>gb|AC084602.1|CBRG43K20 Caenorhabditis briggsae cosmid G43K20, complete sequence
          Length = 43998

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 118  ttcacgtcttgcccttgccc 137
            ||||||||||||||||||||
Sbjct: 2849 ttcacgtcttgcccttgccc 2830

>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome
          Length = 6438405

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 42      cttccagtcgaggtcgagg 60
               |||||||||||||||||||
Sbjct: 3490124 cttccagtcgaggtcgagg 3490106

>gb|AC182587.5| Pan troglodytes BAC clone CH251-207G3 from chromosome 18, complete
              sequence
          Length = 195115

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 37     cgccccttccagtcgaggt 55
              |||||||||||||||||||
Sbjct: 125846 cgccccttccagtcgaggt 125864

>emb|AL163203.2|HS21C003 Homo sapiens chromosome 21 segment HS21C003
          Length = 340000

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 37     cgccccttccagtcgaggt 55
              |||||||||||||||||||
Sbjct: 220648 cgccccttccagtcgaggt 220630

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 74     accaacagatccggtggcc 92
              |||||||||||||||||||
Sbjct: 102510 accaacagatccggtggcc 102528

>dbj|AP005058.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-19M12, complete
             sequence
          Length = 179546

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    cgccccttccagtcgaggt 55
             |||||||||||||||||||
Sbjct: 83032 cgccccttccagtcgaggt 83050

>dbj|AP006142.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT08A24, TM0250,
             complete sequence
          Length = 104321

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 85    cggtggcctcgcctcaccg 103
             |||||||||||||||||||
Sbjct: 32225 cggtggcctcgcctcaccg 32243

>emb|AL078475.2|HS29H4 Homo sapiens chromosome 21 PAC RPCIP704H429Q2, complete sequence
          Length = 107469

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 37    cgccccttccagtcgaggt 55
             |||||||||||||||||||
Sbjct: 89427 cgccccttccagtcgaggt 89409

>dbj|AP005213.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-97O24, complete
             sequence
          Length = 162364

 Score = 38.2 bits (19), Expect = 7.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 37    cgccccttccagtcgaggt 55
             |||||||||||||||||||
Sbjct: 19915 cgccccttccagtcgaggt 19933


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 715,383
Number of Sequences: 3902068
Number of extensions: 715383
Number of successful extensions: 49423
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49345
Number of HSP's gapped (non-prelim): 78
length of query: 155
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 133
effective length of database: 17,147,199,772
effective search space: 2280577569676
effective search space used: 2280577569676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)