| Clone Name | baet93d09 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Y18626.1|TAE18626 Triticum aestivum mRNA for reversibly glycosylated polypeptide Length = 1393 Score = 188 bits (95), Expect = 2e-45 Identities = 113/119 (94%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||| Sbjct: 505 ttcaacaccttgtatgacccctaccgtgaaggtgcggactttgtccgtggataccccttc 564 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| Sbjct: 565 agccttagggagggtgcccccaccgcggtctctcatggcctttggctgaacatccctga 623
>ref|NM_194076.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1519 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 516 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 575 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 576 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 634
>gb|BT017085.1| Zea mays clone EL01N0360E12.c mRNA sequence Length = 1383 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||| |||| |||||||||||||| || || |||||||| ||||||||||||||| Sbjct: 501 ttcaacaccctgtacgacccctaccgtgagggtgctgactttgtgcgtggataccccttc 560 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| ||||||||||| | ||| || ||||| || ||||| ||||||||||||||||| Sbjct: 561 agcctcagggagggtgctcacaccgccgtctcccacggcctgtggctgaacatccctga 619
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Minus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 22190424 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 22190365 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 22190364 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 22190306
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Minus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 22183453 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 22183394 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 22183393 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 22183335
>gb|AC090874.9| Oryza sativa chromosome 3 BAC OJ1523_A02 genomic sequence, complete sequence Length = 132987 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 34438 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 34497 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 34498 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 34556
>gb|AF294725.1|AF294725 Oryza sativa reversibly glycosylated polypeptide mRNA, complete cds Length = 1136 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 451 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 510 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 511 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 569
>emb|AJ011078.1|OSA011078 Oryza sativa mRNA for RGP1 protein Length = 1310 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 504 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 563 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 564 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 622
>emb|Y18624.1|OSA18624 Oryza sativa mRNA for reversibly glycosylated polypeptide Length = 1384 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 500 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 559 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 560 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 618
>dbj|AK098933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029G13, full insert sequence Length = 1492 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 520 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 579 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 580 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 638
>dbj|AK061813.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-B03, full insert sequence Length = 1509 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| |||||||| |||||||| |||||||| ||||| ||||||||| Sbjct: 519 ttcaacaccttgtatgatccctaccgcgaaggcgctgactttgtccgtggttaccccttc 578 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || |||||||||||||| ||||| ||||| ||||||||||| Sbjct: 579 agcctcagggagggagccaagactgctgtctctcacggcctgtggcttaacatccctga 637
>gb|AY111237.1| Zea mays CL1948_1 mRNA sequence Length = 1481 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||| |||| |||||||||||||| || || |||||||| ||||||||||||||| Sbjct: 508 ttcaacaccctgtacgacccctaccgtgagggtgctgactttgtgcgtggataccccttc 567 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| ||||||||||| | ||| || ||||| || ||||| ||||||||||||||||| Sbjct: 568 agcctcagggagggtgctcacaccgccgtctcccacggcctgtggctgaacatccctga 626
>gb|U89897.1|ZMU89897 Zea mays golgi associated protein se-wap41 mRNA, complete cds Length = 1480 Score = 117 bits (59), Expect = 7e-24 Identities = 104/119 (87%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||| |||| |||||||||||||| || || |||||||| ||||||||||||||| Sbjct: 537 ttcaacaccctgtacgacccctaccgtgagggtgctgactttgtgcgtggataccccttc 596 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||| ||||||||||| | ||| || ||||| || ||||| ||||||||||||||||| Sbjct: 597 agcctcagggagggtgctcacaccgccgtctcccacggcctgtggctgaacatccctga 655
>gb|AY389569.1| Hyacinthus orientalis reversibly glycosylated polypeptide (RGP) mRNA, partial cds Length = 642 Score = 97.6 bits (49), Expect = 7e-18 Identities = 97/113 (85%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| || ||||||||||| |||||||| ||||| |||||||| ||||| ||||| ||| Sbjct: 261 ttcaacactttgtatgacccttaccgtgacggcgcagactttgtccgtggctaccctttc 320 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacat 113 ||||| ||||| |||| ||||||| |||||||||||||| ||||| ||||| Sbjct: 321 agcctaagggaaggtgtgtccactgccgtctctcatggcctctggcttaacat 373
>ref|XM_479089.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1407 Score = 89.7 bits (45), Expect = 2e-15 Identities = 96/113 (84%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| || ||||||||||| |||||||| ||||| || ||||| ||||| ||||||||| Sbjct: 471 ttcaacactttgtatgacccgtaccgtgatggcgctgattttgtccgtgggtaccccttc 530 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacat 113 ||||| | |||||||| || ||||| || |||||||| |||||||| ||||| Sbjct: 531 agcctccgtgagggtgccccgactgccgtttctcatgggctttggctcaacat 583
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 89.7 bits (45), Expect = 2e-15 Identities = 96/113 (84%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| || ||||||||||| |||||||| ||||| || ||||| ||||| ||||||||| Sbjct: 24721810 ttcaacactttgtatgacccgtaccgtgatggcgctgattttgtccgtgggtaccccttc 24721869 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacat 113 ||||| | |||||||| || ||||| || |||||||| |||||||| ||||| Sbjct: 24721870 agcctccgtgagggtgccccgactgccgtttctcatgggctttggctcaacat 24721922
>dbj|AP005175.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0040H10 Length = 132919 Score = 89.7 bits (45), Expect = 2e-15 Identities = 96/113 (84%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| || ||||||||||| |||||||| ||||| || ||||| ||||| ||||||||| Sbjct: 77747 ttcaacactttgtatgacccgtaccgtgatggcgctgattttgtccgtgggtaccccttc 77806 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacat 113 ||||| | |||||||| || ||||| || |||||||| |||||||| ||||| Sbjct: 77807 agcctccgtgagggtgccccgactgccgtttctcatgggctttggctcaacat 77859
>dbj|AK061294.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D01, full insert sequence Length = 1407 Score = 89.7 bits (45), Expect = 2e-15 Identities = 96/113 (84%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| || ||||||||||| |||||||| ||||| || ||||| ||||| ||||||||| Sbjct: 471 ttcaacactttgtatgacccgtaccgtgatggcgctgattttgtccgtgggtaccccttc 530 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacat 113 ||||| | |||||||| || ||||| || |||||||| |||||||| ||||| Sbjct: 531 agcctccgtgagggtgccccgactgccgtttctcatgggctttggctcaacat 583
>gb|DQ415921.1| Cleome spinosa clone BAC Cs2, complete sequence Length = 132380 Score = 85.7 bits (43), Expect = 3e-14 Identities = 100/119 (84%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || |||||||| ||||| || || || ||||||||||||||| Sbjct: 26773 ttcaacaccttgtatgatccttaccgtgagggcgctgatttcgtccgtggataccccttc 26832 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | ||||||| || |||||||| || ||||| |||||||| ||||||||||| Sbjct: 26833 agtctccgtgagggtgttcctactgctgtttcccatggtctttggctcaacatccctga 26891
>ref|NM_121569.2| Arabidopsis thaliana RGP2; alpha-1,4-glucan-protein synthase (UDP-forming) AT5G15650 (RGP2) mRNA, complete cds Length = 1530 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 473 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 532 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 533 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 591
>emb|AL391144.1|ATF14F8 Arabidopsis thaliana DNA chromosome 5, BAC clone F14F8 (ESSA project) Length = 96892 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 8844 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 8903 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 8904 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 8962
>gb|AY120691.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, complete cds Length = 1083 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 427 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 486 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 487 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 545
>gb|AY039846.1| Arabidopsis thaliana AT5g15650/F14F8_30 mRNA, complete cds Length = 1411 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 474 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 533 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 534 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 592
>emb|BX831174.1|CNS09ZDG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS64ZH06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1341 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 461 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 520 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 521 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 579
>emb|BX830856.1|CNS09ZF4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS31ZC08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1348 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 451 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 510 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 511 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 569
>emb|BX830946.1|CNS09YLX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS40ZH01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1351 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 457 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 516 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 517 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 575
>gb|AY087476.1| Arabidopsis thaliana clone 35863 mRNA, complete sequence Length = 1396 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 475 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 534 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 535 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 593
>gb|AF013628.1|AF013628 Arabidopsis thaliana reversibly glycosylated polypeptide-2 (AtRGP) mRNA, complete cds Length = 1401 Score = 69.9 bits (35), Expect = 2e-09 Identities = 98/119 (82%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| ||||||||||| || ||||||||||| || || || || ||||||||||| ||| Sbjct: 448 ttcaacaccttgtatgatccttaccgtgaaggtgctgatttcgtccgtggataccctttc 507 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | || |||| |||||||||| || ||||| |||||||| ||||||||||| Sbjct: 508 agtctccgtgaaggtgtttccactgctgtttcccatggtctttggctcaacatccctga 566
>gb|DQ207853.1| Solanum tuberosum clone 075G08 UDP-glucose:protein transglucosylase-like mRNA, complete cds Length = 1244 Score = 65.9 bits (33), Expect = 2e-08 Identities = 90/109 (82%) Strand = Plus / Plus Query: 11 tgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttcagccttaggg 70 ||||||| || ||| | ||||| || || ||||||||||||||||| ||||| | | | Sbjct: 442 tgtatgatccatacagagaaggagcagattttgttcgtggataccctttcagtatgcgtg 501 Query: 71 agggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||||| |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 502 agggtgcggccacagctgtttctcatggactttggctcaacatccctga 550
>emb|AJ310910.1|STU310910 Solanum tuberosum mRNA for UDP-Glucose:protein transglucosylase (uptg2 gene) Length = 1303 Score = 65.9 bits (33), Expect = 2e-08 Identities = 90/109 (82%) Strand = Plus / Plus Query: 11 tgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttcagccttaggg 70 ||||||| || ||| | ||||| || || ||||||||||||||||| ||||| | | | Sbjct: 453 tgtatgatccatacagagaaggagcagattttgttcgtggataccctttcagtatgcgtg 512 Query: 71 agggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 ||||||| |||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 513 agggtgcggccacagctgtttctcatggactttggctcaacatccctga 561
>ref|NM_111090.2| Arabidopsis thaliana RGP1 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 1) AT3G02230 (RGP1) mRNA, complete cds Length = 1385 Score = 61.9 bits (31), Expect = 4e-07 Identities = 97/119 (81%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| |||||||| ||||| ||||||||||| || ||||| || ||||||||||| ||| Sbjct: 495 ttcaacaccttgtacgacccataccgtgaaggtgctgacttcgtccgtggataccctttc 554 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | ||||||| |||| ||||| || || || || ||||| ||||||||||| Sbjct: 555 agtctccgtgagggtgtttccaccgctgtttcccacggtctgtggctcaacatccctga 613
>gb|AC009755.7|ATAC009755 Arabidopsis thaliana chromosome III BAC F14P3 genomic sequence, complete sequence Length = 94369 Score = 61.9 bits (31), Expect = 4e-07 Identities = 97/119 (81%) Strand = Plus / Minus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| |||||||| ||||| ||||||||||| || ||||| || ||||||||||| ||| Sbjct: 58394 ttcaacaccttgtacgacccataccgtgaaggtgctgacttcgtccgtggataccctttc 58335 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | ||||||| |||| ||||| || || || || ||||| ||||||||||| Sbjct: 58334 agtctccgtgagggtgtttccaccgctgtttcccacggtctgtggctcaacatccctga 58276
>gb|BT008841.1| Arabidopsis thaliana At3g02230 mRNA, complete cds Length = 1074 Score = 61.9 bits (31), Expect = 4e-07 Identities = 97/119 (81%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| |||||||| ||||| ||||||||||| || ||||| || ||||||||||| ||| Sbjct: 427 ttcaacaccttgtacgacccataccgtgaaggtgctgacttcgtccgtggataccctttc 486 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | ||||||| |||| ||||| || || || || ||||| ||||||||||| Sbjct: 487 agtctccgtgagggtgtttccaccgctgtttcccacggtctgtggctcaacatccctga 545
>gb|BT002409.1| Arabidopsis thaliana reversibly glycosylated polypeptide-1 (At3g02230) mRNA, complete cds Length = 1374 Score = 61.9 bits (31), Expect = 4e-07 Identities = 97/119 (81%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| |||||||| ||||| ||||||||||| || ||||| || ||||||||||| ||| Sbjct: 498 ttcaacaccttgtacgacccataccgtgaaggtgctgacttcgtccgtggataccctttc 557 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | ||||||| |||| ||||| || || || || ||||| ||||||||||| Sbjct: 558 agtctccgtgagggtgtttccaccgctgtttcccacggtctgtggctcaacatccctga 616
>gb|AF013627.1|AF013627 Arabidopsis thaliana reversibly glycosylated polypeptide-1 (AtRGP) mRNA, complete cds Length = 1393 Score = 61.9 bits (31), Expect = 4e-07 Identities = 97/119 (81%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttc 60 ||||| |||||||| ||||| ||||||||||| || ||||| || ||||||||||| ||| Sbjct: 498 ttcaacaccttgtacgacccataccgtgaaggtgctgacttcgtccgtggataccctttc 557 Query: 61 agccttagggagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 || || | ||||||| |||| ||||| || || || || ||||| ||||||||||| Sbjct: 558 agtctccgtgagggtgtttccaccgctgtttcccacggtctgtggctcaacatccctga 616
>gb|AF005279.1|AF005279 Vigna unguiculata type IIIa membrane protein cp-wap13 mRNA, complete cds Length = 1275 Score = 60.0 bits (30), Expect = 1e-06 Identities = 63/74 (85%) Strand = Plus / Plus Query: 46 cgtggataccccttcagccttagggagggtgcacccactgctgtctctcatggcctttgg 105 ||||||||||| ||||| ||| | |||||||| ||||||||||| ||||| || || ||| Sbjct: 535 cgtggataccctttcagtcttcgtgagggtgctcccactgctgtttctcacggtctctgg 594 Query: 106 ctgaacatccctga 119 || ||||| ||||| Sbjct: 595 ctcaacatacctga 608
>gb|AF005278.1|AF005278 Vigna unguiculata type IIIa membrane protein cp-wap11 mRNA, complete cds Length = 1461 Score = 56.0 bits (28), Expect = 2e-05 Identities = 85/104 (81%) Strand = Plus / Plus Query: 13 tatgacccctaccgtgaaggcgcggactttgttcgtggataccccttcagccttagggag 72 |||||||| ||||| ||||| || ||||||||||| || ||||| ||||| || |||| Sbjct: 493 tatgacccttaccgagaaggtgcagactttgttcgcggttaccctttcagtctccgggaa 552 Query: 73 ggtgcacccactgctgtctctcatggcctttggctgaacatccc 116 |||| || ||||| || |||||||| || ||||| |||||||| Sbjct: 553 ggtgtgccaactgcagtttctcatggtctctggctcaacatccc 596
>dbj|AB154534.1| Cucumis melo 8C01 mRNA for hypothetical protein, partial cds Length = 395 Score = 52.0 bits (26), Expect = 4e-04 Identities = 65/78 (83%) Strand = Plus / Plus Query: 39 ctttgttcgtggataccccttcagccttagggagggtgcacccactgctgtctctcatgg 98 |||||| ||||||||||| ||||| || | ||||||| || ||||| || |||||||| Sbjct: 1 ctttgtccgtggataccctttcagtctccgtgagggtgtcccgactgcggtttctcatgg 60 Query: 99 cctttggctgaacatccc 116 |||||||| |||||||| Sbjct: 61 actttggcttaacatccc 78
>gb|U31565.1|PSU31565 Pisum sativum reversibly glycosylatable polypeptide (RGP1) mRNA, complete cds Length = 1298 Score = 52.0 bits (26), Expect = 4e-04 Identities = 62/74 (83%) Strand = Plus / Plus Query: 46 cgtggataccccttcagccttagggagggtgcacccactgctgtctctcatggcctttgg 105 ||||||||||| ||||| ||| | || |||| |||||||| || ||||| ||||||||| Sbjct: 472 cgtggataccctttcagtcttcgtgaaggtgtccccactgccgtttctcacggcctttgg 531 Query: 106 ctgaacatccctga 119 || ||||| ||||| Sbjct: 532 ctcaacatacctga 545
>emb|Y18625.1|TAE18625 Triticum aestivum mRNA for amylogenin Length = 1903 Score = 46.1 bits (23), Expect = 0.022 Identities = 47/55 (85%) Strand = Plus / Plus Query: 11 tgtatgacccctaccgtgaaggcgcggactttgttcgtggataccccttcagcct 65 |||||||||| ||||| | || || |||||||| ||||||||||| |||||||| Sbjct: 958 tgtatgacccataccgcaagggtgctgactttgtccgtggatacccattcagcct 1012
>ref|NM_111724.2| Arabidopsis thaliana RGP3 (REVERSIBLY GLYCOSYLATED POLYPEPTIDE 3); alpha-1,4-glucan-protein synthase (UDP-forming) AT3G08900 (RGP3) mRNA, complete cds Length = 1350 Score = 44.1 bits (22), Expect = 0.089 Identities = 25/26 (96%) Strand = Plus / Plus Query: 37 gactttgttcgtggataccccttcag 62 |||||||||||||||||||| ||||| Sbjct: 451 gactttgttcgtggataccctttcag 476 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 88 gtctctcatggcctttggctgaacatccctga 119 |||||||||||||| ||||| ||||| ||||| Sbjct: 502 gtctctcatggcctctggctcaacattcctga 533
>gb|AC010871.7|ATAC010871 Arabidopsis thaliana chromosome III BAC T16O11 genomic sequence, complete sequence Length = 80381 Score = 44.1 bits (22), Expect = 0.089 Identities = 25/26 (96%) Strand = Plus / Plus Query: 37 gactttgttcgtggataccccttcag 62 |||||||||||||||||||| ||||| Sbjct: 47382 gactttgttcgtggataccctttcag 47407 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 88 gtctctcatggcctttggctgaacatccctga 119 |||||||||||||| ||||| ||||| ||||| Sbjct: 47433 gtctctcatggcctctggctcaacattcctga 47464
>gb|AF034255.2|AF034255 Arabidopsis thaliana reversibly glycosylated polypeptide-3 (RGP) mRNA, complete cds Length = 1374 Score = 44.1 bits (22), Expect = 0.089 Identities = 25/26 (96%) Strand = Plus / Plus Query: 37 gactttgttcgtggataccccttcag 62 |||||||||||||||||||| ||||| Sbjct: 475 gactttgttcgtggataccctttcag 500 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 88 gtctctcatggcctttggctgaacatccctga 119 |||||||||||||| ||||| ||||| ||||| Sbjct: 526 gtctctcatggcctctggctcaacattcctga 557
>dbj|AK118676.1| Arabidopsis thaliana At3g08900 mRNA for putative reversibly glycosylated polypeptide-3 (RGP), complete cds, clone: RAFL19-94-P04 Length = 901 Score = 44.1 bits (22), Expect = 0.089 Identities = 25/26 (96%) Strand = Plus / Plus Query: 37 gactttgttcgtggataccccttcag 62 |||||||||||||||||||| ||||| Sbjct: 31 gactttgttcgtggataccctttcag 56 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 88 gtctctcatggcctttggctgaacatccctga 119 |||||||||||||| ||||| ||||| ||||| Sbjct: 82 gtctctcatggcctctggctcaacattcctga 113
>emb|AJ223252.2|SOT223252 Solanum tuberosum mRNA for UDP-glucose:protein transglucosylase (uptg1 gene) Length = 1392 Score = 44.1 bits (22), Expect = 0.089 Identities = 43/50 (86%) Strand = Plus / Plus Query: 70 gagggtgcacccactgctgtctctcatggcctttggctgaacatccctga 119 |||||||| || || ||||| |||||||| || ||||| ||||||||||| Sbjct: 497 gagggtgctccaacagctgtttctcatggactgtggctcaacatccctga 546
>ref|NM_124453.2| Arabidopsis thaliana RGP4 (reversibly glycosylated polypeptide 4); alpha-1,4-glucan-protein synthase (UDP-forming) AT5G50750 (RGP4) mRNA, complete cds Length = 1359 Score = 42.1 bits (21), Expect = 0.35 Identities = 27/29 (93%) Strand = Plus / Plus Query: 91 tctcatggcctttggctgaacatccctga 119 |||||||| |||||||| ||||||||||| Sbjct: 579 tctcatggtctttggctcaacatccctga 607
>gb|AY341443.1| Phaseolus vulgaris cultivar Sprite BAC 78L17, partial sequence Length = 106592 Score = 42.1 bits (21), Expect = 0.35 Identities = 63/77 (81%) Strand = Plus / Minus Query: 40 tttgttcgtggataccccttcagccttagggagggtgcacccactgctgtctctcatggc 99 |||||||| || ||||||||||| || | || |||| || ||||| || |||||||| Sbjct: 48857 tttgttcgcggttaccccttcagtctccgtgaaggtgtgccaactgcagtttctcatggt 48798 Query: 100 ctttggctgaacatccc 116 |||||||| |||||||| Sbjct: 48797 ctttggctcaacatccc 48781
>gb|AF329280.1|AF329280 Arabidopsis thaliana reversibly glycosylated polypeptide RGP-4 (RGP4) mRNA, complete cds Length = 1251 Score = 42.1 bits (21), Expect = 0.35 Identities = 27/29 (93%) Strand = Plus / Plus Query: 91 tctcatggcctttggctgaacatccctga 119 |||||||| |||||||| ||||||||||| Sbjct: 517 tctcatggtctttggctcaacatccctga 545
>emb|BX833063.1|CNS09Z8Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL32ZC09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1228 Score = 42.1 bits (21), Expect = 0.35 Identities = 27/29 (93%) Strand = Plus / Plus Query: 91 tctcatggcctttggctgaacatccctga 119 |||||||| |||||||| ||||||||||| Sbjct: 520 tctcatggtctttggctcaacatccctga 548
>gb|BT005194.1| Arabidopsis thaliana clone U20586 putative UDP-glucose (At5g50750) mRNA, complete cds Length = 1126 Score = 42.1 bits (21), Expect = 0.35 Identities = 27/29 (93%) Strand = Plus / Plus Query: 91 tctcatggcctttggctgaacatccctga 119 |||||||| |||||||| ||||||||||| Sbjct: 505 tctcatggtctttggctcaacatccctga 533
>gb|BT004025.1| Arabidopsis thaliana clone RAFL15-21-J03 (R20586) putative UDP-glucose:protein transglucosylase (At5g50750) mRNA, complete cds Length = 1317 Score = 42.1 bits (21), Expect = 0.35 Identities = 27/29 (93%) Strand = Plus / Plus Query: 91 tctcatggcctttggctgaacatccctga 119 |||||||| |||||||| ||||||||||| Sbjct: 543 tctcatggtctttggctcaacatccctga 571
>dbj|AB023037.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MFB16 Length = 66087 Score = 42.1 bits (21), Expect = 0.35 Identities = 27/29 (93%) Strand = Plus / Plus Query: 91 tctcatggcctttggctgaacatccctga 119 |||||||| |||||||| ||||||||||| Sbjct: 45810 tctcatggtctttggctcaacatccctga 45838
>ref|NM_121657.1| Arabidopsis thaliana alpha-1,4-glucan-protein synthase (UDP-forming) AT5G16510 transcript variant AT5G16510.1 mRNA, complete cds Length = 1417 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 574 gcggattttgtccgtggataccctttcagcct 605
>ref|NM_180500.1| Arabidopsis thaliana alpha-1,4-glucan-protein synthase (UDP-forming) AT5G16510 transcript variant AT5G16510.2 mRNA, complete cds Length = 1474 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 635 gcggattttgtccgtggataccctttcagcct 666
>gb|BT011949.1| Arabidopsis thaliana At5g16510 mRNA sequence Length = 1044 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 427 gcggattttgtccgtggataccctttcagcct 458
>gb|AY114087.1| Arabidopsis thaliana putative amylogenin; reversibly glycosylatable polypeptide (At5g16510) mRNA, complete cds Length = 1078 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 430 gcggattttgtccgtggataccctttcagcct 461
>gb|AY091141.1| Arabidopsis thaliana putative amylogenin; reversibly glycosylatable polypeptide (At5g16510) mRNA, complete cds Length = 1412 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 556 gcggattttgtccgtggataccctttcagcct 587
>gb|AC010163.8| Homo sapiens chromosome 10 clone RP11-90J7, complete sequence Length = 157069 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 56 ccttcagccttagggagggt 75 |||||||||||||||||||| Sbjct: 78331 ccttcagccttagggagggt 78312
>emb|BX831289.1|CNS09ZCS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS75ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1360 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 551 gcggattttgtccgtggataccctttcagcct 582
>emb|BX831062.1|CNS09ZHU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZG08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1417 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 623 gcggattttgtccgtggataccctttcagcct 654
>emb|BX830732.1|CNS09ZIV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZH02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1355 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 544 gcggattttgtccgtggataccctttcagcct 575
>emb|BX830725.1|CNS09ZDQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZC11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1349 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 555 gcggattttgtccgtggataccctttcagcct 586
>emb|BX831355.1|CNS09ZG3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS80ZG07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1350 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 588 gcggattttgtccgtggataccctttcagcct 619
>gb|AY088511.1| Arabidopsis thaliana clone 7365 mRNA, complete sequence Length = 1417 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 574 gcggattttgtccgtggataccctttcagcct 605
>dbj|AB005242.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQK4 Length = 82001 Score = 40.1 bits (20), Expect = 1.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 34 gcggactttgttcgtggataccccttcagcct 65 ||||| ||||| ||||||||||| |||||||| Sbjct: 60437 gcggattttgtccgtggataccctttcagcct 60468
>gb|AC117994.12| Mus musculus chromosome 6, clone RP23-25K2, complete sequence Length = 237945 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 tctctcatggcctttggct 107 ||||||||||||||||||| Sbjct: 227600 tctctcatggcctttggct 227582
>ref|XM_612647.2| PREDICTED: Bos taurus similar to sperm associated antigen 9 isoform 1, transcript variant 1 (LOC540689), mRNA Length = 4394 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 93 tcatggcctttggctgaac 111 ||||||||||||||||||| Sbjct: 2980 tcatggcctttggctgaac 2962
>ref|XM_880397.1| PREDICTED: Bos taurus similar to sperm associated antigen 9 isoform 1, transcript variant 6 (LOC540689), mRNA Length = 4394 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 93 tcatggcctttggctgaac 111 ||||||||||||||||||| Sbjct: 2980 tcatggcctttggctgaac 2962
>ref|XM_880378.1| PREDICTED: Bos taurus similar to sperm associated antigen 9 isoform 1, transcript variant 5 (LOC540689), mRNA Length = 4184 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 93 tcatggcctttggctgaac 111 ||||||||||||||||||| Sbjct: 2794 tcatggcctttggctgaac 2776
>ref|XM_867501.1| PREDICTED: Bos taurus similar to sperm associated antigen 9 isoform 1, transcript variant 2 (LOC540689), mRNA Length = 4355 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 93 tcatggcctttggctgaac 111 ||||||||||||||||||| Sbjct: 2980 tcatggcctttggctgaac 2962
>gb|AC125361.4| Mus musculus BAC clone RP23-93M7 from chromosome 12, complete sequence Length = 202234 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 ctgctgtctctcatggcct 101 ||||||||||||||||||| Sbjct: 130286 ctgctgtctctcatggcct 130268
>gb|DQ415922.1| Cleome spinosa clone BAC Cs1, complete sequence Length = 146078 Score = 38.2 bits (19), Expect = 5.5 Identities = 31/35 (88%) Strand = Plus / Plus Query: 85 gctgtctctcatggcctttggctgaacatccctga 119 ||||| |||||||| || ||||| ||||||||||| Sbjct: 21844 gctgtttctcatggtctctggctaaacatccctga 21878
>gb|AC122050.3| Mus musculus BAC clone RP24-457L7 from chromosome 6, complete sequence Length = 179078 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 86 ctgtctctcatggcctttg 104 ||||||||||||||||||| Sbjct: 127661 ctgtctctcatggcctttg 127679
>emb|AL606842.8| Human DNA sequence from clone RP11-523E6 on chromosome 13, complete sequence Length = 111249 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 64 cttagggagggtgcaccca 82 ||||||||||||||||||| Sbjct: 86069 cttagggagggtgcaccca 86051
>gb|AC163282.3| Mus musculus BAC clone RP23-454I20 from chromosome 12, complete sequence Length = 202583 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 83 ctgctgtctctcatggcct 101 ||||||||||||||||||| Sbjct: 49739 ctgctgtctctcatggcct 49721
>emb|AL732504.23| Mouse DNA sequence from clone RP23-177I18 on chromosome 4, complete sequence Length = 192031 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 52 taccccttcagccttaggg 70 ||||||||||||||||||| Sbjct: 73687 taccccttcagccttaggg 73669
>emb|BX537342.6| Zebrafish DNA sequence from clone CH211-198P11 in linkage group 3, complete sequence Length = 195436 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 1 ttcaataccttgtatgacc 19 ||||||||||||||||||| Sbjct: 50385 ttcaataccttgtatgacc 50403
>gb|AC138623.1| Homo sapiens BAC clone RP11-1251L1 from 2, complete sequence Length = 91428 Score = 38.2 bits (19), Expect = 5.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 70 gagggtgcacccactgctgtctc 92 |||||||||| |||||||||||| Sbjct: 83285 gagggtgcactcactgctgtctc 83307
>gb|AC156397.5| Mus musculus 6 BAC RP24-279P24 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 166910 Score = 38.2 bits (19), Expect = 5.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 tctctcatggcctttggct 107 ||||||||||||||||||| Sbjct: 43997 tctctcatggcctttggct 43979 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 686,467 Number of Sequences: 3902068 Number of extensions: 686467 Number of successful extensions: 41548 Number of sequences better than 10.0: 79 Number of HSP's better than 10.0 without gapping: 78 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 41399 Number of HSP's gapped (non-prelim): 125 length of query: 119 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 98 effective length of database: 17,151,101,840 effective search space: 1680807980320 effective search space used: 1680807980320 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)