>emb|X57408.1|TAPSB0 Wheat PsbO mRNA for 33kDa oxygen evolving protein of photosystem
          II
          Length = 1217

 Score = 65.9 bits (33), Expect = 1e-08
 Identities = 40/41 (97%), Gaps = 1/41 (2%)
 Strand = Plus / Plus

                                                   
Query: 24 tcccgcgtaccaagcccaccgaccaacatggcagcgtctct 64
          |||||||||||||||| ||||||||||||||||||||||||
Sbjct: 2  tcccgcgtaccaagcc-accgaccaacatggcagcgtctct 41

>emb|BX039651.1|CNS092RB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                 
Query: 18  cgatcttcccgcgtaccaagcc 39
           ||||| ||||||||||||||||
Sbjct: 226 cgatcatcccgcgtaccaagcc 247

>emb|BX572097.1| Prochlorococcus marinus MIT9313 complete genome; segment 3/7
          Length = 349823

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 47    caacatggcagcgtctct 64
             ||||||||||||||||||
Sbjct: 27945 caacatggcagcgtctct 27962

>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica
          Length = 4224103

 Score = 36.2 bits (18), Expect = 9.5
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 4       accacgagtgagatcgat 21
               ||||||||||||||||||
Sbjct: 1618971 accacgagtgagatcgat 1618988


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 364,464
Number of Sequences: 3902068
Number of extensions: 364464
Number of successful extensions: 16181
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16169
Number of HSP's gapped (non-prelim): 11
length of query: 64
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 43
effective length of database: 17,151,101,840
effective search space: 737497379120
effective search space used: 737497379120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)