ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet94e12 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF181661.1|AF181661 Triticum aestivum EF-hand Ca2+-binding protein CCD1 (ccd1) mRNA, complete cds Length = 643 Score = 474 bits (239), Expect = e-130 Identities = 251/255 (98%) Strand = Plus / Plus Query: 168 gcggtggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctg 227 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 100 gcggtggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctg 159 Query: 228 atggaggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcacc 287 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 160 atggaggagctggcggcggggttccggctgctcatggacccggcgtcgggcctcatcacc 219 Query: 288 ttcgacagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgac 347 |||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||| Sbjct: 220 ttcgacagcctccgccgcaacgcgccgctgctgggcctcgggggcatgtccgacgacgac 279 Query: 348 ctccgcgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggag 407 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 280 ctccgcgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggag 339 Query: 408 ttctgcgtcctcatg 422 ||||||||||||||| Sbjct: 340 ttctgcgtcctcatg 354
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 345 bits (174), Expect = 7e-92 Identities = 231/250 (92%) Strand = Plus / Plus Query: 173 ggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatgga 232 |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| | Sbjct: 28100289 ggggttcgaggactacctgccggtgatggcggagaggctgggggaggaagggctgatgca 28100348 Query: 233 ggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcaccttcga 292 |||||| || |||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 28100349 ggagctcgcaagcgggttccgcctgctcatggacccggcctccgggctcatcaccttcga 28100408 Query: 293 cagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgacctccg 352 ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 28100409 cagcctccgccgcaacgcgccgctgctcggcctcggcgggatgtccgacgacgacctccg 28100468 Query: 353 cgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggagttctg 412 |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| Sbjct: 28100469 ggggatgctcgccgagggcgacttcgacggcgacggcgccctcagcgagatggagttctg 28100528 Query: 413 cgtcctcatg 422 |||||||||| Sbjct: 28100529 cgtcctcatg 28100538 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 27760538 atccatccatccatccatcctcc 27760560 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 27186966 cgatccatccatccatccatcc 27186945 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 |||||||||||||||||||| |||| Sbjct: 27634222 atccatccatccatccatccaccac 27634198 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27760534 atccatccatccatccatcc 27760553 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27186960 atccatccatccatccatcc 27186941 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27186956 atccatccatccatccatcc 27186937 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17271184 atccatccatccatccatcc 17271203 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5282342 atccatccatccatccatcc 5282323 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4465178 atccatccatccatccatcc 4465197 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4465174 atccatccatccatccatcc 4465193 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4465170 atccatccatccatccatcc 4465189
>dbj|AP003766.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0009H10 Length = 175754 Score = 345 bits (174), Expect = 7e-92 Identities = 231/250 (92%) Strand = Plus / Plus Query: 173 ggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatgga 232 |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| | Sbjct: 31195 ggggttcgaggactacctgccggtgatggcggagaggctgggggaggaagggctgatgca 31254 Query: 233 ggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcaccttcga 292 |||||| || |||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 31255 ggagctcgcaagcgggttccgcctgctcatggacccggcctccgggctcatcaccttcga 31314 Query: 293 cagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgacctccg 352 ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 31315 cagcctccgccgcaacgcgccgctgctcggcctcggcgggatgtccgacgacgacctccg 31374 Query: 353 cgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggagttctg 412 |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| Sbjct: 31375 ggggatgctcgccgagggcgacttcgacggcgacggcgccctcagcgagatggagttctg 31434 Query: 413 cgtcctcatg 422 |||||||||| Sbjct: 31435 cgtcctcatg 31444
>dbj|AK112082.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-D12, full insert sequence Length = 677 Score = 345 bits (174), Expect = 7e-92 Identities = 231/250 (92%) Strand = Plus / Plus Query: 173 ggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatgga 232 |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| | Sbjct: 131 ggggttcgaggactacctgccggtgatggcggagaggctgggggaggaagggctgatgca 190 Query: 233 ggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcaccttcga 292 |||||| || |||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 191 ggagctcgcaagcgggttccgcctgctcatggacccggcctccgggctcatcaccttcga 250 Query: 293 cagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgacctccg 352 ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 251 cagcctccgccgcaacgcgccgctgctcggcctcggcgggatgtccgacgacgacctccg 310 Query: 353 cgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggagttctg 412 |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| Sbjct: 311 ggggatgctcgccgagggcgacttcgacggcgacggcgccctcagcgagatggagttctg 370 Query: 413 cgtcctcatg 422 |||||||||| Sbjct: 371 cgtcctcatg 380
>dbj|AK111897.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013028D20, full insert sequence Length = 663 Score = 345 bits (174), Expect = 7e-92 Identities = 231/250 (92%) Strand = Plus / Plus Query: 173 ggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatgga 232 |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| | Sbjct: 132 ggggttcgaggactacctgccggtgatggcggagaggctgggggaggaagggctgatgca 191 Query: 233 ggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcaccttcga 292 |||||| || |||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 192 ggagctcgcaagcgggttccgcctgctcatggacccggcctccgggctcatcaccttcga 251 Query: 293 cagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgacctccg 352 ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 252 cagcctccgccgcaacgcgccgctgctcggcctcggcgggatgtccgacgacgacctccg 311 Query: 353 cgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggagttctg 412 |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| Sbjct: 312 ggggatgctcgccgagggcgacttcgacggcgacggcgccctcagcgagatggagttctg 371 Query: 413 cgtcctcatg 422 |||||||||| Sbjct: 372 cgtcctcatg 381
>dbj|AK111852.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033005P22, full insert sequence Length = 678 Score = 345 bits (174), Expect = 7e-92 Identities = 231/250 (92%) Strand = Plus / Plus Query: 173 ggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatgga 232 |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| | Sbjct: 132 ggggttcgaggactacctgccggtgatggcggagaggctgggggaggaagggctgatgca 191 Query: 233 ggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcaccttcga 292 |||||| || |||||||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 192 ggagctcgcaagcgggttccgcctgctcatggacccggcctccgggctcatcaccttcga 251 Query: 293 cagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgacctccg 352 ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| Sbjct: 252 cagcctccgccgcaacgcgccgctgctcggcctcggcgggatgtccgacgacgacctccg 311 Query: 353 cgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggagttctg 412 |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| Sbjct: 312 ggggatgctcgccgagggcgacttcgacggcgacggcgccctcagcgagatggagttctg 371 Query: 413 cgtcctcatg 422 |||||||||| Sbjct: 372 cgtcctcatg 381
>gb|BT018119.1| Zea mays clone EL01N0554A10.c mRNA sequence Length = 761 Score = 333 bits (168), Expect = 3e-88 Identities = 231/252 (91%) Strand = Plus / Plus Query: 171 gtggggttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatg 230 ||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 151 gtgggcttcgaggactacctgccggtgatggcggagcggctgggcgaggacgggctgatg 210 Query: 231 gaggagctggcggcggggttccggctgctcatggacccggcgtccggcctcatcaccttc 290 |||||||||| |||||||||||||| |||||||||||| ||| |||||||||||| Sbjct: 211 cgggagctggcgagcgggttccggctgctgatggacccggcgcgcgggctcatcaccttc 270 Query: 291 gacagcctccgccgcaacgcgccgctgctaggcctcggcgccatgtccgacgacgacctc 350 ||||||||||||||||||||||||||||| ||||| |||| |||||| |||| ||||||| Sbjct: 271 gacagcctccgccgcaacgcgccgctgctgggcctgggcggcatgtcggacgccgacctc 330 Query: 351 cgcgggatgctcgccgagggcgacttcgacggcgacggcgcgctctcccagatggagttc 410 ||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||| Sbjct: 331 cgcgggatgctcgccgagggcgacttcgacggcgacggcgcgctcagcgagacggagttc 390 Query: 411 tgcgtcctcatg 422 |||||||||||| Sbjct: 391 tgcgtcctcatg 402
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 77.8 bits (39), Expect = 3e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 189 ctgccggtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcgggg 248 ||||||||||||||| || |||||||||||||||||||||| ||||||| || ||| Sbjct: 13427588 ctgccggtgatggcgaagatgctgggggaggaggggctgatgcaggagctcgctagtggg 13427529 Query: 249 ttccggctgctcatggacccggc 271 ||||| |||||||||||||||| Sbjct: 13427528 gtccggatgctcatggacccggc 13427506 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 376 tcgacggcgacggcgcgctctcccagatggagttctgcgtcctcatg 422 ||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 33201198 tcgacggggacggcgcgctggaccagatggagttctgcgtcctcatg 33201152 Score = 50.1 bits (25), Expect = 0.006 Identities = 67/80 (83%), Gaps = 2/80 (2%) Strand = Plus / Plus Query: 189 ctgccggtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcgggg 248 ||||||||||||||| | || |||||| |||||||||||| ||||||| || ||| Sbjct: 26036701 ctgccggtgatggcgaataggttggggg--gaggggctgatgcaggagctcgctagtggg 26036758 Query: 249 ttccggctgctcatggaccc 268 ||||||||||||||||||| Sbjct: 26036759 gtccggctgctcatggaccc 26036778 Score = 46.1 bits (23), Expect = 0.092 Identities = 53/63 (84%) Strand = Plus / Minus Query: 176 gttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatggagga 235 ||||||||||| ||||||| ||||||| | |||||| | |||||||||||| ||||| Sbjct: 33201398 gttcgaggacttcctgccgtcgatggcgaggaagctgggcgtggaggggctgatcgagga 33201339 Query: 236 gct 238 ||| Sbjct: 33201338 gct 33201336 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 38610185 cgatccatccatccatccatcc 38610164 Score = 44.1 bits (22), Expect = 0.36 Identities = 40/46 (86%) Strand = Plus / Plus Query: 193 cggtgatggcggagcggctgggggaggaggggctgatggaggagct 238 ||||||||| | || || ||||||||||| |||||||| ||||||| Sbjct: 28857712 cggtgatggtgaagaggttgggggaggagcggctgatgcaggagct 28857757 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 7149185 cgatccatccatccatccatcc 7149164 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatc 41 ||||||||||||||||||||| Sbjct: 27050310 cgatccatccatccatccatc 27050290 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 21899296 gatccatccatccatccatcc 21899276 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatc 41 ||||||||||||||||||||| Sbjct: 1485301 cgatccatccatccatccatc 1485321 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39168156 atccatccatccatccatcc 39168175 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39168152 atccatccatccatccatcc 39168171 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38808306 atccatccatccatccatcc 38808287 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31845147 atccatccatccatccatcc 31845128 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31845143 atccatccatccatccatcc 31845124 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30536104 atccatccatccatccatcc 30536123 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30536100 atccatccatccatccatcc 30536119 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22093663 atccatccatccatccatcc 22093682 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21899291 atccatccatccatccatcc 21899272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21899287 atccatccatccatccatcc 21899268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21899283 atccatccatccatccatcc 21899264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20704006 atccatccatccatccatcc 20703987 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18835178 atccatccatccatccatcc 18835197 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18835174 atccatccatccatccatcc 18835193 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5104310 atccatccatccatccatcc 5104291 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 25 ccatccatccatccatcctc 44 |||||||||||||||||||| Sbjct: 4811936 ccatccatccatccatcctc 4811955 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4802740 atccatccatccatccatcc 4802721 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4802736 atccatccatccatccatcc 4802717 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4726050 atccatccatccatccatcc 4726031
>dbj|AP003337.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ1111_G12 Length = 112664 Score = 77.8 bits (39), Expect = 3e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 189 ctgccggtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcgggg 248 ||||||||||||||| || |||||||||||||||||||||| ||||||| || ||| Sbjct: 72141 ctgccggtgatggcgaagatgctgggggaggaggggctgatgcaggagctcgctagtggg 72082 Query: 249 ttccggctgctcatggacccggc 271 ||||| |||||||||||||||| Sbjct: 72081 gtccggatgctcatggacccggc 72059
>ref|NM_183941.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 906 Score = 67.9 bits (34), Expect = 3e-08 Identities = 46/50 (92%) Strand = Plus / Plus Query: 189 ctgccggtgatggcggagcggctgggggaggaggggctgatggaggagct 238 ||||||||||||||| || |||||||||||||||||||||| ||||||| Sbjct: 259 ctgccggtgatggcgaagatgctgggggaggaggggctgatgcaggagct 308
>ref|NM_191515.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 336 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 376 tcgacggcgacggcgcgctctcccagatggagttctgcgtcctcatg 422 ||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 233 tcgacggggacggcgcgctggaccagatggagttctgcgtcctcatg 279 Score = 46.1 bits (23), Expect = 0.092 Identities = 53/63 (84%) Strand = Plus / Plus Query: 176 gttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatggagga 235 ||||||||||| ||||||| ||||||| | |||||| | |||||||||||| ||||| Sbjct: 33 gttcgaggacttcctgccgtcgatggcgaggaagctgggcgtggaggggctgatcgagga 92 Query: 236 gct 238 ||| Sbjct: 93 gct 95
>dbj|AP003368.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1100D10 Length = 152997 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 376 tcgacggcgacggcgcgctctcccagatggagttctgcgtcctcatg 422 ||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 138108 tcgacggggacggcgcgctggaccagatggagttctgcgtcctcatg 138062 Score = 46.1 bits (23), Expect = 0.092 Identities = 53/63 (84%) Strand = Plus / Minus Query: 176 gttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatggagga 235 ||||||||||| ||||||| ||||||| | |||||| | |||||||||||| ||||| Sbjct: 138308 gttcgaggacttcctgccgtcgatggcgaggaagctgggcgtggaggggctgatcgagga 138249 Query: 236 gct 238 ||| Sbjct: 138248 gct 138246
>dbj|AK109278.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-188-B02, full insert sequence Length = 549 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Plus Query: 376 tcgacggcgacggcgcgctctcccagatggagttctgcgtcctcatg 422 ||||||| ||||||||||| ||||||||||||||||||||||||| Sbjct: 323 tcgacggggacggcgcgctggaccagatggagttctgcgtcctcatg 369 Score = 46.1 bits (23), Expect = 0.092 Identities = 53/63 (84%) Strand = Plus / Plus Query: 176 gttcgaggactacctgccggtgatggcggagcggctgggggaggaggggctgatggagga 235 ||||||||||| ||||||| ||||||| | |||||| | |||||||||||| ||||| Sbjct: 123 gttcgaggacttcctgccgtcgatggcgaggaagctgggcgtggaggggctgatcgagga 182 Query: 236 gct 238 ||| Sbjct: 183 gct 185
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 58.0 bits (29), Expect = 2e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 195 gtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcggggttccgg 254 |||||||| || ||||||||||||||||||||||| ||||| | || || ||||| Sbjct: 17733958 gtgatggcaaagaggctgggggaggaggggctgatgcaggagttcgctagtagggtccgg 17733899 Query: 255 ctgctcatggacccggc 271 ||||||||||||||||| Sbjct: 17733898 ctgctcatggacccggc 17733882 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 15800707 cgatccatccatccatccatcc 15800686 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 14026643 cgatccatccatccatccatcc 14026664 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 20067539 atccatccatccatccatcct 20067519 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20067547 atccatccatccatccatcc 20067528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20067543 atccatccatccatccatcc 20067524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19965850 atccatccatccatccatcc 19965869 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19965846 atccatccatccatccatcc 19965865 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19226091 atccatccatccatccatcc 19226072 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18699120 atccatccatccatccatcc 18699139 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16527154 atccatccatccatccatcc 16527173 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16527150 atccatccatccatccatcc 16527169 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 14907586 atccatccatccatccatcc 14907567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 14907582 atccatccatccatccatcc 14907563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 14026649 atccatccatccatccatcc 14026668 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10114018 atccatccatccatccatcc 10114037 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10114014 atccatccatccatccatcc 10114033 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10113990 atccatccatccatccatcc 10114009
>dbj|AP005399.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0676H02 Length = 144252 Score = 58.0 bits (29), Expect = 2e-05 Identities = 65/77 (84%) Strand = Plus / Minus Query: 195 gtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcggggttccgg 254 |||||||| || ||||||||||||||||||||||| ||||| | || || ||||| Sbjct: 42592 gtgatggcaaagaggctgggggaggaggggctgatgcaggagttcgctagtagggtccgg 42533 Query: 255 ctgctcatggacccggc 271 ||||||||||||||||| Sbjct: 42532 ctgctcatggacccggc 42516
>gb|AE005835.1| Caulobacter crescentus CB15 section 161 of 359 of the complete genome Length = 10301 Score = 52.0 bits (26), Expect = 0.001 Identities = 29/30 (96%) Strand = Plus / Plus Query: 362 cgccgagggcgacttcgacggcgacggcgc 391 |||||||||||||||||||| ||||||||| Sbjct: 6561 cgccgagggcgacttcgacgtcgacggcgc 6590
>gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosome 8, complete sequence Length = 232127 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccaca 48 |||||||||||||||||||||||||| Sbjct: 111669 atccatccatccatccatcctccaca 111694 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccac 47 |||||||||||||||||| |||||| Sbjct: 193909 atccatccatccatccattctccac 193933 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 194077 atccatccatccatccatcc 194096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 193994 atccatccatccatccatcc 194013 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111665 atccatccatccatccatcc 111684 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111661 atccatccatccatccatcc 111680 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111657 atccatccatccatccatcc 111676 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111653 atccatccatccatccatcc 111672 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111649 atccatccatccatccatcc 111668 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111645 atccatccatccatccatcc 111664 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111641 atccatccatccatccatcc 111660 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111170 atccatccatccatccatcc 111189 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111166 atccatccatccatccatcc 111185 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 104080 atccatccatccatccatcc 104061 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 104076 atccatccatccatccatcc 104057 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 104072 atccatccatccatccatcc 104053
>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence Length = 201535 Score = 52.0 bits (26), Expect = 0.001 Identities = 26/26 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccaca 48 |||||||||||||||||||||||||| Sbjct: 55571 atccatccatccatccatcctccaca 55596 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131427 atccatccatccatccatcc 131446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131423 atccatccatccatccatcc 131442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131419 atccatccatccatccatcc 131438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131398 atccatccatccatccatcc 131417 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131277 atccatccatccatccatcc 131296 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131253 atccatccatccatccatcc 131272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131249 atccatccatccatccatcc 131268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131245 atccatccatccatccatcc 131264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131241 atccatccatccatccatcc 131260 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131237 atccatccatccatccatcc 131256 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131233 atccatccatccatccatcc 131252 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55949 atccatccatccatccatcc 55968 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55945 atccatccatccatccatcc 55964 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55941 atccatccatccatccatcc 55960 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55937 atccatccatccatccatcc 55956 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55933 atccatccatccatccatcc 55952 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55567 atccatccatccatccatcc 55586 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55563 atccatccatccatccatcc 55582 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55559 atccatccatccatccatcc 55578 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55555 atccatccatccatccatcc 55574 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 55531 atccatccatccatccatcc 55550
>gb|AC115898.22| Mus musculus chromosome 7, clone RP24-444C13, complete sequence Length = 177754 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 2157 atccatccatccatccatcctccac 2133 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2161 atccatccatccatccatcc 2142
>gb|AC113001.9| Mus musculus chromosome 7, clone RP23-184M4, complete sequence Length = 206940 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 135734 atccatccatccatccatcctccac 135710 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 135738 atccatccatccatccatcc 135719
>gb|AC140782.4| Mus musculus BAC clone RP24-417N13 from chromosome 7, complete sequence Length = 196282 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 63961 atccatccatccatccatcctccac 63937 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64029 atccatccatccatccatcc 64010 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64025 atccatccatccatccatcc 64006 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64021 atccatccatccatccatcc 64002 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64017 atccatccatccatccatcc 63998 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 63965 atccatccatccatccatcc 63946
>gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosome 7, complete sequence Length = 218222 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 36139 atccatccatccatccatcctccac 36115 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36207 atccatccatccatccatcc 36188 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36203 atccatccatccatccatcc 36184 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36199 atccatccatccatccatcc 36180 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36195 atccatccatccatccatcc 36176 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36143 atccatccatccatccatcc 36124
>gb|AC129202.3| Mus musculus BAC clone RP24-225J1 from chromosome 13, complete sequence Length = 168558 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 30699 atccatccatccatccatcctccac 30723 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30695 atccatccatccatccatcc 30714 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30691 atccatccatccatccatcc 30710 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30687 atccatccatccatccatcc 30706 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30683 atccatccatccatccatcc 30702 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30679 atccatccatccatccatcc 30698
>gb|AC153150.5| Mus musculus BAC clone RP23-181B14 from chromosome 13, complete sequence Length = 212639 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 5087 atccatccatccatccatcctccac 5063 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112100 atccatccatccatccatcc 112081 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112096 atccatccatccatccatcc 112077 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112092 atccatccatccatccatcc 112073 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112088 atccatccatccatccatcc 112069 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5107 atccatccatccatccatcc 5088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5103 atccatccatccatccatcc 5084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5099 atccatccatccatccatcc 5080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5095 atccatccatccatccatcc 5076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5091 atccatccatccatccatcc 5072
>dbj|AP002910.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0707D10 Length = 172003 Score = 50.1 bits (25), Expect = 0.006 Identities = 67/80 (83%), Gaps = 2/80 (2%) Strand = Plus / Plus Query: 189 ctgccggtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcgggg 248 ||||||||||||||| | || |||||| |||||||||||| ||||||| || ||| Sbjct: 132768 ctgccggtgatggcgaataggttggggg--gaggggctgatgcaggagctcgctagtggg 132825 Query: 249 ttccggctgctcatggaccc 268 ||||||||||||||||||| Sbjct: 132826 gtccggctgctcatggaccc 132845
>dbj|AP003234.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0038D11 Length = 156465 Score = 50.1 bits (25), Expect = 0.006 Identities = 67/80 (83%), Gaps = 2/80 (2%) Strand = Plus / Plus Query: 189 ctgccggtgatggcggagcggctgggggaggaggggctgatggaggagctggcggcgggg 248 ||||||||||||||| | || |||||| |||||||||||| ||||||| || ||| Sbjct: 40276 ctgccggtgatggcgaataggttggggg--gaggggctgatgcaggagctcgctagtggg 40333 Query: 249 ttccggctgctcatggaccc 268 ||||||||||||||||||| Sbjct: 40334 gtccggctgctcatggaccc 40353
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 368 gggcgacttcgacggcgacggcgcg 392 ||||||||||||||||||||||||| Sbjct: 5467425 gggcgacttcgacggcgacggcgcg 5467401 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 369 ggcgacttcgacggcgacggc 389 ||||||||||||||||||||| Sbjct: 5472270 ggcgacttcgacggcgacggc 5472250
>gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome 8, complete sequence Length = 249808 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||||||||| Sbjct: 168831 atccatccatccatccatcctccac 168807 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 213088 gatccatccatccatccatcc 213068 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 |||||||||||||||||||| |||| Sbjct: 48490 atccatccatccatccatccaccac 48466 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 214304 atccatccatccatccatcc 214285 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 214300 atccatccatccatccatcc 214281 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 214296 atccatccatccatccatcc 214277 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 214292 atccatccatccatccatcc 214273 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 214288 atccatccatccatccatcc 214269 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 214284 atccatccatccatccatcc 214265 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213083 atccatccatccatccatcc 213064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213079 atccatccatccatccatcc 213060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213075 atccatccatccatccatcc 213056 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213071 atccatccatccatccatcc 213052 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213067 atccatccatccatccatcc 213048 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213063 atccatccatccatccatcc 213044 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212881 atccatccatccatccatcc 212862 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212877 atccatccatccatccatcc 212858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212873 atccatccatccatccatcc 212854 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212869 atccatccatccatccatcc 212850 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212865 atccatccatccatccatcc 212846 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212861 atccatccatccatccatcc 212842 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212815 atccatccatccatccatcc 212796 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 212811 atccatccatccatccatcc 212792 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 212807 atccatccatccatccatcatcca 212784 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 199901 atccatccatccatccatcc 199882 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 199897 atccatccatccatccatcc 199878 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 199893 atccatccatccatccatcc 199874 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 199889 atccatccatccatccatcc 199870 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 199885 atccatccatccatccatcc 199866 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 169078 atccatccatccatccatcatcca 169055 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 169059 atccatccatccatccatcc 169040 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 169055 atccatccatccatccatcc 169036 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 169051 atccatccatccatccatcc 169032 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 169047 atccatccatccatccatcatcca 169024 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 168986 atccatccatccatccatcatcca 168963 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 168941 atccatccatccatccatcc 168922 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 168937 atccatccatccatccatcc 168918 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 168933 atccatccatccatccatcatcca 168910 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 168914 atccatccatccatccatcatcca 168891 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 168895 atccatccatccatccatcc 168876 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 168891 atccatccatccatccatcatcca 168868 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 168839 atccatccatccatccatcc 168820 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 168835 atccatccatccatccatcc 168816 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143996 atccatccatccatccatcc 144015 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143992 atccatccatccatccatcc 144011 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143988 atccatccatccatccatcc 144007 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143984 atccatccatccatccatcc 144003 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143980 atccatccatccatccatcc 143999 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49122 atccatccatccatccatcc 49141 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48579 atccatccatccatccatcc 48560 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48506 atccatccatccatccatcc 48487 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48502 atccatccatccatccatcc 48483 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48498 atccatccatccatccatcc 48479 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48494 atccatccatccatccatcc 48475 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48463 atccatccatccatccatcc 48444 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48459 atccatccatccatccatcc 48440 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48455 atccatccatccatccatcc 48436 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48451 atccatccatccatccatcc 48432 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48447 atccatccatccatccatcc 48428 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 48443 atccatccatccatccatcc 48424
>emb|BX005001.6| Zebrafish DNA sequence from clone DKEY-202E22 in linkage group 21, complete sequence Length = 159375 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcctcc 45 ||||||||||||||||||||||||| Sbjct: 118424 cgatccatccatccatccatcctcc 118400 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcctcc 45 ||||||||||||||||||||||||| Sbjct: 118328 cgatccatccatccatccatcctcc 118304 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 51798 atccatccatccatccatcct 51778 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 51818 atccatccatccatccatcc 51799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 51814 atccatccatccatccatcc 51795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 51810 atccatccatccatccatcc 51791 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 51806 atccatccatccatccatcc 51787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 51802 atccatccatccatccatcc 51783
>emb|CR388001.36| Zebrafish DNA sequence from clone CH211-279I17 in linkage group 22, complete sequence Length = 123028 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcctcca 46 ||||||||||||||||||||||||| Sbjct: 21108 gatccatccatccatccatcctcca 21084 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 22103 atccatccatccatccatcctcc 22081 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 23308 atccatccatccatccatcct 23288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25854 atccatccatccatccatcc 25873 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24047 atccatccatccatccatcc 24028 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24043 atccatccatccatccatcc 24024 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23767 atccatccatccatccatcc 23748 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23763 atccatccatccatccatcc 23744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23573 atccatccatccatccatcc 23554 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23516 atccatccatccatccatcc 23497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23512 atccatccatccatccatcc 23493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23508 atccatccatccatccatcc 23489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23504 atccatccatccatccatcc 23485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23500 atccatccatccatccatcc 23481 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23312 atccatccatccatccatcc 23293 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23234 atccatccatccatccatcc 23215 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23083 atccatccatccatccatcc 23064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23079 atccatccatccatccatcc 23060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23006 atccatccatccatccatcc 22987 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23002 atccatccatccatccatcc 22983 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22998 atccatccatccatccatcc 22979 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22994 atccatccatccatccatcc 22975 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22990 atccatccatccatccatcc 22971 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22119 atccatccatccatccatcc 22100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22115 atccatccatccatccatcc 22096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22111 atccatccatccatccatcc 22092 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22107 atccatccatccatccatcc 22088 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 21789 atccatccatccatccatcatcca 21766 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21476 atccatccatccatccatcc 21457
>gb|AC112361.5| Rattus norvegicus 9 BAC CH230-61F12 (Children's Hospital Oakland Research Institute) complete sequence Length = 216648 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 172359 atccatccatccatccatcctcca 172336 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173462 atccatccatccatccatcc 173443 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173458 atccatccatccatccatcc 173439 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 172378 atccatccatccatccatcatcca 172355 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 172275 tccatccatccatccatcct 172256
>gb|AC131336.9| Mus musculus chromosome 1, clone RP23-96A20, complete sequence Length = 121355 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 75900 atccatccatccatccatcctcca 75923 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 75896 atccatccatccatccatcc 75915 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 75892 atccatccatccatccatcc 75911 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 75888 atccatccatccatccatcc 75907 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 75884 atccatccatccatccatcc 75903 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 75880 atccatccatccatccatcc 75899 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 75876 atccatccatccatccatcc 75895
>gb|AC122457.4| Mus musculus BAC clone RP24-266P11 from chromosome 12, complete sequence Length = 159954 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 108680 atccatccatccatccatcctcca 108657 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109238 atccatccatccatccatcc 109219 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109234 atccatccatccatccatcc 109215 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109187 atccatccatccatccatcc 109168 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109183 atccatccatccatccatcc 109164 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109179 atccatccatccatccatcc 109160 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109175 atccatccatccatccatcc 109156 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109171 atccatccatccatccatcc 109152 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109167 atccatccatccatccatcc 109148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109163 atccatccatccatccatcc 109144 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 108696 atccatccatccatccatcc 108677 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 108692 atccatccatccatccatcc 108673 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 108688 atccatccatccatccatcc 108669 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 108684 atccatccatccatccatcc 108665 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86718 atccatccatccatccatcc 86699 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86714 atccatccatccatccatcc 86695 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86710 atccatccatccatccatcc 86691 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86706 atccatccatccatccatcc 86687 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86702 atccatccatccatccatcc 86683 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86698 atccatccatccatccatcc 86679 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86694 atccatccatccatccatcc 86675
>gb|AF235096.5| Homo sapiens chromosome 8 clone RP11-562D1 map q24.13, complete sequence Length = 199966 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 32330 atccatccatccatccatcctcca 32353 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctccac 47 |||||||||||||||||||||| Sbjct: 31926 catccatccatccatcctccac 31947 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 32546 atccatccatccatccatcct 32566 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 31881 catccatccatccatcctcca 31901 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32473 atccatccatccatccatcc 32492 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32469 atccatccatccatccatcc 32488 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32465 atccatccatccatccatcc 32484 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32461 atccatccatccatccatcc 32480 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||| |||||||||||||||| Sbjct: 32118 atccatctatccatccatcctcca 32141 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||| ||||||||| Sbjct: 31811 atccatccatccattcatcctcca 31834
>gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 183897 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 8725 atccatccatccatccatcctcca 8702 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8687 atccatccatccatccatcc 8668 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8683 atccatccatccatccatcc 8664 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8679 atccatccatccatccatcc 8660 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8675 atccatccatccatccatcc 8656
>gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 map 3, complete sequence Length = 191014 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 17016 atccatccatccatccatcctcca 16993 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 172567 atccatccatccatccatcc 172586 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17020 atccatccatccatccatcc 17001
>gb|DQ483433.1| Gymnogyps californianus clone 136H microsatellite sequence Length = 613 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 424 atccatccatccatccatcctcca 401 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 436 atccatccatccatccatcc 417 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 432 atccatccatccatccatcc 413 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 428 atccatccatccatccatcc 409
>gb|DQ483431.1| Gymnogyps californianus clone 134H microsatellite sequence Length = 1710 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 983 atccatccatccatccatcctcca 960 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1479 atccatccatccatccatcc 1460 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1475 atccatccatccatccatcc 1456 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1471 atccatccatccatccatcc 1452 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 995 atccatccatccatccatcc 976 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 991 atccatccatccatccatcc 972 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 987 atccatccatccatccatcc 968
>gb|DQ483369.1| Gymnogyps californianus clone 72H microsatellite sequence Length = 962 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 522 atccatccatccatccatcctcca 545 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 518 atccatccatccatccatcc 537 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 514 atccatccatccatccatcc 533 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 510 atccatccatccatccatcc 529 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 193 atccatccatccatccatcc 174 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189 atccatccatccatccatcc 170 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 185 atccatccatccatccatcc 166 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 181 atccatccatccatccatcc 162 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 177 atccatccatccatccatcc 158 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173 atccatccatccatccatcc 154
>gb|DQ483367.1| Gymnogyps californianus clone 70H microsatellite sequence Length = 609 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 424 atccatccatccatccatcctcca 401 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 432 atccatccatccatccatcc 413 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 428 atccatccatccatccatcc 409
>gb|AC122414.4| Mus musculus BAC clone RP24-150D8 from chromosome 5, complete sequence Length = 186986 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 13045 atccatccatccatccatcctcca 13022 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42012 atccatccatccatccatcc 41993 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42008 atccatccatccatccatcc 41989 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42004 atccatccatccatccatcc 41985 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42000 atccatccatccatccatcc 41981 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41996 atccatccatccatccatcc 41977 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41992 atccatccatccatccatcc 41973 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41988 atccatccatccatccatcc 41969 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41984 atccatccatccatccatcc 41965 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41980 atccatccatccatccatcc 41961 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41731 atccatccatccatccatcc 41712 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41727 atccatccatccatccatcc 41708 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41723 atccatccatccatccatcc 41704 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41719 atccatccatccatccatcc 41700 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41715 atccatccatccatccatcc 41696 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41711 atccatccatccatccatcc 41692 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41707 atccatccatccatccatcc 41688 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 41703 atccatccatccatccatcc 41684 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13049 atccatccatccatccatcc 13030
>gb|AY330727.1| Corcorax melanorhamphos microsatellite CmeG5 sequence Length = 163 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 59 atccatccatccatccatcctcca 82
>gb|AC103968.11| Homo sapiens chromosome 15, clone RP11-719C20, complete sequence Length = 162470 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 86114 atccatccatccatccatcctcca 86091 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 85834 tccatccatccatccatcctcca 85812 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 86149 catccatccatccatcctcca 86129 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 86011 catccatccatccatcctcca 85991 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 85980 atccatccatccatccatcct 85960 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86122 atccatccatccatccatcc 86103 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86118 atccatccatccatccatcc 86099 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85984 atccatccatccatccatcc 85965 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85862 atccatccatccatccatcc 85843 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||| |||||||||| Sbjct: 85854 atccatccatccacccatcctcca 85831
>gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosome 3, complete sequence Length = 210014 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 45382 atccatccatccatccatcctcca 45359 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 200935 atccatccatccatccatcc 200954 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45386 atccatccatccatccatcc 45367
>gb|AC120544.9| Mus musculus chromosome 1, clone RP23-299N6, complete sequence Length = 223752 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 198892 atccatccatccatccatcctcca 198869 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 198896 atccatccatccatccatcc 198877
>emb|BX546033.1| Human DNA sequence from clone XX-FW80414D10L on chromosome 22, complete sequence Length = 9070 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 6816 atccatccatccatccatcctcca 6839 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 7618 tccatccatccatccatcct 7637 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6812 atccatccatccatccatcc 6831 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6201 atccatccatccatccatcc 6220 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6197 atccatccatccatccatcc 6216 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6193 atccatccatccatccatcc 6212 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6121 atccatccatccatccatcc 6140
>emb|AL589702.8| Human DNA sequence from clone RP5-907A6 on chromosome 1, complete sequence Length = 107103 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 100313 atccatccatccatccatcctcca 100336 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 100165 atccatccatccatccatcctcca 100188 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||| ||||| Sbjct: 103808 atccatccatccatccatcgtccac 103832 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||| |||||||||||||||| Sbjct: 103845 atccatctatccatccatcctcca 103868 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103804 atccatccatccatccatcc 103823 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103800 atccatccatccatccatcc 103819 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103796 atccatccatccatccatcc 103815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103792 atccatccatccatccatcc 103811 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103788 atccatccatccatccatcc 103807 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103784 atccatccatccatccatcc 103803 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||| |||||||||||||| Sbjct: 103580 atccatccacccatccatcctcca 103603 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100375 atccatccatccatccatcc 100394 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100371 atccatccatccatccatcc 100390 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100367 atccatccatccatccatcc 100386 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100309 atccatccatccatccatcc 100328 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100161 atccatccatccatccatcc 100180 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79693 atccatccatccatccatcc 79712 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79566 atccatccatccatccatcc 79585 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79411 atccatccatccatccatcc 79430 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79111 atccatccatccatccatcc 79130 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79107 atccatccatccatccatcc 79126 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79103 atccatccatccatccatcc 79122 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79099 atccatccatccatccatcc 79118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 78875 atccatccatccatccatcc 78894 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 78871 atccatccatccatccatcc 78890 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 78867 atccatccatccatccatcc 78886 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 78863 atccatccatccatccatcc 78882
>emb|AL929420.9| Human DNA sequence from clone CITF22-123F2 on chromosome 22, complete sequence Length = 15041 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 986 atccatccatccatccatcctcca 1009 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 1788 tccatccatccatccatcct 1807 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 982 atccatccatccatccatcc 1001 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 371 atccatccatccatccatcc 390 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 367 atccatccatccatccatcc 386 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 363 atccatccatccatccatcc 382 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 359 atccatccatccatccatcc 378 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 287 atccatccatccatccatcc 306
>emb|AL583882.6| Human DNA sequence from clone RP5-1098C18 on chromosome 1p36.23-36.33 Contains GSSs, STSs and a CpG island, complete sequence Length = 90582 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 49898 atccatccatccatccatcctcca 49875 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50307 atccatccatccatccatcc 50288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49922 atccatccatccatccatcc 49903 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49918 atccatccatccatccatcc 49899 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49914 atccatccatccatccatcc 49895 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49910 atccatccatccatccatcc 49891 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49906 atccatccatccatccatcc 49887 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49902 atccatccatccatccatcc 49883 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49306 atccatccatccatccatcc 49287
>emb|AL450026.10| Human DNA sequence from clone RP11-439A18 on chromosome 9 Contains the 5' UTR of a variant of a novel gene (MGC20553) and a CpG island, complete sequence Length = 84632 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 37006 atccatccatccatccatcctcca 36983 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37026 atccatccatccatccatcc 37007 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37022 atccatccatccatccatcc 37003 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37018 atccatccatccatccatcc 36999 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37014 atccatccatccatccatcc 36995 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37010 atccatccatccatccatcc 36991
>emb|AL358593.22| Human DNA sequence from clone RP11-473A10 on chromosome 1 Contains the 3' end of the gene for a novel protein (KIAA1626, FLJ34701, FLJ44929, FLJ10521) and the 5' end of a novel gene, complete sequence Length = 142454 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 27042 atccatccatccatccatcctcca 27065 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70510 atccatccatccatccatcc 70529 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70506 atccatccatccatccatcc 70525 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70502 atccatccatccatccatcc 70521 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70498 atccatccatccatccatcc 70517 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70494 atccatccatccatccatcc 70513 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27038 atccatccatccatccatcc 27057 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27034 atccatccatccatccatcc 27053 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26611 atccatccatccatccatcc 26630 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26607 atccatccatccatccatcc 26626 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26603 atccatccatccatccatcc 26622 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26599 atccatccatccatccatcc 26618 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26595 atccatccatccatccatcc 26614 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26591 atccatccatccatccatcc 26610 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26587 atccatccatccatccatcc 26606
>emb|AL354984.17| Human DNA sequence from clone RP13-379L11 on chromosome 20 Contains a putative novel gene, ESTs, STSs and GSSs, complete sequence Length = 207694 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 66304 atccatccatccatccatcctcca 66281 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 |||||||||||| |||||||||||| Sbjct: 66281 atccatccatccttccatcctccac 66257 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 43344 atccatccatccatccatcct 43324 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66324 atccatccatccatccatcc 66305 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66320 atccatccatccatccatcc 66301 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66316 atccatccatccatccatcc 66297 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66312 atccatccatccatccatcc 66293 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66308 atccatccatccatccatcc 66289 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43924 atccatccatccatccatcc 43905 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43920 atccatccatccatccatcc 43901 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43916 atccatccatccatccatcc 43897 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43912 atccatccatccatccatcc 43893 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43908 atccatccatccatccatcc 43889 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43844 atccatccatccatccatcc 43825 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43840 atccatccatccatccatcc 43821 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43836 atccatccatccatccatcc 43817 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43672 atccatccatccatccatcc 43653 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43668 atccatccatccatccatcc 43649 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43664 atccatccatccatccatcc 43645 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43636 atccatccatccatccatcc 43617 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43588 atccatccatccatccatcc 43569 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43584 atccatccatccatccatcc 43565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43580 atccatccatccatccatcc 43561 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43576 atccatccatccatccatcc 43557 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43572 atccatccatccatccatcc 43553 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43524 atccatccatccatccatcc 43505 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43520 atccatccatccatccatcc 43501 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43516 atccatccatccatccatcc 43497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43512 atccatccatccatccatcc 43493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43508 atccatccatccatccatcc 43489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43504 atccatccatccatccatcc 43485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43394 atccatccatccatccatcc 43375 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43390 atccatccatccatccatcc 43371 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43386 atccatccatccatccatcc 43367 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43360 atccatccatccatccatcc 43341 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43356 atccatccatccatccatcc 43337 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43352 atccatccatccatccatcc 43333 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43348 atccatccatccatccatcc 43329
>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1, complete sequence Length = 114231 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 72007 atccatccatccatccatcctcca 72030 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72269 atccatccatccatccatcc 72288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72265 atccatccatccatccatcc 72284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72261 atccatccatccatccatcc 72280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71795 atccatccatccatccatcc 71814 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71791 atccatccatccatccatcc 71810 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71787 atccatccatccatccatcc 71806 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71783 atccatccatccatccatcc 71802 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71779 atccatccatccatccatcc 71798 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71775 atccatccatccatccatcc 71794 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52620 atccatccatccatccatcc 52601
>gb|AC153517.8| Mus musculus 10 BAC RP23-22E18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 203981 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 105294 atccatccatccatccatcctcca 105317 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 105344 atccatccatccatccatcc 105363 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 105340 atccatccatccatccatcc 105359 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 105336 atccatccatccatccatcc 105355 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 105332 atccatccatccatccatcc 105351
>gb|AY254848.1| Pongo pygmaeus non-coding region upstream of COX8H pseudogene Length = 2132 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 899 atccatccatccatccatcctcca 922 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 977 atccatccatccatccatcc 996 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 973 atccatccatccatccatcc 992 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 969 atccatccatccatccatcc 988
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 59551 atccatccatccatccatcctcca 59528 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 59412 cagctatccatccatccatccatcc 59388 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 59391 atccatccatccatccatcct 59371 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 59171 atccatccatccatccatcct 59151 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 59088 cagctatccatccatccatccatcc 59064 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 59079 atccatccatccatccatcct 59059 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 59019 atccatccatccatccatcct 58999 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115093 atccatccatccatccatcc 115112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115089 atccatccatccatccatcc 115108 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115085 atccatccatccatccatcc 115104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115081 atccatccatccatccatcc 115100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115077 atccatccatccatccatcc 115096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115073 atccatccatccatccatcc 115092 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115069 atccatccatccatccatcc 115088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115065 atccatccatccatccatcc 115084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115061 atccatccatccatccatcc 115080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115057 atccatccatccatccatcc 115076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71658 atccatccatccatccatcc 71639 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71654 atccatccatccatccatcc 71635 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71650 atccatccatccatccatcc 71631 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71646 atccatccatccatccatcc 71627 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71642 atccatccatccatccatcc 71623 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71566 atccatccatccatccatcc 71547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71502 atccatccatccatccatcc 71483 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71498 atccatccatccatccatcc 71479 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71494 atccatccatccatccatcc 71475 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71490 atccatccatccatccatcc 71471 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71426 atccatccatccatccatcc 71407 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71362 atccatccatccatccatcc 71343 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71310 atccatccatccatccatcc 71291 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71306 atccatccatccatccatcc 71287 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71302 atccatccatccatccatcc 71283 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71298 atccatccatccatccatcc 71279 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71294 atccatccatccatccatcc 71275 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71290 atccatccatccatccatcc 71271 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71286 atccatccatccatccatcc 71267 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71282 atccatccatccatccatcc 71263 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71178 atccatccatccatccatcc 71159 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71110 atccatccatccatccatcc 71091 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71106 atccatccatccatccatcc 71087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71082 atccatccatccatccatcc 71063 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71078 atccatccatccatccatcc 71059 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71074 atccatccatccatccatcc 71055 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71070 atccatccatccatccatcc 71051 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71066 atccatccatccatccatcc 71047 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71062 atccatccatccatccatcc 71043 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71058 atccatccatccatccatcc 71039 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71054 atccatccatccatccatcc 71035 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71050 atccatccatccatccatcc 71031 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71046 atccatccatccatccatcc 71027 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71042 atccatccatccatccatcc 71023 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 71038 atccatccatccatccatcc 71019 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70994 atccatccatccatccatcc 70975 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70990 atccatccatccatccatcc 70971 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70802 atccatccatccatccatcc 70783 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70798 atccatccatccatccatcc 70779 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70794 atccatccatccatccatcc 70775 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70790 atccatccatccatccatcc 70771 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59403 atccatccatccatccatcc 59384 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59399 atccatccatccatccatcc 59380 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59395 atccatccatccatccatcc 59376 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59244 atccatccatccatccatcc 59225 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59240 atccatccatccatccatcc 59221 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59236 atccatccatccatccatcc 59217 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59232 atccatccatccatccatcc 59213 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59179 atccatccatccatccatcc 59160 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59175 atccatccatccatccatcc 59156 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59123 atccatccatccatccatcc 59104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59119 atccatccatccatccatcc 59100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59055 atccatccatccatccatcc 59036 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59051 atccatccatccatccatcc 59032 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59047 atccatccatccatccatcc 59028 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59043 atccatccatccatccatcc 59024 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59039 atccatccatccatccatcc 59020 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59035 atccatccatccatccatcc 59016 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59031 atccatccatccatccatcc 59012 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59027 atccatccatccatccatcc 59008 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59023 atccatccatccatccatcc 59004 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58777 atccatccatccatccatcc 58758 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58773 atccatccatccatccatcc 58754 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58769 atccatccatccatccatcc 58750 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58765 atccatccatccatccatcc 58746 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58761 atccatccatccatccatcc 58742 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58757 atccatccatccatccatcc 58738 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58753 atccatccatccatccatcc 58734 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58749 atccatccatccatccatcc 58730
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 133891 atccatccatccatccatcctcca 133914 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 134625 atccatccatccatccatcct 134645 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 134585 atccatccatccatccatcct 134605 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 134564 cagctatccatccatccatccatcc 134588 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 134497 atccatccatccatccatcct 134517 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 134409 atccatccatccatccatcct 134429 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 134369 atccatccatccatccatcct 134389 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 134289 atccatccatccatccatcct 134309 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 134045 cagctatccatccatccatccatcc 134069 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134910 atccatccatccatccatcc 134929 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134621 atccatccatccatccatcc 134640 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134617 atccatccatccatccatcc 134636 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134613 atccatccatccatccatcc 134632 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134581 atccatccatccatccatcc 134600 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134577 atccatccatccatccatcc 134596 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134573 atccatccatccatccatcc 134592 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134405 atccatccatccatccatcc 134424 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134401 atccatccatccatccatcc 134420 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134397 atccatccatccatccatcc 134416 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134393 atccatccatccatccatcc 134412 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134365 atccatccatccatccatcc 134384 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134285 atccatccatccatccatcc 134304 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134281 atccatccatccatccatcc 134300 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134277 atccatccatccatccatcc 134296 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134273 atccatccatccatccatcc 134292 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134269 atccatccatccatccatcc 134288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134265 atccatccatccatccatcc 134284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134261 atccatccatccatccatcc 134280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134257 atccatccatccatccatcc 134276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134253 atccatccatccatccatcc 134272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134249 atccatccatccatccatcc 134268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134245 atccatccatccatccatcc 134264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134241 atccatccatccatccatcc 134260 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134237 atccatccatccatccatcc 134256 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134233 atccatccatccatccatcc 134252 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134229 atccatccatccatccatcc 134248 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134225 atccatccatccatccatcc 134244 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134221 atccatccatccatccatcc 134240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134217 atccatccatccatccatcc 134236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134213 atccatccatccatccatcc 134232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134177 atccatccatccatccatcc 134196 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134062 atccatccatccatccatcc 134081 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134058 atccatccatccatccatcc 134077 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134054 atccatccatccatccatcc 134073 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 133887 atccatccatccatccatcc 133906 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 133883 atccatccatccatccatcc 133902 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121547 atccatccatccatccatcc 121566 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121543 atccatccatccatccatcc 121562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121539 atccatccatccatccatcc 121558 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121535 atccatccatccatccatcc 121554 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121531 atccatccatccatccatcc 121550 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121527 atccatccatccatccatcc 121546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121523 atccatccatccatccatcc 121542 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121519 atccatccatccatccatcc 121538 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121515 atccatccatccatccatcc 121534 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121511 atccatccatccatccatcc 121530 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121507 atccatccatccatccatcc 121526 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121477 atccatccatccatccatcc 121496 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121473 atccatccatccatccatcc 121492 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121445 atccatccatccatccatcc 121464 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121224 atccatccatccatccatcc 121243 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121220 atccatccatccatccatcc 121239 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121216 atccatccatccatccatcc 121235 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121172 atccatccatccatccatcc 121191 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121168 atccatccatccatccatcc 121187 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121164 atccatccatccatccatcc 121183 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121160 atccatccatccatccatcc 121179 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121156 atccatccatccatccatcc 121175 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121132 atccatccatccatccatcc 121151 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120952 atccatccatccatccatcc 120971 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120856 atccatccatccatccatcc 120875 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120852 atccatccatccatccatcc 120871 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120848 atccatccatccatccatcc 120867 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120844 atccatccatccatccatcc 120863 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120840 atccatccatccatccatcc 120859 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120836 atccatccatccatccatcc 120855 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120832 atccatccatccatccatcc 120851 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120828 atccatccatccatccatcc 120847 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120824 atccatccatccatccatcc 120843 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120820 atccatccatccatccatcc 120839 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120816 atccatccatccatccatcc 120835 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120812 atccatccatccatccatcc 120831 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120808 atccatccatccatccatcc 120827 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120744 atccatccatccatccatcc 120763 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120740 atccatccatccatccatcc 120759 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120736 atccatccatccatccatcc 120755 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120732 atccatccatccatccatcc 120751 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120728 atccatccatccatccatcc 120747 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120724 atccatccatccatccatcc 120743 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120720 atccatccatccatccatcc 120739
>emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chromosome 11 Contains a novel gene, complete sequence Length = 154687 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 96793 atccatccatccatccatcctcca 96770 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96954 atccatccatccatccatcc 96935 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96950 atccatccatccatccatcc 96931 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96946 atccatccatccatccatcc 96927 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96942 atccatccatccatccatcc 96923 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96829 atccatccatccatccatcc 96810
>emb|CR293518.13| Zebrafish DNA sequence from clone CH211-129L10 in linkage group 12, complete sequence Length = 196374 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 175585 atccatccatccatccatcctcca 175562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175823 atccatccatccatccatcc 175804 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175819 atccatccatccatccatcc 175800 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175815 atccatccatccatccatcc 175796 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175811 atccatccatccatccatcc 175792 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175807 atccatccatccatccatcc 175788 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175605 atccatccatccatccatcc 175586 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175601 atccatccatccatccatcc 175582 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175597 atccatccatccatccatcc 175578 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175593 atccatccatccatccatcc 175574 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175589 atccatccatccatccatcc 175570 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175562 atccatccatccatccatcc 175543 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175558 atccatccatccatccatcc 175539 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175554 atccatccatccatccatcc 175535 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||| ||||||||||||| Sbjct: 175488 atccatccatacatccatcctcca 175465 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175465 atccatccatccatccatcc 175446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175461 atccatccatccatccatcc 175442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175457 atccatccatccatccatcc 175438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175453 atccatccatccatccatcc 175434 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175415 atccatccatccatccatcc 175396 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175411 atccatccatccatccatcc 175392 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175407 atccatccatccatccatcc 175388 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116363 atccatccatccatccatcc 116344 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116359 atccatccatccatccatcc 116340 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116355 atccatccatccatccatcc 116336 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116351 atccatccatccatccatcc 116332 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116347 atccatccatccatccatcc 116328 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116343 atccatccatccatccatcc 116324 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116339 atccatccatccatccatcc 116320 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116184 atccatccatccatccatcc 116165 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116180 atccatccatccatccatcc 116161 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116099 atccatccatccatccatcc 116080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116095 atccatccatccatccatcc 116076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116091 atccatccatccatccatcc 116072 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116087 atccatccatccatccatcc 116068 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116083 atccatccatccatccatcc 116064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 116079 atccatccatccatccatcc 116060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115985 atccatccatccatccatcc 115966 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115981 atccatccatccatccatcc 115962 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115977 atccatccatccatccatcc 115958 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115973 atccatccatccatccatcc 115954 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115969 atccatccatccatccatcc 115950 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115876 atccatccatccatccatcc 115857 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115872 atccatccatccatccatcc 115853 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115868 atccatccatccatccatcc 115849 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115864 atccatccatccatccatcc 115845 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115860 atccatccatccatccatcc 115841 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115856 atccatccatccatccatcc 115837 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115852 atccatccatccatccatcc 115833 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115848 atccatccatccatccatcc 115829 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115844 atccatccatccatccatcc 115825 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115840 atccatccatccatccatcc 115821 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115836 atccatccatccatccatcc 115817 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115832 atccatccatccatccatcc 115813 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115828 atccatccatccatccatcc 115809 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115824 atccatccatccatccatcc 115805 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115820 atccatccatccatccatcc 115801 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115571 atccatccatccatccatcc 115552 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115567 atccatccatccatccatcc 115548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115563 atccatccatccatccatcc 115544 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115559 atccatccatccatccatcc 115540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115555 atccatccatccatccatcc 115536 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115551 atccatccatccatccatcc 115532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115547 atccatccatccatccatcc 115528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115543 atccatccatccatccatcc 115524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115539 atccatccatccatccatcc 115520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115535 atccatccatccatccatcc 115516 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115479 atccatccatccatccatcc 115460 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115475 atccatccatccatccatcc 115456 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115471 atccatccatccatccatcc 115452 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115467 atccatccatccatccatcc 115448 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115463 atccatccatccatccatcc 115444 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115459 atccatccatccatccatcc 115440 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115455 atccatccatccatccatcc 115436 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115385 atccatccatccatccatcc 115366 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115381 atccatccatccatccatcc 115362 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115377 atccatccatccatccatcc 115358 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115373 atccatccatccatccatcc 115354 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115369 atccatccatccatccatcc 115350 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 115365 atccatccatccatccatcc 115346
>gb|AC116105.12| Mus musculus chromosome 1, clone RP23-23A4, complete sequence Length = 214780 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 208649 atccatccatccatccatcctcca 208626 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 208673 atccatccatccatccatcc 208654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 208669 atccatccatccatccatcc 208650 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 208665 atccatccatccatccatcc 208646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 208661 atccatccatccatccatcc 208642 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 208657 atccatccatccatccatcc 208638 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 208653 atccatccatccatccatcc 208634
>emb|BX470245.8| Zebrafish DNA sequence from clone DKEY-249O24 in linkage group 9, complete sequence Length = 132054 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 65614 atccatccatccatccatcctcca 65591 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113607 atccatccatccatccatcc 113588 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113603 atccatccatccatccatcc 113584 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113599 atccatccatccatccatcc 113580 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113595 atccatccatccatccatcc 113576 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113591 atccatccatccatccatcc 113572 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113587 atccatccatccatccatcc 113568 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113583 atccatccatccatccatcc 113564 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113579 atccatccatccatccatcc 113560 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69921 atccatccatccatccatcc 69902 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69917 atccatccatccatccatcc 69898 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69913 atccatccatccatccatcc 69894 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69486 atccatccatccatccatcc 69505 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69482 atccatccatccatccatcc 69501 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69478 atccatccatccatccatcc 69497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69474 atccatccatccatccatcc 69493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69470 atccatccatccatccatcc 69489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69442 atccatccatccatccatcc 69461 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66137 atccatccatccatccatcc 66118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66106 atccatccatccatccatcc 66087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65884 atccatccatccatccatcc 65865 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65880 atccatccatccatccatcc 65861 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65876 atccatccatccatccatcc 65857 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65872 atccatccatccatccatcc 65853 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65868 atccatccatccatccatcc 65849 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65864 atccatccatccatccatcc 65845 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65860 atccatccatccatccatcc 65841 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65742 atccatccatccatccatcc 65723 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65280 atccatccatccatccatcc 65261 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65276 atccatccatccatccatcc 65257 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65130 atccatccatccatccatcc 65111 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65126 atccatccatccatccatcc 65107 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 65122 atccatccatccatccatcc 65103
>emb|BX927295.6| Zebrafish DNA sequence from clone DKEY-7P3 in linkage group 18, complete sequence Length = 71075 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 39307 atccatccatccatccatcctcca 39284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39327 atccatccatccatccatcc 39308 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39323 atccatccatccatccatcc 39304 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39319 atccatccatccatccatcc 39300 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39315 atccatccatccatccatcc 39296 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39311 atccatccatccatccatcc 39292
>emb|BX324148.9| Zebrafish DNA sequence from clone RP71-17G11 in linkage group 23, complete sequence Length = 127356 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 95236 atccatccatccatccatcctcca 95213 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96102 atccatccatccatccatcc 96083 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96098 atccatccatccatccatcc 96079 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95808 atccatccatccatccatcc 95789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95804 atccatccatccatccatcc 95785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95800 atccatccatccatccatcc 95781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95796 atccatccatccatccatcc 95777 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95792 atccatccatccatccatcc 95773 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95788 atccatccatccatccatcc 95769 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95784 atccatccatccatccatcc 95765 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95780 atccatccatccatccatcc 95761 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95674 atccatccatccatccatcc 95655 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95670 atccatccatccatccatcc 95651 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95666 atccatccatccatccatcc 95647 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95662 atccatccatccatccatcc 95643 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95452 atccatccatccatccatcc 95433
>gb|AC044792.6| Homo sapiens chromosome 19 clone CTC-258N23, complete sequence Length = 201939 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 78179 atccatccatccatccatcctcca 78202 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 78175 atccatccatccatccatcc 78194
>gb|AC008646.7| Homo sapiens chromosome 5 clone CTB-182O9, complete sequence Length = 174928 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 12665 atccatccatccatccatcctcca 12642
>gb|AC011333.7| Homo sapiens chromosome 5 clone CTC-229L21, complete sequence Length = 159964 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 36228 atccatccatccatccatcctcca 36251 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 158352 atccatccatccatccatcct 158372 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158348 atccatccatccatccatcc 158367 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158101 atccatccatccatccatcc 158120 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158097 atccatccatccatccatcc 158116 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158093 atccatccatccatccatcc 158112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158089 atccatccatccatccatcc 158108 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158085 atccatccatccatccatcc 158104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158081 atccatccatccatccatcc 158100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42914 atccatccatccatccatcc 42933 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42910 atccatccatccatccatcc 42929 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42906 atccatccatccatccatcc 42925 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42902 atccatccatccatccatcc 42921 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42898 atccatccatccatccatcc 42917 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42894 atccatccatccatccatcc 42913 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42890 atccatccatccatccatcc 42909 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42754 atccatccatccatccatcc 42773 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42750 atccatccatccatccatcc 42769 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36224 atccatccatccatccatcc 36243 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36220 atccatccatccatccatcc 36239 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36216 atccatccatccatccatcc 36235 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36212 atccatccatccatccatcc 36231 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36208 atccatccatccatccatcc 36227 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36204 atccatccatccatccatcc 36223 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18384 atccatccatccatccatcc 18403 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18380 atccatccatccatccatcc 18399
>gb|AF192304.6| Homo sapiens chromosome 8 clone CTC-458A3 map 8q24.3, complete sequence Length = 177028 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 60062 atccatccatccatccatcctcca 60039 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 60273 catccatccatccatcctcca 60253 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60066 atccatccatccatccatcc 60047 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59592 atccatccatccatccatcc 59573
>dbj|AK097062.1| Homo sapiens cDNA FLJ39743 fis, clone SMINT2017319 Length = 3376 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 2815 atccatccatccatccatcctcca 2838 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 2474 atccatccatccatccatcctcca 2497 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 2608 atccatccatccatccatcct 2628 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 2577 catccatccatccatcctcca 2597 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 2435 catccatccatccatcctcca 2455 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2865 atccatccatccatccatcc 2884 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2861 atccatccatccatccatcc 2880 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2857 atccatccatccatccatcc 2876 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2853 atccatccatccatccatcc 2872 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2849 atccatccatccatccatcc 2868 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2845 atccatccatccatccatcc 2864 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||| |||||||||| Sbjct: 2792 atccatccatccacccatcctcca 2815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2784 atccatccatccatccatcc 2803 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2780 atccatccatccatccatcc 2799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2776 atccatccatccatccatcc 2795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2772 atccatccatccatccatcc 2791 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2768 atccatccatccatccatcc 2787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2726 atccatccatccatccatcc 2745 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2604 atccatccatccatccatcc 2623 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2470 atccatccatccatccatcc 2489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2466 atccatccatccatccatcc 2485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2462 atccatccatccatccatcc 2481
>gb|AC116559.30| Papio anubis clone rp41-339c10, complete sequence Length = 162030 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 151934 atccatccatccatccatcctcca 151911 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 153396 atccatccatccatccatcc 153377 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 153392 atccatccatccatccatcc 153373 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 153388 atccatccatccatccatcc 153369 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 153384 atccatccatccatccatcc 153365 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 153380 atccatccatccatccatcatcca 153357 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 151264 atccatccatccatccatcc 151245 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 151260 atccatccatccatccatcc 151241 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 151256 atccatccatccatccatcc 151237
>gb|AC116558.21| Papio anubis clone rp41-273g19, complete sequence Length = 188182 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 7045 atccatccatccatccatcctcca 7068 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcct 43 ||||||||||||||||||||||| Sbjct: 6119 cgatccatccatccatccatcct 6141 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7747 atccatccatccatccatcc 7766 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7743 atccatccatccatccatcc 7762 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7739 atccatccatccatccatcc 7758 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7735 atccatccatccatccatcc 7754 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7731 atccatccatccatccatcc 7750 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7727 atccatccatccatccatcc 7746 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7723 atccatccatccatccatcc 7742 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7719 atccatccatccatccatcc 7738 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7715 atccatccatccatccatcc 7734 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 5599 atccatccatccatccatcatcca 5622 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5595 atccatccatccatccatcc 5614 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5591 atccatccatccatccatcc 5610 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5587 atccatccatccatccatcc 5606
>gb|AC083841.9| Homo sapiens chromosome 8, clone RP11-706C16, complete sequence Length = 203375 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 141142 atccatccatccatccatcctcca 141165 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 141092 atccatccatccatccatcctcca 141115 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccac 47 |||||||||||||||| |||||||| Sbjct: 140647 atccatccatccatccctcctccac 140671 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140643 atccatccatccatccatcc 140662 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140639 atccatccatccatccatcc 140658 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140635 atccatccatccatccatcc 140654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140631 atccatccatccatccatcc 140650
>gb|AC090064.3| Homo sapiens chromosome 5 clone CTB-43C3, complete sequence Length = 124882 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 34518 atccatccatccatccatcctcca 34541 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 14 caagcagcgatccatccatccatccatcc 42 |||||| | |||||||||||||||||||| Sbjct: 44708 caagcatccatccatccatccatccatcc 44736 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44733 atccatccatccatccatcc 44752 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44729 atccatccatccatccatcc 44748 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44725 atccatccatccatccatcc 44744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44721 atccatccatccatccatcc 44740
>gb|AC011407.6| Homo sapiens chromosome 5 clone CTB-54I1, complete sequence Length = 240957 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 8407 atccatccatccatccatcctcca 8430 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 14 caagcagcgatccatccatccatccatcc 42 |||||| | |||||||||||||||||||| Sbjct: 18804 caagcatccatccatccatccatccatcc 18832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 211925 atccatccatccatccatcc 211906 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 211921 atccatccatccatccatcc 211902 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 211917 atccatccatccatccatcc 211898 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 211913 atccatccatccatccatcc 211894 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18829 atccatccatccatccatcc 18848 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18825 atccatccatccatccatcc 18844 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18821 atccatccatccatccatcc 18840 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18817 atccatccatccatccatcc 18836
>gb|AF470043.1| Oncorhynchus mykiss microsatellite OMM1279 sequence Length = 495 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 259 atccatccatccatccatcctcca 282 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 255 atccatccatccatccatcc 274 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 251 atccatccatccatccatcc 270 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 247 atccatccatccatccatcc 266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 243 atccatccatccatccatcc 262 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 239 atccatccatccatccatcc 258 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 235 atccatccatccatccatcc 254 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 231 atccatccatccatccatcc 250
>gb|AC008415.6| Homo sapiens chromosome 5 clone CTC-283O18, complete sequence Length = 168368 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 96731 atccatccatccatccatcctcca 96708
>gb|AC025470.5| Homo sapiens chromosome 5 clone CTD-2516K3, complete sequence Length = 201687 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 410 atccatccatccatccatcctcca 387 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 418 atccatccatccatccatcc 399 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 414 atccatccatccatccatcc 395
>gb|AC008780.7| Homo sapiens chromosome 5 clone CTD-2023N9, complete sequence Length = 178203 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 174690 atccatccatccatccatcctcca 174667 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 174698 atccatccatccatccatcc 174679 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 174694 atccatccatccatccatcc 174675 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131124 atccatccatccatccatcc 131105 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131120 atccatccatccatccatcc 131101 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131116 atccatccatccatccatcc 131097 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131112 atccatccatccatccatcc 131093 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131108 atccatccatccatccatcc 131089 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131104 atccatccatccatccatcc 131085 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131100 atccatccatccatccatcc 131081 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131096 atccatccatccatccatcc 131077 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131092 atccatccatccatccatcc 131073 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131088 atccatccatccatccatcc 131069
>dbj|AK034483.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched library, clone:9330198P08 product:hypothetical protein, full insert sequence Length = 3071 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 2389 atccatccatccatccatcctcca 2412 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2385 atccatccatccatccatcc 2404
>emb|BX255929.7| Zebrafish DNA sequence from clone CH211-271P5 in linkage group 14, complete sequence Length = 147460 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 62606 atccatccatccatccatcctcca 62629 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 62555 atccatccatccatccatcctcc 62577 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69821 atccatccatccatccatcc 69840 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69817 atccatccatccatccatcc 69836 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69813 atccatccatccatccatcc 69832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69809 atccatccatccatccatcc 69828 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69805 atccatccatccatccatcc 69824 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69801 atccatccatccatccatcc 69820 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69797 atccatccatccatccatcc 69816 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69793 atccatccatccatccatcc 69812 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69789 atccatccatccatccatcc 69808 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69785 atccatccatccatccatcc 69804 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69781 atccatccatccatccatcc 69800 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69777 atccatccatccatccatcc 69796 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69773 atccatccatccatccatcc 69792 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69769 atccatccatccatccatcc 69788 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69765 atccatccatccatccatcc 69784 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69761 atccatccatccatccatcc 69780 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69757 atccatccatccatccatcc 69776 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69753 atccatccatccatccatcc 69772 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69749 atccatccatccatccatcc 69768 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62649 atccatccatccatccatcc 62668 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62645 atccatccatccatccatcc 62664 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62641 atccatccatccatccatcc 62660 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62602 atccatccatccatccatcc 62621 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62598 atccatccatccatccatcc 62617 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62594 atccatccatccatccatcc 62613 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62551 atccatccatccatccatcc 62570 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62547 atccatccatccatccatcc 62566 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62543 atccatccatccatccatcc 62562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62539 atccatccatccatccatcc 62558 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62535 atccatccatccatccatcc 62554 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 62531 atccatccatccatccatcc 62550 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59080 atccatccatccatccatcc 59099 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59076 atccatccatccatccatcc 59095 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59072 atccatccatccatccatcc 59091 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59068 atccatccatccatccatcc 59087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59064 atccatccatccatccatcc 59083 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59060 atccatccatccatccatcc 59079 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59056 atccatccatccatccatcc 59075 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3334 atccatccatccatccatcc 3353 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3330 atccatccatccatccatcc 3349 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3326 atccatccatccatccatcc 3345 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3257 atccatccatccatccatcc 3276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3253 atccatccatccatccatcc 3272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3171 atccatccatccatccatcc 3190 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3135 atccatccatccatccatcc 3154 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3007 atccatccatccatccatcc 3026 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2921 atccatccatccatccatcc 2940 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2917 atccatccatccatccatcc 2936 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2913 atccatccatccatccatcc 2932 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2909 atccatccatccatccatcc 2928 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2905 atccatccatccatccatcc 2924 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2901 atccatccatccatccatcc 2920
>gb|AC005064.3|AC005064 Homo sapiens clone CTB-107G13, complete sequence Length = 119484 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 83830 atccatccatccatccatcctcca 83853
>ref|NM_182562.1| Homo sapiens hypothetical protein FLJ39743 (FLJ39743), mRNA Length = 3376 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 2815 atccatccatccatccatcctcca 2838 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 2474 atccatccatccatccatcctcca 2497 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 2608 atccatccatccatccatcct 2628 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 2577 catccatccatccatcctcca 2597 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 2435 catccatccatccatcctcca 2455 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2865 atccatccatccatccatcc 2884 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2861 atccatccatccatccatcc 2880 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2857 atccatccatccatccatcc 2876 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2853 atccatccatccatccatcc 2872 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2849 atccatccatccatccatcc 2868 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2845 atccatccatccatccatcc 2864 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||| |||||||||| Sbjct: 2792 atccatccatccacccatcctcca 2815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2784 atccatccatccatccatcc 2803 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2780 atccatccatccatccatcc 2799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2776 atccatccatccatccatcc 2795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2772 atccatccatccatccatcc 2791 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2768 atccatccatccatccatcc 2787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2726 atccatccatccatccatcc 2745 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2604 atccatccatccatccatcc 2623 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2470 atccatccatccatccatcc 2489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2466 atccatccatccatccatcc 2485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2462 atccatccatccatccatcc 2481
>gb|AC021636.16| Homo sapiens chromosome 8, clone RP11-637F16, complete sequence Length = 148687 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 101399 atccatccatccatccatcctcca 101376 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101403 atccatccatccatccatcc 101384 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100060 atccatccatccatccatcc 100041
>gb|AC007406.1| Homo sapiens 12 BAC RPCI11-283I3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177402 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 44153 atccatccatccatccatcctcca 44130 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||| ||||||||||| Sbjct: 44340 atccatccatccgtccatcctcca 44317 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44317 atccatccatccatccatcc 44298 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44269 atccatccatccatccatcc 44250 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44265 atccatccatccatccatcc 44246 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44261 atccatccatccatccatcc 44242 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44257 atccatccatccatccatcc 44238 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44253 atccatccatccatccatcc 44234 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44249 atccatccatccatccatcc 44230 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44197 atccatccatccatccatcc 44178 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44193 atccatccatccatccatcc 44174 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44189 atccatccatccatccatcc 44170 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44185 atccatccatccatccatcc 44166 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44157 atccatccatccatccatcc 44138 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24098 atccatccatccatccatcc 24117 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24094 atccatccatccatccatcc 24113 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24090 atccatccatccatccatcc 24109 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24086 atccatccatccatccatcc 24105 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24082 atccatccatccatccatcc 24101 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24078 atccatccatccatccatcc 24097 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24074 atccatccatccatccatcc 24093 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24070 atccatccatccatccatcc 24089 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24066 atccatccatccatccatcc 24085 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24062 atccatccatccatccatcc 24081 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24058 atccatccatccatccatcc 24077 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24054 atccatccatccatccatcc 24073 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24050 atccatccatccatccatcc 24069 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24046 atccatccatccatccatcc 24065 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24042 atccatccatccatccatcc 24061 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24038 atccatccatccatccatcc 24057 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24034 atccatccatccatccatcc 24053 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24030 atccatccatccatccatcc 24049 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24026 atccatccatccatccatcc 24045 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24022 atccatccatccatccatcc 24041 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24018 atccatccatccatccatcc 24037 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24014 atccatccatccatccatcc 24033 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24010 atccatccatccatccatcc 24029 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24006 atccatccatccatccatcc 24025 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24002 atccatccatccatccatcc 24021 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23998 atccatccatccatccatcc 24017
>gb|AC073934.1|AC073934 Human Chromosome 7 clone SCb-354C16, complete sequence Length = 131165 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 111267 atccatccatccatccatcctcca 111290 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111733 atccatccatccatccatcc 111752 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111729 atccatccatccatccatcc 111748 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111725 atccatccatccatccatcc 111744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111721 atccatccatccatccatcc 111740 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111717 atccatccatccatccatcc 111736 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111713 atccatccatccatccatcc 111732 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111709 atccatccatccatccatcc 111728 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111263 atccatccatccatccatcc 111282 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111259 atccatccatccatccatcc 111278 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111255 atccatccatccatccatcc 111274 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111251 atccatccatccatccatcc 111270 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111247 atccatccatccatccatcc 111266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111243 atccatccatccatccatcc 111262
>emb|AL954710.27| Mouse DNA sequence from clone RP23-275J10 on chromosome 4, complete sequence Length = 202551 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 10320 atccatccatccatccatcctcca 10297 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 10798 atccatccatccatccatcct 10778 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 10537 atccatccatccatccatcct 10517 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143623 atccatccatccatccatcc 143604 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52574 atccatccatccatccatcc 52555 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52570 atccatccatccatccatcc 52551 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52566 atccatccatccatccatcc 52547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52562 atccatccatccatccatcc 52543 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52558 atccatccatccatccatcc 52539 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52554 atccatccatccatccatcc 52535 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52550 atccatccatccatccatcc 52531 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52546 atccatccatccatccatcc 52527 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52542 atccatccatccatccatcc 52523 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52538 atccatccatccatccatcc 52519 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52514 atccatccatccatccatcc 52495 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52510 atccatccatccatccatcc 52491 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52506 atccatccatccatccatcc 52487 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10826 atccatccatccatccatcc 10807 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10822 atccatccatccatccatcc 10803 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10818 atccatccatccatccatcc 10799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10814 atccatccatccatccatcc 10795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10810 atccatccatccatccatcc 10791 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10806 atccatccatccatccatcc 10787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10802 atccatccatccatccatcc 10783 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10766 atccatccatccatccatcc 10747 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10762 atccatccatccatccatcc 10743 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10758 atccatccatccatccatcc 10739 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10754 atccatccatccatccatcc 10735 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10750 atccatccatccatccatcc 10731 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10702 atccatccatccatccatcc 10683 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10698 atccatccatccatccatcc 10679 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10694 atccatccatccatccatcc 10675 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10690 atccatccatccatccatcc 10671 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10686 atccatccatccatccatcc 10667 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10682 atccatccatccatccatcc 10663 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10678 atccatccatccatccatcc 10659 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10674 atccatccatccatccatcc 10655 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 10670 atccatccatccatccatcatcca 10647 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10549 atccatccatccatccatcc 10530 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10545 atccatccatccatccatcc 10526 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10541 atccatccatccatccatcc 10522 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10505 atccatccatccatccatcc 10486 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10501 atccatccatccatccatcc 10482 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10497 atccatccatccatccatcc 10478 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10493 atccatccatccatccatcc 10474 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10489 atccatccatccatccatcc 10470 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10485 atccatccatccatccatcc 10466 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10481 atccatccatccatccatcc 10462 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10477 atccatccatccatccatcc 10458 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10433 atccatccatccatccatcc 10414 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10429 atccatccatccatccatcc 10410 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10425 atccatccatccatccatcc 10406 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10421 atccatccatccatccatcc 10402 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10417 atccatccatccatccatcc 10398 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||| |||||||||| Sbjct: 10389 atccatccatccacccatcctcca 10366 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10340 atccatccatccatccatcc 10321 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10336 atccatccatccatccatcc 10317 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10332 atccatccatccatccatcc 10313 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10328 atccatccatccatccatcc 10309 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10324 atccatccatccatccatcc 10305
>emb|BX005015.5| Zebrafish DNA sequence from clone CH211-66I11 in linkage group 9, complete sequence Length = 172283 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 19 agcgatccatccatccatccatcc 42 |||||||||||||||||||||||| Sbjct: 102307 agcgatccatccatccatccatcc 102330 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128445 atccatccatccatccatcc 128464 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128441 atccatccatccatccatcc 128460 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128437 atccatccatccatccatcc 128456 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128433 atccatccatccatccatcc 128452 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128429 atccatccatccatccatcc 128448 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128425 atccatccatccatccatcc 128444 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128421 atccatccatccatccatcc 128440 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128417 atccatccatccatccatcc 128436 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128413 atccatccatccatccatcc 128432 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128195 atccatccatccatccatcc 128214 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128191 atccatccatccatccatcc 128210 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128187 atccatccatccatccatcc 128206 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128183 atccatccatccatccatcc 128202 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128179 atccatccatccatccatcc 128198 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128175 atccatccatccatccatcc 128194 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128171 atccatccatccatccatcc 128190 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128167 atccatccatccatccatcc 128186 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128163 atccatccatccatccatcc 128182 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102323 atccatccatccatccatcc 102342 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102319 atccatccatccatccatcc 102338 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102315 atccatccatccatccatcc 102334 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57287 atccatccatccatccatcc 57268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57283 atccatccatccatccatcc 57264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57279 atccatccatccatccatcc 57260 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57275 atccatccatccatccatcc 57256 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57271 atccatccatccatccatcc 57252 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57267 atccatccatccatccatcc 57248 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57263 atccatccatccatccatcc 57244 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57259 atccatccatccatccatcc 57240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57255 atccatccatccatccatcc 57236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57251 atccatccatccatccatcc 57232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57247 atccatccatccatccatcc 57228 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57243 atccatccatccatccatcc 57224 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57239 atccatccatccatccatcc 57220
>gb|AC000359.1|HSAC000359 Human cosmid g1572c264, complete sequence Length = 43394 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 28479 atccatccatccatccatcctcca 28456 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28499 atccatccatccatccatcc 28480 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28495 atccatccatccatccatcc 28476 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28491 atccatccatccatccatcc 28472 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28487 atccatccatccatccatcc 28468 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28483 atccatccatccatccatcc 28464 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28037 atccatccatccatccatcc 28018 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28033 atccatccatccatccatcc 28014 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28029 atccatccatccatccatcc 28010 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28025 atccatccatccatccatcc 28006 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28021 atccatccatccatccatcc 28002 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28017 atccatccatccatccatcc 27998
>emb|AJ340231.1|HSA340231 Homo sapiens genomic sequence surrounding NotI site, clone NR1-SJ22C Length = 681 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 535 atccatccatccatccatcctcca 558 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 531 atccatccatccatccatcc 550
>emb|AL391153.3|CNS06C7Z Human chromosome 14 DNA sequence BAC C-2576L4 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 172336 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 114930 atccatccatccatccatcctcca 114953 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 58295 atccatccatccatccatcct 58315 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114906 atccatccatccatccatcc 114925 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114902 atccatccatccatccatcc 114921 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114898 atccatccatccatccatcc 114917 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||| ||||||||||||||| Sbjct: 58539 atccatccgtccatccatcctcca 58562 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58507 atccatccatccatccatcc 58526 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58503 atccatccatccatccatcc 58522 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58291 atccatccatccatccatcc 58310 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58287 atccatccatccatccatcc 58306 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58283 atccatccatccatccatcc 58302 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58279 atccatccatccatccatcc 58298 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58275 atccatccatccatccatcc 58294 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58271 atccatccatccatccatcc 58290
>emb|CR394541.16| Zebrafish DNA sequence from clone DKEY-51M5 in linkage group 22, complete sequence Length = 64881 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 19 agcgatccatccatccatccatcc 42 |||||||||||||||||||||||| Sbjct: 32302 agcgatccatccatccatccatcc 32325 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 39072 atccatccatccatccatcct 39092 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 34894 atccatccatccatccatcct 34914 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39068 atccatccatccatccatcc 39087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38822 atccatccatccatccatcc 38841 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38818 atccatccatccatccatcc 38837 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38714 atccatccatccatccatcc 38733 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38710 atccatccatccatccatcc 38729 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38706 atccatccatccatccatcc 38725 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38702 atccatccatccatccatcc 38721 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38698 atccatccatccatccatcc 38717 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38694 atccatccatccatccatcc 38713 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38690 atccatccatccatccatcc 38709 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38686 atccatccatccatccatcc 38705 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38682 atccatccatccatccatcc 38701 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38678 atccatccatccatccatcc 38697 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38674 atccatccatccatccatcc 38693 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38423 atccatccatccatccatcc 38442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38419 atccatccatccatccatcc 38438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37851 atccatccatccatccatcc 37870 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37847 atccatccatccatccatcc 37866 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37843 atccatccatccatccatcc 37862 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37839 atccatccatccatccatcc 37858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37835 atccatccatccatccatcc 37854 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37831 atccatccatccatccatcc 37850 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37827 atccatccatccatccatcc 37846 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37622 atccatccatccatccatcc 37641 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37618 atccatccatccatccatcc 37637 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34980 atccatccatccatccatcc 34999 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34976 atccatccatccatccatcc 34995 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34930 atccatccatccatccatcc 34949 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34890 atccatccatccatccatcc 34909 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34886 atccatccatccatccatcc 34905 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34766 atccatccatccatccatcc 34785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34762 atccatccatccatccatcc 34781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32991 atccatccatccatccatcc 33010 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32987 atccatccatccatccatcc 33006 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32983 atccatccatccatccatcc 33002 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32979 atccatccatccatccatcc 32998 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32527 atccatccatccatccatcc 32546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32314 atccatccatccatccatcc 32333 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32310 atccatccatccatccatcc 32329 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32196 atccatccatccatccatcc 32215
>emb|BX664613.17| Zebrafish DNA sequence from clone DKEY-5P5 in linkage group 22, complete sequence Length = 121435 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 19 agcgatccatccatccatccatcc 42 |||||||||||||||||||||||| Sbjct: 11332 agcgatccatccatccatccatcc 11309 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 4645 atccatccatccatccatcct 4625 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11442 atccatccatccatccatcc 11423 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11438 atccatccatccatccatcc 11419 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11324 atccatccatccatccatcc 11305 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11320 atccatccatccatccatcc 11301 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11107 atccatccatccatccatcc 11088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11103 atccatccatccatccatcc 11084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10651 atccatccatccatccatcc 10632 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10647 atccatccatccatccatcc 10628 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10643 atccatccatccatccatcc 10624 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8904 atccatccatccatccatcc 8885 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8900 atccatccatccatccatcc 8881 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 8829 tccatccatccatccatcct 8810 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 8781 tccatccatccatccatcct 8762 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8704 atccatccatccatccatcc 8685 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8700 atccatccatccatccatcc 8681 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8696 atccatccatccatccatcc 8677 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8692 atccatccatccatccatcc 8673 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8650 atccatccatccatccatcc 8631 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5255 atccatccatccatccatcc 5236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5251 atccatccatccatccatcc 5232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5247 atccatccatccatccatcc 5228 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4999 atccatccatccatccatcc 4980 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4995 atccatccatccatccatcc 4976
>emb|BX470160.9| Zebrafish DNA sequence from clone DKEY-25F3 in linkage group 18, complete sequence Length = 207501 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 4536 atccatccatccatccatcctcca 4559 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4532 atccatccatccatccatcc 4551
>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24, complete sequence Length = 147604 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 38677 atccatccatccatccatcctcca 38654 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 38534 cagctatccatccatccatccatcc 38510 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 38517 atccatccatccatccatcct 38497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122434 atccatccatccatccatcc 122453 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122430 atccatccatccatccatcc 122449 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122426 atccatccatccatccatcc 122445 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122422 atccatccatccatccatcc 122441 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122418 atccatccatccatccatcc 122437 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122414 atccatccatccatccatcc 122433 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122410 atccatccatccatccatcc 122429 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122406 atccatccatccatccatcc 122425 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122402 atccatccatccatccatcc 122421 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122398 atccatccatccatccatcc 122417 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122394 atccatccatccatccatcc 122413 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122390 atccatccatccatccatcc 122409 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122386 atccatccatccatccatcc 122405 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122382 atccatccatccatccatcc 122401 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122378 atccatccatccatccatcc 122397 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122374 atccatccatccatccatcc 122393 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122370 atccatccatccatccatcc 122389 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122366 atccatccatccatccatcc 122385 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122362 atccatccatccatccatcc 122381 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122358 atccatccatccatccatcc 122377 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94259 atccatccatccatccatcc 94278 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94255 atccatccatccatccatcc 94274 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94251 atccatccatccatccatcc 94270 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94247 atccatccatccatccatcc 94266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94243 atccatccatccatccatcc 94262 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94239 atccatccatccatccatcc 94258 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94235 atccatccatccatccatcc 94254 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94231 atccatccatccatccatcc 94250 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94227 atccatccatccatccatcc 94246 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94223 atccatccatccatccatcc 94242 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94219 atccatccatccatccatcc 94238 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50259 atccatccatccatccatcc 50240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50255 atccatccatccatccatcc 50236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50167 atccatccatccatccatcc 50148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50119 atccatccatccatccatcc 50100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50115 atccatccatccatccatcc 50096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50111 atccatccatccatccatcc 50092 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50107 atccatccatccatccatcc 50088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50103 atccatccatccatccatcc 50084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50099 atccatccatccatccatcc 50080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50095 atccatccatccatccatcc 50076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50091 atccatccatccatccatcc 50072 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50087 atccatccatccatccatcc 50068 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50083 atccatccatccatccatcc 50064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50079 atccatccatccatccatcc 50060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50075 atccatccatccatccatcc 50056 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50071 atccatccatccatccatcc 50052 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50067 atccatccatccatccatcc 50048 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50063 atccatccatccatccatcc 50044 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49999 atccatccatccatccatcc 49980 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49995 atccatccatccatccatcc 49976 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49991 atccatccatccatccatcc 49972 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49967 atccatccatccatccatcc 49948 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49859 atccatccatccatccatcc 49840 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49855 atccatccatccatccatcc 49836 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49851 atccatccatccatccatcc 49832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49667 atccatccatccatccatcc 49648 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49623 atccatccatccatccatcc 49604 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49619 atccatccatccatccatcc 49600 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49615 atccatccatccatccatcc 49596 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49340 atccatccatccatccatcc 49321 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49336 atccatccatccatccatcc 49317 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49332 atccatccatccatccatcc 49313 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49328 atccatccatccatccatcc 49309 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49324 atccatccatccatccatcc 49305 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49320 atccatccatccatccatcc 49301 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49316 atccatccatccatccatcc 49297 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49312 atccatccatccatccatcc 49293 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49308 atccatccatccatccatcc 49289 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49304 atccatccatccatccatcc 49285 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49300 atccatccatccatccatcc 49281 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49296 atccatccatccatccatcc 49277 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49292 atccatccatccatccatcc 49273 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49288 atccatccatccatccatcc 49269 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49284 atccatccatccatccatcc 49265 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49280 atccatccatccatccatcc 49261 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49276 atccatccatccatccatcc 49257 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38701 atccatccatccatccatcc 38682 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38697 atccatccatccatccatcc 38678 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38693 atccatccatccatccatcc 38674 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38689 atccatccatccatccatcc 38670 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38685 atccatccatccatccatcc 38666 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38681 atccatccatccatccatcc 38662 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38525 atccatccatccatccatcc 38506 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38521 atccatccatccatccatcc 38502
>gb|AC145869.2| Pan troglodytes BAC clone RP43-39F14 from chromosome 7, complete sequence Length = 201977 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 131220 atccatccatccatccatcctcca 131197 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131236 atccatccatccatccatcc 131217 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131232 atccatccatccatccatcc 131213 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131228 atccatccatccatccatcc 131209 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131224 atccatccatccatccatcc 131205 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130933 atccatccatccatccatcc 130914 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130929 atccatccatccatccatcc 130910 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130925 atccatccatccatccatcc 130906 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88378 atccatccatccatccatcc 88359 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88374 atccatccatccatccatcc 88355 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88370 atccatccatccatccatcc 88351 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88366 atccatccatccatccatcc 88347 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88362 atccatccatccatccatcc 88343 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88358 atccatccatccatccatcc 88339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88354 atccatccatccatccatcc 88335
>gb|AC006287.1|AC006287 Homo sapiens, clone hRPK.22_A_1, complete sequence Length = 176153 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 28733 atccatccatccatccatcctcca 28756 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 141207 atccatccatccatccatcc 141226 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28729 atccatccatccatccatcc 28748 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28725 atccatccatccatccatcc 28744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28721 atccatccatccatccatcc 28740 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28717 atccatccatccatccatcc 28736 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28713 atccatccatccatccatcc 28732 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28709 atccatccatccatccatcc 28728 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28705 atccatccatccatccatcc 28724
>gb|AC149277.11| Mus musculus BAC clone RP24-213J23 from chromosome 7, complete sequence Length = 198579 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 112984 atccatccatccatccatcctcca 112961 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 112961 atccatccatccatccatcctcca 112938 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 107615 atccatccatccatccatcct 107595 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113051 atccatccatccatccatcc 113032 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 113047 atccatccatccatccatcc 113028 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112927 atccatccatccatccatcc 112908 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112923 atccatccatccatccatcc 112904 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112919 atccatccatccatccatcc 112900 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112915 atccatccatccatccatcc 112896 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112911 atccatccatccatccatcc 112892 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112907 atccatccatccatccatcc 112888 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112903 atccatccatccatccatcc 112884 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112863 atccatccatccatccatcc 112844 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112859 atccatccatccatccatcc 112840 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112855 atccatccatccatccatcc 112836 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112851 atccatccatccatccatcc 112832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112847 atccatccatccatccatcc 112828 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112843 atccatccatccatccatcc 112824 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112839 atccatccatccatccatcc 112820 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112835 atccatccatccatccatcc 112816 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112831 atccatccatccatccatcc 112812 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112803 atccatccatccatccatcc 112784 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112799 atccatccatccatccatcc 112780 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112795 atccatccatccatccatcc 112776 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112791 atccatccatccatccatcc 112772 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112787 atccatccatccatccatcc 112768 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112783 atccatccatccatccatcc 112764 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112755 atccatccatccatccatcc 112736 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112751 atccatccatccatccatcc 112732 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112747 atccatccatccatccatcc 112728 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112743 atccatccatccatccatcc 112724 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112739 atccatccatccatccatcc 112720 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112735 atccatccatccatccatcc 112716 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112707 atccatccatccatccatcc 112688 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112703 atccatccatccatccatcc 112684 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112699 atccatccatccatccatcc 112680 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112695 atccatccatccatccatcc 112676 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112691 atccatccatccatccatcc 112672 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111716 atccatccatccatccatcc 111697 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111692 atccatccatccatccatcc 111673 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111688 atccatccatccatccatcc 111669 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111684 atccatccatccatccatcc 111665 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111680 atccatccatccatccatcc 111661 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111676 atccatccatccatccatcc 111657 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111672 atccatccatccatccatcc 111653 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111668 atccatccatccatccatcc 111649 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111664 atccatccatccatccatcc 111645 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107639 atccatccatccatccatcc 107620 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107635 atccatccatccatccatcc 107616 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107631 atccatccatccatccatcc 107612 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107627 atccatccatccatccatcc 107608 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107623 atccatccatccatccatcc 107604 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107619 atccatccatccatccatcc 107600
>emb|BX004822.12| Zebrafish DNA sequence from clone DKEY-18F18, complete sequence Length = 201902 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 43261 atccatccatccatccatcctcca 43284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189521 atccatccatccatccatcc 189540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189517 atccatccatccatccatcc 189536 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189513 atccatccatccatccatcc 189532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189509 atccatccatccatccatcc 189528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189505 atccatccatccatccatcc 189524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189501 atccatccatccatccatcc 189520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121266 atccatccatccatccatcc 121285 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50902 atccatccatccatccatcc 50921 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50898 atccatccatccatccatcc 50917 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50894 atccatccatccatccatcc 50913 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50702 atccatccatccatccatcc 50721 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50698 atccatccatccatccatcc 50717 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50694 atccatccatccatccatcc 50713 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50690 atccatccatccatccatcc 50709 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50686 atccatccatccatccatcc 50705 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50682 atccatccatccatccatcc 50701 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50678 atccatccatccatccatcc 50697 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50674 atccatccatccatccatcc 50693 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50670 atccatccatccatccatcc 50689 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50666 atccatccatccatccatcc 50685 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 50647 atccatccatccatccatcatcca 50670 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50643 atccatccatccatccatcc 50662 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50639 atccatccatccatccatcc 50658 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50635 atccatccatccatccatcc 50654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50631 atccatccatccatccatcc 50650 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50627 atccatccatccatccatcc 50646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50623 atccatccatccatccatcc 50642 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50619 atccatccatccatccatcc 50638 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50615 atccatccatccatccatcc 50634 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50611 atccatccatccatccatcc 50630 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50607 atccatccatccatccatcc 50626 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50603 atccatccatccatccatcc 50622 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50599 atccatccatccatccatcc 50618 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 50595 atccatccatccatccatcc 50614 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44034 atccatccatccatccatcc 44053 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43257 atccatccatccatccatcc 43276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43221 atccatccatccatccatcc 43240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39723 atccatccatccatccatcc 39742 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39719 atccatccatccatccatcc 39738 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39715 atccatccatccatccatcc 39734 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39711 atccatccatccatccatcc 39730 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39707 atccatccatccatccatcc 39726 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39703 atccatccatccatccatcc 39722 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39699 atccatccatccatccatcc 39718 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39695 atccatccatccatccatcc 39714 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39691 atccatccatccatccatcc 39710 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39687 atccatccatccatccatcc 39706 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39683 atccatccatccatccatcc 39702 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39679 atccatccatccatccatcc 39698 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39675 atccatccatccatccatcc 39694 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39671 atccatccatccatccatcc 39690 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39667 atccatccatccatccatcc 39686 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39663 atccatccatccatccatcc 39682 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39659 atccatccatccatccatcc 39678 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39655 atccatccatccatccatcc 39674 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39651 atccatccatccatccatcc 39670 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39647 atccatccatccatccatcc 39666
>gb|AC139382.3| Mus musculus BAC clone RP23-30B24 from 12, complete sequence Length = 180698 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 156334 atccatccatccatccatcctcca 156357 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 11171 atccatccatccatccatcctc 11150 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 156330 atccatccatccatccatcc 156349 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 156326 atccatccatccatccatcc 156345 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 156322 atccatccatccatccatcc 156341 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 156318 atccatccatccatccatcc 156337 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16556 atccatccatccatccatcc 16537 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16552 atccatccatccatccatcc 16533 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16548 atccatccatccatccatcc 16529 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16544 atccatccatccatccatcc 16525 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16540 atccatccatccatccatcc 16521 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16536 atccatccatccatccatcc 16517 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12568 atccatccatccatccatcc 12549 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12564 atccatccatccatccatcc 12545 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11187 atccatccatccatccatcc 11168 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11183 atccatccatccatccatcc 11164 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11179 atccatccatccatccatcc 11160 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11175 atccatccatccatccatcc 11156
>gb|AC154374.1| Mus musculus BAC clone RP23-81F24 from 9, complete sequence Length = 169272 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 112481 atccatccatccatccatcctcca 112504 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 148862 atccatccatccatccatcc 148881 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 148858 atccatccatccatccatcc 148877 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112524 atccatccatccatccatcc 112543 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112477 atccatccatccatccatcc 112496 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 112409 atccatccatccatccatcc 112428
>emb|AL669980.9| Mouse DNA sequence from clone RP23-218C2 on chromosome 4, complete sequence Length = 157624 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 23086 atccatccatccatccatcctcca 23109 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23082 atccatccatccatccatcc 23101 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23078 atccatccatccatccatcc 23097 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20795 atccatccatccatccatcc 20814 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20791 atccatccatccatccatcc 20810 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20583 atccatccatccatccatcc 20602
>emb|AL627104.16| Mouse DNA sequence from clone RP23-412B2 on chromosome 4, complete sequence Length = 193363 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 182638 atccatccatccatccatcctcca 182661 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182793 atccatccatccatccatcc 182812 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182789 atccatccatccatccatcc 182808 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182725 atccatccatccatccatcatcca 182748 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182721 atccatccatccatccatcc 182740 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182717 atccatccatccatccatcc 182736 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182713 atccatccatccatccatcc 182732 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182709 atccatccatccatccatcc 182728 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182690 atccatccatccatccatcatcca 182713 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182634 atccatccatccatccatcc 182653 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182544 atccatccatccatccatcatcca 182567 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182525 atccatccatccatccatcatcca 182548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182521 atccatccatccatccatcc 182540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182498 atccatccatccatccatcc 182517 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182419 atccatccatccatccatcatcca 182442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182415 atccatccatccatccatcc 182434 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182411 atccatccatccatccatcc 182430 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182407 atccatccatccatccatcc 182426 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182403 atccatccatccatccatcc 182422 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182399 atccatccatccatccatcc 182418 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182380 atccatccatccatccatcatcca 182403 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182316 atccatccatccatccatcatcca 182339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182312 atccatccatccatccatcc 182331 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182247 atccatccatccatccatcc 182266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182243 atccatccatccatccatcc 182262 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182205 atccatccatccatccatcc 182224 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182201 atccatccatccatccatcc 182220 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182163 atccatccatccatccatcc 182182 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182159 atccatccatccatccatcc 182178 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182140 atccatccatccatccatcatcca 182163 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182136 atccatccatccatccatcc 182155 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 182048 atccatccatccatccatcatcca 182071 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 181999 atccatccatccatccatcatcca 182022 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 181995 atccatccatccatccatcc 182014 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 181948 atccatccatccatccatcc 181967 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130324 atccatccatccatccatcc 130343 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130320 atccatccatccatccatcc 130339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130316 atccatccatccatccatcc 130335 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130312 atccatccatccatccatcc 130331 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130308 atccatccatccatccatcc 130327 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130304 atccatccatccatccatcc 130323 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130300 atccatccatccatccatcc 130319 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130296 atccatccatccatccatcc 130315 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97513 atccatccatccatccatcc 97532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97379 atccatccatccatccatcc 97398 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97375 atccatccatccatccatcc 97394 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97371 atccatccatccatccatcc 97390 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97367 atccatccatccatccatcc 97386 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97268 atccatccatccatccatcc 97287 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97264 atccatccatccatccatcc 97283 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97260 atccatccatccatccatcc 97279 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97256 atccatccatccatccatcc 97275 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97252 atccatccatccatccatcc 97271 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97248 atccatccatccatccatcc 97267
>emb|Y19165.1|SSC19165 Sus scrofa hypervariable VNTR locus, (894 bp) Length = 894 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 717 atccatccatccatccatcctcca 740 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 643 atccatccatccatccatcctcca 666 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 378 atccatccatccatccatcctcca 401 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 818 tccatccatccatccatcctcca 840 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 791 atccatccatccatccatcatcca 814 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 610 atccatccatccatccatcatcca 633 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 606 atccatccatccatccatcc 625 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 602 atccatccatccatccatcc 621 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 345 atccatccatccatccatcatcca 368
>dbj|AP001531.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-772F18, complete sequence Length = 167583 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 46322 atccatccatccatccatcctcca 46345
>emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6) clone 278H24 of library Caltech CITB-BAC from chromosome 11 of Mus musculus (mouse) Length = 150493 Score = 48.1 bits (24), Expect = 0.023 Identities = 24/24 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||||||||||||||||||||| Sbjct: 89367 atccatccatccatccatcctcca 89390 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89331 atccatccatccatccatcc 89350 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89218 atccatccatccatccatcc 89237 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89214 atccatccatccatccatcc 89233 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89210 atccatccatccatccatcc 89229 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89206 atccatccatccatccatcc 89225
>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence Length = 201694 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 15273 atccatccatccatccatcctcc 15295 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 42605 atccatccatccatccatcct 42625 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 7059 cagccatccatccatccatccatcc 7035 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180397 atccatccatccatccatcc 180416 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180393 atccatccatccatccatcc 180412 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180389 atccatccatccatccatcc 180408 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180385 atccatccatccatccatcc 180404 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180381 atccatccatccatccatcc 180400 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180377 atccatccatccatccatcc 180396 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 180373 atccatccatccatccatcc 180392 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131324 atccatccatccatccatcc 131343 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131320 atccatccatccatccatcc 131339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131316 atccatccatccatccatcc 131335 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131312 atccatccatccatccatcc 131331 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 131308 atccatccatccatccatcc 131327 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58190 atccatccatccatccatcc 58171 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15269 atccatccatccatccatcc 15288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15265 atccatccatccatccatcc 15284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15261 atccatccatccatccatcc 15280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15257 atccatccatccatccatcc 15276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7050 atccatccatccatccatcc 7031 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7046 atccatccatccatccatcc 7027 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7042 atccatccatccatccatcc 7023 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7038 atccatccatccatccatcc 7019 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7034 atccatccatccatccatcc 7015 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6876 atccatccatccatccatcc 6857 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6872 atccatccatccatccatcc 6853 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6868 atccatccatccatccatcc 6849 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6864 atccatccatccatccatcc 6845
>gb|AC144926.6| Mus musculus chromosome 8, clone RP23-8E24, complete sequence Length = 214694 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccacaa 49 |||||||||||||||||| |||||||| Sbjct: 137753 atccatccatccatccatactccacaa 137779 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53442 atccatccatccatccatcc 53423 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53438 atccatccatccatccatcc 53419 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53434 atccatccatccatccatcc 53415 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53430 atccatccatccatccatcc 53411 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53426 atccatccatccatccatcc 53407 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53422 atccatccatccatccatcc 53403 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53418 atccatccatccatccatcc 53399 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53414 atccatccatccatccatcc 53395 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53410 atccatccatccatccatcc 53391 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53406 atccatccatccatccatcc 53387 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53402 atccatccatccatccatcc 53383 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 53398 atccatccatccatccatcc 53379
>gb|AC121498.12| Mus musculus chromosome 1, clone RP23-38P22, complete sequence Length = 152264 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 30533 atccatccatccatccatcctcc 30555 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30529 atccatccatccatccatcc 30548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30525 atccatccatccatccatcc 30544 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30521 atccatccatccatccatcc 30540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30517 atccatccatccatccatcc 30536
>gb|AC152978.1| Mus musculus BAC RP23-111A15 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 180393 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 72702 atccatccatccatccatcctcc 72724 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72698 atccatccatccatccatcc 72717 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72694 atccatccatccatccatcc 72713 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72690 atccatccatccatccatcc 72709 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72686 atccatccatccatccatcc 72705 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72654 atccatccatccatccatcc 72673 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 72650 atccatccatccatccatcc 72669
>gb|AE017348.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 8, complete sequence Length = 1194300 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 203683 atccatccatccatccatcctcc 203705
>gb|AC124981.25| Mus musculus chromosome 5, clone RP24-170P20, complete sequence Length = 153767 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 16861 atccatccatccatccatcctcc 16883 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16857 atccatccatccatccatcc 16876 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16853 atccatccatccatccatcc 16872 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16849 atccatccatccatccatcc 16868 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16845 atccatccatccatccatcc 16864 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16841 atccatccatccatccatcc 16860 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16837 atccatccatccatccatcc 16856 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16833 atccatccatccatccatcc 16852
>gb|AC145205.2| Homo sapiens chromosome 17, clone RP11-1224M18, complete sequence Length = 81310 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 2659 atccatccatccatccatcctcc 2637 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 2543 atccatccatccatccatcctcc 2521 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2683 atccatccatccatccatcc 2664 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2679 atccatccatccatccatcc 2660 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2675 atccatccatccatccatcc 2656 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2671 atccatccatccatccatcc 2652 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2667 atccatccatccatccatcc 2648 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2663 atccatccatccatccatcc 2644 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2547 atccatccatccatccatcc 2528
>gb|AF241735.2| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete sequence Length = 39877 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 26689 atccatccatccatccatcctcc 26667 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 26645 atccatccatccatccatcctcc 26623 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 26597 atccatccatccatccatcctcc 26575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26693 atccatccatccatccatcc 26674 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26657 atccatccatccatccatcc 26638 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26653 atccatccatccatccatcc 26634 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26649 atccatccatccatccatcc 26630 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26605 atccatccatccatccatcc 26586 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26601 atccatccatccatccatcc 26582 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6225 atccatccatccatccatcc 6206 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6123 atccatccatccatccatcc 6104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6119 atccatccatccatccatcc 6100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6115 atccatccatccatccatcc 6096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6111 atccatccatccatccatcc 6092 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6107 atccatccatccatccatcc 6088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6103 atccatccatccatccatcc 6084
>gb|AC091810.4| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete sequence Length = 100442 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 27715 atccatccatccatccatcctcc 27693 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 27671 atccatccatccatccatcctcc 27649 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 27623 atccatccatccatccatcctcc 27601 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27719 atccatccatccatccatcc 27700 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27683 atccatccatccatccatcc 27664 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27679 atccatccatccatccatcc 27660 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27675 atccatccatccatccatcc 27656 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27631 atccatccatccatccatcc 27612 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27627 atccatccatccatccatcc 27608 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7256 atccatccatccatccatcc 7237 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7154 atccatccatccatccatcc 7135 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7150 atccatccatccatccatcc 7131 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7146 atccatccatccatccatcc 7127 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7142 atccatccatccatccatcc 7123 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7138 atccatccatccatccatcc 7119 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7134 atccatccatccatccatcc 7115
>gb|AC129553.10| Mus musculus chromosome 5, clone RP24-351J24, complete sequence Length = 152414 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 130517 atccatccatccatccatcctcc 130539 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 106747 atccatccatccatccatcctc 106768 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 122303 cagccatccatccatccatccatcc 122279 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Plus Query: 14 caagcagcgatccatccatccatccatcc 42 |||||| | |||||||||||||||||||| Sbjct: 106714 caagcatccatccatccatccatccatcc 106742 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130513 atccatccatccatccatcc 130532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130509 atccatccatccatccatcc 130528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130505 atccatccatccatccatcc 130524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130501 atccatccatccatccatcc 130520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122294 atccatccatccatccatcc 122275 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122290 atccatccatccatccatcc 122271 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122286 atccatccatccatccatcc 122267 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122282 atccatccatccatccatcc 122263 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122278 atccatccatccatccatcc 122259 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122120 atccatccatccatccatcc 122101 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122116 atccatccatccatccatcc 122097 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122112 atccatccatccatccatcc 122093 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122108 atccatccatccatccatcc 122089 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 109584 atccatccatccatccatcatcca 109607 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109580 atccatccatccatccatcc 109599 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109576 atccatccatccatccatcc 109595 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109572 atccatccatccatccatcc 109591 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109568 atccatccatccatccatcc 109587 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109564 atccatccatccatccatcc 109583 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109560 atccatccatccatccatcc 109579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109556 atccatccatccatccatcc 109575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 106743 atccatccatccatccatcc 106762 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 106739 atccatccatccatccatcc 106758 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 106735 atccatccatccatccatcc 106754 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 106731 atccatccatccatccatcc 106750 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 106727 atccatccatccatccatcc 106746 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49474 atccatccatccatccatcc 49493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49470 atccatccatccatccatcc 49489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49466 atccatccatccatccatcc 49485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49462 atccatccatccatccatcc 49481 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49458 atccatccatccatccatcc 49477 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49454 atccatccatccatccatcc 49473 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49450 atccatccatccatccatcc 49469 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49446 atccatccatccatccatcc 49465 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49343 atccatccatccatccatcc 49362 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49339 atccatccatccatccatcc 49358 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49335 atccatccatccatccatcc 49354 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49331 atccatccatccatccatcc 49350 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 49327 atccatccatccatccatcc 49346
>gb|DQ515958.1| Homo sapiens cytochrome P450, family 2, subfamily E, polypeptide 1 (CYP2E1) gene, complete cds Length = 15654 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 11522 tccatccatccatccatcctcca 11500 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11044 atccatccatccatccatcc 11025 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11040 atccatccatccatccatcc 11021 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11036 atccatccatccatccatcc 11017
>gb|AC156554.13| Mus musculus chromosome 8, clone RP23-15O21, complete sequence Length = 221400 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccacaa 49 |||||||||||||||||| |||||||| Sbjct: 2170 atccatccatccatccatactccacaa 2196
>gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 181588 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 97728 atccatccatccatccatcctcc 97706 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 20147 gatccatccatccatccatcc 20127 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctccac 47 |||||||||||||||||||| |||| Sbjct: 20138 atccatccatccatccatccaccac 20114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97812 atccatccatccatccatcc 97793 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97808 atccatccatccatccatcc 97789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97804 atccatccatccatccatcc 97785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97800 atccatccatccatccatcc 97781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97796 atccatccatccatccatcc 97777 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97792 atccatccatccatccatcc 97773 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97748 atccatccatccatccatcc 97729 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97744 atccatccatccatccatcc 97725 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97740 atccatccatccatccatcc 97721 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97736 atccatccatccatccatcc 97717 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 97732 atccatccatccatccatcc 97713 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20142 atccatccatccatccatcc 20123
>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete sequence Length = 186859 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 61503 atccatccatccatccatcctcc 61481 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 61435 atccatccatccatccatcctcc 61413 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 61391 atccatccatccatccatcctcc 61369 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 61363 atccatccatccatccatcctcc 61341 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 61319 atccatccatccatccatcctcc 61297 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 61291 atccatccatccatccatcctcc 61269 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 77508 atccatccatccatccatcct 77488 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 20449 atccatccatccatccatcct 20429 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114216 atccatccatccatccatcc 114197 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114212 atccatccatccatccatcc 114193 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114208 atccatccatccatccatcc 114189 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114204 atccatccatccatccatcc 114185 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114200 atccatccatccatccatcc 114181 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114196 atccatccatccatccatcc 114177 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77540 atccatccatccatccatcc 77521 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77536 atccatccatccatccatcc 77517 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77532 atccatccatccatccatcc 77513 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77528 atccatccatccatccatcc 77509 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77524 atccatccatccatccatcc 77505 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77520 atccatccatccatccatcc 77501 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77516 atccatccatccatccatcc 77497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77512 atccatccatccatccatcc 77493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77448 atccatccatccatccatcc 77429 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77376 atccatccatccatccatcc 77357 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77372 atccatccatccatccatcc 77353 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77368 atccatccatccatccatcc 77349 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77364 atccatccatccatccatcc 77345 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77360 atccatccatccatccatcc 77341 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77356 atccatccatccatccatcc 77337 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77352 atccatccatccatccatcc 77333 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 77320 atccatccatccatccatcc 77301 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61523 atccatccatccatccatcc 61504 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61519 atccatccatccatccatcc 61500 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61515 atccatccatccatccatcc 61496 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61511 atccatccatccatccatcc 61492 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61507 atccatccatccatccatcc 61488 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61459 atccatccatccatccatcc 61440 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61411 atccatccatccatccatcc 61392 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61407 atccatccatccatccatcc 61388 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61403 atccatccatccatccatcc 61384 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61399 atccatccatccatccatcc 61380 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61395 atccatccatccatccatcc 61376 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61367 atccatccatccatccatcc 61348 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61339 atccatccatccatccatcc 61320 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61335 atccatccatccatccatcc 61316 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61331 atccatccatccatccatcc 61312 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61327 atccatccatccatccatcc 61308 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61323 atccatccatccatccatcc 61304 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 61295 atccatccatccatccatcc 61276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57133 atccatccatccatccatcc 57114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57129 atccatccatccatccatcc 57110 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57125 atccatccatccatccatcc 57106 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57121 atccatccatccatccatcc 57102 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57117 atccatccatccatccatcc 57098 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57113 atccatccatccatccatcc 57094 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57109 atccatccatccatccatcc 57090 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57081 atccatccatccatccatcc 57062 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57077 atccatccatccatccatcc 57058 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57073 atccatccatccatccatcc 57054 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57069 atccatccatccatccatcc 57050 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57065 atccatccatccatccatcc 57046 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57061 atccatccatccatccatcc 57042 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23304 atccatccatccatccatcc 23285 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23300 atccatccatccatccatcc 23281 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23296 atccatccatccatccatcc 23277 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23267 atccatccatccatccatcc 23248 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23218 atccatccatccatccatcc 23199 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23214 atccatccatccatccatcc 23195 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23135 atccatccatccatccatcc 23116 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23131 atccatccatccatccatcc 23112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23106 atccatccatccatccatcc 23087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23049 atccatccatccatccatcc 23030 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 23045 atccatccatccatccatcc 23026 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20469 atccatccatccatccatcc 20450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20465 atccatccatccatccatcc 20446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20461 atccatccatccatccatcc 20442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20457 atccatccatccatccatcc 20438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20453 atccatccatccatccatcc 20434
>gb|AC183833.2| Pan troglodytes BAC clone CH251-141C5 from chromosome 7, complete sequence Length = 155911 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 60148 atccatccatccatccatcctcc 60170 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 ccatccatccatccatcctcc 45 ||||||||||||||||||||| Sbjct: 60526 ccatccatccatccatcctcc 60546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60652 atccatccatccatccatcc 60671 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60648 atccatccatccatccatcc 60667 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60252 atccatccatccatccatcc 60271 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60076 atccatccatccatccatcc 60095 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60072 atccatccatccatccatcc 60091 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60068 atccatccatccatccatcc 60087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59894 atccatccatccatccatcc 59913 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59890 atccatccatccatccatcc 59909 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59844 atccatccatccatccatcc 59863 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59840 atccatccatccatccatcc 59859
>gb|AC093168.3| Homo sapiens BAC clone RP11-148M21 from 7, complete sequence Length = 148689 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 101911 atccatccatccatccatcctcc 101933 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 ccatccatccatccatcctcc 45 ||||||||||||||||||||| Sbjct: 102285 ccatccatccatccatcctcc 102305 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102403 atccatccatccatccatcc 102422 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102399 atccatccatccatccatcc 102418 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102395 atccatccatccatccatcc 102414 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101839 atccatccatccatccatcc 101858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101835 atccatccatccatccatcc 101854 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101831 atccatccatccatccatcc 101850 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101827 atccatccatccatccatcc 101846 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101823 atccatccatccatccatcc 101842 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101819 atccatccatccatccatcc 101838 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101815 atccatccatccatccatcc 101834 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101641 atccatccatccatccatcc 101660 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101637 atccatccatccatccatcc 101656 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101633 atccatccatccatccatcc 101652 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101629 atccatccatccatccatcc 101648 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101625 atccatccatccatccatcc 101644 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101621 atccatccatccatccatcc 101640
>gb|AC093734.3| Homo sapiens BAC clone RP11-16P10 from 7, complete sequence Length = 114085 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 101397 atccatccatccatccatcctcc 101419 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 101149 atccatccatccatccatcctcc 101171 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 101090 atccatccatccatccatcctcc 101112 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 100998 atccatccatccatccatcct 101018 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101678 atccatccatccatccatcc 101697 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101393 atccatccatccatccatcc 101412 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101389 atccatccatccatccatcc 101408 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101385 atccatccatccatccatcc 101404 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101145 atccatccatccatccatcc 101164 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 101141 atccatccatccatccatcc 101160 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100994 atccatccatccatccatcc 101013 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100990 atccatccatccatccatcc 101009 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100986 atccatccatccatccatcc 101005 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100574 atccatccatccatccatcc 100593 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100570 atccatccatccatccatcc 100589 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100566 atccatccatccatccatcc 100585 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 100562 atccatccatccatccatcc 100581 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84694 atccatccatccatccatcc 84713 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84146 atccatccatccatccatcc 84165 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84142 atccatccatccatccatcc 84161 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84138 atccatccatccatccatcc 84157
>gb|AC145199.3| Mus musculus BAC clone RP23-173N12 from chromosome 7, complete sequence Length = 220892 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 14430 atccatccatccatccatcctcc 14452 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143720 atccatccatccatccatcc 143701 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 14426 atccatccatccatccatcc 14445 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 14422 atccatccatccatccatcc 14441 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 14418 atccatccatccatccatcc 14437
>gb|AC113977.16| Mus musculus chromosome 1, clone RP23-161E13, complete sequence Length = 235738 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 87353 atccatccatccatccatcctcc 87331 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 27483 atccatccatccatccatcct 27503 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87361 atccatccatccatccatcc 87342 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87357 atccatccatccatccatcc 87338 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 27479 atccatccatccatccatcc 27498
>gb|AC127259.3| Mus musculus BAC clone RP24-304A20 from chromosome 9, complete sequence Length = 162717 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 67614 atccatccatccatccatcctcc 67592 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67042 atccatccatccatccatcc 67023 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67038 atccatccatccatccatcc 67019 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67034 atccatccatccatccatcc 67015 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67030 atccatccatccatccatcc 67011 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67026 atccatccatccatccatcc 67007 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67022 atccatccatccatccatcc 67003 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 67018 atccatccatccatccatcc 66999
>gb|AC121909.3| Mus musculus BAC clone RP24-179L9 from chromosome 5, complete sequence Length = 155771 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 120910 atccatccatccatccatcctcc 120888 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121181 atccatccatccatccatcc 121162 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121057 atccatccatccatccatcc 121038 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121053 atccatccatccatccatcc 121034 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121049 atccatccatccatccatcc 121030 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121045 atccatccatccatccatcc 121026 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121041 atccatccatccatccatcc 121022 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120914 atccatccatccatccatcc 120895 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120811 atccatccatccatccatcc 120792 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120807 atccatccatccatccatcc 120788 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92904 atccatccatccatccatcc 92885 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82947 atccatccatccatccatcc 82928 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82943 atccatccatccatccatcc 82924 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82939 atccatccatccatccatcc 82920 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82935 atccatccatccatccatcc 82916 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82931 atccatccatccatccatcc 82912 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82927 atccatccatccatccatcc 82908 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82923 atccatccatccatccatcc 82904 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82835 atccatccatccatccatcc 82816 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82831 atccatccatccatccatcc 82812 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82827 atccatccatccatccatcc 82808 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82823 atccatccatccatccatcc 82804 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 60719 atccatccatccatccatcc 60700
>emb|CR354390.16| Zebrafish DNA sequence from clone CH211-90K4 in linkage group 5, complete sequence Length = 141684 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 91112 atccatccatccatccatcctcc 91090 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 90998 atccatccatccatccatcct 90978 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 90914 atccatccatccatccatcct 90894 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 91116 atccatccatccatccatcc 91097 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90938 atccatccatccatccatcc 90919 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90934 atccatccatccatccatcc 90915 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90930 atccatccatccatccatcc 90911 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90926 atccatccatccatccatcc 90907 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90922 atccatccatccatccatcc 90903 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90918 atccatccatccatccatcc 90899
>gb|AC009119.10| Homo sapiens chromosome 16 clone RP11-483P21, complete sequence Length = 181020 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 150879 atccatccatccatccatcctcc 150857 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 ccatccatccatccatcctcc 45 ||||||||||||||||||||| Sbjct: 150934 ccatccatccatccatcctcc 150914 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150883 atccatccatccatccatcc 150864 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 150616 atccatccatccatccatcttcca 150593 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150442 atccatccatccatccatcc 150423 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150438 atccatccatccatccatcc 150419 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150434 atccatccatccatccatcc 150415 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150430 atccatccatccatccatcc 150411 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150426 atccatccatccatccatcc 150407 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150422 atccatccatccatccatcc 150403
>gb|AC121922.3| Mus musculus BAC clone RP24-198H19 from chromosome 9, complete sequence Length = 180690 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 45514 atccatccatccatccatcctcc 45492 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 45478 atccatccatccatccatcctcc 45456 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 45327 atccatccatccatccatcctcc 45305 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 45187 atccatccatccatccatcctcc 45165 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52881 atccatccatccatccatcc 52900 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52877 atccatccatccatccatcc 52896 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52873 atccatccatccatccatcc 52892 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52869 atccatccatccatccatcc 52888 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45518 atccatccatccatccatcc 45499 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45347 atccatccatccatccatcc 45328 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45343 atccatccatccatccatcc 45324 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45339 atccatccatccatccatcc 45320 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45335 atccatccatccatccatcc 45316 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45331 atccatccatccatccatcc 45312 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45291 atccatccatccatccatcc 45272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45287 atccatccatccatccatcc 45268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45203 atccatccatccatccatcc 45184 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45199 atccatccatccatccatcc 45180 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45195 atccatccatccatccatcc 45176 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45191 atccatccatccatccatcc 45172
>gb|AC164702.2| Mus musculus BAC clone RP23-402H19 from chromosome 10, complete sequence Length = 208221 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 30430 tccatccatccatccatcctcca 30452 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 188826 atccatccatccatccatcc 188807 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94799 atccatccatccatccatcc 94818 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 94795 atccatccatccatccatcc 94814
>gb|AC110237.8| Mus musculus chromosome 5, clone RP23-104B24, complete sequence Length = 243323 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 96230 atccatccatccatccatcctcc 96252 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96226 atccatccatccatccatcc 96245 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96222 atccatccatccatccatcc 96241 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96218 atccatccatccatccatcc 96237 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 96214 atccatccatccatccatcc 96233
>emb|BX901913.8| Zebrafish DNA sequence from clone CH211-241E15 in linkage group 1, complete sequence Length = 142370 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 87802 atccatccatccatccatcctcc 87780 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 87738 atccatccatccatccatcctcc 87716 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 87287 atccatccatccatccatcctc 87266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88456 atccatccatccatccatcc 88437 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88452 atccatccatccatccatcc 88433 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88268 atccatccatccatccatcc 88249 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88264 atccatccatccatccatcc 88245 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88208 atccatccatccatccatcc 88189 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88204 atccatccatccatccatcc 88185 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88200 atccatccatccatccatcc 88181 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88196 atccatccatccatccatcc 88177 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88101 atccatccatccatccatcc 88082 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88097 atccatccatccatccatcc 88078 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88093 atccatccatccatccatcc 88074 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88001 atccatccatccatccatcc 87982 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87818 atccatccatccatccatcc 87799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87814 atccatccatccatccatcc 87795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87810 atccatccatccatccatcc 87791 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87806 atccatccatccatccatcc 87787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87746 atccatccatccatccatcc 87727 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87742 atccatccatccatccatcc 87723 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87682 atccatccatccatccatcc 87663 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87678 atccatccatccatccatcc 87659 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87674 atccatccatccatccatcc 87655 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87670 atccatccatccatccatcc 87651 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87666 atccatccatccatccatcc 87647 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87547 atccatccatccatccatcc 87528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87503 atccatccatccatccatcc 87484 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87499 atccatccatccatccatcc 87480 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87495 atccatccatccatccatcc 87476 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87491 atccatccatccatccatcc 87472 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87487 atccatccatccatccatcc 87468 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87483 atccatccatccatccatcc 87464 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87479 atccatccatccatccatcc 87460 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87475 atccatccatccatccatcc 87456 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87471 atccatccatccatccatcc 87452 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87467 atccatccatccatccatcc 87448 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87463 atccatccatccatccatcc 87444 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87459 atccatccatccatccatcc 87440 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87455 atccatccatccatccatcc 87436 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87451 atccatccatccatccatcc 87432 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87447 atccatccatccatccatcc 87428 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87383 atccatccatccatccatcc 87364 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87379 atccatccatccatccatcc 87360 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87347 atccatccatccatccatcc 87328 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87343 atccatccatccatccatcc 87324 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87303 atccatccatccatccatcc 87284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87299 atccatccatccatccatcc 87280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87295 atccatccatccatccatcc 87276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87291 atccatccatccatccatcc 87272
>gb|AC158512.2| Mus musculus BAC clone RP24-319O6 from chromosome 9, complete sequence Length = 171723 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 59643 atccatccatccatccatcctcc 59665 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59639 atccatccatccatccatcc 59658 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59635 atccatccatccatccatcc 59654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59631 atccatccatccatccatcc 59650 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59627 atccatccatccatccatcc 59646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59623 atccatccatccatccatcc 59642 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59619 atccatccatccatccatcc 59638 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59615 atccatccatccatccatcc 59634
>emb|BX927158.14| Zebrafish DNA sequence from clone DKEY-106K1 in linkage group 5, complete sequence Length = 144909 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 39157 atccatccatccatccatcctcc 39179 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 142881 cgatccatccatccatccatcc 142902 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 142802 gatccatccatccatccatcc 142822 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 39513 atccatccatccatccatcct 39533 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 39418 atccatccatccatccatcct 39438 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 39319 atccatccatccatccatcct 39339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143836 atccatccatccatccatcc 143855 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143832 atccatccatccatccatcc 143851 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143544 atccatccatccatccatcc 143563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143264 atccatccatccatccatcc 143283 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 143260 atccatccatccatccatcc 143279 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 142965 tccatccatccatccatcct 142984 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 142807 atccatccatccatccatcc 142826 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 142661 atccatccatccatccatcc 142680 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39691 atccatccatccatccatcc 39710 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39509 atccatccatccatccatcc 39528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39505 atccatccatccatccatcc 39524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcct 43 |||||||||||||||||||| Sbjct: 39229 tccatccatccatccatcct 39248 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 39063 atccatccatccatccatcc 39082
>emb|BX537131.17| Zebrafish DNA sequence from clone CH211-266K2 in linkage group 14, complete sequence Length = 140171 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 20191 atccatccatccatccatcctcc 20213 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 19963 atccatccatccatccatcctcc 19985 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20731 atccatccatccatccatcc 20750 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20727 atccatccatccatccatcc 20746 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20723 atccatccatccatccatcc 20742 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20719 atccatccatccatccatcc 20738 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20187 atccatccatccatccatcc 20206 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20183 atccatccatccatccatcc 20202
>gb|AC094784.13| Rattus norvegicus 11 BAC CH230-4O6 (Children's Hospital Oakland Research Institute) complete sequence Length = 228501 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 192836 atccatccatccatccatcctcc 192858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 192832 atccatccatccatccatcc 192851
>emb|Z93942.1|HS230I19 Human DNA sequence from clone RP1-230I19 on chromosome 20q12-13.12 Contains part of the PTPRT gene for protein tyrosine phosphatase receptor type T, genomic marker D20S858, a ca repeat polymorphism, ESTs, STS and GSSs, complete sequence Length = 144201 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 126642 atccatccatccatccatcctcc 126664 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35422 atccatccatccatccatcc 35441 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35418 atccatccatccatccatcc 35437 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35414 atccatccatccatccatcc 35433 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35410 atccatccatccatccatcc 35429 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35406 atccatccatccatccatcc 35425 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35402 atccatccatccatccatcc 35421 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35398 atccatccatccatccatcc 35417
>emb|AL691497.8| Human DNA sequence from clone RP11-542C10 on chromosome 1 Contains putative novel transcript, complete sequence Length = 174648 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 72089 atccatccatccatccatcctcc 72067
>emb|AL592309.24| Human DNA sequence from clone RP11-293F5 on chromosome 1 Contains a novel gene, a novel pseudogene, a novel gene similar to heparan sulfate 6-O-sulfotransferase 1 (HS6ST1), a pseudogene similar to part of a novel gene, the gene for a hypothetical protein AE2, a profilin 1 (PFN1) pseudogene, the 5' end of the ALPL gene for alkaline phosphatase, liver/bone/kidney and a CpG island, complete sequence Length = 206231 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcct 43 ||||||||||||||||||||||| Sbjct: 195098 cgatccatccatccatccatcct 195076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 195180 atccatccatccatccatcc 195161 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 195176 atccatccatccatccatcc 195157 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 195172 atccatccatccatccatcc 195153 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 195168 atccatccatccatccatcc 195149 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 195164 atccatccatccatccatcc 195145 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166563 atccatccatccatccatcc 166544 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166559 atccatccatccatccatcc 166540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166555 atccatccatccatccatcc 166536 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166551 atccatccatccatccatcc 166532 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 166547 atccatccatccatccatcatcca 166524
>emb|AL589202.1| Human DNA sequence from clone RP11-391F23 on chromosome 6, complete sequence Length = 52411 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 19123 atccatccatccatccatcctcc 19145 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 18944 atccatccatccatccatcctcc 18966 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19455 atccatccatccatccatcc 19474 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19119 atccatccatccatccatcc 19138 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19115 atccatccatccatccatcc 19134 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19111 atccatccatccatccatcc 19130 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19107 atccatccatccatccatcc 19126 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19103 atccatccatccatccatcc 19122 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19099 atccatccatccatccatcc 19118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 19095 atccatccatccatccatcc 19114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18940 atccatccatccatccatcc 18959 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18936 atccatccatccatccatcc 18955 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18932 atccatccatccatccatcc 18951 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18928 atccatccatccatccatcc 18947 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18924 atccatccatccatccatcc 18943
>emb|AL513206.6| Human DNA sequence from clone RP11-382F13 on chromosome 1 Contains part of the VAV3 gene for VAV3 oncogene, complete sequence Length = 108124 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 12145 atccatccatccatccatcctcc 12123 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12157 atccatccatccatccatcc 12138 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12153 atccatccatccatccatcc 12134 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12149 atccatccatccatccatcc 12130
>emb|AL356389.20| Human DNA sequence from clone RP11-352P4 on chromosome 1 Contains the 3' end of the gene for maba1 (KIAA1324) and the SARS gene for seryl-tRNA synthetase, complete sequence Length = 97114 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 92212 tccatccatccatccatcctcca 92234 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 93341 atccatccatccatccatcct 93321 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93353 atccatccatccatccatcc 93334 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93349 atccatccatccatccatcc 93330 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93345 atccatccatccatccatcc 93326
>emb|AL354898.10| Human DNA sequence from clone RP11-618A20 on chromosome 9 Contains a novel gene (DKFZp434P0216), the ASS gene for argininosuccinate synthetase (ASS1,CTLN1) and three CpG islands, complete sequence Length = 173023 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 9406 atccatccatccatccatcctcc 9384 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 25913 atccatccatccatccatcct 25893 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107115 atccatccatccatccatcc 107134 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccat 40 |||||||||||||||||||| Sbjct: 107051 cgatccatccatccatccat 107070 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26240 atccatccatccatccatcc 26221 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26236 atccatccatccatccatcc 26217 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26232 atccatccatccatccatcc 26213 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26228 atccatccatccatccatcc 26209 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26057 atccatccatccatccatcc 26038 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26017 atccatccatccatccatcc 25998 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26013 atccatccatccatccatcc 25994 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25965 atccatccatccatccatcc 25946 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25961 atccatccatccatccatcc 25942 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25957 atccatccatccatccatcc 25938 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25953 atccatccatccatccatcc 25934 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25917 atccatccatccatccatcc 25898 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13202 atccatccatccatccatcc 13221 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13097 atccatccatccatccatcc 13116 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13093 atccatccatccatccatcc 13112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13089 atccatccatccatccatcc 13108 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13085 atccatccatccatccatcc 13104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 13081 atccatccatccatccatcc 13100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 9422 atccatccatccatccatcc 9403 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 9418 atccatccatccatccatcc 9399 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 9414 atccatccatccatccatcc 9395 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 9410 atccatccatccatccatcc 9391
>emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on chromosome 9 Contains the CRAT gene for carnitine acetyltransferase (CAT1), the PPP2R4 gene for protein phosphatase 2A, regulatory subunit B' (PR 53) (PTPA), the IER5L gene for immediate early response 5-like, a novel gene and three CpG islands, complete sequence Length = 162445 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 140585 atccatccatccatccatcctcc 140607 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 140269 atccatccatccatccatcctcc 140291 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 140385 atccatccatccatccatcctc 140406 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140669 atccatccatccatccatcc 140688 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140665 atccatccatccatccatcc 140684 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140661 atccatccatccatccatcc 140680 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140581 atccatccatccatccatcc 140600 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140577 atccatccatccatccatcc 140596 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140573 atccatccatccatccatcc 140592 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140457 atccatccatccatccatcc 140476 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140453 atccatccatccatccatcc 140472 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140381 atccatccatccatccatcc 140400 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140377 atccatccatccatccatcc 140396 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140373 atccatccatccatccatcc 140392 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140265 atccatccatccatccatcc 140284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140261 atccatccatccatccatcc 140280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140257 atccatccatccatccatcc 140276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140253 atccatccatccatccatcc 140272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140249 atccatccatccatccatcc 140268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140245 atccatccatccatccatcc 140264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 140241 atccatccatccatccatcc 140260
>emb|AL133343.23| Human DNA sequence from clone RP11-410N8 on chromosome 20 Contains the 5' end of two variants of the C20orf112 gene for a novel protein similar to nucleolar protein 4 (NOL4), three novel genes and a CpG island, complete sequence Length = 63609 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 59933 atccatccatccatccatcctcc 59911 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59949 atccatccatccatccatcc 59930 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59945 atccatccatccatccatcc 59926 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59941 atccatccatccatccatcc 59922 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59937 atccatccatccatccatcc 59918 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59429 atccatccatccatccatcc 59410 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59425 atccatccatccatccatcc 59406 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59421 atccatccatccatccatcc 59402 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59417 atccatccatccatccatcc 59398 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59413 atccatccatccatccatcc 59394 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59409 atccatccatccatccatcc 59390 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59373 atccatccatccatccatcc 59354 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59369 atccatccatccatccatcc 59350 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59365 atccatccatccatccatcc 59346 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59361 atccatccatccatccatcc 59342 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59357 atccatccatccatccatcc 59338
>emb|AL121901.20|HSBA49G10 Human DNA sequence from clone RP11-49G10 on chromosome 20 Contains the C20orf70 gene, the SOCS2P1 gene for suppressor of cytokine signalling 2 pseudogene 1, a novel gene, the C20orf71 gene, the PLUNC gene for palate, lung and nasal epithelium carcinoma associated, the 5' end of the C20orf114 gene encoding a protein similar to murine von ebner minor salivary gland protein, the RPL12P3 gene for ribosomal protein L12 pseudogene 3, the gene for breast cancer and salivary gland expression protein (BASE) and a CpG island, complete sequence Length = 161593 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 16311 atccatccatccatccatcctcc 16289 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107953 atccatccatccatccatcc 107934 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107949 atccatccatccatccatcc 107930 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107945 atccatccatccatccatcc 107926 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107941 atccatccatccatccatcc 107922 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107937 atccatccatccatccatcc 107918 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107933 atccatccatccatccatcc 107914 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 107929 atccatccatccatccatcc 107910 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90045 atccatccatccatccatcc 90026 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90041 atccatccatccatccatcc 90022 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90037 atccatccatccatccatcc 90018 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90033 atccatccatccatccatcc 90014 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89981 atccatccatccatccatcc 89962 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89977 atccatccatccatccatcc 89958 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89973 atccatccatccatccatcc 89954 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89969 atccatccatccatccatcc 89950 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89965 atccatccatccatccatcc 89946 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89961 atccatccatccatccatcc 89942 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89957 atccatccatccatccatcc 89938 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89953 atccatccatccatccatcc 89934 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16315 atccatccatccatccatcc 16296
>gb|AC119619.5| Homo sapiens X BAC RP11-1J4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 94158 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 10411 atccatccatccatccatcctcc 10389
>emb|AL109615.42|HS1120P11 Human DNA sequence from clone RP5-1120P11 on chromosome 6p12.3-21.2, complete sequence Length = 146655 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 85249 atccatccatccatccatcctcc 85227 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85277 atccatccatccatccatcc 85258 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85273 atccatccatccatccatcc 85254 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85269 atccatccatccatccatcc 85250 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85265 atccatccatccatccatcc 85246 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85261 atccatccatccatccatcc 85242 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85257 atccatccatccatccatcc 85238 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85253 atccatccatccatccatcc 85234
>emb|AL035070.3|HS1043L13 Human DNA sequence from clone RP5-1043L13 on chromosome 20q13.2-13.33 Contains part of a novel gene (LOC284757), complete sequence Length = 156666 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 147251 atccatccatccatccatcctcc 147273 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 146825 atccatccatccatccatcctcc 146847 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147247 atccatccatccatccatcc 147266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147243 atccatccatccatccatcc 147262 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147087 atccatccatccatccatcc 147106
>emb|CR376835.6| Zebrafish DNA sequence from clone CH211-59E4 in linkage group 23, complete sequence Length = 23743 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 16968 atccatccatccatccatcctcc 16990 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 17180 gatccatccatccatccatcc 17200 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 17044 gatccatccatccatccatcc 17064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17193 atccatccatccatccatcc 17212 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17189 atccatccatccatccatcc 17208 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17185 atccatccatccatccatcc 17204 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17096 atccatccatccatccatcc 17115 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17092 atccatccatccatccatcc 17111 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17088 atccatccatccatccatcc 17107 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17084 atccatccatccatccatcc 17103 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17080 atccatccatccatccatcc 17099 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17076 atccatccatccatccatcc 17095 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17049 atccatccatccatccatcc 17068 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16964 atccatccatccatccatcc 16983 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16960 atccatccatccatccatcc 16979 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16956 atccatccatccatccatcc 16975
>emb|BX897743.8| Zebrafish DNA sequence from clone CH211-164N21 in linkage group 10, complete sequence Length = 112314 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 87518 atccatccatccatccatcctcc 87540 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 87218 cgatccatccatccatccatcc 87239 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87288 atccatccatccatccatcc 87307 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87284 atccatccatccatccatcc 87303 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87280 atccatccatccatccatcc 87299 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87276 atccatccatccatccatcc 87295 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87272 atccatccatccatccatcc 87291 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87268 atccatccatccatccatcc 87287 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87264 atccatccatccatccatcc 87283 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87260 atccatccatccatccatcc 87279 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87256 atccatccatccatccatcc 87275 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87252 atccatccatccatccatcc 87271 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84730 atccatccatccatccatcc 84749 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84443 atccatccatccatccatcc 84462 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84439 atccatccatccatccatcc 84458 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84435 atccatccatccatccatcc 84454 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84431 atccatccatccatccatcc 84450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84427 atccatccatccatccatcc 84446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84423 atccatccatccatccatcc 84442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84419 atccatccatccatccatcc 84438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84415 atccatccatccatccatcc 84434 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84411 atccatccatccatccatcc 84430 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84407 atccatccatccatccatcc 84426 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84403 atccatccatccatccatcc 84422 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84399 atccatccatccatccatcc 84418 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84395 atccatccatccatccatcc 84414 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84391 atccatccatccatccatcc 84410 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84367 atccatccatccatccatcc 84386 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84363 atccatccatccatccatcc 84382
>gb|AC175363.2| Pan troglodytes chromosome X clone CH251-7A1 map human ortholog p11.4, complete sequence Length = 221738 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 175595 atccatccatccatccatcctcc 175573 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 175543 atccatccatccatccatcctcc 175521 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175631 atccatccatccatccatcc 175612 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175627 atccatccatccatccatcc 175608 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175623 atccatccatccatccatcc 175604 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175619 atccatccatccatccatcc 175600 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175615 atccatccatccatccatcc 175596 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175611 atccatccatccatccatcc 175592 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175607 atccatccatccatccatcc 175588 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175603 atccatccatccatccatcc 175584 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175599 atccatccatccatccatcc 175580 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175555 atccatccatccatccatcc 175536 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175551 atccatccatccatccatcc 175532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175547 atccatccatccatccatcc 175528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155473 atccatccatccatccatcc 155454 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155469 atccatccatccatccatcc 155450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155465 atccatccatccatccatcc 155446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155461 atccatccatccatccatcc 155442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155457 atccatccatccatccatcc 155438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155453 atccatccatccatccatcc 155434
>emb|BX842605.1|OSJN00299 Oryza sativa genomic DNA, chromosome 4, BAC clone: B1358B12, complete sequence Length = 131246 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 16 agcagcgatccatccatccatccatcc 42 ||||||||| ||||||||||||||||| Sbjct: 90052 agcagcgattcatccatccatccatcc 90026
>emb|BX572601.1| Rhodopseudomonas palustris CGA009 complete genome; segment 9/16 Length = 348580 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Plus Query: 333 atgtccgacgacgacctccgcgggatg 359 ||||| ||||||||||||||||||||| Sbjct: 327794 atgtcggacgacgacctccgcgggatg 327820
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 369 ggcgacttcgacggcgacggcgc 391 ||||||||||||||||||||||| Sbjct: 139314 ggcgacttcgacggcgacggcgc 139336 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 369 ggcgacttcgacggcgacggc 389 ||||||||||||||||||||| Sbjct: 139881 ggcgacttcgacggcgacggc 139901
>emb|BX927088.11| Zebrafish DNA sequence from clone CH211-212M21 in linkage group 2, complete sequence Length = 201361 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 17236 atccatccatccatccatcctcc 17258 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 16877 atccatccatccatccatcctcc 16899 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 190668 atccatccatccatccatcct 190648 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190680 atccatccatccatccatcc 190661 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190676 atccatccatccatccatcc 190657 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190672 atccatccatccatccatcc 190653 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190516 atccatccatccatccatcc 190497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190512 atccatccatccatccatcc 190493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190508 atccatccatccatccatcc 190489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190504 atccatccatccatccatcc 190485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190500 atccatccatccatccatcc 190481 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190496 atccatccatccatccatcc 190477 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190492 atccatccatccatccatcc 190473 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190488 atccatccatccatccatcc 190469 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190484 atccatccatccatccatcc 190465 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190480 atccatccatccatccatcc 190461 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190476 atccatccatccatccatcc 190457 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190472 atccatccatccatccatcc 190453 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190468 atccatccatccatccatcc 190449 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190464 atccatccatccatccatcc 190445 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190460 atccatccatccatccatcc 190441 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190456 atccatccatccatccatcc 190437 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190452 atccatccatccatccatcc 190433 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190448 atccatccatccatccatcc 190429 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190444 atccatccatccatccatcc 190425 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190440 atccatccatccatccatcc 190421 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190436 atccatccatccatccatcc 190417 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190412 atccatccatccatccatcc 190393 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190408 atccatccatccatccatcc 190389 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190404 atccatccatccatccatcc 190385 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190400 atccatccatccatccatcc 190381 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190396 atccatccatccatccatcc 190377 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17343 atccatccatccatccatcc 17362 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17339 atccatccatccatccatcc 17358 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17232 atccatccatccatccatcc 17251 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17228 atccatccatccatccatcc 17247 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17224 atccatccatccatccatcc 17243 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17220 atccatccatccatccatcc 17239 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17216 atccatccatccatccatcc 17235 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17212 atccatccatccatccatcc 17231 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17208 atccatccatccatccatcc 17227 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17204 atccatccatccatccatcc 17223 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17200 atccatccatccatccatcc 17219 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17196 atccatccatccatccatcc 17215 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17192 atccatccatccatccatcc 17211 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17188 atccatccatccatccatcc 17207 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 17184 atccatccatccatccatcc 17203 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16873 atccatccatccatccatcc 16892 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16869 atccatccatccatccatcc 16888 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16865 atccatccatccatccatcc 16884 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16861 atccatccatccatccatcc 16880 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16857 atccatccatccatccatcc 16876 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16853 atccatccatccatccatcc 16872 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16849 atccatccatccatccatcc 16868 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16845 atccatccatccatccatcc 16864 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16841 atccatccatccatccatcc 16860 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16837 atccatccatccatccatcc 16856 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16833 atccatccatccatccatcc 16852 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16829 atccatccatccatccatcc 16848 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16825 atccatccatccatccatcc 16844 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 16821 atccatccatccatccatcc 16840
>emb|BX571852.20| Zebrafish DNA sequence from clone DKEY-175N6 in linkage group 10, complete sequence Length = 178333 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 36558 tccatccatccatccatcctcca 36536 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 36295 atccatccatccatccatcct 36275 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121341 atccatccatccatccatcc 121360 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121337 atccatccatccatccatcc 121356 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121333 atccatccatccatccatcc 121352 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121329 atccatccatccatccatcc 121348 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121325 atccatccatccatccatcc 121344 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121321 atccatccatccatccatcc 121340 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121221 atccatccatccatccatcc 121240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121217 atccatccatccatccatcc 121236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38143 atccatccatccatccatcc 38124 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38139 atccatccatccatccatcc 38120 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38135 atccatccatccatccatcc 38116 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38131 atccatccatccatccatcc 38112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38127 atccatccatccatccatcc 38108 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38055 atccatccatccatccatcc 38036 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38051 atccatccatccatccatcc 38032 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38047 atccatccatccatccatcc 38028 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38043 atccatccatccatccatcc 38024 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38039 atccatccatccatccatcc 38020 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38035 atccatccatccatccatcc 38016 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38031 atccatccatccatccatcc 38012 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38027 atccatccatccatccatcc 38008 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38023 atccatccatccatccatcc 38004 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38019 atccatccatccatccatcc 38000 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38015 atccatccatccatccatcc 37996 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38011 atccatccatccatccatcc 37992 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38007 atccatccatccatccatcc 37988 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38003 atccatccatccatccatcc 37984 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37999 atccatccatccatccatcc 37980 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37995 atccatccatccatccatcc 37976 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37991 atccatccatccatccatcc 37972 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37987 atccatccatccatccatcc 37968 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37983 atccatccatccatccatcc 37964 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37979 atccatccatccatccatcc 37960 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37975 atccatccatccatccatcc 37956 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37971 atccatccatccatccatcc 37952 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37967 atccatccatccatccatcc 37948 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37842 atccatccatccatccatcc 37823 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37838 atccatccatccatccatcc 37819 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37834 atccatccatccatccatcc 37815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37830 atccatccatccatccatcc 37811 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37826 atccatccatccatccatcc 37807 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37822 atccatccatccatccatcc 37803 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37818 atccatccatccatccatcc 37799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37814 atccatccatccatccatcc 37795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37665 atccatccatccatccatcc 37646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37661 atccatccatccatccatcc 37642 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37657 atccatccatccatccatcc 37638 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37653 atccatccatccatccatcc 37634 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36536 atccatccatccatccatcc 36517 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36532 atccatccatccatccatcc 36513 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36528 atccatccatccatccatcc 36509 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36429 atccatccatccatccatcc 36410 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36354 atccatccatccatccatcc 36335 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 36350 atccatccatccatccatcatcca 36327 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36331 atccatccatccatccatcc 36312 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36327 atccatccatccatccatcc 36308 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36323 atccatccatccatccatcc 36304 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36319 atccatccatccatccatcc 36300 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36315 atccatccatccatccatcc 36296 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36311 atccatccatccatccatcc 36292 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36307 atccatccatccatccatcc 36288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36303 atccatccatccatccatcc 36284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36299 atccatccatccatccatcc 36280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36180 atccatccatccatccatcc 36161 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36176 atccatccatccatccatcc 36157 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36172 atccatccatccatccatcc 36153 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36168 atccatccatccatccatcc 36149 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 36164 atccatccatccatccatcatcca 36141 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36145 atccatccatccatccatcc 36126 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36141 atccatccatccatccatcc 36122 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36137 atccatccatccatccatcc 36118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36133 atccatccatccatccatcc 36114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 36006 atccatccatccatccatcc 35987 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 36002 atccatccatccatccatcatcca 35979 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35983 atccatccatccatccatcc 35964 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35892 atccatccatccatccatcc 35873 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35888 atccatccatccatccatcc 35869 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 35884 atccatccatccatccatcatcca 35861 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35865 atccatccatccatccatcc 35846 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35861 atccatccatccatccatcc 35842 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35857 atccatccatccatccatcc 35838 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35853 atccatccatccatccatcc 35834 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35849 atccatccatccatccatcc 35830 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35845 atccatccatccatccatcc 35826 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35841 atccatccatccatccatcc 35822 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35746 atccatccatccatccatcc 35727 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35742 atccatccatccatccatcc 35723 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35606 atccatccatccatccatcc 35587 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35602 atccatccatccatccatcc 35583 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35598 atccatccatccatccatcc 35579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35594 atccatccatccatccatcc 35575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35517 atccatccatccatccatcc 35498 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35513 atccatccatccatccatcc 35494 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35509 atccatccatccatccatcc 35490 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35505 atccatccatccatccatcc 35486 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35501 atccatccatccatccatcc 35482 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35497 atccatccatccatccatcc 35478 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35493 atccatccatccatccatcc 35474 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35489 atccatccatccatccatcc 35470 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35485 atccatccatccatccatcc 35466 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35369 atccatccatccatccatcc 35350 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35207 atccatccatccatccatcc 35188 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35203 atccatccatccatccatcc 35184 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35175 atccatccatccatccatcc 35156 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35171 atccatccatccatccatcc 35152 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35167 atccatccatccatccatcc 35148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35163 atccatccatccatccatcc 35144 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35159 atccatccatccatccatcc 35140 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35155 atccatccatccatccatcc 35136 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 35151 atccatccatccatccatcc 35132
>emb|AL645965.8| Mouse DNA sequence from clone RP23-65I14 on chromosome 11 Contains the 5' end of the gene for a novel protein (330000P08Rik) (Luc7a), the gene for a novel protein (5530600A18Rik), the Abcc3 gene for ATP-binding cassette sub-family C (CFTR/MRP) member 3, the Cacna1g gene for calcium channel voltage-dependent T type alpha 1G subunit, the 3' end of the Tisp78 gene for transcript increased in spermiogenesis 78 and one CpG island, complete sequence Length = 161978 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 136315 atccatccatccatccatcctcc 136293 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 136327 atccatccatccatccatcc 136308 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 136323 atccatccatccatccatcc 136304 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 136319 atccatccatccatccatcc 136300 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 catccatccatccatcctcc 45 |||||||||||||||||||| Sbjct: 136183 catccatccatccatcctcc 136164 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37267 atccatccatccatccatcc 37248
>gb|AC009780.12| Homo sapiens 12 BAC RP11-1C11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 144454 Score = 46.1 bits (23), Expect = 0.092 Identities = 29/31 (93%) Strand = Plus / Minus Query: 17 gcagcgatccatccatccatccatcctccac 47 ||||| ||||||||||||||||||| ||||| Sbjct: 104285 gcagccatccatccatccatccatcatccac 104255 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 103847 atccatccatccatccatcct 103827 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 104195 atccatccatccatccatcc 104176 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 104191 atccatccatccatccatcc 104172 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44863 atccatccatccatccatcc 44844 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44859 atccatccatccatccatcc 44840 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44855 atccatccatccatccatcc 44836 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44851 atccatccatccatccatcc 44832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 44847 atccatccatccatccatcc 44828
>gb|AC121541.31| Mus musculus chromosome 5, clone RP24-132B11, complete sequence Length = 171770 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 76046 atccatccatccatccatcctcc 76068
>gb|AC118207.13| Mus musculus chromosome 8, clone RP24-215A12, complete sequence Length = 187453 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 78793 atccatccatccatccatcctcc 78815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162641 atccatccatccatccatcc 162622 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162530 atccatccatccatccatcc 162511 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162526 atccatccatccatccatcc 162507 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162522 atccatccatccatccatcc 162503 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162518 atccatccatccatccatcc 162499 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162514 atccatccatccatccatcc 162495 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162510 atccatccatccatccatcc 162491 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 111069 atccatccatccatccatcc 111050 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88506 atccatccatccatccatcc 88525 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 88502 atccatccatccatccatcc 88521 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 78656 atccatccatccatccatcc 78675 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5132 atccatccatccatccatcc 5151 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5128 atccatccatccatccatcc 5147
>gb|AC073548.5| Homo sapiens chromosome 19 clone RP11-43N16, complete sequence Length = 167722 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 51766 atccatccatccatccatcctcc 51744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 51770 atccatccatccatccatcc 51751
>gb|AC008737.11| Homo sapiens chromosome 19 clone CTD-2538G9, complete sequence Length = 248281 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 90065 atccatccatccatccatcctcc 90087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89882 atccatccatccatccatcc 89901 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89691 atccatccatccatccatcc 89710 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89687 atccatccatccatccatcc 89706 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89683 atccatccatccatccatcc 89702 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89679 atccatccatccatccatcc 89698 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89675 atccatccatccatccatcc 89694 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80208 atccatccatccatccatcc 80227 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80204 atccatccatccatccatcc 80223 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80116 atccatccatccatccatcc 80135 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80112 atccatccatccatccatcc 80131 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80108 atccatccatccatccatcc 80127 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80104 atccatccatccatccatcc 80123 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80100 atccatccatccatccatcc 80119 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 80065 atccatccatccatccatcc 80084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70535 atccatccatccatccatcc 70554 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70531 atccatccatccatccatcc 70550 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70527 atccatccatccatccatcc 70546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70221 atccatccatccatccatcc 70240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70217 atccatccatccatccatcc 70236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70213 atccatccatccatccatcc 70232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70209 atccatccatccatccatcc 70228 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70205 atccatccatccatccatcc 70224 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 70201 atccatccatccatccatcc 70220 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69770 atccatccatccatccatcc 69789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69766 atccatccatccatccatcc 69785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69762 atccatccatccatccatcc 69781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69582 atccatccatccatccatcc 69601 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69578 atccatccatccatccatcc 69597 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69574 atccatccatccatccatcc 69593 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69570 atccatccatccatccatcc 69589 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69566 atccatccatccatccatcc 69585
>gb|AC104849.2| Homo sapiens chromosome 3 clone RP11-154D3, complete sequence Length = 165849 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 122124 atccatccatccatccatcctcc 122102 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122152 atccatccatccatccatcc 122133 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122148 atccatccatccatccatcc 122129 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122144 atccatccatccatccatcc 122125 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122140 atccatccatccatccatcc 122121 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122136 atccatccatccatccatcc 122117 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122132 atccatccatccatccatcc 122113 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122128 atccatccatccatccatcc 122109
>gb|AC115458.5| Rattus norvegicus 13 BAC CH230-190J23 (Children's Hospital Oakland Research Institute) complete sequence Length = 69404 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcct 43 ||||||||||||||||||||||| Sbjct: 52546 cgatccatccatccatccatcct 52524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52520 atccatccatccatccatcc 52501 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52516 atccatccatccatccatcc 52497 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52512 atccatccatccatccatcc 52493 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52508 atccatccatccatccatcc 52489 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52504 atccatccatccatccatcc 52485 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52500 atccatccatccatccatcc 52481 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52496 atccatccatccatccatcc 52477 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52492 atccatccatccatccatcc 52473 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52488 atccatccatccatccatcc 52469 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52484 atccatccatccatccatcc 52465 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52480 atccatccatccatccatcc 52461 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52476 atccatccatccatccatcc 52457 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 52472 atccatccatccatccatcc 52453
>emb|BX511218.9| Zebrafish DNA sequence from clone DKEY-37K14 in linkage group 17, complete sequence Length = 152316 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 82884 atccatccatccatccatcctcc 82906 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 82880 atccatccatccatccatcc 82899
>emb|AL954696.17| Zebrafish DNA sequence from clone CH211-234K4, complete sequence Length = 149858 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 107849 atccatccatccatccatcctcc 107871
>gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194589 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 192757 atccatccatccatccatcctcc 192735
>gb|AC091228.3| Drosophila melanogaster 3L BAC RP98-10L9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 156142 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 51628 atccatccatccatccatcctcc 51650
>gb|AC105939.2| Homo sapiens chromosome 3 clone RP11-241A5, complete sequence Length = 97387 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 34349 atccatccatccatccatcctcc 34327 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34377 atccatccatccatccatcc 34358 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34373 atccatccatccatccatcc 34354 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34369 atccatccatccatccatcc 34350 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34365 atccatccatccatccatcc 34346 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34361 atccatccatccatccatcc 34342 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34357 atccatccatccatccatcc 34338 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 34353 atccatccatccatccatcc 34334
>dbj|D78272.1|CHKM1R Gallus gallus gene for melanocortin 1-receptor, complete cds Length = 1770 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 1441 atccatccatccatccatcctcc 1419
>gb|AC007481.6|AC007481 Homo sapiens chromosome 8, clone RP11-50A1, complete sequence Length = 137032 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 122678 atccatccatccatccatcctcc 122656
>gb|AC011454.6|AC011454 Homo sapiens chromosome 19 clone CTC-347E6, complete sequence Length = 163120 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 117926 atccatccatccatccatcctcc 117948 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121920 atccatccatccatccatcc 121939 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118066 atccatccatccatccatcc 118085 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118062 atccatccatccatccatcc 118081 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118058 atccatccatccatccatcc 118077 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcc 45 |||||||||||||||||||| Sbjct: 117985 catccatccatccatcctcc 118004 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 117922 atccatccatccatccatcc 117941 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 117802 atccatccatccatccatcc 117821 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 117798 atccatccatccatccatcc 117817 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 117794 atccatccatccatccatcc 117813 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103995 atccatccatccatccatcc 104014 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103951 atccatccatccatccatcc 103970 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103947 atccatccatccatccatcc 103966 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 103943 atccatccatccatccatcc 103962
>emb|BX897752.7| Chicken DNA sequence from clone WAG-88M21, complete sequence Length = 107816 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 95635 atccatccatccatccatcctcc 95613 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95659 atccatccatccatccatcc 95640 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95655 atccatccatccatccatcc 95636 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95651 atccatccatccatccatcc 95632 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95647 atccatccatccatccatcc 95628 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95643 atccatccatccatccatcc 95624 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 95639 atccatccatccatccatcc 95620 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43867 atccatccatccatccatcc 43886 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43863 atccatccatccatccatcc 43882 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43859 atccatccatccatccatcc 43878 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43855 atccatccatccatccatcc 43874 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43851 atccatccatccatccatcc 43870 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43847 atccatccatccatccatcc 43866 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43843 atccatccatccatccatcc 43862 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43839 atccatccatccatccatcc 43858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43835 atccatccatccatccatcc 43854 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37165 atccatccatccatccatcc 37146 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37161 atccatccatccatccatcc 37142 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37157 atccatccatccatccatcc 37138 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37153 atccatccatccatccatcc 37134 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37149 atccatccatccatccatcc 37130 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37145 atccatccatccatccatcc 37126 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37141 atccatccatccatccatcc 37122 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37137 atccatccatccatccatcc 37118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37133 atccatccatccatccatcc 37114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37129 atccatccatccatccatcc 37110 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37125 atccatccatccatccatcc 37106 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 37121 atccatccatccatccatcc 37102
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 16 agcagcgatccatccatccatccatcc 42 ||||||||| ||||||||||||||||| Sbjct: 23093712 agcagcgattcatccatccatccatcc 23093686 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatc 41 ||||||||||||||||||||| Sbjct: 33727714 cgatccatccatccatccatc 33727694 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 33253374 gatccatccatccatccatcc 33253354 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatc 41 ||||||||||||||||||||| Sbjct: 10370383 cgatccatccatccatccatc 10370363 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30820461 atccatccatccatccatcc 30820480 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 29370055 atccatccatccatccatcc 29370036 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28128488 atccatccatccatccatcc 28128469 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28128484 atccatccatccatccatcc 28128465 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28128480 atccatccatccatccatcc 28128461 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22848923 atccatccatccatccatcc 22848904 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22848919 atccatccatccatccatcc 22848900 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22848915 atccatccatccatccatcc 22848896 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15910753 atccatccatccatccatcc 15910772 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15910673 atccatccatccatccatcc 15910692 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5642159 atccatccatccatccatcc 5642140 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5642155 atccatccatccatccatcc 5642136 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5642081 atccatccatccatccatcc 5642062
>emb|BX323807.8| Zebrafish DNA sequence from clone DKEY-154P10 in linkage group 2, complete sequence Length = 194313 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 16 agcagcgatccatccatccatccatcc 42 |||||| |||||||||||||||||||| Sbjct: 87101 agcagccatccatccatccatccatcc 87075 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89385 atccatccatccatccatcc 89366 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89136 atccatccatccatccatcc 89117 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89132 atccatccatccatccatcc 89113 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 89104 atccatccatccatccatcc 89085 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87605 atccatccatccatccatcc 87586 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87601 atccatccatccatccatcc 87582 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87513 atccatccatccatccatcc 87494 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87509 atccatccatccatccatcc 87490 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87505 atccatccatccatccatcc 87486 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87501 atccatccatccatccatcc 87482 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87497 atccatccatccatccatcc 87478 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87493 atccatccatccatccatcc 87474 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87489 atccatccatccatccatcc 87470 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87485 atccatccatccatccatcc 87466 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87481 atccatccatccatccatcc 87462 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87477 atccatccatccatccatcc 87458 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87473 atccatccatccatccatcc 87454 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87469 atccatccatccatccatcc 87450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87465 atccatccatccatccatcc 87446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87461 atccatccatccatccatcc 87442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87457 atccatccatccatccatcc 87438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87453 atccatccatccatccatcc 87434 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87449 atccatccatccatccatcc 87430 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87445 atccatccatccatccatcc 87426 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87441 atccatccatccatccatcc 87422 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87437 atccatccatccatccatcc 87418 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87433 atccatccatccatccatcc 87414 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87429 atccatccatccatccatcc 87410 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87425 atccatccatccatccatcc 87406 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87421 atccatccatccatccatcc 87402 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87417 atccatccatccatccatcc 87398 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87413 atccatccatccatccatcc 87394 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87409 atccatccatccatccatcc 87390 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87405 atccatccatccatccatcc 87386 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87349 atccatccatccatccatcc 87330 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87345 atccatccatccatccatcc 87326 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87341 atccatccatccatccatcc 87322 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87090 atccatccatccatccatcc 87071 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87058 atccatccatccatccatcc 87039
>emb|BX663530.7| Chicken DNA sequence from clone WAG-52G8, complete sequence Length = 123203 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 28363 atccatccatccatccatcctcc 28385 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 11374 atccatccatccatccatcctcc 11352 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86521 atccatccatccatccatcc 86540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86517 atccatccatccatccatcc 86536 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86513 atccatccatccatccatcc 86532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86509 atccatccatccatccatcc 86528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86505 atccatccatccatccatcc 86524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86501 atccatccatccatccatcc 86520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86497 atccatccatccatccatcc 86516 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86493 atccatccatccatccatcc 86512 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86489 atccatccatccatccatcc 86508 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79819 atccatccatccatccatcc 79800 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79815 atccatccatccatccatcc 79796 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79811 atccatccatccatccatcc 79792 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79807 atccatccatccatccatcc 79788 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79803 atccatccatccatccatcc 79784 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79799 atccatccatccatccatcc 79780 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79795 atccatccatccatccatcc 79776 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79791 atccatccatccatccatcc 79772 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79787 atccatccatccatccatcc 79768 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79783 atccatccatccatccatcc 79764 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79779 atccatccatccatccatcc 79760 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 79775 atccatccatccatccatcc 79756 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28359 atccatccatccatccatcc 28378 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28355 atccatccatccatccatcc 28374 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28351 atccatccatccatccatcc 28370 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28347 atccatccatccatccatcc 28366 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28343 atccatccatccatccatcc 28362 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28339 atccatccatccatccatcc 28358 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11410 atccatccatccatccatcc 11391 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11406 atccatccatccatccatcc 11387 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11402 atccatccatccatccatcc 11383 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11398 atccatccatccatccatcc 11379 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11394 atccatccatccatccatcc 11375 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11390 atccatccatccatccatcc 11371 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11386 atccatccatccatccatcc 11367 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11382 atccatccatccatccatcc 11363 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11378 atccatccatccatccatcc 11359
>emb|BX663527.6| Chicken DNA sequence from clone WAG-112A23, complete sequence Length = 111067 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 87170 atccatccatccatccatcctcc 87148 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 18 cagcgatccatccatccatccatcc 42 |||| |||||||||||||||||||| Sbjct: 46019 cagccatccatccatccatccatcc 46043 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87202 atccatccatccatccatcc 87183 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87198 atccatccatccatccatcc 87179 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87194 atccatccatccatccatcc 87175 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87190 atccatccatccatccatcc 87171 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87186 atccatccatccatccatcc 87167 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87182 atccatccatccatccatcc 87163 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87178 atccatccatccatccatcc 87159 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87174 atccatccatccatccatcc 87155 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 46036 atccatccatccatccatcc 46055 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 46032 atccatccatccatccatcc 46051 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 46028 atccatccatccatccatcc 46047 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7779 atccatccatccatccatcc 7798 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7775 atccatccatccatccatcc 7794 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7771 atccatccatccatccatcc 7790 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7767 atccatccatccatccatcc 7786 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7763 atccatccatccatccatcc 7782 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7759 atccatccatccatccatcc 7778 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7755 atccatccatccatccatcc 7774 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7751 atccatccatccatccatcc 7770 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7747 atccatccatccatccatcc 7766
>gb|AC157497.3| Pan troglodytes BAC clone CH251-490K17 from chromosome unknown, complete sequence Length = 207664 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 87054 atccatccatccatccatcctcc 87076 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 86886 atccatccatccatccatcctcc 86908 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 86574 atccatccatccatccatcctcc 86596 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 86942 atccatccatccatccatcctc 86963 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 86774 atccatccatccatccatcctc 86795 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 86694 atccatccatccatccatcct 86714 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87134 atccatccatccatccatcc 87153 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87130 atccatccatccatccatcc 87149 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87050 atccatccatccatccatcc 87069 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86938 atccatccatccatccatcc 86957 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86934 atccatccatccatccatcc 86953 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86930 atccatccatccatccatcc 86949 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86926 atccatccatccatccatcc 86945 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86922 atccatccatccatccatcc 86941 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86918 atccatccatccatccatcc 86937 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86914 atccatccatccatccatcc 86933 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86882 atccatccatccatccatcc 86901 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86770 atccatccatccatccatcc 86789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86766 atccatccatccatccatcc 86785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86762 atccatccatccatccatcc 86781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86758 atccatccatccatccatcc 86777 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86690 atccatccatccatccatcc 86709 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86686 atccatccatccatccatcc 86705 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86682 atccatccatccatccatcc 86701 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86678 atccatccatccatccatcc 86697 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86674 atccatccatccatccatcc 86693 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86570 atccatccatccatccatcc 86589
>gb|AC154733.2| Mus musculus BAC clone RP24-380I6 from chromosome 13, complete sequence Length = 209751 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 126173 atccatccatccatccatcctcc 126195 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 129769 atccatccatccatccatcct 129749 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 126137 atccatccatccatccatcct 126157 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129773 atccatccatccatccatcc 129754 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129741 atccatccatccatccatcc 129722 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129737 atccatccatccatccatcc 129718 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129733 atccatccatccatccatcc 129714 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129729 atccatccatccatccatcc 129710 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129725 atccatccatccatccatcc 129706 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129721 atccatccatccatccatcc 129702 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 129717 atccatccatccatccatcc 129698 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126301 atccatccatccatccatcc 126320 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126297 atccatccatccatccatcc 126316 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126293 atccatccatccatccatcc 126312 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126289 atccatccatccatccatcc 126308 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126285 atccatccatccatccatcc 126304 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126281 atccatccatccatccatcc 126300 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126277 atccatccatccatccatcc 126296 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126245 atccatccatccatccatcc 126264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126241 atccatccatccatccatcc 126260 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126237 atccatccatccatccatcc 126256 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126233 atccatccatccatccatcc 126252 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126229 atccatccatccatccatcc 126248 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126225 atccatccatccatccatcc 126244 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126221 atccatccatccatccatcc 126240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126133 atccatccatccatccatcc 126152 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126129 atccatccatccatccatcc 126148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126097 atccatccatccatccatcc 126116 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126093 atccatccatccatccatcc 126112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126089 atccatccatccatccatcc 126108 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126085 atccatccatccatccatcc 126104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126081 atccatccatccatccatcc 126100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126077 atccatccatccatccatcc 126096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126045 atccatccatccatccatcc 126064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126041 atccatccatccatccatcc 126060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126037 atccatccatccatccatcc 126056 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126033 atccatccatccatccatcc 126052 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126029 atccatccatccatccatcc 126048 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126025 atccatccatccatccatcc 126044 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 24 tccatccatccatccatcctccac 47 |||||||||||||||||| ||||| Sbjct: 125975 tccatccatccatccatcatccac 125998
>gb|AC018802.8| Homo sapiens BAC clone RP11-315L16 from 2, complete sequence Length = 123993 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 99587 atccatccatccatccatcctcc 99565 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 99595 atccatccatccatccatcc 99576 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 99591 atccatccatccatccatcc 99572 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 99440 atccatccatccatccatcc 99421
>gb|AC013471.7| Homo sapiens BAC clone RP11-489A14 from 2, complete sequence Length = 145040 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 6227 atccatccatccatccatcctcc 6249 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6223 atccatccatccatccatcc 6242 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6219 atccatccatccatccatcc 6238 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6215 atccatccatccatccatcc 6234 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 6211 atccatccatccatccatcc 6230
>gb|AC113611.3| Homo sapiens BAC clone RP11-421M20 from 4, complete sequence Length = 60597 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 43060 atccatccatccatccatcctcc 43082 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43056 atccatccatccatccatcc 43075 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43052 atccatccatccatccatcc 43071 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33840 atccatccatccatccatcc 33859 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33836 atccatccatccatccatcc 33855 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33832 atccatccatccatccatcc 33851 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33828 atccatccatccatccatcc 33847 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33824 atccatccatccatccatcc 33843 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33820 atccatccatccatccatcc 33839 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33816 atccatccatccatccatcc 33835 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33812 atccatccatccatccatcc 33831 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33808 atccatccatccatccatcc 33827 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33804 atccatccatccatccatcc 33823 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33800 atccatccatccatccatcc 33819 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33796 atccatccatccatccatcc 33815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33792 atccatccatccatccatcc 33811 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33788 atccatccatccatccatcc 33807 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33784 atccatccatccatccatcc 33803 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33780 atccatccatccatccatcc 33799 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33776 atccatccatccatccatcc 33795 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33772 atccatccatccatccatcc 33791 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33768 atccatccatccatccatcc 33787 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33764 atccatccatccatccatcc 33783 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33760 atccatccatccatccatcc 33779 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33756 atccatccatccatccatcc 33775 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33752 atccatccatccatccatcc 33771 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33748 atccatccatccatccatcc 33767 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33744 atccatccatccatccatcc 33763 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33740 atccatccatccatccatcc 33759 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33736 atccatccatccatccatcc 33755
>gb|AC079587.4| Homo sapiens BAC clone RP11-245G13 from 2, complete sequence Length = 53801 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 32335 atccatccatccatccatcctcc 32357 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 32331 atccatccatccatccatcc 32350
>gb|AC097628.2| Takifugu rubripes clone 264E2, complete sequence Length = 88203 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 22 gatccatccatccatccatcctc 44 ||||||||||||||||||||||| Sbjct: 78199 gatccatccatccatccatcctc 78221 Score = 42.1 bits (21), Expect = 1.4 Identities = 24/25 (96%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctccac 47 ||||||||||||||||||| ||||| Sbjct: 8595 atccatccatccatccatcatccac 8619 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 8721 atccatccatccatccatcatcca 8744 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 8531 atccatccatccatccatcatcca 8554 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8527 atccatccatccatccatcc 8546 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 8523 atccatccatccatccatcc 8542
>gb|AC092758.3| Papio anubis clone RP41-22J16, complete sequence Length = 171690 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 31733 atccatccatccatccatcctcc 31755 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31729 atccatccatccatccatcc 31748 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31725 atccatccatccatccatcc 31744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31721 atccatccatccatccatcc 31740
>gb|AC068580.23| Homo sapiens chromosome 11, clone RP11-295K3, complete sequence Length = 120298 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 64355 tccatccatccatccatcctcca 64377 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccatccatccatcctcca 46 ||||||||||||||||||||| Sbjct: 63864 catccatccatccatcctcca 63884 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||| |||||||||||||||| Sbjct: 64392 atccatctatccatccatcctcca 64415 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||| |||||||||||||||| Sbjct: 64228 atccatctatccatccatcctcca 64251 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 63990 atccatccatccatccatcc 64009 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 |||||| ||||||||||||||||| Sbjct: 63952 atccattcatccatccatcctcca 63975
>gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, complete sequence Length = 167395 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 56832 atccatccatccatccatcctcc 56854 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 56716 atccatccatccatccatcctcc 56738 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56828 atccatccatccatccatcc 56847 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56712 atccatccatccatccatcc 56731 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56708 atccatccatccatccatcc 56727 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56704 atccatccatccatccatcc 56723 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56700 atccatccatccatccatcc 56719 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56696 atccatccatccatccatcc 56715 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56692 atccatccatccatccatcc 56711 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56688 atccatccatccatccatcc 56707 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 56684 atccatccatccatccatcc 56703 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26803 atccatccatccatccatcc 26784 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26799 atccatccatccatccatcc 26780 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26795 atccatccatccatccatcc 26776 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26791 atccatccatccatccatcc 26772 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26787 atccatccatccatccatcc 26768 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 26313 atccatccatccatccatcc 26294
>gb|AC018552.6| Homo sapiens chromosome 16 clone RP11-405F3, complete sequence Length = 152156 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 34699 atccatccatccatccatcctcc 34677 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 ccatccatccatccatcctcc 45 ||||||||||||||||||||| Sbjct: 34439 ccatccatccatccatcctcc 34419 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147998 atccatccatccatccatcc 147979 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147994 atccatccatccatccatcc 147975 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147990 atccatccatccatccatcc 147971 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147986 atccatccatccatccatcc 147967 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 147982 atccatccatccatccatcc 147963 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10406 atccatccatccatccatcc 10425 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10402 atccatccatccatccatcc 10421 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10043 atccatccatccatccatcc 10062 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 9948 atccatccatccatccatcc 9967 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 9784 atccatccatccatccatcc 9803
>gb|AF221943.1|AF221943 Homo sapiens leukotriene B4 omega hydroxylase (CYP4F2) gene, exons 1 through 5 and partial cds; CYP4F3 gene, exon 4 Length = 6740 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcct 43 ||||||||||||||||||||||| Sbjct: 2595 cgatccatccatccatccatcct 2573 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2500 atccatccatccatccatcc 2481
>gb|AC108448.12| Homo sapiens chromosome 11, clone CTD-2544D21, complete sequence Length = 198599 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 92782 atccatccatccatccatcctcc 92804 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176047 atccatccatccatccatcc 176066 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176043 atccatccatccatccatcc 176062 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176039 atccatccatccatccatcc 176058 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176035 atccatccatccatccatcc 176054 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176031 atccatccatccatccatcc 176050 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176027 atccatccatccatccatcc 176046 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176023 atccatccatccatccatcc 176042 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 176019 atccatccatccatccatcc 176038 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175995 atccatccatccatccatcc 176014 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175991 atccatccatccatccatcc 176010 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175987 atccatccatccatccatcc 176006 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175983 atccatccatccatccatcc 176002 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175907 atccatccatccatccatcc 175926 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175903 atccatccatccatccatcc 175922 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175899 atccatccatccatccatcc 175918 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175895 atccatccatccatccatcc 175914 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 175891 atccatccatccatccatcc 175910 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93097 atccatccatccatccatcc 93116 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93093 atccatccatccatccatcc 93112 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93089 atccatccatccatccatcc 93108 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93085 atccatccatccatccatcc 93104 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93081 atccatccatccatccatcc 93100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93077 atccatccatccatccatcc 93096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93021 atccatccatccatccatcc 93040 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93017 atccatccatccatccatcc 93036 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93013 atccatccatccatccatcc 93032 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93009 atccatccatccatccatcc 93028 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93005 atccatccatccatccatcc 93024 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 93001 atccatccatccatccatcc 93020 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92997 atccatccatccatccatcc 93016 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92925 atccatccatccatccatcc 92944 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92837 atccatccatccatccatcc 92856 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92778 atccatccatccatccatcc 92797 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92774 atccatccatccatccatcc 92793 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92770 atccatccatccatccatcc 92789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92766 atccatccatccatccatcc 92785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92631 atccatccatccatccatcc 92650 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92595 atccatccatccatccatcc 92614 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92449 atccatccatccatccatcc 92468 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 92413 atccatccatccatccatcc 92432 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85903 atccatccatccatccatcc 85884 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 85899 atccatccatccatccatcc 85880
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 368 gggcgacttcgacggcgacggcg 390 ||||||||||||||||||||||| Sbjct: 4416653 gggcgacttcgacggcgacggcg 4416631 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 368 gggcgacttcgacggcgacggcg 390 ||||||||||||||||||||||| Sbjct: 3657294 gggcgacttcgacggcgacggcg 3657272 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 368 gggcgacttcgacggcgacggcg 390 ||||||||||||||||||||||| Sbjct: 1443097 gggcgacttcgacggcgacggcg 1443119 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 367 agggcgacttcgacggcgacggcg 390 ||||||| |||||||||||||||| Sbjct: 3657739 agggcgatttcgacggcgacggcg 3657716 Score = 40.1 bits (20), Expect = 5.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 363 gccgagggcgacttcgacggcgacggcg 390 |||| ||||||| ||||||||||||||| Sbjct: 1009922 gccgtgggcgacctcgacggcgacggcg 1009895
>dbj|AP004989.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B1153E06 Length = 174588 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 109793 atccatccatccatccatcctcc 109815 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109789 atccatccatccatccatcc 109808
>dbj|AP003728.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0710B08 Length = 186991 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 63047 atccatccatccatccatcctcc 63069 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 63043 atccatccatccatccatcc 63062
>emb|BX663534.4| Chicken DNA sequence from clone WAG-58B13, complete sequence Length = 67055 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 64752 atccatccatccatccatcctcc 64730 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 42752 atccatccatccatccatcctcc 42774 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64780 atccatccatccatccatcc 64761 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64776 atccatccatccatccatcc 64757 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64772 atccatccatccatccatcc 64753 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64768 atccatccatccatccatcc 64749 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64764 atccatccatccatccatcc 64745 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64760 atccatccatccatccatcc 64741 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64756 atccatccatccatccatcc 64737 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42748 atccatccatccatccatcc 42767 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20922 atccatccatccatccatcc 20903 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20918 atccatccatccatccatcc 20899 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20914 atccatccatccatccatcc 20895 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20910 atccatccatccatccatcc 20891 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20906 atccatccatccatccatcc 20887 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20902 atccatccatccatccatcc 20883 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7068 atccatccatccatccatcc 7087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7064 atccatccatccatccatcc 7083 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7060 atccatccatccatccatcc 7079 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7056 atccatccatccatccatcc 7075 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7052 atccatccatccatccatcc 7071 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7048 atccatccatccatccatcc 7067 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7044 atccatccatccatccatcc 7063
>gb|AC158669.3| Mus musculus 6 BAC RP23-66K6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 242779 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 132838 atccatccatccatccatcctcc 132860 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 132834 atccatccatccatccatcc 132853 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 132830 atccatccatccatccatcc 132849 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 132826 atccatccatccatccatcc 132845 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 132794 atccatccatccatccatcc 132813
>emb|AL772132.6| Zebrafish DNA sequence from clone CH211-196N11, complete sequence Length = 205802 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 165742 atccatccatccatccatcctcc 165764 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 165738 atccatccatccatccatcc 165757 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 165734 atccatccatccatccatcc 165753 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43222 atccatccatccatccatcc 43203 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43218 atccatccatccatccatcc 43199 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43214 atccatccatccatccatcc 43195 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43210 atccatccatccatccatcc 43191 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42909 atccatccatccatccatcc 42890 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42905 atccatccatccatccatcc 42886 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33054 atccatccatccatccatcc 33035 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33050 atccatccatccatccatcc 33031
>emb|BX247945.6| Zebrafish DNA sequence from clone CH211-209L14 in linkage group 24, complete sequence Length = 199345 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 167129 atccatccatccatccatcctcc 167107 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 167053 gatccatccatccatccatcc 167033 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 166912 gatccatccatccatccatcc 166892 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167149 atccatccatccatccatcc 167130 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167145 atccatccatccatccatcc 167126 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167141 atccatccatccatccatcc 167122 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167137 atccatccatccatccatcc 167118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167133 atccatccatccatccatcc 167114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167048 atccatccatccatccatcc 167029 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167044 atccatccatccatccatcc 167025 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167040 atccatccatccatccatcc 167021 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167036 atccatccatccatccatcc 167017 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167032 atccatccatccatccatcc 167013 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167028 atccatccatccatccatcc 167009 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167024 atccatccatccatccatcc 167005 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167020 atccatccatccatccatcc 167001 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167016 atccatccatccatccatcc 166997 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167012 atccatccatccatccatcc 166993 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167008 atccatccatccatccatcc 166989 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167004 atccatccatccatccatcc 166985 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 167000 atccatccatccatccatcc 166981 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166996 atccatccatccatccatcc 166977 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166907 atccatccatccatccatcc 166888 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166903 atccatccatccatccatcc 166884 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166899 atccatccatccatccatcc 166880 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166895 atccatccatccatccatcc 166876
>gb|AC155305.2| Mus musculus BAC clone RP24-182I21 from 12, complete sequence Length = 172724 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 66860 atccatccatccatccatcctcc 66882 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66856 atccatccatccatccatcc 66875 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66852 atccatccatccatccatcc 66871 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66848 atccatccatccatccatcc 66867 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66844 atccatccatccatccatcc 66863 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66840 atccatccatccatccatcc 66859 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66836 atccatccatccatccatcc 66855 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66832 atccatccatccatccatcc 66851 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66828 atccatccatccatccatcc 66847 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66824 atccatccatccatccatcc 66843 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 66796 atccatccatccatccatcc 66815
>emb|BX950197.23| Zebrafish DNA sequence from clone CH211-123N8 in linkage group 10, complete sequence Length = 155683 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 45862 atccatccatccatccatcctcc 45884 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 45514 cgatccatccatccatccatcc 45535 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 81319 atccatccatccatccatcct 81339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81211 atccatccatccatccatcc 81230 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81207 atccatccatccatccatcc 81226 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81203 atccatccatccatccatcc 81222 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81161 atccatccatccatccatcc 81180 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81157 atccatccatccatccatcc 81176 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81153 atccatccatccatccatcc 81172 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81149 atccatccatccatccatcc 81168 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81145 atccatccatccatccatcc 81164 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81141 atccatccatccatccatcc 81160 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81137 atccatccatccatccatcc 81156 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81133 atccatccatccatccatcc 81152 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81129 atccatccatccatccatcc 81148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 81125 atccatccatccatccatcc 81144 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45640 atccatccatccatccatcc 45659 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45636 atccatccatccatccatcc 45655 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45632 atccatccatccatccatcc 45651 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45628 atccatccatccatccatcc 45647 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45624 atccatccatccatccatcc 45643 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45620 atccatccatccatccatcc 45639 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45616 atccatccatccatccatcc 45635 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45612 atccatccatccatccatcc 45631 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45608 atccatccatccatccatcc 45627 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45604 atccatccatccatccatcc 45623 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45600 atccatccatccatccatcc 45619 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45596 atccatccatccatccatcc 45615 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45592 atccatccatccatccatcc 45611 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45588 atccatccatccatccatcc 45607 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45584 atccatccatccatccatcc 45603 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45580 atccatccatccatccatcc 45599 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45576 atccatccatccatccatcc 45595 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45572 atccatccatccatccatcc 45591 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45568 atccatccatccatccatcc 45587 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45564 atccatccatccatccatcc 45583 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45560 atccatccatccatccatcc 45579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 45556 atccatccatccatccatcc 45575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 43018 atccatccatccatccatcc 43037 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42811 atccatccatccatccatcc 42830 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42807 atccatccatccatccatcc 42826 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42803 atccatccatccatccatcc 42822 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42799 atccatccatccatccatcc 42818 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42795 atccatccatccatccatcc 42814 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42791 atccatccatccatccatcc 42810 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42787 atccatccatccatccatcc 42806 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42783 atccatccatccatccatcc 42802 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42779 atccatccatccatccatcc 42798 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42775 atccatccatccatccatcc 42794 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42771 atccatccatccatccatcc 42790 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42767 atccatccatccatccatcc 42786 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42763 atccatccatccatccatcc 42782 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42759 atccatccatccatccatcc 42778 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42735 atccatccatccatccatcc 42754 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 42731 atccatccatccatccatcc 42750
>gb|AC151716.5| Mus musculus BAC clone RP23-316A23 from 5, complete sequence Length = 193466 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 190009 atccatccatccatccatcctcc 190031 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190112 atccatccatccatccatcc 190131 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190108 atccatccatccatccatcc 190127 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190005 atccatccatccatccatcc 190024 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189878 atccatccatccatccatcc 189897 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189874 atccatccatccatccatcc 189893 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189870 atccatccatccatccatcc 189889 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189866 atccatccatccatccatcc 189885 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189862 atccatccatccatccatcc 189881 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189738 atccatccatccatccatcc 189757 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 18577 atccatccatccatccatcc 18558
>emb|AL954149.19| Zebrafish DNA sequence from clone CH211-146G19 in linkage group 2, complete sequence Length = 163971 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 56770 atccatccatccatccatcctcc 56792 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58573 atccatccatccatccatcc 58592 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58569 atccatccatccatccatcc 58588 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58565 atccatccatccatccatcc 58584 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58561 atccatccatccatccatcc 58580 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58557 atccatccatccatccatcc 58576 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 58284 atccatccatccatccatcc 58303 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57283 atccatccatccatccatcc 57302 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57279 atccatccatccatccatcc 57298 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57275 atccatccatccatccatcc 57294 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57271 atccatccatccatccatcc 57290 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57267 atccatccatccatccatcc 57286 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57263 atccatccatccatccatcc 57282 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57259 atccatccatccatccatcc 57278 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57255 atccatccatccatccatcc 57274 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57251 atccatccatccatccatcc 57270 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57247 atccatccatccatccatcc 57266 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57065 atccatccatccatccatcc 57084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57061 atccatccatccatccatcc 57080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57057 atccatccatccatccatcc 57076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57053 atccatccatccatccatcc 57072 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57049 atccatccatccatccatcc 57068 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57045 atccatccatccatccatcc 57064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57041 atccatccatccatccatcc 57060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 57037 atccatccatccatccatcc 57056 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 56711 atccatccatccatccatcatcca 56734 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 54688 atccatccatccatccatcc 54707 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 54684 atccatccatccatccatcc 54703 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 54680 atccatccatccatccatcc 54699 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 54621 atccatccatccatccatcatcca 54644
>emb|BX247899.17| Zebrafish DNA sequence from clone CH211-229B6 in linkage group 19, complete sequence Length = 150160 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 15306 atccatccatccatccatcctcc 15284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15334 atccatccatccatccatcc 15315 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15330 atccatccatccatccatcc 15311 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15326 atccatccatccatccatcc 15307 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15322 atccatccatccatccatcc 15303 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15318 atccatccatccatccatcc 15299 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15314 atccatccatccatccatcc 15295 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 15310 atccatccatccatccatcc 15291
>emb|BX465846.14| Zebrafish DNA sequence from clone CH211-215B21 in linkage group 18, complete sequence Length = 109342 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 96203 atccatccatccatccatcctcc 96225 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 103330 atccatccatccatccatcct 103310 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 103059 atccatccatccatccatcct 103039 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 102798 atccatccatccatccatcct 102778 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102498 atccatccatccatccatcc 102479 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 102494 atccatccatccatccatcc 102475 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22078 atccatccatccatccatcc 22097 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22074 atccatccatccatccatcc 22093
>emb|BX004834.13| Zebrafish DNA sequence from clone CH211-42E22 in linkage group 18, complete sequence Length = 188895 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 4952 atccatccatccatccatcctcc 4974 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5081 atccatccatccatccatcc 5100 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5077 atccatccatccatccatcc 5096 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5073 atccatccatccatccatcc 5092 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5069 atccatccatccatccatcc 5088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5065 atccatccatccatccatcc 5084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5061 atccatccatccatccatcc 5080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5057 atccatccatccatccatcc 5076 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5053 atccatccatccatccatcc 5072 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5049 atccatccatccatccatcc 5068 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5045 atccatccatccatccatcc 5064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5041 atccatccatccatccatcc 5060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5037 atccatccatccatccatcc 5056 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5033 atccatccatccatccatcc 5052 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5029 atccatccatccatccatcc 5048 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5025 atccatccatccatccatcc 5044 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5021 atccatccatccatccatcc 5040 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5017 atccatccatccatccatcc 5036 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5013 atccatccatccatccatcc 5032 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5009 atccatccatccatccatcc 5028 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5005 atccatccatccatccatcc 5024 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 5001 atccatccatccatccatcc 5020 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 4997 atccatccatccatccatcc 5016
>emb|BX323558.7| Zebrafish DNA sequence from clone CH211-214J24 in linkage group 4, complete sequence Length = 160379 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 2759 atccatccatccatccatcctcc 2737 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3677 atccatccatccatccatcc 3658 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3673 atccatccatccatccatcc 3654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3669 atccatccatccatccatcc 3650 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3665 atccatccatccatccatcc 3646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3661 atccatccatccatccatcc 3642 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2871 atccatccatccatccatcc 2852 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2867 atccatccatccatccatcc 2848 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2863 atccatccatccatccatcc 2844 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2859 atccatccatccatccatcc 2840 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2855 atccatccatccatccatcc 2836 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2851 atccatccatccatccatcc 2832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2847 atccatccatccatccatcc 2828 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2843 atccatccatccatccatcc 2824 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 2839 atccatccatccatccatcc 2820
>emb|BX005185.5| Zebrafish DNA sequence from clone CH211-132N11 in linkage group 24, complete sequence Length = 164521 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 24953 atccatccatccatccatcctcc 24931 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 24877 gatccatccatccatccatcc 24857 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 24736 gatccatccatccatccatcc 24716 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87553 atccatccatccatccatcc 87534 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87549 atccatccatccatccatcc 87530 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87545 atccatccatccatccatcc 87526 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87541 atccatccatccatccatcc 87522 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83926 atccatccatccatccatcc 83907 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83922 atccatccatccatccatcc 83903 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83918 atccatccatccatccatcc 83899 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83914 atccatccatccatccatcc 83895 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83910 atccatccatccatccatcc 83891 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83906 atccatccatccatccatcc 83887 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83902 atccatccatccatccatcc 83883 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83761 atccatccatccatccatcc 83742 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83153 atccatccatccatccatcc 83134 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83149 atccatccatccatccatcc 83130 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83145 atccatccatccatccatcc 83126 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83141 atccatccatccatccatcc 83122 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83137 atccatccatccatccatcc 83118 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83133 atccatccatccatccatcc 83114 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83129 atccatccatccatccatcc 83110 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83125 atccatccatccatccatcc 83106 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83121 atccatccatccatccatcc 83102 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83117 atccatccatccatccatcc 83098 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83113 atccatccatccatccatcc 83094 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83109 atccatccatccatccatcc 83090 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 83105 atccatccatccatccatcc 83086 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24977 atccatccatccatccatcc 24958 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24973 atccatccatccatccatcc 24954 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24969 atccatccatccatccatcc 24950 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24965 atccatccatccatccatcc 24946 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24961 atccatccatccatccatcc 24942 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24957 atccatccatccatccatcc 24938 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24872 atccatccatccatccatcc 24853 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24868 atccatccatccatccatcc 24849 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24864 atccatccatccatccatcc 24845 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24860 atccatccatccatccatcc 24841 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24856 atccatccatccatccatcc 24837 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24852 atccatccatccatccatcc 24833 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24848 atccatccatccatccatcc 24829 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24844 atccatccatccatccatcc 24825 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24840 atccatccatccatccatcc 24821 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24836 atccatccatccatccatcc 24817 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24832 atccatccatccatccatcc 24813 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24828 atccatccatccatccatcc 24809 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24824 atccatccatccatccatcc 24805 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24820 atccatccatccatccatcc 24801 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24731 atccatccatccatccatcc 24712 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24727 atccatccatccatccatcc 24708 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24723 atccatccatccatccatcc 24704 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 24719 atccatccatccatccatcc 24700
>emb|CR925790.6| Zebrafish DNA sequence from clone DKEY-275J21 in linkage group 10, complete sequence Length = 136117 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 22335 atccatccatccatccatcctcc 22313 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22355 atccatccatccatccatcc 22336 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22351 atccatccatccatccatcc 22332 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22347 atccatccatccatccatcc 22328 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22343 atccatccatccatccatcc 22324 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22339 atccatccatccatccatcc 22320 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22311 atccatccatccatccatcc 22292 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22307 atccatccatccatccatcc 22288 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22303 atccatccatccatccatcc 22284 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22299 atccatccatccatccatcc 22280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22295 atccatccatccatccatcc 22276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22291 atccatccatccatccatcc 22272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22287 atccatccatccatccatcc 22268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22283 atccatccatccatccatcc 22264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22279 atccatccatccatccatcc 22260 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22275 atccatccatccatccatcc 22256 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22271 atccatccatccatccatcc 22252 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22267 atccatccatccatccatcc 22248 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22263 atccatccatccatccatcc 22244 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22259 atccatccatccatccatcc 22240 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22255 atccatccatccatccatcc 22236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22251 atccatccatccatccatcc 22232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22247 atccatccatccatccatcc 22228 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22243 atccatccatccatccatcc 22224 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22239 atccatccatccatccatcc 22220 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22235 atccatccatccatccatcc 22216 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22231 atccatccatccatccatcc 22212 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22227 atccatccatccatccatcc 22208 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 22223 atccatccatccatccatcc 22204
>gb|AF063674.1|MMCOLLAG09 Mus musculus type XIII collagen (col13a1) gene, exon 9 Length = 217 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 60 tccatccatccatccatcctcca 38
>emb|AL512547.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0812A04, complete sequence Length = 43144 Score = 46.1 bits (23), Expect = 0.092 Identities = 26/27 (96%) Strand = Plus / Minus Query: 16 agcagcgatccatccatccatccatcc 42 ||||||||| ||||||||||||||||| Sbjct: 14635 agcagcgattcatccatccatccatcc 14609
>gb|AC007759.1|AC007759 Homo sapiens chromosome 19, cosmid R27714, complete sequence Length = 40331 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 20311 atccatccatccatccatcctcc 20333
>gb|AE003561.3| Drosophila melanogaster chromosome 3L, section 24 of 83 of the complete sequence Length = 274289 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 120345 atccatccatccatccatcctcc 120323
>gb|AC108805.15| Mus musculus chromosome 9, clone RP23-226G13, complete sequence Length = 242531 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 69446 atccatccatccatccatcctcc 69424 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69474 atccatccatccatccatcc 69455 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69470 atccatccatccatccatcc 69451 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69466 atccatccatccatccatcc 69447 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69462 atccatccatccatccatcc 69443 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69458 atccatccatccatccatcc 69439 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69454 atccatccatccatccatcc 69435 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69450 atccatccatccatccatcc 69431
>gb|AC113464.17| Mus musculus chromosome 8, clone RP23-183P1, complete sequence Length = 191444 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 10677 atccatccatccatccatcctcc 10655 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10697 atccatccatccatccatcc 10678 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10693 atccatccatccatccatcc 10674 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10689 atccatccatccatccatcc 10670 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10685 atccatccatccatccatcc 10666 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10681 atccatccatccatccatcc 10662 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10653 atccatccatccatccatcc 10634 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10649 atccatccatccatccatcc 10630 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10645 atccatccatccatccatcc 10626 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10641 atccatccatccatccatcc 10622 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10637 atccatccatccatccatcc 10618 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10633 atccatccatccatccatcc 10614 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 10629 atccatccatccatccatcc 10610
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence Length = 230278 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 48981 atccatccatccatccatcctcc 49003
>gb|AC153639.4| Mus musculus 6 BAC RP23-124H2 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 190211 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 155013 atccatccatccatccatcctcc 154991 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155057 atccatccatccatccatcc 155038 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155025 atccatccatccatccatcc 155006 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155021 atccatccatccatccatcc 155002 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 155017 atccatccatccatccatcc 154998
>gb|AC005619.1|AC005619 Homo sapiens chromosome 19, cosmid R34241, complete sequence Length = 45746 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 33095 atccatccatccatccatcctcc 33073 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33470 atccatccatccatccatcc 33451 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33142 atccatccatccatccatcc 33123 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33138 atccatccatccatccatcc 33119 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33111 atccatccatccatccatcc 33092 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33107 atccatccatccatccatcc 33088 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33103 atccatccatccatccatcc 33084 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 33099 atccatccatccatccatcc 33080 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21255 atccatccatccatccatcc 21236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21251 atccatccatccatccatcc 21232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21247 atccatccatccatccatcc 21228 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21243 atccatccatccatccatcc 21224 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21239 atccatccatccatccatcc 21220 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21235 atccatccatccatccatcc 21216 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21231 atccatccatccatccatcc 21212 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21175 atccatccatccatccatcc 21156 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21171 atccatccatccatccatcc 21152 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21167 atccatccatccatccatcc 21148 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21163 atccatccatccatccatcc 21144 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21011 atccatccatccatccatcc 20992 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21007 atccatccatccatccatcc 20988 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 21003 atccatccatccatccatcc 20984 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20999 atccatccatccatccatcc 20980
>emb|AL161645.14| Human DNA sequence from clone RP11-108K14 on chromosome 10 Contains the 3' end of a novel gene (LOC92170) (FLJ90495, FLJ39553), three novel genes, the CYP2E1 gene for family 2 subfamily E polypeptide 1 cytochrome P450, a novel gene (LOC93426), the 3' end of a olfactory receptor protein pseudogene and eight CpG islands, complete sequence Length = 161644 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 121561 tccatccatccatccatcctcca 121539 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121083 atccatccatccatccatcc 121064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121079 atccatccatccatccatcc 121060 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 121075 atccatccatccatccatcc 121056
>gb|AC167333.3| Mus musculus BAC clone RP23-92L4 from chromosome 5, complete sequence Length = 236596 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 154817 atccatccatccatccatcctcc 154839 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154813 atccatccatccatccatcc 154832 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154809 atccatccatccatccatcc 154828 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154805 atccatccatccatccatcc 154824 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154801 atccatccatccatccatcc 154820 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154797 atccatccatccatccatcc 154816 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154793 atccatccatccatccatcc 154812 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154789 atccatccatccatccatcc 154808 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11279 atccatccatccatccatcc 11298 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11275 atccatccatccatccatcc 11294 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11271 atccatccatccatccatcc 11290 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11267 atccatccatccatccatcc 11286
>gb|AC138620.4| Mus musculus BAC clone RP23-250E1 from 6, complete sequence Length = 209846 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 84029 atccatccatccatccatcctcc 84007 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 84058 gatccatccatccatccatcc 84038 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146974 atccatccatccatccatcc 146993 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146970 atccatccatccatccatcc 146989 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146966 atccatccatccatccatcc 146985 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146962 atccatccatccatccatcc 146981 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146958 atccatccatccatccatcc 146977 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146954 atccatccatccatccatcc 146973 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146950 atccatccatccatccatcc 146969 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146946 atccatccatccatccatcc 146965 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146942 atccatccatccatccatcc 146961 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84053 atccatccatccatccatcc 84034 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84049 atccatccatccatccatcc 84030 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84045 atccatccatccatccatcc 84026 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84041 atccatccatccatccatcc 84022 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84037 atccatccatccatccatcc 84018 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 84033 atccatccatccatccatcc 84014
>gb|AC122315.5| Mus musculus BAC clone RP23-302P6 from 10, complete sequence Length = 197288 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 103 tccatccatccatccatcctcca 81 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163363 atccatccatccatccatcc 163344 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163359 atccatccatccatccatcc 163340 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118618 atccatccatccatccatcc 118599 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118614 atccatccatccatccatcc 118595 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118610 atccatccatccatccatcc 118591 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118606 atccatccatccatccatcc 118587 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118602 atccatccatccatccatcc 118583 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118598 atccatccatccatccatcc 118579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118594 atccatccatccatccatcc 118575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118590 atccatccatccatccatcc 118571 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118493 atccatccatccatccatcc 118474 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118489 atccatccatccatccatcc 118470 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118485 atccatccatccatccatcc 118466 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118481 atccatccatccatccatcc 118462 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118477 atccatccatccatccatcc 118458 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118473 atccatccatccatccatcc 118454 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118469 atccatccatccatccatcc 118450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118465 atccatccatccatccatcc 118446
>emb|CR956367.12| Pig DNA sequence from clone PigE-122C21 on chromosome 17, complete sequence Length = 124577 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 25 ccatccatccatccatcctccac 47 ||||||||||||||||||||||| Sbjct: 1526 ccatccatccatccatcctccac 1548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 atccatccatccatcctcca 46 |||||||||||||||||||| Sbjct: 1497 atccatccatccatcctcca 1516
>dbj|AP003071.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-554A11, complete sequence Length = 191898 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 30916 atccatccatccatccatcctcc 30938 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125533 atccatccatccatccatcc 125552 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125529 atccatccatccatccatcc 125548 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125525 atccatccatccatccatcc 125544 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125521 atccatccatccatccatcc 125540 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125517 atccatccatccatccatcc 125536 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125513 atccatccatccatccatcc 125532 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125509 atccatccatccatccatcc 125528 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125505 atccatccatccatccatcc 125524 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125501 atccatccatccatccatcc 125520 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125497 atccatccatccatccatcc 125516 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125493 atccatccatccatccatcc 125512 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125469 atccatccatccatccatcc 125488 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125465 atccatccatccatccatcc 125484 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125461 atccatccatccatccatcc 125480 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125457 atccatccatccatccatcc 125476 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125453 atccatccatccatccatcc 125472 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125449 atccatccatccatccatcc 125468 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125445 atccatccatccatccatcc 125464 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125417 atccatccatccatccatcc 125436 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125413 atccatccatccatccatcc 125432 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125409 atccatccatccatccatcc 125428 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125261 atccatccatccatccatcc 125280 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125257 atccatccatccatccatcc 125276 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125253 atccatccatccatccatcc 125272 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125249 atccatccatccatccatcc 125268 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125245 atccatccatccatccatcc 125264 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125241 atccatccatccatccatcc 125260 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 125045 atccatccatccatccatcc 125064 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 124989 atccatccatccatccatcc 125008 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 124953 atccatccatccatccatcc 124972 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 124913 atccatccatccatccatcc 124932 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 124909 atccatccatccatccatcc 124928 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 124905 atccatccatccatccatcc 124924 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 124901 atccatccatccatccatcc 124920 Score = 40.1 bits (20), Expect = 5.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcca 46 ||||||||||||||||||| |||| Sbjct: 31364 atccatccatccatccatcatcca 31387 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31360 atccatccatccatccatcc 31379 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31356 atccatccatccatccatcc 31375 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31352 atccatccatccatccatcc 31371 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31348 atccatccatccatccatcc 31367 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31320 atccatccatccatccatcc 31339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31316 atccatccatccatccatcc 31335 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31312 atccatccatccatccatcc 31331 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31308 atccatccatccatccatcc 31327 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31304 atccatccatccatccatcc 31323 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31300 atccatccatccatccatcc 31319 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31296 atccatccatccatccatcc 31315 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31228 atccatccatccatccatcc 31247 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31224 atccatccatccatccatcc 31243 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31220 atccatccatccatccatcc 31239 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31216 atccatccatccatccatcc 31235 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31212 atccatccatccatccatcc 31231 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31208 atccatccatccatccatcc 31227 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31204 atccatccatccatccatcc 31223 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31140 atccatccatccatccatcc 31159 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31136 atccatccatccatccatcc 31155 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31132 atccatccatccatccatcc 31151 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31128 atccatccatccatccatcc 31147 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31124 atccatccatccatccatcc 31143 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31120 atccatccatccatccatcc 31139 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31068 atccatccatccatccatcc 31087 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31064 atccatccatccatccatcc 31083 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31032 atccatccatccatccatcc 31051 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 31028 atccatccatccatccatcc 31047 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 30912 atccatccatccatccatcc 30931
>emb|AL929508.6| Zebrafish DNA sequence from clone CH211-158G13, complete sequence Length = 180029 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 173805 atccatccatccatccatcctcc 173783 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173885 atccatccatccatccatcc 173866 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173881 atccatccatccatccatcc 173862 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173877 atccatccatccatccatcc 173858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173873 atccatccatccatccatcc 173854 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173869 atccatccatccatccatcc 173850 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173865 atccatccatccatccatcc 173846 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173861 atccatccatccatccatcc 173842 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173857 atccatccatccatccatcc 173838 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173853 atccatccatccatccatcc 173834 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173849 atccatccatccatccatcc 173830 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173845 atccatccatccatccatcc 173826 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173841 atccatccatccatccatcc 173822 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173837 atccatccatccatccatcc 173818 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173833 atccatccatccatccatcc 173814 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173829 atccatccatccatccatcc 173810 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173825 atccatccatccatccatcc 173806 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173821 atccatccatccatccatcc 173802 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173817 atccatccatccatccatcc 173798 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173813 atccatccatccatccatcc 173794 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173809 atccatccatccatccatcc 173790 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173681 atccatccatccatccatcc 173662 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173677 atccatccatccatccatcc 173658 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173673 atccatccatccatccatcc 173654 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173669 atccatccatccatccatcc 173650 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173665 atccatccatccatccatcc 173646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173661 atccatccatccatccatcc 173642 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173657 atccatccatccatccatcc 173638 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173653 atccatccatccatccatcc 173634 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173649 atccatccatccatccatcc 173630 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173570 atccatccatccatccatcc 173551 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173566 atccatccatccatccatcc 173547 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173562 atccatccatccatccatcc 173543 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173558 atccatccatccatccatcc 173539 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173343 atccatccatccatccatcc 173324 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90705 atccatccatccatccatcc 90686 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90701 atccatccatccatccatcc 90682 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90697 atccatccatccatccatcc 90678 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90693 atccatccatccatccatcc 90674 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90689 atccatccatccatccatcc 90670 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90685 atccatccatccatccatcc 90666 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 90681 atccatccatccatccatcc 90662
>emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chromosome 4, complete sequence Length = 151688 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 137836 atccatccatccatccatcctcc 137858 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 137832 atccatccatccatccatcc 137851 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 137828 atccatccatccatccatcc 137847 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 137824 atccatccatccatccatcc 137843
>emb|AL671854.14| Mouse DNA sequence from clone RP23-89M15 on chromosome 3, complete sequence Length = 207265 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 153222 atccatccatccatccatcctcc 153200
>emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chromosome 11, complete sequence Length = 242502 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 179766 atccatccatccatccatcctcc 179744 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 209441 atccatccatccatccatcc 209422 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 209437 atccatccatccatccatcc 209418 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 179770 atccatccatccatccatcc 179751
>emb|AJ251155.1|MMU251155 Mus musculus olfactory receptor gene cluster, OR17 and OR6 genes Length = 24035 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 12396 atccatccatccatccatcctcc 12374 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12408 atccatccatccatccatcc 12389 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12404 atccatccatccatccatcc 12385 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 12400 atccatccatccatccatcc 12381
>gb|J02843.1|HUMCYPIIE Human cytochrome P450IIE1 (ethanol-inducible) gene, complete cds Length = 14776 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccatccatccatcctcca 46 ||||||||||||||||||||||| Sbjct: 12008 tccatccatccatccatcctcca 11986 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11858 atccatccatccatccatcc 11839 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11854 atccatccatccatccatcc 11835 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 11850 atccatccatccatccatcc 11831
>dbj|AP000346.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB1572G7 Length = 151600 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 1337 atccatccatccatccatcctcc 1315 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1349 atccatccatccatccatcc 1330 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1345 atccatccatccatccatcc 1326 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1341 atccatccatccatccatcc 1322
>dbj|AP000345.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB208E9 Length = 113255 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 38699 atccatccatccatccatcctcc 38677 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38715 atccatccatccatccatcc 38696 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38711 atccatccatccatccatcc 38692 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38707 atccatccatccatccatcc 38688 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 38703 atccatccatccatccatcc 38684
>dbj|AP000915.5| Homo sapiens genomic DNA, chromosome 18p clone:RP11-720L2, complete sequences Length = 188439 Score = 46.1 bits (23), Expect = 0.092 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctcc 45 ||||||||||||||||||||||| Sbjct: 64779 atccatccatccatccatcctcc 64801 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64775 atccatccatccatccatcc 64794 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64771 atccatccatccatccatcc 64790 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64767 atccatccatccatccatcc 64786 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64763 atccatccatccatccatcc 64782 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64759 atccatccatccatccatcc 64778 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 64755 atccatccatccatccatcc 64774 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 22 gatccatccatccatccatc 41 |||||||||||||||||||| Sbjct: 20450 gatccatccatccatccatc 20469
>gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, complete sequence Length = 162317 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Plus Query: 24 tccatccatccatccatcctccacaa 49 ||||||||||||||||||| |||||| Sbjct: 74576 tccatccatccatccatcccccacaa 74601 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 74431 atccatccatccatccatcc 74450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 74427 atccatccatccatccatcc 74446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 74423 atccatccatccatccatcc 74442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 74419 atccatccatccatccatcc 74438 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 74415 atccatccatccatccatcc 74434 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 74411 atccatccatccatccatcc 74430
>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11, complete sequence Length = 115808 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 20 gcgatccatccatccatccatc 41 |||||||||||||||||||||| Sbjct: 101664 gcgatccatccatccatccatc 101643
>gb|AC132396.6| Mus musculus BAC clone RP23-394F17 from chromosome 6, complete sequence Length = 190146 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 164049 cgatccatccatccatccatcc 164070 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164278 atccatccatccatccatcc 164297 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164274 atccatccatccatccatcc 164293 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164270 atccatccatccatccatcc 164289 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164266 atccatccatccatccatcc 164285 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164202 atccatccatccatccatcc 164221 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164198 atccatccatccatccatcc 164217 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164194 atccatccatccatccatcc 164213 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164190 atccatccatccatccatcc 164209 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164186 atccatccatccatccatcc 164205 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164182 atccatccatccatccatcc 164201 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164178 atccatccatccatccatcc 164197 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164174 atccatccatccatccatcc 164193 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164111 atccatccatccatccatcc 164130 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 164055 atccatccatccatccatcc 164074 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163983 atccatccatccatccatcc 164002 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163979 atccatccatccatccatcc 163998 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163975 atccatccatccatccatcc 163994 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163971 atccatccatccatccatcc 163990 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163967 atccatccatccatccatcc 163986 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163963 atccatccatccatccatcc 163982 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163959 atccatccatccatccatcc 163978 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163903 atccatccatccatccatcc 163922 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163899 atccatccatccatccatcc 163918 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163895 atccatccatccatccatcc 163914 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163891 atccatccatccatccatcc 163910 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163887 atccatccatccatccatcc 163906 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163883 atccatccatccatccatcc 163902 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163879 atccatccatccatccatcc 163898 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163831 atccatccatccatccatcc 163850 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163827 atccatccatccatccatcc 163846 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163823 atccatccatccatccatcc 163842 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 163819 atccatccatccatccatcc 163838
>gb|AF169659.3|HSTHRG06 Homo sapiens thyroglobulin gene, exons 30 and 31 Length = 2417 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 1324 cgatccatccatccatccatcc 1345 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1443 atccatccatccatccatcc 1462 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1439 atccatccatccatccatcc 1458 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1435 atccatccatccatccatcc 1454 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1431 atccatccatccatccatcc 1450 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1427 atccatccatccatccatcc 1446 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1423 atccatccatccatccatcc 1442 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1350 atccatccatccatccatcc 1369 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1346 atccatccatccatccatcc 1365 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1342 atccatccatccatccatcc 1361 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1338 atccatccatccatccatcc 1357 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1334 atccatccatccatccatcc 1353 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1330 atccatccatccatccatcc 1349 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1263 atccatccatccatccatcc 1282 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1259 atccatccatccatccatcc 1278 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 1255 atccatccatccatccatcc 1274
>gb|AF393664.1| Siphateles bicolor obesa isolate G19 microsatellite sequence Length = 538 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 405 cgatccatccatccatccatcc 426 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 469 atccatccatccatccatcc 488 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 411 atccatccatccatccatcc 430
>gb|AF190464.1| Homo sapiens hepatocytic transcription factor (B1F) gene, alternatively spliced products, complete cds, complete sequence Length = 209216 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 187761 atccatccatccatccatcctc 187740 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 187785 atccatccatccatccatcc 187766 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 187781 atccatccatccatccatcc 187762 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 187777 atccatccatccatccatcc 187758 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 187773 atccatccatccatccatcc 187754 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 187769 atccatccatccatccatcc 187750 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 187765 atccatccatccatccatcc 187746 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122835 atccatccatccatccatcc 122816
>gb|AY024098.1| Oryza sativa microsatellite MRG6423 containing (GGAT)X6, closest to marker R521, genomic sequence Length = 224 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 126 cgatccatccatccatccatcc 105 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 120 atccatccatccatccatcc 101
>gb|AY023918.1| Oryza sativa microsatellite MRG6243 containing (ATCC)X7, closest to marker L655, genomic sequence Length = 228 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 99 cgatccatccatccatccatcc 120 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 109 atccatccatccatccatcc 128 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 105 atccatccatccatccatcc 124
>gb|AC098833.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1288_A07, complete sequence Length = 122120 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 20 gcgatccatccatccatccatc 41 |||||||||||||||||||||| Sbjct: 2606 gcgatccatccatccatccatc 2585
>gb|DQ198488.1| Elephas maximus clone LaT26 microsatellite sequence Length = 286 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 208 cgatccatccatccatccatcc 187 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatc 41 ||||||||||||||||||||| Sbjct: 256 cgatccatccatccatccatc 236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 202 atccatccatccatccatcc 183 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 198 atccatccatccatccatcc 179 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 194 atccatccatccatccatcc 175 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 190 atccatccatccatccatcc 171 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 186 atccatccatccatccatcc 167 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 182 atccatccatccatccatcc 163 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 178 atccatccatccatccatcc 159 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 174 atccatccatccatccatcc 155 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 170 atccatccatccatccatcc 151 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 166 atccatccatccatccatcc 147 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 162 atccatccatccatccatcc 143 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 158 atccatccatccatccatcc 139 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 154 atccatccatccatccatcc 135 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 150 atccatccatccatccatcc 131 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 146 atccatccatccatccatcc 127 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 142 atccatccatccatccatcc 123 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 138 atccatccatccatccatcc 119 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 134 atccatccatccatccatcc 115 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 130 atccatccatccatccatcc 111 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 126 atccatccatccatccatcc 107 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 122 atccatccatccatccatcc 103 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 118 atccatccatccatccatcc 99 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 114 atccatccatccatccatcc 95
>gb|AC101852.7| Mus musculus chromosome 1, clone RP23-279P3, complete sequence Length = 185975 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 7198 cgatccatccatccatccatcc 7177 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7192 atccatccatccatccatcc 7173 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7188 atccatccatccatccatcc 7169 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7184 atccatccatccatccatcc 7165 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7180 atccatccatccatccatcc 7161 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7176 atccatccatccatccatcc 7157 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 7172 atccatccatccatccatcc 7153
>gb|AC150386.2| Branchiostoma floridae clone CH302-103G16, complete sequence Length = 195926 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 69772 atccatccatccatccatcctc 69751 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 69692 atccatccatccatccatcctc 69671 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 69608 atccatccatccatccatcct 69588 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 gatccatccatccatccatcc 42 ||||||||||||||||||||| Sbjct: 69473 gatccatccatccatccatcc 69453 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69832 atccatccatccatccatcc 69813 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69828 atccatccatccatccatcc 69809 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69824 atccatccatccatccatcc 69805 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69820 atccatccatccatccatcc 69801 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69816 atccatccatccatccatcc 69797 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69812 atccatccatccatccatcc 69793 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69808 atccatccatccatccatcc 69789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69804 atccatccatccatccatcc 69785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69800 atccatccatccatccatcc 69781 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69796 atccatccatccatccatcc 69777 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69792 atccatccatccatccatcc 69773 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69788 atccatccatccatccatcc 69769 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69784 atccatccatccatccatcc 69765 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69780 atccatccatccatccatcc 69761 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69776 atccatccatccatccatcc 69757 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69745 atccatccatccatccatcc 69726 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69665 atccatccatccatccatcc 69646 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69612 atccatccatccatccatcc 69593 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 69468 atccatccatccatccatcc 69449
>gb|AC092244.2| Drosophila melanogaster clone BACR19N22, complete sequence Length = 171000 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 19042 atccatccatccatccatcctc 19063 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 25931 atccatccatccatccatcc 25912
>gb|AY523006.1| Colinus virginianus clone A-10G microsatellite sequence Length = 264 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 221 atccatccatccatccatcctc 242 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 217 atccatccatccatccatcc 236 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 213 atccatccatccatccatcc 232 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 209 atccatccatccatccatcc 228 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 205 atccatccatccatccatcc 224 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 201 atccatccatccatccatcc 220 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 197 atccatccatccatccatcc 216 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 193 atccatccatccatccatcc 212 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 189 atccatccatccatccatcc 208 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 185 atccatccatccatccatcc 204 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 181 atccatccatccatccatcc 200 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 177 atccatccatccatccatcc 196 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 173 atccatccatccatccatcc 192 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 169 atccatccatccatccatcc 188
>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 231716 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 86800 atccatccatccatccatcctc 86779 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 25 ccatccatccatccatcctcca 46 |||||||||||||||||||||| Sbjct: 86718 ccatccatccatccatcctcca 86697 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87416 atccatccatccatccatcc 87397 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87412 atccatccatccatccatcc 87393 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87408 atccatccatccatccatcc 87389 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87404 atccatccatccatccatcc 87385 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87400 atccatccatccatccatcc 87381 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87396 atccatccatccatccatcc 87377 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87392 atccatccatccatccatcc 87373 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87388 atccatccatccatccatcc 87369 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87277 atccatccatccatccatcc 87258 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87273 atccatccatccatccatcc 87254 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87269 atccatccatccatccatcc 87250 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87265 atccatccatccatccatcc 87246 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 87261 atccatccatccatccatcc 87242 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86824 atccatccatccatccatcc 86805 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86820 atccatccatccatccatcc 86801 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86816 atccatccatccatccatcc 86797 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86812 atccatccatccatccatcc 86793 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86808 atccatccatccatccatcc 86789 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86804 atccatccatccatccatcc 86785 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86682 atccatccatccatccatcc 86663 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86678 atccatccatccatccatcc 86659 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 86674 atccatccatccatccatcc 86655
>gb|AC116075.5| Rattus norvegicus 6 BAC CH230-139H23 (Children's Hospital Oakland Research Institute) complete sequence Length = 153441 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcctc 44 |||||||||||||||||||||| Sbjct: 3835 atccatccatccatccatcctc 3856 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128336 atccatccatccatccatcc 128355 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128332 atccatccatccatccatcc 128351 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128328 atccatccatccatccatcc 128347 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128324 atccatccatccatccatcc 128343 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128320 atccatccatccatccatcc 128339 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128316 atccatccatccatccatcc 128335 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128312 atccatccatccatccatcc 128331 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128308 atccatccatccatccatcc 128327 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 128304 atccatccatccatccatcc 128323 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 3831 atccatccatccatccatcc 3850
>gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21-667A15, RP21-395M8 complete sequence Length = 350000 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Plus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 342840 cgatccatccatccatccatcc 342861
>gb|AC158542.2| Pan troglodytes BAC clone CH251-262O17 from chromosome y, complete sequence Length = 174274 Score = 44.1 bits (22), Expect = 0.36 Identities = 25/26 (96%) Strand = Plus / Minus Query: 17 gcagcgatccatccatccatccatcc 42 ||||| |||||||||||||||||||| Sbjct: 20532 gcagccatccatccatccatccatcc 20507 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcct 43 ||||||||||||||||||||| Sbjct: 20578 atccatccatccatccatcct 20558 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28768 atccatccatccatccatcc 28749 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28764 atccatccatccatccatcc 28745 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28760 atccatccatccatccatcc 28741 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28756 atccatccatccatccatcc 28737 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 28752 atccatccatccatccatcc 28733 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20602 atccatccatccatccatcc 20583 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20598 atccatccatccatccatcc 20579 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20594 atccatccatccatccatcc 20575 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20590 atccatccatccatccatcc 20571 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20586 atccatccatccatccatcc 20567 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20582 atccatccatccatccatcc 20563 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20522 atccatccatccatccatcc 20503 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20518 atccatccatccatccatcc 20499 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20514 atccatccatccatccatcc 20495 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20510 atccatccatccatccatcc 20491 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20506 atccatccatccatccatcc 20487 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 20502 atccatccatccatccatcc 20483
>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02, complete sequence Length = 157106 Score = 44.1 bits (22), Expect = 0.36 Identities = 22/22 (100%) Strand = Plus / Minus Query: 21 cgatccatccatccatccatcc 42 |||||||||||||||||||||| Sbjct: 59397 cgatccatccatccatccatcc 59376 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 atccatccatccatccatcc 42 |||||||||||||||||||| Sbjct: 59391 atccatccatccatccatcc 59372 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,156,613 Number of Sequences: 3902068 Number of extensions: 4156613 Number of successful extensions: 434709 Number of sequences better than 10.0: 12777 Number of HSP's better than 10.0 without gapping: 12841 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 104732 Number of HSP's gapped (non-prelim): 286024 length of query: 422 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 400 effective length of database: 17,147,199,772 effective search space: 6858879908800 effective search space used: 6858879908800 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
