>emb|X96979.1|HVLTP7A2B H.vulgare mRNA for lipid transfer protein 7a2b
          Length = 755

 Score =  153 bits (77), Expect = 9e-35
 Identities = 80/81 (98%)
 Strand = Plus / Plus

                                                                       
Query: 5   caccacacccactcatctgatcacctgctagccagatagcttaaccgatgactcgtctca 64
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 49  caccacacccactcatctgatcacctgctagccagatagcttaaccgatggctcgtctca 108

                                
Query: 65  acagcaaggctgtggcggccg 85
           |||||||||||||||||||||
Sbjct: 109 acagcaaggctgtggcggccg 129

>gb|AY226580.1| Triticum aestivum lipid transfer protein 3 (LTP3) mRNA, complete
           cds
          Length = 555

 Score = 60.0 bits (30), Expect = 1e-06
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 56  ctcgtctcaacagcaaggctgtggcggccg 85
           ||||||||||||||||||||||||||||||
Sbjct: 81  ctcgtctcaacagcaaggctgtggcggccg 110

>emb|AJ784900.2| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.4 gene)
          Length = 771

 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 50  cgatgactcgtctcaacagcaaggctgtggcggccg 85
           ||||| |||||||||||||||||||||||| |||||
Sbjct: 74  cgatggctcgtctcaacagcaaggctgtggtggccg 109

>emb|AJ852541.1| Triticum aestivum ltp9.4a gene for type 1 non specific lipid
           transfer protein precursor, exons 1-2
          Length = 1965

 Score = 56.0 bits (28), Expect = 2e-05
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 50  cgatgactcgtctcaacagcaaggctgtggcggccg 85
           ||||| |||||||||||||||||||||||| |||||
Sbjct: 842 cgatggctcgtctcaacagcaaggctgtggtggccg 877

>emb|AJ852561.1| Triticum aestivum mRNA for type 1 non specific lipid transfer
          protein precursor (ltp9.4b gene)
          Length = 776

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                        
Query: 50 cgatgactcgtctcaacagcaaggctgtgg 79
          ||||| ||||||||||||||||||||||||
Sbjct: 70 cgatggctcgtctcaacagcaaggctgtgg 99

>emb|AJ852548.1| Triticum aestivum ltp9.4b gene for type 1 non specific lipid transfer
            protein precursor, exons 1-2
          Length = 2000

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                          
Query: 50   cgatgactcgtctcaacagcaaggctgtgg 79
            ||||| ||||||||||||||||||||||||
Sbjct: 1006 cgatggctcgtctcaacagcaaggctgtgg 1035

>gb|AC124012.4| Mus musculus BAC clone RP24-357P22 from chromosome 18, complete
             sequence
          Length = 193064

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     caccaccacacccactcatc 21
             ||||||||||||||||||||
Sbjct: 17696 caccaccacacccactcatc 17715

>gb|AC152060.3| Mus musculus BAC clone RP23-430C3 from chromosome 18, complete sequence
          Length = 198600

 Score = 40.1 bits (20), Expect = 0.96
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      caccaccacacccactcatc 21
              ||||||||||||||||||||
Sbjct: 128051 caccaccacacccactcatc 128070

>gb|AC135962.4| Mus musculus BAC clone RP23-342H15 from chromosome 16, complete
             sequence
          Length = 202525

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 1     acaccaccacacccactca 19
             |||||||||||||||||||
Sbjct: 66492 acaccaccacacccactca 66510

>gb|AC113266.24| Papio anubis clone rp41-106a4, complete sequence
          Length = 193032

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 62    tcaacagcaaggctgtggc 80
             |||||||||||||||||||
Sbjct: 58238 tcaacagcaaggctgtggc 58220


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 800,797
Number of Sequences: 3902068
Number of extensions: 800797
Number of successful extensions: 95696
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95672
Number of HSP's gapped (non-prelim): 24
length of query: 89
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 68
effective length of database: 17,151,101,840
effective search space: 1166274925120
effective search space used: 1166274925120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)