbjct: 26 ctaccttaccggagagttccctggtgactacggttgggacactgctggactttcagctga 85 Query: 356 ccccgagaccttcgccaagaaccg 379 ||||||||||||||||||||||| Sbjct: 86 tcccgagaccttcgccaagaaccg 109
>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 1781 Score = 71.9 bits (36), Expect = 1e-09 Identities = 45/48 (93%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||||||||||||||| || |||||||||||||| ||||||||| Sbjct: 695 gactacggctgggacaccgccggtctgtccgctgacccggagaccttc 742 Score = 50.1 bits (25), Expect = 0.005 Identities = 34/37 (91%) Strand = Plus / Plus Query: 282 ggcgaccccccgagctacctcaccggcgagttccccg 318 ||||| |||||||||||||| || ||||||||||||| Sbjct: 403 ggcgagcccccgagctacctgactggcgagttccccg 439
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 329 gaccccgagacattcgcaaggaaccgt 355
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 315 gaccccgagacattcgcaaggaaccgt 341
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 315 gaccccgagacattcgcaaggaaccgt 341
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 262 gaccccgagacattcgcaaggaaccgt 288
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 314 gaccccgagacattcgcaaggaaccgt 340
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 262 gaccccgagacattcgcaaggaaccgt 288
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 248 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 307 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 308 gaccccgagacattcgcaaggaaccgt 334
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 314 gaccccgagacattcgcaaggaaccgt 340
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 240 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 299 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 300 gaccccgagacattcgcaaggaaccgt 326
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 329 gaccccgagacattcgcaaggaaccgt 355
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 69.9 bits (35), Expect = 6e-09 Identities = 74/87 (85%) Strand = Plus / Plus Query: 294 agctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgct 353 |||||||| ||||| |||||||| | |||||||| |||||||| || || || |||||| Sbjct: 347 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 406 Query: 354 gaccccgagaccttcgccaagaaccgt 380 ||||||||||| ||||| | ||||||| Sbjct: 407 gaccccgagacattcgcaaggaaccgt 433
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 67.9 bits (34), Expect = 2e-08 Identities = 70/82 (85%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 ||||||||| || |||||||| | ||||| || |||||||| || || |||||||| || Sbjct: 722 ctacctcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcaga 781 Query: 356 ccccgagaccttcgccaagaac 377 ||| |||||||||||||||||| Sbjct: 782 cccagagaccttcgccaagaac 803
>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein Length = 928 Score = 67.9 bits (34), Expect = 2e-08 Identities = 40/42 (95%) Strand = Plus / Plus Query: 305 cggcgagttccccgacgactacggctgggacaccgcggggct 346 |||||||||||||| ||||||||||||||||||||| ||||| Sbjct: 243 cggcgagttccccggcgactacggctgggacaccgccgggct 284
>ref|NM_126540.2| Arabidopsis thaliana LHCB2.1; chlorophyll binding AT2G05100 (LHCB2.1) mRNA, complete cds Length = 1068 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 262 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 321 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 322 cccggagacattcgctaagaaccgt 346
>gb|AY045787.1| Arabidopsis thaliana At2g05100 mRNA sequence Length = 1047 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 347 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 406 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 407 cccggagacattcgctaagaaccgt 431
>gb|AC007443.5| Arabidopsis thaliana chromosome 2 clone F15L11 map ve013, complete sequence Length = 13145 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Minus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 5600 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 5541 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 5540 cccggagacattcgctaagaaccgt 5516
>gb|AY052348.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds Length = 1001 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 260 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 319 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 320 cccggagacattcgctaagaaccgt 344
>gb|AY052275.1| Arabidopsis thaliana At2g05100/F15L11.2 mRNA, complete cds Length = 943 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 255 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 314 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 315 cccggagacattcgctaagaaccgt 339
>emb|BX819843.1|CNS0A9GW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS37ZB02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 980 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 240 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 299 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 300 cccggagacattcgctaagaaccgt 324
>emb|BX819702.1|CNS0A9H1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZH11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 912 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 223 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 282 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 283 cccggagacattcgctaagaaccgt 307
>emb|BX821844.1|CNS0A936 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL79ZE01 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 859 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 238 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 297 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 298 cccggagacattcgctaagaaccgt 322
>emb|BX821132.1|CNS0A9BI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL18ZF10 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 941 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 238 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 297 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 298 cccggagacattcgctaagaaccgt 322
>emb|BX819861.1|CNS0A9DS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS3ZD09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 964 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 252 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 311 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 312 cccggagacattcgctaagaaccgt 336
>emb|BX819688.1|CNS0A9G4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZE08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 914 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 221 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 280 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 281 cccggagacattcgctaagaaccgt 305
>emb|BX819687.1|CNS0A9G3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZE07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 917 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 223 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 282 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 283 cccggagacattcgctaagaaccgt 307
>emb|BX819683.1|CNS0A80L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS17ZA01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 922 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 223 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 282 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 283 cccggagacattcgctaagaaccgt 307
>emb|BX842010.1|CNS09YA7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS22ZD11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 934 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 243 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 302 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 303 cccggagacattcgctaagaaccgt 327
>gb|AF134124.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.3) mRNA, complete cds Length = 967 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 250 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 309 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 310 cccggagacattcgctaagaaccgt 334
>gb|AF134122.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.1) mRNA, complete cds Length = 974 Score = 65.9 bits (33), Expect = 9e-08 Identities = 72/85 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 259 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 318 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| ||||| ||||| ||||||||| Sbjct: 319 cccggagacattcgctaagaaccgt 343
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaa 373 |||||||| ||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 18 gactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaa 70
>dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat inducible, partial cds, clone:M26 Length = 476 Score = 65.9 bits (33), Expect = 9e-08 Identities = 39/41 (95%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacac 337 ||||| |||||||||||||||| |||||||||||||||||| Sbjct: 253 tacctgaccggcgagttccccggcgactacggctgggacac 293
>ref|NM_126537.2| Arabidopsis thaliana LHCB2.2; chlorophyll binding AT2G05070 (LHCB2.2) mRNA, complete cds Length = 1060 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 286 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 345
>ref|NM_001036246.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G05060 transcript variant AT2G05060.2 mRNA, complete cds Length = 2130 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 1854 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 1795
>ref|XM_483142.1| Oryza sativa (japonica cultivar-group), mRNA Length = 426 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||||||| ||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 350 gcagcccgtcgtacggccccgaccgcgtcatctacctccgcccgctctccgg 401
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 63.9 bits (32), Expect = 3e-07 Identities = 56/64 (87%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 |||||||||| || ||||||||||| ||||| ||||||||| |||||||| ||||||| Sbjct: 257 tctccggcgagccaccgagctaccttaccggacagttccccggagactacggatgggaca 316 Query: 337 ccgc 340 |||| Sbjct: 317 ccgc 320
>gb|AY093372.1| Arabidopsis thaliana putative chlorophyll a/b binding protein (At2g05070) mRNA, complete cds Length = 881 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 226 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 285
>gb|AC007211.6| Arabidopsis thaliana chromosome 2 BAC F1O13 genomic sequence, complete sequence Length = 103889 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Minus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 81577 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 81518
>gb|AY066036.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds Length = 798 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 226 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 285
>gb|AY062563.1| Arabidopsis thaliana putative chlorophyll a/b binding protein (At2g05070; F1O13.20) mRNA, complete cds Length = 958 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 286 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 345
>gb|AY054218.1| Arabidopsis thaliana At2g05070/F1O13.20 mRNA, complete cds Length = 929 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 284 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 343
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||||||| ||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 24462467 gcagcccgtcgtacggccccgaccgcgtcatctacctccgcccgctctccgg 24462518
>emb|BX819347.1|CNS0A9RX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZE07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 933 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 267 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 326
>emb|BX819270.1|CNS0A9RF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB62ZB12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 937 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 257 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 316
>emb|BX820206.1|CNS0A9D7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZF11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 906 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 275 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 334
>emb|BX820202.1|CNS0A9FS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS92ZB05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 873 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 269 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 328
>emb|BX819668.1|CNS0A9CZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS14ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 274 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 333
>emb|BX819509.1|CNS0A82Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB85ZB03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 926 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 262 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 321
>gb|AF134123.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2.2) mRNA, complete cds Length = 943 Score = 63.9 bits (32), Expect = 3e-07 Identities = 53/60 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || |||||||| ||||| ||||| ||||||||| Sbjct: 276 gactacggctgggacaccgctggactctcggctgacccggagacattcgctaagaaccgt 335
>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0505D12 Length = 146951 Score = 63.9 bits (32), Expect = 3e-07 Identities = 44/48 (91%) Strand = Plus / Minus Query: 236 cccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||||||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 37953 cccgtggtacggccccgaccgcgtcatctacctccgcccgctctccgg 37906
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 63.9 bits (32), Expect = 3e-07 Identities = 86/104 (82%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || ||||| |||||| | ||||| || ||||||| ||||| |||||||||| Sbjct: 191 tctccggtgagcccccaagctacttgaccggtgaattccccggtgactatggctgggaca 250 Query: 337 ccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 | || || || || |||||||| || ||||| |||||||||||| Sbjct: 251 ctgccggactctcagctgacccagaaacctttgccaagaaccgt 294
>dbj|AP005148.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B1142B04 Length = 161964 Score = 63.9 bits (32), Expect = 3e-07 Identities = 47/52 (90%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||||||| ||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 78183 gcagcccgtcgtacggccccgaccgcgtcatctacctccgcccgctctccgg 78234
>gb|BT001933.1| Arabidopsis thaliana clone C105385 putative chlorophyll a/b binding protein (At2g05100) mRNA, complete cds Length = 829 Score = 63.9 bits (32), Expect = 3e-07 Identities = 71/84 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || | ||||| |||||||||||||||||||| || || || ||||| Sbjct: 201 ctacctaaccggagaataccccggagactacggctgggacaccgctggactctcggctga 260 Query: 356 ccccgagaccttcgccaagaaccg 379 ||| ||||| ||||| |||||||| Sbjct: 261 cccggagacattcgctaagaaccg 284
>ref|NM_190738.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1044 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 236 cccgtggtacggctccgaccgcgtgctctacctcggcccgctctccg 282 ||||||||||||| |||||||||| |||||||| |||||||||||| Sbjct: 483 cccgtggtacggccccgaccgcgtcatctacctccgcccgctctccg 529
>dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat inducible, partial cds, clone:M27 Length = 687 Score = 61.9 bits (31), Expect = 1e-06 Identities = 61/71 (85%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||| ||||||||||| || | |||||||||||||||||| || || ||||| || ||| Sbjct: 173 tacctgaccggcgagtttccgggcgactacggctgggacactgctggcctgtcggccgac 232 Query: 357 cccgagacctt 367 || |||||||| Sbjct: 233 ccggagacctt 243
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 242 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 294
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 266 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 318
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 266 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 318
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 268 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 320
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 273 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 325
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 306 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 358
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 22434279 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 22434331 Score = 46.1 bits (23), Expect = 0.082 Identities = 23/23 (100%) Strand = Plus / Plus Query: 85 agcgagcgatggcggccgcggcg 107 ||||||||||||||||||||||| Sbjct: 25864797 agcgagcgatggcggccgcggcg 25864819
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 95346 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 95398
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>emb|X16536.1|GMCAB5 G.max DNA for Cab5 Length = 1467 Score = 58.0 bits (29), Expect = 2e-05 Identities = 71/85 (83%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 ||||||||| || || ||||| | ||||| || |||||||| || ||||| || ||||| Sbjct: 525 ctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgctga 584 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| |||||||| |||||||||||| Sbjct: 585 cccagagacctttgccaagaaccgt 609
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 58.0 bits (29), Expect = 2e-05 Identities = 68/81 (83%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||| ||||| || ||||||| |||||||| |||||||| ||||||||||| || || Sbjct: 296 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgtcggcggat 355 Query: 357 cccgagaccttcgccaagaac 377 || ||||| ||||| |||||| Sbjct: 356 ccggagacgttcgcgaagaac 376
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 242 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 294
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 266 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 318
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 266 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 318
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 323
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 267 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 319
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 273 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 325
>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding protein mRNA, complete cds Length = 1118 Score = 58.0 bits (29), Expect = 2e-05 Identities = 68/81 (83%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 ||||||||| ||||||||||||| || |||||||||||||| || || |||| || || Sbjct: 290 ctacctcactggcgagttccccggtgattacggctgggacactgctggcttgtcggcgga 349 Query: 356 ccccgagaccttcgccaagaa 376 ||| || |||||||| ||||| Sbjct: 350 cccagaaaccttcgctaagaa 370 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 174 ggcgagggccgcatcaccatgc 195 |||||||||||||||||||||| Sbjct: 144 ggcgagggccgcatcaccatgc 165
>gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1105 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | ||||||||| |||||||| |||||||| ||||| ||||| Sbjct: 247 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggaccc 299
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaac 377 |||||||| |||||||| ||||||||||| || ||||| ||||| ||||| |||||| Sbjct: 299 gactacgggtgggacacggcggggctgtcggcggacccggagacgttcgcgaagaac 355
>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b binding protein (Lhcb-Pp1) gene, complete cds Length = 1912 Score = 58.0 bits (29), Expect = 2e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 324 tacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| || ||||| || |||||||| |||||||| |||||||||||| Sbjct: 570 tacggttgggacactgctgggctctcagctgacccagagacctttgccaagaaccgt 626
>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII) mRNA, 3' end Length = 911 Score = 58.0 bits (29), Expect = 2e-05 Identities = 71/85 (83%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 ||||||||| || || ||||| | ||||| || |||||||| || ||||| || ||||| Sbjct: 143 ctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgctga 202 Query: 356 ccccgagaccttcgccaagaaccgt 380 ||| |||||||| |||||||||||| Sbjct: 203 cccagagacctttgccaagaaccgt 227
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 56.0 bits (28), Expect = 9e-05 Identities = 61/72 (84%) Strand = Plus / Plus Query: 309 gagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||||| |||||||| |||||||| || || || || |||||||| ||||| ||| Sbjct: 217 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 276 Query: 369 gccaagaaccgt 380 ||||||||||| Sbjct: 277 tccaagaaccgt 288
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09, complete sequence Length = 167318 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 236 cccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||| ||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 62463 cccgtcgtacggccccgaccgcgtcatctacctccgcccgctctccgg 62510
>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA, partial cds Length = 780 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 ||||| ||||||||||| || ||||| || |||||||| || ||||| |||||||||||| Sbjct: 214 gactatggctgggacactgctgggctttcagctgacccagaaacctttgccaagaaccgt 273
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||| |||||||| || || || || |||||||| ||||| ||||||||||||||| Sbjct: 281 gactacggttgggacactgctggactttctgctgacccagagacattcgccaagaaccgt 340
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 56.0 bits (28), Expect = 9e-05 Identities = 43/48 (89%) Strand = Plus / Plus Query: 236 cccgtggtacggctccgaccgcgtgctctacctcggcccgctctccgg 283 ||||| ||||||| |||||||||| |||||||| ||||||||||||| Sbjct: 17802509 cccgtcgtacggccccgaccgcgtcatctacctccgcccgctctccgg 17802556
>gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlorophyll a/b-binding protein (ChBP) mRNA, complete cds Length = 411 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||| |||||||| || ||||| || || |||||||| ||||| |||||||||||| Sbjct: 57 gactacggatgggacactgctgggctatcagcagaccccgaaacctttgccaagaaccgt 116
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 56.0 bits (28), Expect = 9e-05 Identities = 40/44 (90%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgc 340 ||||| |||||||||||||||| ||||||||| ||||| ||||| Sbjct: 232 tacctgaccggcgagttccccggcgactacgggtgggagaccgc 275
>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding protein Length = 2236 Score = 56.0 bits (28), Expect = 9e-05 Identities = 61/72 (84%) Strand = Plus / Plus Query: 309 gagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||||| |||||||| |||||||| || || || || |||||||| ||||| ||| Sbjct: 1533 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 1592 Query: 369 gccaagaaccgt 380 ||||||||||| Sbjct: 1593 tccaagaaccgt 1604
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein Length = 963 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 ||||| ||||||||||| || ||||| || |||||||| ||||| || |||||||||||| Sbjct: 265 gactatggctgggacactgctgggctttcggctgaccctgagacttttgccaagaaccgt 324
>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein mRNA, complete sequence; nuclear gene for chloroplast product Length = 643 Score = 56.0 bits (28), Expect = 9e-05 Identities = 70/84 (83%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||| ||||| | |||||||| |||||||| |||||||| || ||||| || ||||| Sbjct: 33 tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92 Query: 357 cccgagaccttcgccaagaaccgt 380 || || || ||||||||||||||| Sbjct: 93 cctgaaacattcgccaagaaccgt 116
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||| |||||||| || || || || |||||||| ||||| ||||||||||||||| Sbjct: 280 gactacggatgggacactgctggactttctgctgacccagagacattcgccaagaaccgt 339
>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a, complete sequence Length = 48924 Score = 56.0 bits (28), Expect = 9e-05 Identities = 52/60 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||| |||||||| || || | || ||||||||||| |||||||||||||||||| Sbjct: 40131 gactacggatgggacacagctggattatcagctgaccccgaaaccttcgccaagaaccgt 40190
>gb|M64619.1|PEACAB66 Pea cab gene, complete cds Length = 1666 Score = 56.0 bits (28), Expect = 9e-05 Identities = 61/72 (84%) Strand = Plus / Plus Query: 309 gagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||||| |||||||| |||||||| || || || || |||||||| ||||| ||| Sbjct: 935 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 994 Query: 369 gccaagaaccgt 380 ||||||||||| Sbjct: 995 tccaagaaccgt 1006
>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll a/b-binding protein (polypeptide 15) complex precursor, complete coding sequence Length = 1993 Score = 56.0 bits (28), Expect = 9e-05 Identities = 61/72 (84%) Strand = Plus / Plus Query: 309 gagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagaccttc 368 |||||||||| |||||||| |||||||| || || || || |||||||| ||||| ||| Sbjct: 1236 gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 1295 Query: 369 gccaagaaccgt 380 ||||||||||| Sbjct: 1296 tccaagaaccgt 1307
>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 907 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 291 ccgagctacctcaccggcgagttccccgacgactacggctgggacac 337 ||||||||||| ||||| |||||||||| |||||||| |||||||| Sbjct: 677 ccgagctaccttaccggagagttccccggagactacggatgggacac 631
>dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene for light-harvesting chlorophyll a/b-binding protein 1, complete cds Length = 1975 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgcc 371 |||||||||||||||||||| || || || | |||||||||||||||||| Sbjct: 1280 gactacggctgggacaccgccggactctcgtcggaccccgagaccttcgcc 1330
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 54.0 bits (27), Expect = 3e-04 Identities = 45/51 (88%) Strand = Plus / Plus Query: 320 cgactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgc 370 ||||||||| |||||||| ||||||||||| || ||||| ||||| ||||| Sbjct: 5 cgactacgggtgggacacggcggggctgtcggcggacccggagacgttcgc 55
>gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA Length = 454 Score = 52.0 bits (26), Expect = 0.001 Identities = 69/82 (84%), Gaps = 1/82 (1%) Strand = Plus / Plus Query: 277 tctccggcgaccccccgagctacctcaccggcgagttccccgacgactacggctgggaca 336 ||||||| || |||||| ||||||||| || |||||||| | ||||||| |||||||| Sbjct: 272 tctccggtgagcccccgtcctacctcactggtgagttcccaggtgactacg-ctgggaca 330 Query: 337 ccgcggggctgtccgctgaccc 358 | || ||||| ||||||||||| Sbjct: 331 ctgctgggctttccgctgaccc 352
>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds Length = 2544 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccccgagacc 365 ||||||||| ||| ||||||||| ||||||||||| || ||||| | ||||| ||||| Sbjct: 1856 ggcgagttcgccggcgactacggatgggacaccgctggactgtcgtcagacccggagacg 1915 Query: 366 ttcgcc 371 |||||| Sbjct: 1916 ttcgcc 1921
>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein of photosystem II Length = 7650 Score = 50.1 bits (25), Expect = 0.005 Identities = 40/45 (88%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgc 340 |||||| ||||| ||| | |||| ||||||||||||||||||||| Sbjct: 4429 ctacctgaccggtgagctgcccggcgactacggctgggacaccgc 4473 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Plus Query: 315 cccgacgactacggctgggacaccgc 340 |||| ||||||||||||||||||||| Sbjct: 5744 cccggcgactacggctgggacaccgc 5769 Score = 44.1 bits (22), Expect = 0.32 Identities = 37/42 (88%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacac 337 |||||| ||||| ||| | |||| |||||||||||||||||| Sbjct: 986 ctacctgaccggtgagctgcccggcgactacggctgggacac 1027
>emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyll a/b-binding protein, partial Length = 2036 Score = 50.1 bits (25), Expect = 0.005 Identities = 67/81 (82%) Strand = Plus / Plus Query: 297 tacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgac 356 ||||||||||| ||||| |||| |||||| || ||||||||||| || | ||||| ||| Sbjct: 1568 tacctcaccggagagtttcccggcgactatggttgggacaccgccggtttatccgcagac 1627 Query: 357 cccgagaccttcgccaagaac 377 || || |||| ||||||||| Sbjct: 1628 cctgaagcctttgccaagaac 1648
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 50.1 bits (25), Expect = 0.005 Identities = 49/57 (85%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaac 377 |||||||| |||||||| ||||||||||| || || || ||||| ||||| |||||| Sbjct: 266 gactacgggtgggacacggcggggctgtcggcagatccggagacgttcgcgaagaac 322
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 50.1 bits (25), Expect = 0.005 Identities = 46/53 (86%) Strand = Plus / Plus Query: 306 ggcgagttccccgacgactacggctgggacaccgcggggctgtccgctgaccc 358 ||||||||||| | |||||| || |||||||| |||||||| ||||| ||||| Sbjct: 271 ggcgagttcccgggcgactatgggtgggacacggcggggctctccgcggaccc 323
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 50.1 bits (25), Expect = 0.005 Identities = 49/57 (85%) Strand = Plus / Plus Query: 324 tacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 ||||| |||||||| || || || || ||||| |||||||| ||||||||||||||| Sbjct: 255 tacggttgggacactgctggcctttctgctgatcccgagacattcgccaagaaccgt 311
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 50.1 bits (25), Expect = 0.005 Identities = 58/69 (84%) Strand = Plus / Plus Query: 296 ctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgtccgctga 355 |||||| ||||| || || |||| ||||||||||||||||| || ||||| || ||||| Sbjct: 219 ctaccttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctga 278 Query: 356 ccccgagac 364 ||| ||||| Sbjct: 279 ccctgagac 287
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 50.1 bits (25), Expect = 0.005 Identities = 46/53 (86%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaa 373 |||||||| |||||||| || ||||| || || || ||||||||||||||||| Sbjct: 169 gactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaa 221
>gb|DQ249342.1| Streptomyces hygroscopicus subsp. duamyceticus strain JCM4427 unknown polyketide biosynthetic gene cluster, partial sequence; and AHBA biosynthesis gene cluster, complete sequence Length = 55488 Score = 48.1 bits (24), Expect = 0.021 Identities = 30/32 (93%) Strand = Plus / Plus Query: 305 cggcgagttccccgacgactacggctgggaca 336 ||||||||||||||||||| ||||||||||| Sbjct: 13179 cggcgagttccccgacgaccgcggctgggaca 13210
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R Length = 1173 Score = 48.1 bits (24), Expect = 0.021 Identities = 75/92 (81%) Strand = Plus / Plus Query: 289 ccccgagctacctcaccggcgagttccccgacgactacggctgggacaccgcggggctgt 348 |||| |||||| | ||||| |||||||| | ||||| || ||||||||||| | || | Sbjct: 430 ccccaagctacttgaccggtgagttccctggtgactatggttgggacaccgctgaacttt 489 Query: 349 ccgctgaccccgagaccttcgccaagaaccgt 380 | ||||| ||||| || ||||||||||||||| Sbjct: 490 cagctgatcccgaaacattcgccaagaaccgt 521
>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1011 Score = 48.1 bits (24), Expect = 0.021 Identities = 51/60 (85%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 ||||| || |||||||| || ||||| || |||||||||||||| || || ||||||||| Sbjct: 288 gactatggttgggacactgctgggctctcagctgaccccgagacttttgctaagaaccgt 347
>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein (LHCP), complete cds Length = 905 Score = 48.1 bits (24), Expect = 0.021 Identities = 51/60 (85%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 |||||||||||||||||||| || || || ||||| || ||||| || ||||||||||| Sbjct: 273 gactacggctgggacaccgccggactttctgctgatccagagacattttccaagaaccgt 332
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete cds Length = 1010 Score = 48.1 bits (24), Expect = 0.021 Identities = 51/60 (85%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagaccttcgccaagaaccgt 380 ||||| ||||||||||| || ||||| || |||||||| || ||||| || ||||||||| Sbjct: 270 gactatggctgggacactgctgggctatcagctgacccagaaacctttgctaagaaccgt 329
>ref|NM_197383.1| Oryza sativa (japonica cultivar-group) putaive mitochondrial inner membrane protein (OSJNBb0018B10.5), mRNA Length = 588 Score = 46.1 bits (23), Expect = 0.082 Identities = 29/31 (93%) Strand = Plus / Minus Query: 101 cgcggcgaccatggcgctctcctccccggcg 131 |||||||||||||||||||||| ||||||| Sbjct: 414 cgcggcgaccatggcgctctccatcccggcg 384
>gb|AC051634.6| Oryza sativa chromosome 10 BAC OSJNBb0018B10 genomic sequence, complete sequence Length = 135789 Score = 46.1 bits (23), Expect = 0.082 Identities = 29/31 (93%) Strand = Plus / Plus Query: 101 cgcggcgaccatggcgctctcctccccggcg 131 |||||||||||||||||||||| ||||||| Sbjct: 34037 cgcggcgaccatggcgctctccatcccggcg 34067
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 46.1 bits (23), Expect = 0.082 Identities = 29/31 (93%) Strand = Plus / Plus Query: 101 cgcggcgaccatggcgctctcctccccggcg 131 |||||||||||||||||||||| ||||||| Sbjct: 19576846 cgcggcgaccatggcgctctccatcccggcg 19576876 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgt 259 |||||||||||||||| |||||||||| Sbjct: 18136656 gcagcccgtggtacggacccgaccgcgt 18136683 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 ctcaccaccaacgaccacca 22 |||||||||||||||||||| Sbjct: 7947606 ctcaccaccaacgaccacca 7947625
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 46.1 bits (23), Expect = 0.082 Identities = 41/47 (87%) Strand = Plus / Plus Query: 321 gactacggctgggacaccgcggggctgtccgctgaccccgagacctt 367 |||||||| ||||||||||| || || ||| | |||||||||||||| Sbjct: 2452 gactacggatgggacaccgctggactctcctccgaccccgagacctt 2498
>dbj|AK107812.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-133-F03, full insert sequence Length = 944 Score = 46.1 bits (23), Expect = 0.082 Identities = 29/31 (93%) Strand = Plus / Minus Query: 101 cgcggcgaccatggcgctctcctccccggcg 131 |||||||||||||||||||||| ||||||| Sbjct: 519 cgcggcgaccatggcgctctccatcccggcg 489
>dbj|AP004009.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1339_F05 Length = 132708 Score = 46.1 bits (23), Expect = 0.082 Identities = 23/23 (100%) Strand = Plus / Plus Query: 85 agcgagcgatggcggccgcggcg 107 ||||||||||||||||||||||| Sbjct: 35245 agcgagcgatggcggccgcggcg 35267
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 46.1 bits (23), Expect = 0.082 Identities = 29/31 (93%) Strand = Plus / Plus Query: 101 cgcggcgaccatggcgctctcctccccggcg 131 |||||||||||||||||||||| ||||||| Sbjct: 19588122 cgcggcgaccatggcgctctccatcccggcg 19588152 Score = 40.1 bits (20), Expect = 5.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 232 gcagcccgtggtacggctccgaccgcgt 259 |||||||||||||||| |||||||||| Sbjct: 18145909 gcagcccgtggtacggacccgaccgcgt 18145936 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 ctcaccaccaacgaccacca 22 |||||||||||||||||||| Sbjct: 7952705 ctcaccaccaacgaccacca 7952724 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,189,000 Number of Sequences: 3902068 Number of extensions: 2189000 Number of successful extensions: 46432 Number of sequences better than 10.0: 314 Number of HSP's better than 10.0 without gapping: 317 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 44169 Number of HSP's gapped (non-prelim): 2244 length of query: 380 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 358 effective length of database: 17,147,199,772 effective search space: 6138697518376 effective search space used: 6138697518376 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
