ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet91f10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 478 e-132
2gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 226 4e-56
3gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 222 7e-55
4emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 214 2e-52
5emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 206 4e-50
6ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 178 9e-42
7gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 178 9e-42
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 178 9e-42
9dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 178 9e-42
10dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 9e-42
11dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 9e-42
12dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 9e-42
13dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 9e-42
14ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 174 1e-40
15dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
16dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
17dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
18dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 174 1e-40
19dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
20dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
21dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
22dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
23dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
24dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 174 1e-40
25gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 170 2e-39
26dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 170 2e-39
27dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 3e-38
28emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 161 2e-36
29gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 159 8e-36
30emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 157 3e-35
31emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 153 5e-34
32emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 151 2e-33
33emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 151 2e-33
34gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 147 3e-32
35emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 145 1e-31
36emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 143 5e-31
37gb|AY109324.1| Zea mays CL187_1 mRNA sequence 143 5e-31
38dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 143 5e-31
39gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 141 2e-30
40emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 139 8e-30
41emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 137 3e-29
42gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 137 3e-29
43gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 133 5e-28
44gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 129 7e-27
45dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 129 7e-27
46emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 129 7e-27
47dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 127 3e-26
48emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 127 3e-26
49emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 ... 127 3e-26
50emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 125 1e-25
51ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 123 5e-25
52gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 123 5e-25
53gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 123 5e-25
54gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 123 5e-25
55gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 123 5e-25
56gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 123 5e-25
57gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 123 5e-25
58gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 123 5e-25
59gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 123 5e-25
60gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 123 5e-25
61gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 123 5e-25
62emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 123 5e-25
63emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 123 5e-25
64gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 123 5e-25
65gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 123 5e-25
66ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 121 2e-24
67ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 121 2e-24
68ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 121 2e-24
69ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 121 2e-24
70gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 121 2e-24
71gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 121 2e-24
72gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 121 2e-24
73gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 121 2e-24
74gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 121 2e-24
75gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 121 2e-24
76gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 121 2e-24
77gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 121 2e-24
78gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 121 2e-24
79gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 121 2e-24
80gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 121 2e-24
81gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 121 2e-24
82emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
83emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 121 2e-24
84emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 121 2e-24
85emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 121 2e-24
86gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 121 2e-24
87dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 121 2e-24
88gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 119 7e-24
89dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 119 7e-24
90dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 119 7e-24
91gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 117 3e-23
92gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 117 3e-23
93gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 115 1e-22
94emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 115 1e-22
95gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 115 1e-22
96emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 113 4e-22
97emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 113 4e-22
98emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 113 4e-22
99emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 113 4e-22
100gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 111 2e-21
101emb|X16535.1|GMCAB4 G.max DNA for Cab4 111 2e-21
102gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 111 2e-21
103emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 109 7e-21
104emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 109 7e-21
105emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 109 7e-21
106gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 109 7e-21
107emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 107 3e-20
108emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 107 3e-20
109emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 107 3e-20
110emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 107 3e-20
111gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 107 3e-20
112emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 107 3e-20
113gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-... 107 3e-20
114dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 107 3e-20
115gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 105 1e-19
116emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 105 1e-19
117dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 103 4e-19
118gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 103 4e-19
119gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 103 4e-19
120ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 101 2e-18
121gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 101 2e-18
122gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 101 2e-18
123gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 101 2e-18
124gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 101 2e-18
125gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 101 2e-18
126gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 101 2e-18
127emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 101 2e-18
128emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 101 2e-18
129gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 101 2e-18
130gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 101 2e-18
131gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 101 2e-18
132emb|X16536.1|GMCAB5 G.max DNA for Cab5 100 7e-18
133gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 100 7e-18
134gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 100 7e-18
135gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 100 7e-18
136gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 100 7e-18
137gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 100 7e-18
138emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 96 1e-16
139gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 96 1e-16
140emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 96 1e-16
141gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 94 4e-16
142gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 94 4e-16
143emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 94 4e-16
144emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 92 2e-15
145gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 92 2e-15
146gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 92 2e-15
147gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 92 2e-15
148gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 92 2e-15
149emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 90 6e-15
150emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 90 6e-15
151gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 90 6e-15
152dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 90 6e-15
153gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 88 3e-14
154emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 88 3e-14
155ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 86 1e-13
156emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 86 1e-13
157gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 86 1e-13
158gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 86 1e-13
159emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 86 1e-13
160gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 86 1e-13
161gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 86 1e-13
162gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 86 1e-13
163dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 86 1e-13
164gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 84 4e-13
165emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 84 4e-13
166gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 84 4e-13
167gb|M64619.1|PEACAB66 Pea cab gene, complete cds 84 4e-13
168gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 84 4e-13
169gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 84 4e-13
170dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 84 4e-13
171gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 82 2e-12
172gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 82 2e-12
173gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 82 2e-12
174emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 82 2e-12
175gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA 82 2e-12
176emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 80 6e-12
177gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl... 78 2e-11
178emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 78 2e-11
179emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 78 2e-11
180emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 78 2e-11
181gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 78 2e-11
182gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 76 1e-10
183emb|X61915.1|PTCABP P.thunbergii cab gene 76 1e-10
184emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 76 1e-10
185gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 76 1e-10
186dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 76 1e-10
187gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 74 4e-10
188gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 74 4e-10
189gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 74 4e-10
190gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 74 4e-10
191gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 74 4e-10
192gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 74 4e-10
193gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 74 4e-10
194dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 74 4e-10
195emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 74 4e-10
196dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro... 74 4e-10
197ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 72 1e-09
198gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 72 1e-09
199gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 72 1e-09
200emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 72 1e-09
201gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 72 1e-09
202gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 72 1e-09
203gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 72 1e-09
204gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 72 1e-09
205gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 72 1e-09
206gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 72 1e-09
207gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 72 1e-09
208emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 72 1e-09
209gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 72 1e-09
210emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 72 1e-09
211dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 72 1e-09
212emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 70 6e-09
213gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 70 6e-09
214gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 70 6e-09
215gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a... 70 6e-09
216emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 70 6e-09
217gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 70 6e-09
218dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone... 70 6e-09
219emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 68 2e-08
220emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 68 2e-08
221gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 66 9e-08
222gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 66 9e-08
223gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 66 9e-08
224gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 66 9e-08
225gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 66 9e-08
226gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 66 9e-08
227dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 66 9e-08
228emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 66 9e-08
229emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA 66 9e-08
230emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 66 9e-08
231emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 66 9e-08
232gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 66 9e-08
233gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 66 9e-08
234dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c... 64 4e-07
235gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 62 1e-06
236gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 62 1e-06
237gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 62 1e-06
238gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 62 1e-06
239gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 62 1e-06
240gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 62 1e-06
241gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 62 1e-06
242gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 62 1e-06
243emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 62 1e-06
244emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 62 1e-06
245emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 62 1e-06
246emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 60 6e-06
247dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 6e-06
248gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 60 6e-06
249gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 58 2e-05
250emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 58 2e-05
251emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 58 2e-05
252gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 58 2e-05
253gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 58 2e-05
254dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 58 2e-05
255gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi... 54 4e-04
256gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor... 54 4e-04
257emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy... 54 4e-04
258gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 54 4e-04
259gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 54 4e-04
260dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 54 4e-04
261ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 52 0.001
262ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
263ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
264ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
265ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
266ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
267ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
268ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 52 0.001
269dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
270dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.001
271dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
272dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
273dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
274dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
275dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
276dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
277dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
278dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
279dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
280dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.001
281gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 52 0.001
282dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene... 50 0.005
283gb|AF207690.1|AF207690 Daucus carota cultivar Kurodagosun chloro... 50 0.005
284gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 50 0.005
285gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 48 0.022
286emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b... 48 0.022
287gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 48 0.022
288emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20... 48 0.022
289dbj|AB050126.1| Amaranthus tricolor cab3 mRNA for type III chlor... 48 0.022
290ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH... 46 0.086
291ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA... 46 0.086
292ref|XM_483142.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.086
293emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl... 46 0.086
294gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 46 0.086
295gb|AF526508.1| Vicia faba A-B binding protein (CHLOR1) mRNA, par... 46 0.086
296gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 46 0.086
297gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 46 0.086
298gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c... 46 0.086
299gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c... 46 0.086
300gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 46 0.086
301gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN... 46 0.086
302dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.086
303emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co... 46 0.086
304emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co... 46 0.086
305gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (... 46 0.086
306dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 46 0.086
307gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 46 0.086
308dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 46 0.086
309dbj|AP005148.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.086
310gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll... 46 0.086
311gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 46 0.086
312dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 46 0.086
313dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 46 0.086
314emb|BX817733.1|CNS0AE6W Arabidopsis thaliana Full-length cDNA Co... 44 0.34
315emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 44 0.34
316dbj|D78207.1|PHNCABBP Japanese morning glory mRNA for chlorophyl... 44 0.34
317dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro... 44 0.34
318gb|AC147802.2| Oryza sativa chromosome 3 BAC OSJNBb0013C14 genom... 42 1.3
319gb|DQ226734.1| Boechera divaricarpa isolate SLW-A-E08 mRNA sequence 42 1.3
320emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 42 1.3
321gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end 42 1.3
322gb|AY845255.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 40 5.3
323gb|AC116593.4| Mus musculus BAC clone RP24-91C7 from chromosome ... 40 5.3
324gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome... 40 5.3
325emb|AL590128.11| Human DNA sequence from clone RP11-312B8 on chr... 40 5.3
326emb|AJ720383.1| Gallus gallus mRNA for hypothetical protein, clo... 40 5.3
327gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 40 5.3
328gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosom... 40 5.3
329ref|NM_001006351.1| Gallus gallus similar to SCO-spondin (LOC420... 40 5.3
330gb|AE001825.1| Deinococcus radiodurans R1 chromosome 2, complete... 40 5.3
331dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 40 5.3

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  478 bits (241), Expect = e-132
 Identities = 321/347 (92%), Gaps = 3/347 (0%)
 Strand = Plus / Plus

                                                                       
Query: 53  agctttccaatggcggcagccaccatgtccatctcctt---gacctttgccggcaagacg 109
           |||||||||||||||||||||||||||||| ||||||    |||||||||||||||| ||
Sbjct: 1   agctttccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcg 60

                                                                       
Query: 110 gtgaagaacgtaccatctttggttctctttggcgaagcccgagtcaccatgcgcaagacc 169
           |||||||| ||||||||||||| |||||| ||||| ||||| ||||||||||||||||||
Sbjct: 61  gtgaagaatgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagacc 120

                                                                       
Query: 170 ggagcaaaggcaaagcaagtttcctccggcagcccatggtacggtgccgaccgtgtgctc 229
           | ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 121 gcagcaaaggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctc 180

                                                                       
Query: 230 tacctcggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgac 289
           |||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||
Sbjct: 181 tacctcggcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgac 240

                                                                       
Query: 290 tatgggtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggag 349
           ||||||||||||||||| |||||||| |||||||| ||||||||| ||||||||||||||
Sbjct: 241 tatgggtgggacactgctggactttcggctgacccggagaccttctccaagaaccgggag 300

                                                          
Query: 350 ctggaagtgatccattgtcgatgggccatgctcggagcacttggttg 396
           ||||| |||||||| ||||| ||||||||||| || |||||||||||
Sbjct: 301 ctggaggtgatccactgtcgctgggccatgcttggggcacttggttg 347



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  226 bits (114), Expect = 4e-56
 Identities = 201/230 (87%)
 Strand = Plus / Plus

                                                                       
Query: 152 gtcaccatgcgcaagaccggagcaaaggcaaagcaagtttcctccggcagcccatggtac 211
           |||||||||||||||||||  || ||||| ||||  || || ||||||||||| ||||||
Sbjct: 157 gtcaccatgcgcaagaccgcggccaaggccaagccggtgtcgtccggcagcccgtggtac 216

                                                                       
Query: 212 ggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcacc 271
           ||  ||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||
Sbjct: 217 gggtccgaccgcgtgctctacctcggcccgctctccggcgaccccccgagctacctcacc 276

                                                                       
Query: 272 ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
           || |||||||| |||||||| ||||||||||| || || || || || ||||| ||||||
Sbjct: 277 ggcgagttccccggcgactacgggtgggacaccgcggggctgtcggccgaccccgagacc 336

                                                             
Query: 332 ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           ||||||||||||||||||||||| |||||||| || || |||||||||||
Sbjct: 337 ttcgccaagaaccgggagctggaggtgatccactgccggtgggccatgct 386



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  222 bits (112), Expect = 7e-55
 Identities = 208/240 (86%)
 Strand = Plus / Plus

                                                                       
Query: 157 catgcgcaagaccggagcaaaggcaaagcaagtttcctccggcagcccatggtacggtgc 216
           |||||||||||| |  || ||||| || |||||||| ||  ||||||| ||||||||  |
Sbjct: 299 catgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagcccgtggtacggctc 358

                                                                       
Query: 217 cgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcaccggtga 276
            ||||||||||||||||||||||| || ||||| |||||||| |||||| | || |||||
Sbjct: 359 tgaccgtgtgctctacctcggcccgctttccggcgagccccccagctacttgactggtga 418

                                                                       
Query: 277 gttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttcgc 336
           |||||| || ||||||||||||||||| ||||| || || ||||||||||||||||||||
Sbjct: 419 gttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttcgc 478

                                                                       
Query: 337 caagaaccgggagctggaagtgatccattgtcgatgggccatgctcggagcacttggttg 396
           ||||||||||||||| || |||||||| || ||||||||||||||||| || ||||||||
Sbjct: 479 caagaaccgggagctcgaggtgatccactgccgatgggccatgctcggtgcgcttggttg 538



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  214 bits (108), Expect = 2e-52
 Identities = 284/342 (83%), Gaps = 3/342 (0%)
 Strand = Plus / Plus

                                                                       
Query: 58  tccaatggcggcagccaccatgtccatctcctt---gacctttgccggcaagacggtgaa 114
           ||||||||||||  ||||||||| | ||||||    ||| || ||||| ||| |||||||
Sbjct: 15  tccaatggcggccaccaccatgtacctctcctcatcgacattcgccggaaaggcggtgaa 74

                                                                       
Query: 115 gaacgtaccatctttggttctctttggcgaagcccgagtcaccatgcgcaagaccggagc 174
           ||| || ||||  | || |||||| || || || || |||||||||||||||||||  ||
Sbjct: 75  gaatgtcccattatcggctctcttcggtgaggctcgcgtcaccatgcgcaagaccgcggc 134

                                                                       
Query: 175 aaaggcaaagcaagtttcctccggcagcccatggtacggtgccgaccgtgtgctctacct 234
            || || ||||||||||||||| |||||||||||||||| || || ||||||||||||||
Sbjct: 135 gaaagctaagcaagtttcctccagcagcccatggtacggagctgatcgtgtgctctacct 194

                                                                       
Query: 235 cggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgg 294
           ||||||||||||  | |||||||| ||||||||||||||||| ||||| || ||||| ||
Sbjct: 195 cggcccactctctcgcgagcccccaagctacctcaccggtgatttccccggtgactacgg 254

                                                                       
Query: 295 gtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctgga 354
           ||||||||| || ||||| || |||||||| ||||||||| | |||||||| ||| ||||
Sbjct: 255 gtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgcgagttgga 314

                                                     
Query: 355 agtgatccattgtcgatgggccatgctcggagcacttggttg 396
            ||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 315 ggtgatacactgccgctgggctatgcttggtgcactgggttg 356



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  206 bits (104), Expect = 4e-50
 Identities = 206/240 (85%)
 Strand = Plus / Plus

                                                                       
Query: 157 catgcgcaagaccggagcaaaggcaaagcaagtttcctccggcagcccatggtacggtgc 216
           |||||||||||| |  || ||||| || |||||||| ||  ||||||| ||||||||  |
Sbjct: 94  catgcgcaagactgcggcgaaggccaaacaagtttcgtcgagcagcccgtggtacggctc 153

                                                                       
Query: 217 cgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcaccggtga 276
            ||||||||||||||||||||| | || ||||| || ||||| |||||| | || |||||
Sbjct: 154 tgaccgtgtgctctacctcggctcgctttccggcgaaccccccagctacttgactggtga 213

                                                                       
Query: 277 gttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttcgc 336
           |||||| || ||||||||||||||||| ||||| || || ||||||||||||||||||||
Sbjct: 214 gttccccggtgactatgggtgggacaccgccgggctctcggctgaccctgagaccttcgc 273

                                                                       
Query: 337 caagaaccgggagctggaagtgatccattgtcgatgggccatgctcggagcacttggttg 396
           ||||||||||||||| || |||||||| || ||||||||||||||||| || ||||||||
Sbjct: 274 caagaaccgggagctcgaggtgatccactgccgatgggccatgctcggtgcgcttggttg 333



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318

             
Query: 380 ct 381
           ||
Sbjct: 319 ct 320



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                         
Query: 200   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
             ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476

                                                                         
Query: 260   agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
               |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416

                                                                         
Query: 320   gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
             ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356

               
Query: 380   ct 381
             ||
Sbjct: 14355 ct 14354



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                            
Query: 200      agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
                ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535

                                                                            
Query: 260      agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
                  |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595

                                                                            
Query: 320      gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
                ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655

                  
Query: 380      ct 381
                ||
Sbjct: 30024656 ct 30024657



 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                            
Query: 200      agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
                ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729

                                                                            
Query: 260      agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
                |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789

                                                            
Query: 320      gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
                ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 23603833



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                           
Query: 195      ccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
                |||||| ||| ||||||||  ||||||| ||  |||||||| |||| ||||||||||||
Sbjct: 37443423 ccggcaacccgtggtacggccccgaccgcgtcatctacctccgcccgctctccggtgag 37443365



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                         
Query: 200   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
             ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525

                                                                         
Query: 260   agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
               |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585

                                                                         
Query: 320   gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
             ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645

               
Query: 380   ct 381
             ||
Sbjct: 20646 ct 20647



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

             
Query: 380 ct 381
           ||
Sbjct: 400 ct 401



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

             
Query: 380 ct 381
           ||
Sbjct: 400 ct 401



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

             
Query: 380 ct 381
           ||
Sbjct: 402 ct 403



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

             
Query: 380 ct 381
           ||
Sbjct: 402 ct 403



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 290



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                            
Query: 200      agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
                ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182

                                                                            
Query: 260      agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
                |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242

                                                            
Query: 320      gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
                ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 10793286



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                         
Query: 200   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
             ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905

                                                                         
Query: 260   agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965

                                                         
Query: 320   gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
             ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 17009



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                         
Query: 200   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
             ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428

                                                                         
Query: 260   agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488

                                                         
Query: 320   gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
             ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 66532



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                          
Query: 200    agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
              ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800

                                                                          
Query: 260    agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
              |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860

                                                          
Query: 320    gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
              ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 129904



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 361



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 360



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 354



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 359



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 361



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  174 bits (88), Expect = 1e-40
 Identities = 145/164 (88%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatcca 359



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||||||| |||||| | |||||||| || |||||||| ||||| || || || 
Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||||||||
Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360

             
Query: 380 ct 381
           ||
Sbjct: 361 ct 362



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| |||||||||||||||||||||||  ||||||| |  |||||||| |||
Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356

             
Query: 380 ct 381
           ||
Sbjct: 357 ct 358



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  167 bits (84), Expect = 3e-38
 Identities = 144/164 (87%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| |||||  |||||||||||||||||||||| ||||||||
Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatcca 359



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  161 bits (81), Expect = 2e-36
 Identities = 162/189 (85%)
 Strand = Plus / Plus

                                                                       
Query: 193 ctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtga 252
           |||||||||||| ||||||||  ||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 144 ctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccggcga 203

                                                                       
Query: 253 gcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggact 312
           ||||||||||||||| || || |||||||| |||||||| || |||||||| || || ||
Sbjct: 204 gcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggct 263

                                                                       
Query: 313 ttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatg 372
            || || ||||| ||||| ||||||||||||||||||||||| || ||||| |  || ||
Sbjct: 264 gtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatccactcccgctg 323

                    
Query: 373 ggccatgct 381
           |||||||||
Sbjct: 324 ggccatgct 332



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score =  159 bits (80), Expect = 8e-36
 Identities = 170/200 (85%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  | ||||||||    ||| | |||||| |||||||||||
Sbjct: 142 tccggcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgag 201

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           ||||| |||||| | |||||||| ||||| || |||||||| ||||||||||||||||| 
Sbjct: 202 cccccaagctacttgaccggtgaattccccggtgactatggctgggacactgccggactc 261

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           ||||||||||| || ||||| ||||||||||| ||||| ||||||||||| |   |||||
Sbjct: 262 tcagctgacccagaaacctttgccaagaaccgtgagctcgaagtgatccactcaagatgg 321

                               
Query: 374 gccatgctcggagcacttgg 393
           || ||||| ||||| |||||
Sbjct: 322 gctatgcttggagctcttgg 341



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  157 bits (79), Expect = 3e-35
 Identities = 163/191 (85%)
 Strand = Plus / Plus

                                                                        
Query: 194  tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
            ||||||||||| ||||||||  ||||||| ||    |||||||||||  ||||||| |||
Sbjct: 1015 tccggcagcccctggtacggccccgaccgcgtcaagtacctcggccccttctccggcgag 1074

                                                                        
Query: 254  cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            |||||||||||||||||||| |||||||| |||||||| || |||||||| ||||| || 
Sbjct: 1075 cccccgagctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 1134

                                                                        
Query: 314  tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
            || || ||||| ||||| |||||||||||||| |||||||| |||||||| |  || |||
Sbjct: 1135 tccgccgaccccgagacattcgccaagaaccgcgagctggaggtgatccactcccgctgg 1194

                       
Query: 374  gccatgctcgg 384
            |||||||||||
Sbjct: 1195 gccatgctcgg 1205



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  153 bits (77), Expect = 5e-34
 Identities = 145/167 (86%), Gaps = 3/167 (1%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt---gagccc 256
           ||||| |||||||| |||||||| ||||||||||||||||| ||||||||    ||||| 
Sbjct: 624 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 684 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           || ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 744 gccgacccggagacgttcgccaagaaccgggagctggaggtgatcca 790



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  151 bits (76), Expect = 2e-33
 Identities = 130/148 (87%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||||||| ||||||||||| | |||||||||||||| || ||||| || |||||||
Sbjct: 74  tctccggtgagtccccgagctacttgaccggtgagttccccggtgactacggctgggaca 133

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           |||| ||||| ||||||||||| |||||||||||||||||||| ||||| || |||||||
Sbjct: 134 ctgctggactctcagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatcc 193

                                       
Query: 363 attgtcgatgggccatgctcggagcact 390
           | |   ||||||||||||| ||||||||
Sbjct: 194 actcaagatgggccatgcttggagcact 221



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||| ||||| ||||||||  ||||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || ||||| ||||| ||||||||||||||||||||||| |||||||| || || |||
Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376

                   
Query: 374 gccatgct 381
           ||||||||
Sbjct: 377 gccatgct 384



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  147 bits (74), Expect = 3e-32
 Identities = 155/182 (85%)
 Strand = Plus / Plus

                                                                       
Query: 182 aagcaagtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggccca 241
           ||||| ||||||||||| ||||||||||||||  | ||||||||    ||| | ||||||
Sbjct: 173 aagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggccca 232

                                                                       
Query: 242 ctctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggac 301
            ||||||| |||||||||  |||||||||||| ||||||||||| ||||| || ||||||
Sbjct: 233 ttctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggac 292

                                                                       
Query: 302 actgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatc 361
           ||||| || ||||| |||||||| ||||||||||||| |||||| ||| ||||||| |||
Sbjct: 293 actgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtcatc 352

             
Query: 362 ca 363
           ||
Sbjct: 353 ca 354



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  145 bits (73), Expect = 1e-31
 Identities = 144/167 (86%), Gaps = 3/167 (1%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt---gagccc 256
           ||||| |||||||| |||||||| || |||||||||||||| ||||| ||    ||||| 
Sbjct: 585 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||||||||| |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 645 ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           || ||||| ||||| ||||||||||||||||||||||| ||||||||
Sbjct: 705 gccgacccggagacgttcgccaagaaccgggagctggaggtgatcca 751



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Plus

                                                                        
Query: 194  tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
            ||||| ||||| ||||||||  ||||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 254  cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 314  tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
            || || ||||| ||||| ||||||||||||||||||||||| |||||||| |  || |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                    
Query: 374  gccatgct 381
            ||||||||
Sbjct: 1325 gccatgct 1332



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  143 bits (72), Expect = 5e-31
 Identities = 159/188 (84%)
 Strand = Plus / Plus

                                                                        
Query: 194  tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
            ||||| ||||| ||||||||  ||||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 254  cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 314  tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
            || || ||||| ||||| ||||||||||||||||||||||| |||||||| |  || |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                    
Query: 374  gccatgct 381
            ||||||||
Sbjct: 1325 gccatgct 1332



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  143 bits (72), Expect = 5e-31
 Identities = 168/200 (84%)
 Strand = Plus / Minus

                                                                        
Query: 197  ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccc 256
            |||||||||||||||||| ||||||||||    ||| | |||||| |||| |||||| | 
Sbjct: 2532 ggcagcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggtgagtct 2473

                                                                        
Query: 257  ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
            || |||||| | || |||||||| ||||| |||||||| ||||||||||| |||||||||
Sbjct: 2472 ccaagctacttgactggtgagtttccaggtgactatggatgggacactgctggactttca 2413

                                                                        
Query: 317  gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
            ||||| || || || || ||||||||||| ||| |||| |||||||| ||  ||||||||
Sbjct: 2412 gctgatccagaaacttttgccaagaaccgtgagttggaggtgatccactgcagatgggcc 2353

                                
Query: 377  atgctcggagcacttggttg 396
            ||||| ||||| ||||||||
Sbjct: 2352 atgcttggagctcttggttg 2333



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 133/161 (82%)
 Strand = Plus / Plus

                                                                        
Query: 236  ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
            |||||| |||| |||||| | || |||||| | || ||||| ||||| || ||||| |||
Sbjct: 4540 ggcccattctctggtgagtctccaagctacttgactggtgaattccctggtgactacggg 4599

                                                                        
Query: 296  tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
            ||||||||||| |||||||||||||| || || || || || |||||||| ||| |||| 
Sbjct: 4600 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 4659

                                                     
Query: 356  gtgatccattgtcgatgggccatgctcggagcacttggttg 396
            |||||||| ||  ||||||| ||||| ||||| ||||||||
Sbjct: 4660 gtgatccactgcagatgggcaatgcttggagctcttggttg 4700



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score =  141 bits (71), Expect = 2e-30
 Identities = 125/143 (87%)
 Strand = Plus / Plus

                                                                       
Query: 245 tccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacact 304
           ||||| ||||||||||||||||||||||| |||||||| || ||||| || |||||||| 
Sbjct: 1   tccggagagcccccgagctacctcaccggagagttccccggagactacggatgggacacc 60

                                                                       
Query: 305 gccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccat 364
           ||||| || || |||||||| ||||||||||||| |||||| ||||| ||||| ||||| 
Sbjct: 61  gccggtctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccac 120

                                  
Query: 365 tgtcgatgggccatgctcggagc 387
           ||  |||||||||||||||||||
Sbjct: 121 tgcagatgggccatgctcggagc 143



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  139 bits (70), Expect = 8e-30
 Identities = 157/186 (84%)
 Strand = Plus / Plus

                                                                        
Query: 193  ctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtga 252
            |||||||||||| ||||||||||||||||| || || ||||| ||||| || |||||   
Sbjct: 2055 ctccggcagcccctggtacggtgccgaccgcgtcctgtacctgggcccgctgtccggctc 2114

                                                                        
Query: 253  gcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggact 312
             || ||||||||||| ||||| |||||||| |||||||| ||||||||||| |  || ||
Sbjct: 2115 acctccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgaggggct 2174

                                                                        
Query: 313  ttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatg 372
             || || ||||| |||||||||||||||||||| |||||||| |||||||| || || ||
Sbjct: 2175 gtcggcggacccggagaccttcgccaagaaccgcgagctggaggtgatccactgccgctg 2234

                  
Query: 373  ggccat 378
            ||||||
Sbjct: 2235 ggccat 2240



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  137 bits (69), Expect = 3e-29
 Identities = 165/197 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||||||| | ||||||||    ||| | |||||| ||||||||||  |||| 
Sbjct: 375 agcccatggtacggtcctgaccgtgtcaagtacttgggcccattctccggtgaagcccca 434

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||| | |||||||||||||| || |||||||| |||||||| || | ||||||||||
Sbjct: 435 agctacttgaccggtgagttccctggtgactatggttgggacaccgctgaactttcagct 494

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           || || || || |||||||||||||| ||| |||| |||||||| ||  |||||||||||
Sbjct: 495 gatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 554

                            
Query: 380 ctcggagcacttggttg 396
           || ||||| ||||||||
Sbjct: 555 cttggagctcttggttg 571



to top

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  137 bits (69), Expect = 3e-29
 Identities = 168/201 (83%)
 Strand = Plus / Plus

                                                                       
Query: 187 agtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctc 246
           |||||| ||||||||||| ||||| ||| | ||||||||    ||| | |||||| ||||
Sbjct: 96  agtttcttccggcagcccgtggtatggtcctgaccgtgtcaagtacttgggcccattctc 155

                                                                       
Query: 247 cggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgc 306
            |||||||| ||   |||||| ||||| |||||||| || ||||| || |||||||||||
Sbjct: 156 tggtgagccaccatcctaccttaccggagagttccctggtgactacggttgggacactgc 215

                                                                       
Query: 307 cggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattg 366
            |||||||||||||| || |||||||||||||||||||| ||| ||||||||||||| | 
Sbjct: 216 tggactttcagctgatcccgagaccttcgccaagaaccgtgagttggaagtgatccactc 275

                                
Query: 367 tcgatgggccatgctcggagc 387
             ||||||||||||| |||||
Sbjct: 276 cagatgggccatgcttggagc 296



to top

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score =  133 bits (67), Expect = 5e-28
 Identities = 118/135 (87%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           ||||||||| || || || || ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 207 ctacctcacaggagaatttcctggcgactatggttgggacactgccggactctcagctga 266

                                                                       
Query: 322 ccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           ||| ||||| ||||| |||||||| ||||| |||||||||||||  ||||||||||||||
Sbjct: 267 cccggagacattcgctaagaaccgtgagctcgaagtgatccattcacgatgggccatgct 326

                          
Query: 382 cggagcacttggttg 396
            || || ||||||||
Sbjct: 327 tggggctcttggttg 341



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  129 bits (65), Expect = 7e-27
 Identities = 125/145 (86%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| |||||||| ||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 224 tctccggagagcccccaagctacctcacaggagagttccccggtgactacggatgggaca 283

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | ||||| ||||| |||||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 284 ccgccggtctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatcc 343

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           | ||  ||||||||||||| |||||
Sbjct: 344 actgcagatgggccatgcttggagc 368



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
           protein, complete cds
          Length = 1500

 Score =  129 bits (65), Expect = 7e-27
 Identities = 146/173 (84%)
 Strand = Plus / Plus

                                                                       
Query: 207 ggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacc 266
           ||||||||||||||||  | |||||||| |||||| |||| |||   |||||   |||||
Sbjct: 667 ggtacggtgccgaccgccttctctacctgggcccattctctggttctcccccatcctacc 726

                                                                       
Query: 267 tcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctg 326
           |||| ||||||||||| || ||||||||||||||||| || || || || || ||||| |
Sbjct: 727 tcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcagacccag 786

                                                                
Query: 327 agaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||||||||||||||| |||||||||| ||||||||||   |||||||||||
Sbjct: 787 agaccttcgccaagaacagggagctggaggtgatccattccagatgggccatg 839



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  129 bits (65), Expect = 7e-27
 Identities = 128/149 (85%)
 Strand = Plus / Plus

                                                                       
Query: 248 ggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgcc 307
           |||||| |||| |||||| | || |||||||| || || |||||||||||||| ||||| 
Sbjct: 420 ggtgaggccccaagctacttgactggtgagtttcctggtgactatgggtgggatactgct 479

                                                                       
Query: 308 ggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgt 367
           ||||||||||| ||||| || || |||||||||||||||||| |||| |||||||| || 
Sbjct: 480 ggactttcagcagacccagaaactttcgccaagaaccgggagttggaggtgatccactgc 539

                                        
Query: 368 cgatgggccatgctcggagcacttggttg 396
            ||||||||||||| ||||| ||||||||
Sbjct: 540 agatgggccatgcttggagctcttggttg 568



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  127 bits (64), Expect = 3e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| |||||||| ||||| || |||||||||||||||||||| |||||||||||||||
Sbjct: 224 tacctgaccggtgaattccctggagactatgggtgggacactgctggactttcagctgac 283

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           || ||||| || ||||||||||| ||||| |||||||||||  |  ||||||||||||| 
Sbjct: 284 ccagagacatttgccaagaaccgtgagctcgaagtgatccacagcagatgggccatgctt 343

                   
Query: 383 ggagcact 390
           || |||||
Sbjct: 344 ggtgcact 351



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  127 bits (64), Expect = 3e-26
 Identities = 130/152 (85%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| || |||||||||  |||||| ||||||||||||||||||||||| || 
Sbjct: 419 ggcccattctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggc 478

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||||||||| || ||||| || ||||| || ||||||||||||||||| || || |||
Sbjct: 479 tgggacactgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaa 538

                                           
Query: 356 gtgatccattgtcgatgggccatgctcggagc 387
           |||||||| |   | |||||||||||||||||
Sbjct: 539 gtgatccactccaggtgggccatgctcggagc 570



to top

>emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 gene for chlorophyll
           a/b-binding protein
          Length = 741

 Score =  127 bits (64), Expect = 3e-26
 Identities = 64/64 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atctccacactcactcatctccttgagaacccatatagcagacacttcgcttagctttcc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 678 atctccacactcactcatctccttgagaacccatatagcagacacttcgcttagctttcc 737

               
Query: 61  aatg 64
           ||||
Sbjct: 738 aatg 741



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score =  125 bits (63), Expect = 1e-25
 Identities = 159/191 (83%)
 Strand = Plus / Minus

                                                                       
Query: 197 ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccc 256
           |||||||||||||||||  | ||||| |||   ||| | || ||| ||||||| ||||||
Sbjct: 285 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 226

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| |||||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 166

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           || ||||| ||||||||||||| |||||| ||||| ||||| |||||  |  ||||||||
Sbjct: 165 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 106

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 105 atgctcggagc 95



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 375 gccatgctcggagc 388



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||| ||||||||  |||| |||||    |||||||||||  |||||||||||
Sbjct: 174 tccggcagcccgtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgag 233

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            | ||    |||||||||||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 234 gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 293

                                                             
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||| |||||||||||||||||||| || ||||||||
Sbjct: 294 tcagcggaccccgagacattcgccaagaaccgggagctcgaggtgatcca 343



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  123 bits (62), Expect = 5e-25
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||| ||||||||  |||| |||||    |||||||||||  |||||||||||
Sbjct: 9   tccggcagcccgtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgag 68

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            | ||    |||||||||||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 69  gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 128

                                                             
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| ||||| |||||||||||||||||||| || ||||||||
Sbjct: 129 tcagcggaccccgagacattcgccaagaaccgggagctcgaggtgatcca 178



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score =  123 bits (62), Expect = 5e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                       
Query: 188 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 247
           |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 115 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 174

                                                                       
Query: 248 ggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgcc 307
           |||||||||||    ||||| || ||||| ||||| || |||||||| ||||||||||| 
Sbjct: 175 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 234

                                                                       
Query: 308 ggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgt 367
           || |||||||||||||| || ||||| ||||||||||| ||||| ||||||||||| |  
Sbjct: 235 gggctttcagctgacccagaaacctttgccaagaaccgtgagcttgaagtgatccactcc 294

                                     
Query: 368 cgatgggccatgctcggagcacttgg 393
            ||||||||||||| ||||| |||||
Sbjct: 295 agatgggccatgcttggagctcttgg 320



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 313 gccatgctcggagc 326



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 375 gccatgctcggagc 388



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 375 gccatgctcggagc 388



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                         
Query: 194   tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
             ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 95437 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 95496

                                                                         
Query: 254   cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
             || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 95497 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 95556

                                                                         
Query: 314   tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
             || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 95557 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 95616

                           
Query: 374   gccatgctcggagc 387
             ||||||||||||||
Sbjct: 95617 gccatgctcggagc 95630



 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                         
Query: 243   tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
             ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 93822 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 93763

                                                                         
Query: 303   ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
             | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 93762 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 93703

                                      
Query: 363   attgtcgatgggccatgctcggagc 387
             |  |  |||||||||||||||||||
Sbjct: 93702 acagcagatgggccatgctcggagc 93678



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Minus

                                                                         
Query: 194   tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
             ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 78765 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 78706

                                                                         
Query: 254   cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
             || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 78705 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 78646

                                                                         
Query: 314   tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
             || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 78645 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 78586

                           
Query: 374   gccatgctcggagc 387
             ||||||||||||||
Sbjct: 78585 gccatgctcggagc 78572



 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                         
Query: 243   tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
             ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 80380 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 80439

                                                                         
Query: 303   ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
             | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 80440 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 80499

                                      
Query: 363   attgtcgatgggccatgctcggagc 387
             |  |  |||||||||||||||||||
Sbjct: 80500 acagcagatgggccatgctcggagc 80524



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 375 gccatgctcggagc 388



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 375 gccatgctcggagc 388



to top

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  123 bits (62), Expect = 5e-25
 Identities = 131/154 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           |||| |||||| |||| |||||| | || ||||||||||| || || |||||||||||||
Sbjct: 418 tctctggtgaggccccaagctacttgactggtgagttccctggtgattatgggtgggaca 477

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           |||| |||||||||||||| || || || ||||||||||| || ||| |||| |||||||
Sbjct: 478 ctgctggactttcagctgatccagaaactttcgccaagaatcgtgagttggaggtgatcc 537

                                             
Query: 363 attgtcgatgggccatgctcggagcacttggttg 396
           | ||  ||||||||||||| ||||| ||||||||
Sbjct: 538 actgcagatgggccatgcttggagctcttggttg 571



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 433 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 492

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 493 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 552

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 553 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 612

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 613 gccatgctcggagc 626



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score =  123 bits (62), Expect = 5e-25
 Identities = 161/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || || || ||||||||||| | |||||| ||||| ||||| |||||  |  |||||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                         
Query: 374 gccatgctcggagc 387
           ||||||||||||||
Sbjct: 313 gccatgctcggagc 326



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  123 bits (62), Expect = 5e-25
 Identities = 131/154 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           |||| |||||| | || |||||| | || ||||||||||| || |||||||| ||||| |
Sbjct: 624 tctctggtgagtctccaagctacttgactggtgagttccctggtgactatggatgggata 683

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           |||| |||||||||||||| ||||| || || ||||||||||| ||| |||| |||||||
Sbjct: 684 ctgctggactttcagctgatcctgaaacttttgccaagaaccgtgagttggaggtgatcc 743

                                             
Query: 363 attgtcgatgggccatgctcggagcacttggttg 396
           | ||| ||||||||||||| ||||| ||||||||
Sbjct: 744 actgtagatgggccatgcttggagctcttggttg 777



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                        
Query: 243  tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
            ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 3065 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3006

                                                                        
Query: 303  ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
            | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 3005 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 2946

                                     
Query: 363  attgtcgatgggccatgctcggagc 387
            |  |  |||||||||||||||||||
Sbjct: 2945 acagcagatgggccatgctcggagc 2921



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Minus

                                                                        
Query: 243  tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
            ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 3104 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3045

                                                                        
Query: 303  ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
            | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 3044 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 2985

                                     
Query: 363  attgtcgatgggccatgctcggagc 387
            |  |  |||||||||||||||||||
Sbjct: 2984 acagcagatgggccatgctcggagc 2960



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 354 acagcagatgggccatgctcggagc 378



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 354 acagcagatgggccatgctcggagc 378



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||| ||||||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 13  tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | ||||| || || ||||| || ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 73  ccgccggtctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatcc 132

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 133 acagcagatgggccatgctcggagc 157



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcggagc 323



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 354 acagcagatgggccatgctcggagc 378



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcggagc 323



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcggagc 323



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcggagc 323



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcggagc 374



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcggagc 374



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcggagc 374



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcggagc 374



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcggagc 374



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcggagc 374



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 211 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 270

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 271 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 330

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 331 acagcagatgggccatgctcggagc 355



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 214 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 273

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 274 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 333

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 334 acagcagatgggccatgctcggagc 358



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score =  121 bits (61), Expect = 2e-24
 Identities = 124/145 (85%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 479 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 538

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 539 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 598

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 599 acagcagatgggccatgctcggagc 623



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/197 (82%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 208 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtcccca 267

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||| | || ||||||||||| || ||||| |||||||||||||| ||||||||||||
Sbjct: 268 agctacttgactggtgagttccctggtgactacgggtgggacactgctggactttcagct 327

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           || || || || || |||||||| || ||| |||| |||||||| ||  |||||||||||
Sbjct: 328 gatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcagatgggccatg 387

                            
Query: 380 ctcggagcacttggttg 396
           || ||||| ||||||||
Sbjct: 388 cttggagctcttggttg 404



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  121 bits (61), Expect = 2e-24
 Identities = 163/197 (82%)
 Strand = Plus / Plus

                                                                        
Query: 200  agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
            ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 1120 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 1179

                                                                        
Query: 260  agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
            |||||| | || |||||||| || || || || |||||||||||||||||||||||||||
Sbjct: 1180 agctacttgactggtgagtttcctggtgattacgggtgggacactgccggactttcagct 1239

                                                                        
Query: 320  gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
            || || || || |||||||||||||| ||| |||| |||||||| ||  |||||||||||
Sbjct: 1240 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 1299

                             
Query: 380  ctcggagcacttggttg 396
            || ||||| ||||||||
Sbjct: 1300 cttggagctcttggttg 1316



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  121 bits (61), Expect = 2e-24
 Identities = 136/161 (84%)
 Strand = Plus / Plus

                                                                        
Query: 236  ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
            |||||| |||| |||||| |||| |||||| | || ||||||||||| || || ||||| 
Sbjct: 1631 ggcccattctctggtgagtccccaagctacttgacgggtgagttccctggtgattatgga 1690

                                                                        
Query: 296  tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
            ||||||||||| |||||||||||||| || || || || || |||||||| ||| |||| 
Sbjct: 1691 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 1750

                                                     
Query: 356  gtgatccattgtcgatgggccatgctcggagcacttggttg 396
            |||||||||||  ||||||||||||| ||||| ||||||||
Sbjct: 1751 gtgatccattgcagatgggccatgcttggagctcttggttg 1791



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  119 bits (60), Expect = 7e-24
 Identities = 156/188 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||| ||||||||  | ||||||||    |||||||||||  ||||||| |||
Sbjct: 190 tccggcagcccgtggtacggcccggaccgtgtcaagtacctcggcccgttctccggcgag 249

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            ||||    ||||||||||| || ||||| |||||||| ||||||||||| ||||| || 
Sbjct: 250 gccccatcatacctcaccggcgaattccccggcgactacgggtgggacaccgccgggctc 309

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || ||||| ||||||||| |||||||||||||||| || |||||||| || || |||
Sbjct: 310 tccgccgaccccgagaccttctccaagaaccgggagctcgaggtgatccactgccggtgg 369

                   
Query: 374 gccatgct 381
           ||||||||
Sbjct: 370 gccatgct 377



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  119 bits (60), Expect = 7e-24
 Identities = 111/128 (86%)
 Strand = Plus / Minus

                                                                         
Query: 236   ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
             |||||| |||||||||||||||||  |||| | |||||||||||||| || ||||| || 
Sbjct: 66182 ggcccattctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggc 66123

                                                                         
Query: 296   tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
             ||||||||||| || ||||| |||||||| ||||| |||||||||||||| ||||| || 
Sbjct: 66122 tgggacactgctgggctttctgctgaccccgagacattcgccaagaaccgtgagcttgag 66063

                     
Query: 356   gtgatcca 363
             ||||||||
Sbjct: 66062 gtgatcca 66055



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  119 bits (60), Expect = 7e-24
 Identities = 153/184 (83%)
 Strand = Plus / Plus

                                                                        
Query: 198  gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
            ||||||||||||||||| | ||||||||    ||| | |||||| ||||||||||| |||
Sbjct: 4471 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattctccggtgagtccc 4530

                                                                        
Query: 258  cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
            | |||||| | |||||||| || || || |||||||||||||| ||||| ||||||||||
Sbjct: 4531 caagctacttgaccggtgaatttcccggtgactatgggtgggatactgctggactttcag 4590

                                                                        
Query: 318  ctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcca 377
            | || || || ||||| ||||||||||| ||||| || |||||||| ||  ||||||| |
Sbjct: 4591 cagatccagaaacctttgccaagaaccgtgagctcgaggtgatccactgcagatgggcta 4650

                
Query: 378  tgct 381
            ||||
Sbjct: 4651 tgct 4654



 Score =  103 bits (52), Expect = 4e-19
 Identities = 151/184 (82%)
 Strand = Plus / Plus

                                                                        
Query: 198  gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
            ||||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| |||
Sbjct: 7011 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgaggccc 7070

                                                                        
Query: 258  cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
            | |||||| | |||||||| |||||||| || || |||||||| ||||| ||||||||||
Sbjct: 7071 caagctacttgaccggtgaattcccaggtgattacgggtgggatactgctggactttcag 7130

                                                                        
Query: 318  ctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcca 377
            | || || || ||||| ||||||||||| || || || |||||||| ||  ||||||| |
Sbjct: 7131 cggatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 7190

                
Query: 378  tgct 381
            ||||
Sbjct: 7191 tgct 7194



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 120/148 (81%)
 Strand = Plus / Plus

                                                                        
Query: 198  gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
            ||||||||||||||||| | ||||||||    ||| | |||||| | || |||||| | |
Sbjct: 2018 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattttctggtgagtctc 2077

                                                                        
Query: 258  cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
            | |||||  | || ||||| ||||| || |||||||||||||| ||||| ||||||||||
Sbjct: 2078 caagctatttgactggtgaattccctggtgactatgggtgggatactgctggactttcag 2137

                                        
Query: 318  ctgaccctgagaccttcgccaagaaccg 345
            | ||||| || || || |||||||||||
Sbjct: 2138 ccgacccagaaacttttgccaagaaccg 2165



to top

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score =  117 bits (59), Expect = 3e-23
 Identities = 104/119 (87%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||||||||||||||||||||| |||||||| ||||||||||| ||||| |||||||||
Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320

                                                                      
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || ||||| ||||| |  ||||| || || || ||||||||||| || |||||||||||
Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgct 379



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  117 bits (59), Expect = 3e-23
 Identities = 128/151 (84%)
 Strand = Plus / Plus

                                                                       
Query: 237 gcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggt 296
           ||||| |||| |||||||| ||   |||||| ||||| |||||||| || ||||| || |
Sbjct: 1   gcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggtt 60

                                                                       
Query: 297 gggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaag 356
           |||||||||| |||||||||||||| || |||||||||||||||||||| ||| ||||||
Sbjct: 61  gggacactgctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaag 120

                                          
Query: 357 tgatccattgtcgatgggccatgctcggagc 387
           ||||||| |    |||||||||||| |||||
Sbjct: 121 tgatccactccacatgggccatgcttggagc 151



to top

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score =  115 bits (58), Expect = 1e-22
 Identities = 133/158 (84%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| || |||||||| |||||| | |||||||||||||| |||||||| || 
Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           |||||||| ||||| |||||||||||||| || ||||| |||||||| || || || |||
Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctttgccaagaatcgtgaactcgaa 291

                                                 
Query: 356 gtgatccattgtcgatgggccatgctcggagcacttgg 393
           || ||||| ||  ||||||||||| | ||||| |||||
Sbjct: 292 gtcatccactgcagatgggccatgttgggagctcttgg 329



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                        
Query: 272  ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
            |||||||||||||| || || |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 945  ggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccagagaca 1004

                                                              
Query: 332  ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
            ||||| | |||||| ||||| || ||||||||||| || |||||||||||
Sbjct: 1005 ttcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgct 1054



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  115 bits (58), Expect = 1e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           |||||||||||||| ||||||||  ||||||| ||    ||||| |||||  ||||||| 
Sbjct: 527 tcctccggcagcccctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggc 586

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||| | |||  |||||| ||||| |||||| | |||||||| || |||||||| ||||| 
Sbjct: 587 gaggcgccgtcctacctgaccggcgagttcgccggcgactacggctgggacaccgccggg 646

                                                                       
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcga 370
           || || || ||||| ||||||||||||||||||||||||||||| ||||||||    || 
Sbjct: 647 ctctcggccgaccccgagaccttcgccaagaaccgggagctggaggtgatccacgcgcgg 706

                         
Query: 371 tgggccatgctcgg 384
           ||||||||||||||
Sbjct: 707 tgggccatgctcgg 720



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 221 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 280

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| || |||||||||| |||||| ||||| ||||| ||||
Sbjct: 281 ccgctggtctatccgccgacccagaaaccttcgccaggaaccgtgagctagaagttatcc 340

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 341 acagcagatgggccatgctcggagc 365



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Minus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 705 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 646

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || || ||||| ||||||||||||| | |||| ||||| ||||| ||||
Sbjct: 645 ccgctggtctatccgccgacccagagaccttcgccagggaccgtgagctagaagttatcc 586

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  |||||||||||||||||||
Sbjct: 585 acagcagatgggccatgctcggagc 561



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score =  113 bits (57), Expect = 4e-22
 Identities = 135/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | || ||||||||||| || |||||||| 
Sbjct: 299 ggcccattctctggtgaggccccaagctacttgactggtgagttccctggtgactatgga 358

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| ||||| ||||||||||| ||||| |  || ||||||||||||||| | ||||| 
Sbjct: 359 tgggatactgctggactttcagccgacccagcaactttcgccaagaaccggaaactggag 418

                                                    
Query: 356 gtgatccattgtcgatgggccatgctcggagcacttggttg 396
           || ||||| ||| ||||| ||||||| ||||| ||||||||
Sbjct: 419 gtaatccactgtagatggaccatgcttggagctcttggttg 459



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  113 bits (57), Expect = 4e-22
 Identities = 162/197 (82%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 200 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 259

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||| | || |||||||| || || || || |||||||||||||| ||||||||||||
Sbjct: 260 agctacttgactggtgagtttcctggtgattacgggtgggacactgctggactttcagct 319

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           || || || || |||||||||||||| ||| |||| |||||||| ||  |||||||||||
Sbjct: 320 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 379

                            
Query: 380 ctcggagcacttggttg 396
           || ||||| ||||||||
Sbjct: 380 cttggagctcttggttg 396



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  111 bits (56), Expect = 2e-21
 Identities = 155/188 (82%)
 Strand = Plus / Plus

                                                                       
Query: 194 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
           ||||||||||| ||||||||  | ||||||||    |||||||||||  |||||||||||
Sbjct: 94  tccggcagcccctggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgag 153

                                                                       
Query: 254 cccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactt 313
            | ||    |||||||||||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 154 gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 213

                                                                       
Query: 314 tcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgg 373
           || || ||||| ||||| || ||||||||||||||||| || |||||||| || || |||
Sbjct: 214 tccgcggaccccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgg 273

                   
Query: 374 gccatgct 381
           || |||||
Sbjct: 274 gcaatgct 281



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score =  111 bits (56), Expect = 2e-21
 Identities = 110/128 (85%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||||||||   ||||||||| ||||| |||||||| |||||||| 
Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||||||||| || ||||| |||||||| |||||||| ||||| ||||| || ||||||
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaaaaaccgtgaactggaa 621

                   
Query: 356 gtgatcca 363
           || |||||
Sbjct: 622 gtcatcca 629



to top

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score =  111 bits (56), Expect = 2e-21
 Identities = 122/144 (84%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||||||||   ||||||||| ||||| |||||||| |||||||| 
Sbjct: 117 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 176

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||||||||| || ||||| |||||||| |||||||| ||||||||||| || || |||
Sbjct: 177 tgggacactgctgggctttctgctgacccagagacctttgccaagaaccgtgaacttgaa 236

                                   
Query: 356 gtgatccattgtcgatgggccatg 379
           || ||||| |   |||||||||||
Sbjct: 237 gtcatccactccagatgggccatg 260



 Score =  111 bits (56), Expect = 2e-21
 Identities = 137/164 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 81  agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 140

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             ||||||||| ||||| |||||||| |||||||| ||||||||||| || ||||| |||
Sbjct: 141 tcctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 200

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 201 gacccagagacctttgccaagaaccgtgaacttgaagtcatcca 244



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 197 ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccc 256
           |||||||||||||||||  | ||||| |||   ||| | || ||| ||||||| ||||||
Sbjct: 168 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 227

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| |||||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           || ||||| || |||||||||| |||||| ||||  ||||| |||||  |  ||||||||
Sbjct: 288 gccgacccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggcc 347

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 348 atgctcggagc 358



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  109 bits (55), Expect = 7e-21
 Identities = 163/199 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
           ||||||||||||| ||| | ||||||||    ||| | || ||| |||| |||||| | |
Sbjct: 373 gcagcccatggtatggtcctgaccgtgtcaagtacttgggaccattctctggtgaggcac 432

                                                                       
Query: 258 cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
           | |||||| | || |||||||||||  | |||||||| ||||| ||||| |||||||| |
Sbjct: 433 caagctacttgactggtgagttccctagtgactatggatgggatactgctggactttcgg 492

                                                                       
Query: 318 ctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcca 377
           |||| ||||| || || ||||||||||| |||||||| || ||||| ||| |||||||||
Sbjct: 493 ctgatcctgaaacttttgccaagaaccgtgagctggaggtcatccactgtagatgggcca 552

                              
Query: 378 tgctcggagcacttggttg 396
           |||| ||||| ||||||||
Sbjct: 553 tgcttggagctcttggttg 571



to top

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score =  109 bits (55), Expect = 7e-21
 Identities = 112/131 (85%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| || |||||||| ||||| |||||||| ||||||||||| || ||||| ||||||
Sbjct: 241 taccttactggtgagtttccaggtgactatggctgggacactgctgggctttcggctgac 300

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           |||||||| || ||||||||||| || || ||||||||||| |   ||||||||||||| 
Sbjct: 301 cctgagacttttgccaagaaccgtgaacttgaagtgatccactccagatgggccatgctt 360

                      
Query: 383 ggagcacttgg 393
           ||||| |||||
Sbjct: 361 ggagcccttgg 371



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           ||||| || ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||
Sbjct: 171 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggt 230

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||  |||| |||||| | || |||||||| || || ||||| || ||||||||||| |||
Sbjct: 231 gaagccccaagctacttgactggtgagtttcctggtgactacggatgggacactgctgga 290

                                                                       
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcga 370
           ||||||||||||||||| || ||||| |||||||| ||||| || |||||||| ||  ||
Sbjct: 291 ctttcagctgaccctgaaacattcgctaagaaccgtgagcttgaggtgatccactgcaga 350

                      
Query: 371 tgggccatgct 381
           |||||||||||
Sbjct: 351 tgggccatgct 361



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score =  107 bits (54), Expect = 3e-20
 Identities = 129/154 (83%)
 Strand = Plus / Plus

                                                                        
Query: 243  tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
            ||||||| |||||||| |||||||| || || |||||||| || |||||||| |||||||
Sbjct: 1757 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1816

                                                                        
Query: 303  ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
            | || || || ||||||||||| ||||| ||||| |  ||||| ||||| ||||| ||||
Sbjct: 1817 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1876

                                              
Query: 363  attgtcgatgggccatgctcggagcacttggttg 396
            | ||  ||||||||||||||||||| || |||||
Sbjct: 1877 actgcagatgggccatgctcggagccctaggttg 1910



to top

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score =  107 bits (54), Expect = 3e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                       
Query: 192 cctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtg 251
           ||||| ||||||| ||||||||  ||||||| ||||||||||||||||| |||||||| |
Sbjct: 172 cctccagcagcccgtggtacggccccgaccgcgtgctctacctcggcccgctctccggcg 231

                                         
Query: 252 agcccccgagctacctcaccggtgagttcc 281
           |||||||||||||||||| ||| |||||||
Sbjct: 232 agcccccgagctacctcagcggcgagttcc 261



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score =  107 bits (54), Expect = 3e-20
 Identities = 129/154 (83%)
 Strand = Plus / Plus

                                                                        
Query: 243  tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
            ||||||| |||||||| |||||||| || || |||||||| || |||||||| |||||||
Sbjct: 1758 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1817

                                                                        
Query: 303  ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
            | || || || ||||||||||| ||||| ||||| |  ||||| ||||| ||||| ||||
Sbjct: 1818 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1877

                                              
Query: 363  attgtcgatgggccatgctcggagcacttggttg 396
            | ||  ||||||||||||||||||| || |||||
Sbjct: 1878 actgcagatgggccatgctcggagccctaggttg 1911



to top

>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score =  107 bits (54), Expect = 3e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                        
Query: 272  ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
            ||||||||||| || ||||| || ||||||||||| ||||| ||||||||||||||||| 
Sbjct: 2322 ggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctgagaca 2381

                                                              
Query: 332  ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
            || || | ||||| |||||| || |||||||||||||| |||||||||||
Sbjct: 2382 tttgctaggaacctggagcttgaggtgatccattgtcgttgggccatgct 2431



to top

>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 405

 Score =  107 bits (54), Expect = 3e-20
 Identities = 123/146 (84%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | |||||||| ||||| || ||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| ||||| ||||||||||| |||||||| ||||| ||||||||||| || || || 
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||||||  ||||||| |||||
Sbjct: 295 gtgatccattgcagatgggctatgct 320



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score =  107 bits (54), Expect = 3e-20
 Identities = 138/166 (83%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
           ||||||||||||||||  | ||||||||    ||| | |||||| |||||||||||  ||
Sbjct: 192 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgagagcc 251

                                                                       
Query: 258 cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
           |    |||||||||||||||||||| || ||||| || ||||||||||| || |||||||
Sbjct: 252 catcatacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcag 311

                                                         
Query: 318 ctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||||| || |||||||| |||||||| ||||| ||||| |||||
Sbjct: 312 ctgacccagaaaccttcgctaagaaccgtgagcttgaagttatcca 357



to top

>gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-binding protein, 3' end
          Length = 810

 Score =  107 bits (54), Expect = 3e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
           |||||||| ||||| |||||||| ||||||||||||||||| ||||||||||||||||| 
Sbjct: 129 ggtgagtttccaggtgactatggatgggacactgccggactctcagctgaccctgagaca 188

                                                             
Query: 332 ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || | |||||| ||||| || ||||| |||||||| ||||| |||||
Sbjct: 189 tttgcaaggaaccgtgagcttgaggtgatacattgtcgttgggctatgct 238



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score =  107 bits (54), Expect = 3e-20
 Identities = 168/206 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 247
           |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 171 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 230

                                                                       
Query: 248 ggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgcc 307
           |||||||||||    ||||| || ||||| ||||| || |||||||| ||||||||||| 
Sbjct: 231 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 290

                                                                       
Query: 308 ggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgt 367
           || || ||||||||||| || ||||| || |||||||| ||||| ||||||||||| |  
Sbjct: 291 gggctatcagctgacccagaaacctttgctaagaaccgtgagcttgaagtgatccactcc 350

                                     
Query: 368 cgatgggccatgctcggagcacttgg 393
            ||||||||||||| ||||| |||||
Sbjct: 351 agatgggccatgcttggagctcttgg 376



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score =  105 bits (53), Expect = 1e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| |||
Sbjct: 185 tcctctggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 244

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           |||||||||   ||| | || || ||||||||||| ||||| || ||||||||||| |||
Sbjct: 245 gagcccccgtcttacttgactggagagttcccaggtgactacggttgggacactgctgga 304

                                                                
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| |||||||| ||||| |||||||||||||| ||||| ||||| |||||
Sbjct: 305 ctttctgctgacccagagacattcgccaagaaccgtgagcttgaagttatcca 357



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score =  105 bits (53), Expect = 1e-19
 Identities = 122/145 (84%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 209 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 268

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | ||  | || || || ||||| ||||||||||||| |||||| ||||| ||||| ||||
Sbjct: 269 ccgcttgtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 328

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  || ||||||||||||||||
Sbjct: 329 acagcagaagggccatgctcggagc 353



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  103 bits (52), Expect = 4e-19
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                       
Query: 192 cctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtg 251
           ||||||||||||| ||||||||  ||||| | ||    |||||||||||  ||||||| |
Sbjct: 42  cctccggcagcccctggtacggccccgacagagtcaagtacctcggccccttctccggcg 101

                                                                       
Query: 252 agcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggac 311
           || ||||    ||||||||||| |||||| | |||||||| || |||||||| ||||| |
Sbjct: 102 aggccccctcatacctcaccggcgagttcgccggcgactacggctgggacaccgccgggc 161

                                                               
Query: 312 tttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           | || || ||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 162 tctccgccgaccccgagaccttcgccaagaaccgcgagctggaggtgatcca 213



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score =  103 bits (52), Expect = 4e-19
 Identities = 154/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 188 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 247
           |||||||| || ||||||||||||||  | |||||||||   ||||| |||||| |||| 
Sbjct: 180 gtttcctctggaagcccatggtacggcccagaccgtgtgaagtacctgggcccattctcg 239

                                                                       
Query: 248 ggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgcc 307
           |||||| | ||    ||||| || || || |||||||| |||||||||||||||||||||
Sbjct: 240 ggtgaggctccttcttacctgacgggggaattcccaggtgactatgggtgggacactgcc 299

                                                                       
Query: 308 ggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgt 367
           || ||||| |||||||| ||||| || ||   |||||| || |||||||||||||| | |
Sbjct: 300 gggctttcggctgacccggagacatttgctcggaaccgtgaactggaagtgatccactct 359

                   
Query: 368 cgatgggc 375
           ||||||||
Sbjct: 360 cgatgggc 367



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score =  103 bits (52), Expect = 4e-19
 Identities = 157/192 (81%)
 Strand = Plus / Plus

                                                                        
Query: 188  gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 247
            |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 881  gtttcctcaggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctca 940

                                                                        
Query: 248  ggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgcc 307
            |||||||||||   ||| ||||| ||||| |||||||| |||||||| ||||||||||| 
Sbjct: 941  ggtgagcccccctcctatctcactggtgaattcccaggtgactatggttgggacactgct 1000

                                                                        
Query: 308  ggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgt 367
            || ||||| |||||||| ||||| || ||||| ||||| || |||||||| ||||| |  
Sbjct: 1001 gggctttctgctgacccagagacttttgccaaaaaccgtgaactggaagtcatccactcc 1060

                        
Query: 368  cgatgggccatg 379
             |||||||||||
Sbjct: 1061 agatgggccatg 1072



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 385 atgctcggagc 395



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 319 atgctcggagc 329



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 385 atgctcggagc 395



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 385 atgctcggagc 395



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 385 atgctcggagc 395



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| ||||| || ||||| || ||||| || ||||||||||| ||||| |||||||||
Sbjct: 517 tacctgaccggagaattccccggtgactacggatgggacactgctggactatcagctgac 576

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           || || |||||||||| ||||||||||||||| ||||| ||  |  ||||||||||||| 
Sbjct: 577 ccggaaaccttcgccaggaaccgggagctggaggtgattcacagcagatgggccatgctt 636

                      
Query: 383 ggagcacttgg 393
           || ||||||||
Sbjct: 637 ggtgcacttgg 647



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 385 atgctcggagc 395



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 354 atgctcggagc 364



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 369 atgctcggagc 379



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 265 atgctcggagc 275



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                         
Query: 257   ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
             ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657

                                                                         
Query: 317   gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
             |||||||| ||||| ||||| | |||||| || || ||||| |||||  |  | ||||||
Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597

                        
Query: 377   atgctcggagc 387
             |||||||||||
Sbjct: 16596 atgctcggagc 16586



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                         
Query: 257   ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
             ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996

                                                            
Query: 317   gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
             ||||| || ||||| ||||| | |||||| ||||| ||||| |||||
Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatcca 22043



 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                         
Query: 260   agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
             |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353

                                                                         
Query: 320   gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
             ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 19354 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 19413

                     
Query: 380   ctcggagc 387
             ||||||||
Sbjct: 19414 ctcggagc 19421



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  101 bits (51), Expect = 2e-18
 Identities = 156/191 (81%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           ||||| || ||||||||||| ||| | ||||||||    ||| | || ||| |||| || 
Sbjct: 338 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggtccattctctggg 397

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||| |||| |||||| | ||||||||||| || || || || || ||||||||||| |||
Sbjct: 398 gagtccccaagctacttgaccggtgagtttcctggtgattacggatgggacactgctgga 457

                                                                       
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcga 370
           ||||||||||||||||| || ||||| |||||||| ||| |||| || || |||||| ||
Sbjct: 458 ctttcagctgaccctgaaacattcgctaagaaccgtgagttggaggttattcattgtaga 517

                      
Query: 371 tgggccatgct 381
           |||||||||||
Sbjct: 518 tgggccatgct 528



to top

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 136/164 (82%), Gaps = 3/164 (1%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||||||  | ||||||||    ||| | |||||| |||| |||||||||   
Sbjct: 466 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccc--- 522

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           | ||||||||| ||||| |||||||| |||||||| ||||||||||| || ||||| |||
Sbjct: 523 atctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 582

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 583 gacccagagacctttgccaagaaccgtgaacttgaagtcatcca 626



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 143/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| |||
Sbjct: 184 tcctcaggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 243

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           |||||||||   ||| | || || ||||||||||| ||||| || ||||||||||| |||
Sbjct: 244 gagcccccgtcttacttgactggagagttcccaggtgactacggatgggacactgctgga 303

                                                                 
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccat 364
           ||||| |||||||| ||||| |||||||||||||| || || ||||| ||||||
Sbjct: 304 ctttctgctgacccagagacattcgccaagaaccgtgaacttgaagtcatccat 357



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 122/146 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | |||||||| ||||| || ||||| |||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||| ||||| ||||||||||| || || || 
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggcaatgct 320



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 137/166 (82%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
           ||||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggtgagtccc 196

                                                                       
Query: 258 cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
           | || ||| | |||||||| ||||| || |||||||| ||||| ||||| ||||||||||
Sbjct: 197 caagttacttgaccggtgaattccctggtgactatggctgggatactgctggactttcag 256

                                                         
Query: 318 ctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           | |||||||| ||||| ||||||||||| || || || ||||||||
Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactagaggtgatcca 302



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 122/146 (83%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | |||||||| ||||| || ||||| |||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||| ||||| ||||||||||| || || || 
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggcaatgct 320



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                        
Query: 275  gagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttc 334
            |||||||| |||||||| ||||||||||| ||||| || || || ||||| |||||||||
Sbjct: 950  gagttccccggcgactacgggtgggacacggccggcctctccgccgacccggagaccttc 1009

                                                              
Query: 335  gccaagaaccgggagctggaagtgatccattgtcgatgggccatgctcgg 384
            ||||||||||| |||||||| || |||||  | || ||||||||||||||
Sbjct: 1010 gccaagaaccgcgagctggaggtcatccacagccggtgggccatgctcgg 1059



to top

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 150/184 (81%)
 Strand = Plus / Plus

                                                                       
Query: 198 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 257
           ||||||||||||||||  | ||||||||    ||| | || ||| ||||||||||| |||
Sbjct: 199 gcagcccatggtacggcccagaccgtgttaagtacttgggtccattctccggtgagtccc 258

                                                                       
Query: 258 cgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcag 317
           | |||||| | |||||||| ||||| || || || |||||||| ||||| ||||||||||
Sbjct: 259 caagctacttgaccggtgaattccccggtgattacgggtgggatactgctggactttcag 318

                                                                       
Query: 318 ctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcca 377
           | ||||| || ||||| ||||||||||| || || || |||||||| ||  ||||||| |
Sbjct: 319 cagacccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 378

               
Query: 378 tgct 381
           ||||
Sbjct: 379 tgct 382



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 147/180 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||||||  | ||||||||    ||||| |||||| ||||||||||| | || 
Sbjct: 201 agcccatggtacggcccagaccgtgtcaagtacctaggcccattctccggtgaggcacca 260

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
              |||||||| ||||| ||||| || |||||||| ||||||||||| || || ||||||
Sbjct: 261 tcttacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagct 320

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| || || |||||||| ||||| || |||||||| ||| | |||||||||
Sbjct: 321 gaccccgagacttttgctaagaaccgtgagcttgaggtgatccactgtaggtgggccatg 380



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | |||||||| ||||| || ||||| |||
Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||| ||||| ||||||||||| || || || 
Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499

                   
Query: 356 gtgatcca 363
           ||||||||
Sbjct: 498 gtgatcca 491



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 110/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216

                                                                       
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggcc 376
           ||||| || ||||| ||||| | |||||| ||||| ||||| |||||  |  | ||||||
Sbjct: 217 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggcc 276

                      
Query: 377 atgctcggagc 387
           |||||||||||
Sbjct: 277 atgctcggagc 287



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| ||||||||||| ||||    |||||||| ||||| |||||||| |||||||| 
Sbjct: 227 ggcccattctccggtgaggccccatcttacctcactggtgaattcccaggtgactatggt 286

                                              
Query: 296 tgggacactgccggactttcagctgaccctgagac 330
           |||||||||||||| ||||| ||||||||||||||
Sbjct: 287 tgggacactgccgggctttctgctgaccctgagac 321



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 92/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           |||||||| ||||| ||||| | |||||| || || ||||| |||||
Sbjct: 476 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatcca 522



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 166/206 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           ||||| |||||||||||||| ||| | ||||||||    ||| | || ||| |||| |||
Sbjct: 203 tcctctggcagcccatggtatggtcctgaccgtgtcaagtacttggggccattctctggt 262

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||| | || || ||| | || ||||| ||||| || |||||||| ||||||||||| |||
Sbjct: 263 gagtctccaagttacttgacgggtgaattccctggtgactatggatgggacactgctgga 322

                                                                       
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcga 370
           ||||||||||| || || || || |||||||| || ||| |||| |||||||| ||  ||
Sbjct: 323 ctttcagctgatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcaga 382

                                     
Query: 371 tgggccatgctcggagcacttggttg 396
           ||||| ||||| ||||| ||||||||
Sbjct: 383 tgggctatgcttggagctcttggttg 408



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 157/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           |||||||| ||||||||||||||  | ||||| ||    ||| | |||||| |||| || 
Sbjct: 155 tcctccggaagcccatggtacggcccagaccgcgtcaagtacttgggcccattctctggc 214

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           |||||||||  ||||||||| || ||||||||||| ||||| || ||||||||||| || 
Sbjct: 215 gagcccccgtcctacctcactggcgagttcccaggtgactacggctgggacactgctggg 274

                                                                       
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcga 370
           ||||| || ||||| || ||||||||||  ||||  ||||| ||||||||||| |   | 
Sbjct: 275 ctttcggccgacccagaaaccttcgccagaaaccctgagctcgaagtgatccactccagg 334

                         
Query: 371 tgggccatgctcgg 384
           ||||||||||||||
Sbjct: 335 tgggccatgctcgg 348



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | || ||||| ||||| || ||||| |||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgactggtgaattccctggtgactacggg 234

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||| ||||| ||||||||||| || || || 
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggctatgct 320



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| || ||| | || ||||| ||||| || |||||||| 
Sbjct: 175 ggcccattctctggtgagtccccaagttacttgactggtgaattccctggtgactatgga 234

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||||||||| ||||||||||| || || || 
Sbjct: 235 tgggataccgctggactttcagcagaccctgagacctttgccaagaaccgtgaacttgag 294

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggctatgct 320



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 157/194 (80%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||||||| | ||||| ||  | ||| | || ||||| ||||||||||| || 
Sbjct: 333 agcccatggtacggtcctgaccgagttttgtacttgggtccactttccggtgagccacca 392

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
              ||| | |||||||||||||| || |||||||| ||||||||||| ||||| ||||||
Sbjct: 393 tcttacttgaccggtgagttccctggtgactatggttgggacactgctggactctcagct 452

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           || || |||||||| || | |||||| ||||| ||||| || || ||  |||||||||||
Sbjct: 453 gatcccgagacctttgctaggaaccgtgagctcgaagtcattcactgcagatgggccatg 512

                         
Query: 380 ctcggagcacttgg 393
            | ||||| |||||
Sbjct: 513 ttgggagctcttgg 526



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/125 (84%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
           ||||||||||| || || ||||||||||||||||| |||||||||||||| || || || 
Sbjct: 718 ggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaaact 777

                                                                       
Query: 332 ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctcggagcactt 391
           || || |||||||| ||||| || ||||| || ||| ||||||| ||||| ||||| || 
Sbjct: 778 tttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgcttggagctctc 837

                
Query: 392 ggttg 396
           |||||
Sbjct: 838 ggttg 842



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 141/173 (81%)
 Strand = Plus / Plus

                                                                        
Query: 191  tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
            ||||| || ||||||||||||||  | ||||||||    ||| | |||||| ||||||||
Sbjct: 1449 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 1508

                                                                        
Query: 251  gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
            ||| | |||  |||| | || || |||||||| || ||||| || |||||||||||||||
Sbjct: 1509 gagtctccgtcctacttgactggagagttccccggtgactacggttgggacactgccgga 1568

                                                                 
Query: 311  ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
            || || |||||||| ||||| ||| |||||||||| ||||| ||||| |||||
Sbjct: 1569 ctctctgctgacccagagacattctccaagaaccgtgagcttgaagtcatcca 1621



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 135/165 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 cagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccccc 258
           |||||||||||||||| ||||||||||    ||| | |||||| |||| || ||| | ||
Sbjct: 168 cagcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggcgagtcacc 227

                                                                       
Query: 259 gagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagc 318
              ||||||||| ||||| ||||| || ||||| |||||||||||||| ||||| || ||
Sbjct: 228 atcctacctcactggtgaattccctggtgactacgggtgggacactgctggactctctgc 287

                                                        
Query: 319 tgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           |||||| |||||||| || |||||||| || || || ||||||||
Sbjct: 288 tgacccagagacctttgctaagaaccgcgaacttgaggtgatcca 332



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 105/125 (84%)
 Strand = Plus / Plus

                                                                        
Query: 272  ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
            ||||||||||| || || ||||||||||||||||| |||||||||||||| || || || 
Sbjct: 2121 ggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaaact 2180

                                                                        
Query: 332  ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctcggagcactt 391
            || || |||||||| ||||| || ||||| || ||| ||||||| ||||| ||||| || 
Sbjct: 2181 tttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgcttggagctctc 2240

                 
Query: 392  ggttg 396
            |||||
Sbjct: 2241 ggttg 2245



to top

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 74/84 (88%)
 Strand = Plus / Plus

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||||||||| ||||| ||||||||||| || ||||| ||||||||||| ||||| || 
Sbjct: 12  tgggacactgctggactctcagctgacccagaaacctttgccaagaaccgtgagcttgag 71

                                   
Query: 356 gtgatccattgtcgatgggccatg 379
           |||||||||||  |||||||||||
Sbjct: 72  gtgatccattgcagatgggccatg 95



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                        
Query: 287  gactatgggtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgg 346
            ||||| || ||||||||||| |||||||||||||| || || || || ||||||||||| 
Sbjct: 1132 gactacggatgggacactgctggactttcagctgatccagaaacttttgccaagaaccgt 1191

                                            
Query: 347  gagctggaagtgatccattgtcgatgggccat 378
            ||| |||| |||||||||||| ||||||||||
Sbjct: 1192 gagttggaggtgatccattgtagatgggccat 1223



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| || ||||| ||||| | |||||| ||||| ||||| |||||
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatcca 358



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| |||||||| ||||| || ||||| |||||||| ||||| ||| | |||||||||
Sbjct: 745 tacctgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgac 804

                                                                      
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || ||||| || ||||||||||| ||||| || |||||||| ||| | ||||| |||||
Sbjct: 805 ccagagacatttgccaagaaccgtgagcttgaggtgatccactgtaggtgggctatgct 863



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| || ||||| ||||| | |||||| ||||| ||||| |||||
Sbjct: 259 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatcca 305



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| || ||||| ||||| | |||||| ||||| ||||| |||||
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatcca 358



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464

                                                          
Query: 317 gctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| || ||||| ||||| | |||||| ||||| ||||| |||||
Sbjct: 465 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatcca 511



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| ||||||| |||||| || ||||| || ||||||||||| || || || ||||| 
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           ||||| || |||||||||||||| ||||| || || |||||  |  ||||||||||||||
Sbjct: 93  cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgctc 152

                      
Query: 383 ggagcacttgg 393
           ||||| |||||
Sbjct: 153 ggagctcttgg 163



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           |||||||| |||||||| ||||| || || || ||||||||||| || ||||| ||||| 
Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           || ||||| |||||||||||||| ||||| || ||||| ||  |  ||||||||||||| 
Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgctt 347

                      
Query: 383 ggagcacttgg 393
           ||||| |||||
Sbjct: 348 ggagcccttgg 358



to top

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           |||||||| || || ||||| || || || || ||||||||||| || || |||||||||
Sbjct: 543 tacctcactggagaattccctggtgattacggttgggacactgctgggctctcagctgac 602

                                                                      
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || |||||||| ||||||||||| ||||| ||||| |||||||   |||||||||||||
Sbjct: 603 ccagagacctttgccaagaaccgtgagcttgaagttatccattcaagatgggccatgct 661



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| |||||||| |||||||| ||||| || |||||||| ||||||||||| ||||| 
Sbjct: 249 tacctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgat 308

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           || ||||| ||  |||||||||| ||||| || || ||||| ||  ||||||| ||||| 
Sbjct: 309 ccagagacattttccaagaaccgtgagcttgaggtcatccactgcagatgggcaatgctt 368

                      
Query: 383 ggagcacttgg 393
           ||||| |||||
Sbjct: 369 ggagctcttgg 379



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 266 ctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccct 325
           |||||||| || || || |||||||| ||||||||||| ||||| || || || ||||||
Sbjct: 282 ctcaccggcgaatttcccggcgactacgggtgggacaccgccgggctctctgccgaccct 341

                                                 
Query: 326 gagaccttcgccaagaaccgggagctggaagtgatcca 363
           |||||||||||||| ||| | |||||||| ||||||||
Sbjct: 342 gagaccttcgccaaaaacagagagctggaggtgatcca 379



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           |||||| ||||| |||||||| || ||||| ||||||||||| ||||| ||    || ||
Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437

                                                     
Query: 322 ccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatcca 479



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| ||||| |||||||| |||||||| || ||||||||||| || || || || |||
Sbjct: 253 tacctgaccggagagttccccggcgactacggatgggacactgctgggctgtcggcggac 312

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           || ||||| ||||||| |||||| |||||||| |||||||| |   | ||||||||||||
Sbjct: 313 ccagagactttcgccaggaaccgtgagctggaggtgatccactcgaggtgggccatgctc 372

             
Query: 383 gg 384
           ||
Sbjct: 373 gg 374



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                        
Query: 190  ttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccgg 249
            |||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||||||
Sbjct: 850  ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 909

                                                                        
Query: 250  tgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgg 309
            |||| | ||   |||| | || || |||||||| || ||||| || ||||||||||||||
Sbjct: 910  tgagtctccatcctacttgacaggagagttccccggtgactacggttgggacactgccgg 969

                                                                  
Query: 310  actttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
            ||| || |||||||| ||||| ||| |||||||||| ||||| ||||| |||||
Sbjct: 970  actctctgctgacccagagacattctccaagaaccgtgagcttgaagtcatcca 1023



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 120/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | |||||||| || || || || || |||
Sbjct: 365 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 424

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||| || || ||||||||||| || || |||
Sbjct: 425 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgaa 484

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 485 gtgatccactgcagatgggctatgct 510



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 141/174 (81%)
 Strand = Plus / Plus

                                                                        
Query: 190  ttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccgg 249
            |||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||||||
Sbjct: 1151 ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 1210

                                                                        
Query: 250  tgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgg 309
            |||| | ||   |||| | || || |||||||| || ||||| || ||||||||||||||
Sbjct: 1211 tgagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgg 1270

                                                                  
Query: 310  actttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
            ||| || |||||||| ||||| ||| |||||||||| ||||| ||||| |||||
Sbjct: 1271 actctctgctgacccagagacattctccaagaaccgtgagcttgaagtcatcca 1324



to top

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 120/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| ||||||||||| | || |||||| | ||| |||| ||||| || || ||||||
Sbjct: 311 ggcccattctccggtgagtctccaagctacttgaccagtgaattccctggtgattatggg 370

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| ||||| ||||||||||| || || || ||||| ||||||||||| || || || 
Sbjct: 371 tgggatactgctggactttcagcagatccagaaacctttgccaagaaccgtgaactcgag 430

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 431 gtgatccactgcagatgggctatgct 456



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 140/173 (80%)
 Strand = Plus / Plus

                                                                       
Query: 191 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 250
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| ||||||||
Sbjct: 133 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 192

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||| | ||   |||| | || || |||||||| || ||||| || |||||||||||||||
Sbjct: 193 gagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgga 252

                                                                
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           || || |||||||| ||||| ||| |||||||||| ||||| ||||| |||||
Sbjct: 253 ctctctgctgacccagagacattctccaagaaccgtgagcttgaagtcatcca 305



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           ||||||| ||||| |||||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 13  tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72

                                                                       
Query: 303 ctgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatcc 362
           | || || || || |||||||| ||||| || || | |||||| ||||| ||||| ||||
Sbjct: 73  cagctggcctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatcc 132

                                    
Query: 363 attgtcgatgggccatgctcggagc 387
           |  |  | |||||||||||||||||
Sbjct: 133 acagcaggtgggccatgctcggagc 157



to top

>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA,
           partial cds
          Length = 446

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                       
Query: 287 gactatgggtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgg 346
           |||||||| ||||||||||| ||| | || || ||||||||||| || || |||||||| 
Sbjct: 312 gactatggctgggacactgctggattatccgcagaccctgagacatttgctaagaaccgt 371

                                                    
Query: 347 gagctggaagtgatccattgtcgatgggccatgctcggagc 387
           |||||||| ||||||||  | |||||||||||||| |||||
Sbjct: 372 gagctggaggtgatccacagccgatgggccatgcttggagc 412



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 77/89 (86%)
 Strand = Plus / Plus

                                                                       
Query: 275 gagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttc 334
           |||||||| || ||||| || ||||||||||| ||||| ||||| |||||||| ||||||
Sbjct: 289 gagttccctggtgactacggttgggacactgctggactatcagcagaccctgaaaccttc 348

                                        
Query: 335 gccaagaaccgggagctggaagtgatcca 363
           || |||||||| ||||| || ||||||||
Sbjct: 349 gctaagaaccgtgagctcgaggtgatcca 377



to top

>gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA
          Length = 454

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 78/89 (87%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||||||||||||||||  ||||||||| |||||||||||||| |||||  | 
Sbjct: 265 ggcccattctccggtgagcccccgtcctacctcactggtgagttcccaggtgacta-cgc 323

                                        
Query: 296 tgggacactgccggactttcagctgaccc 324
           ||||||||||| || ||||| ||||||||
Sbjct: 324 tgggacactgctgggctttccgctgaccc 352



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 133/164 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 259
           ||||||||||||||| | |||||||||   ||| | || ||| |||| ||||||||||||
Sbjct: 156 agcccatggtacggtccagaccgtgtgaagtacttagggccattctctggtgagcccccg 215

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
              ||| | || || ||||||||||| |||||||| ||||||||||| || ||||| |||
Sbjct: 216 tcgtacttgactggagagttcccaggtgactatggttgggacactgctgggctttctgct 275

                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||||| ||||| || || || ||||| || ||||| || |||||
Sbjct: 276 gacccagagacatttgcgaaaaaccgtgaactggaggtaatcca 319



to top

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || ||||||||| | |||||||||||||||||
Sbjct: 288 acgtttgccaagaacagagagctggaagtgatcca 322



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 262 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 321

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || ||||||||| | |||||||||||||||||
Sbjct: 322 acgtttgccaagaacagagagctggaagtgatcca 356



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 259 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 318

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || ||||||||| | |||||||||||||||||
Sbjct: 319 acgtttgccaagaacagagagctggaagtgatcca 353



to top

>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                       
Query: 275 gagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttc 334
           |||||||| || |||||||| ||||| ||||| ||||| ||||| |||||||| || || 
Sbjct: 562 gagttccctggtgactatggatgggatactgctggactctcagccgaccctgaaacattt 621

                                                          
Query: 335 gccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           |||| |||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 622 gccaggaaccgtgagcttgaggtgatccattgccgttgggcaatgct 668



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           ||||| ||||||||||| ||||| || ||||||||||| |||||||| || || || |||
Sbjct: 98  accggagagttcccaggtgactacggttgggacactgctggactttctgccgatccagag 157

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || ||||||||||| ||||| ||||| |||||
Sbjct: 158 acatttgccaagaaccgtgagcttgaagttatcca 192



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| |||| |||||| |||| |||||| | |||||||| || || || || || |||
Sbjct: 219 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 278

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||| || || ||||||||||| |||||||| || || ||||||||||| || || || 
Sbjct: 279 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgag 338

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           |||||||| ||  ||||||| |||||
Sbjct: 339 gtgatccactgcagatgggctatgct 364



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                        
Query: 266  ctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccct 325
            |||||||| || || || |||||||| ||||||||||||||||| || || || || || 
Sbjct: 2476 ctcaccggagaatttcccggcgactacgggtgggacactgccggcctctcggcggatcca 2535

                                                                  
Query: 326  gagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
            ||||||||||| || ||| | |||||||| |||||||| ||  |||||||||||
Sbjct: 2536 gagaccttcgcaaaaaacagagagctggaggtgatccactgcagatgggccatg 2589



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 131/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 218 gaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcaccggtgag 277
           ||||||||||| ||  | || ||| ||||||| ||||| |||   ||||| |||||||| 
Sbjct: 197 gaccgtgtgctgtatttgggtccattctccggggagccaccgtcgtacctaaccggtgaa 256

                                                                       
Query: 278 ttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttcgcc 337
           ||||| || ||||| ||||||||||| || || || || || || || ||||| ||||| 
Sbjct: 257 ttcccgggtgactacgggtgggacacggcggggctgtcggcagatccggagacgttcgcg 316

                                                     
Query: 338 aagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           |||||| | |||||||||||||||||  | ||||||||||||
Sbjct: 317 aagaacagagagctggaagtgatccacggccgatgggccatg 358



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 95/114 (83%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           |||||| |||||||| || || || ||||| || ||||||||||| || ||||| |||||
Sbjct: 219 ctaccttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctga 278

                                                                 
Query: 322 ccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggc 375
           ||||||||| ||  | |||||||| ||||| || ||||| ||||| ||||||||
Sbjct: 279 ccctgagacttttactaagaaccgtgagctcgaggtgattcattgccgatgggc 332



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           |||||||| |||||||||| | || || || || ||||||||||| ||||| ||| | ||
Sbjct: 249 ctacctcaacggtgagttcgctggtgattacggctgggacactgctggactctcatccga 308

                                                                       
Query: 322 ccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           ||| ||||||||||||   ||||| ||||| || ||||||||   |||||||||||||||
Sbjct: 309 ccccgagaccttcgcccgcaaccgcgagctcgaggtgatccacgctcgatgggccatgct 368

                 
Query: 382 cggagc 387
            |||||
Sbjct: 369 tggagc 374



 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 139 tggcgaagcccgagtcaccatgcgcaagaccg 170
           |||||||||||| |||||||||||||||||||
Sbjct: 132 tggcgaagcccgcgtcaccatgcgcaagaccg 163



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| |||||||||||||| || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | || |||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 274 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 333

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 334 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 386



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| |||||||| ||||| || ||||| ||||||||||| || || ||||| || || 
Sbjct: 303 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctttcggcggat 362

                                                    
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           || ||||| ||||| |||||| | |||||||||||||||||
Sbjct: 363 ccggagacgttcgcgaagaacagagagctggaagtgatcca 403



to top

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 130/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 ccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccgagc 262
           |||||||||||  | ||||||||||| ||  | || ||| ||||||| ||||| |||   
Sbjct: 236 ccatggtacggaccggaccgtgtgctgtatttgggtccattctccggcgagccgccgtca 295

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| |||||||| ||||| || ||||| ||||||||||| || || || || || || 
Sbjct: 296 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgtcggcggat 355

                                                    
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           || ||||| ||||| |||||| | |||||||||||||||||
Sbjct: 356 ccggagacgttcgcgaagaacagagagctggaagtgatcca 396



to top

>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding
           protein b, partial cds
          Length = 461

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 79/93 (84%)
 Strand = Plus / Plus

                                                                       
Query: 287 gactatgggtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgg 346
           ||||| |||||||||||||| || |||||||||||||| || ||||| || |||||||| 
Sbjct: 1   gactacgggtgggacactgctgggctttcagctgacccggaaacctttgctaagaaccgt 60

                                            
Query: 347 gagctggaagtgatccattgtcgatgggccatg 379
           ||||| || || || || || ||||||||||||
Sbjct: 61  gagcttgaggtcattcactgccgatgggccatg 93



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 389 ctcggagc 396



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 186 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 245

                                   
Query: 311 ctttcagctgaccctgagaccttc 334
           || || |||||||| |||||||||
Sbjct: 246 ctgtccgctgacccggagaccttc 269



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 375 ctcggagc 382



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 236 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggc 177

                                   
Query: 311 ctttcagctgaccctgagaccttc 334
           || || |||||||| |||||||||
Sbjct: 176 ctgtccgctgacccggagaccttc 153



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 184 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 243

                                   
Query: 311 ctttcagctgaccctgagaccttc 334
           || || |||||||| |||||||||
Sbjct: 244 ctgtccgctgacccggagaccttc 267



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 375 ctcggagc 382



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 322 ctcggagc 329



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 374 ctcggagc 381



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 322 ctcggagc 329



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 248 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 307

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 308 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 367

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 368 ctcggagc 375



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 374 ctcggagc 381



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 240 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 299

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 300 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 359

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 360 ctcggagc 367



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 389 ctcggagc 396



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 agctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagct 319
           |||||||| ||||| |||||||| || ||||| || |||||||| || || || || |||
Sbjct: 347 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 406

                                                                       
Query: 320 gaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||| ||||| ||||| | |||||| ||||| ||||| |||||  |  | |||||||||
Sbjct: 407 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 466

                   
Query: 380 ctcggagc 387
           ||||||||
Sbjct: 467 ctcggagc 474



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 72/84 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 gagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccgga 310
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 170 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 229

                                   
Query: 311 ctttcagctgaccctgagaccttc 334
           || || |||||||| |||||||||
Sbjct: 230 ctgtccgctgacccggagaccttc 253



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 298 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 357

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | |||||||||||||||||
Sbjct: 358 acttttgcgaagaacagagagctggaagtgatcca 392



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 217 accggtgagttcccgggtgactacgggtgggacacwgcggggctttcggcggatccggag 276

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | || |||||||||||||| || || ||||| |||||
Sbjct: 277 acttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | |||||||||||||||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatcca 322



to top

>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein
           (CipLhcb2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1033

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| |||||||| ||||| || ||||| || |||||||| || ||| | |||||||||
Sbjct: 258 tacctgaccggtgaattccctggtgactacggatgggacacagctggattatcagctgac 317

                                                                      
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           ||||| ||||| |||| |||||| ||| |||| ||||| ||  |  |||||||||||||
Sbjct: 318 cctgaaacctttgccaggaaccgtgagttggaggtgattcacagcagatgggccatgct 376



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 80/95 (84%)
 Strand = Plus / Plus

                                                                        
Query: 269  accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
            |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 1376 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 1435

                                               
Query: 329  accttcgccaagaaccgggagctggaagtgatcca 363
            || || || |||||| | |||||||||||||||||
Sbjct: 1436 acttttgcgaagaacagagagctggaagtgatcca 1470



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| || ||||| ||||| || || || || ||||||||||| ||||| |||||||||
Sbjct: 226 taccttacaggtgaattccccggtgattacggttgggacactgctggactctcagctgac 285

                                                                      
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || ||||| |||||||| ||||| || |||||||| ||  ||||||| |||||
Sbjct: 286 ccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatgct 344



to top

>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a,
             complete sequence
          Length = 48924

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 98/119 (82%)
 Strand = Plus / Plus

                                                                         
Query: 263   tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
             ||||| || ||||| ||||| || ||||| || |||||||| || ||| | |||||||||
Sbjct: 40107 tacctgactggtgaattccctggtgactacggatgggacacagctggattatcagctgac 40166

                                                                        
Query: 323   cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
             || || ||||||||||||||||| ||||| || ||||| ||  |  |||||||||||||
Sbjct: 40167 cccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgct 40225



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 278 ttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttcgcc 337
           ||||| || |||||||| ||||||||||| ||||||||||| ||||| || ||||| |||
Sbjct: 383 ttccctggtgactatggttgggacactgctggactttcagcagacccagaaacctttgcc 442

                                     
Query: 338 aagaaccgggagctggaagtgatcca 363
           |  ||||| ||||| || ||||||||
Sbjct: 443 agaaaccgtgagcttgaggtgatcca 468



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           |||||| ||||| |||||||| || ||||| || ||||||||||| || || || |||||
Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262

                                                     
Query: 322 ccctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           ||| |||||||||   ||| |||| |||||||| ||||||||
Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatcca 304



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                         
Query: 263   tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
             ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 79568 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 79509

                                                      
Query: 323   cctgagaccttcgccaagaaccgggagctggaagtgatcca 363
             || ||||| ||||| | |||| |||||||||| ||||||||
Sbjct: 79508 ccggagacgttcgcgaggaacagggagctggaggtgatcca 79468



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                            
Query: 263      tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
                ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 21808248 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21808307

                                                         
Query: 323      cctgagaccttcgccaagaaccgggagctggaagtgatcca 363
                || ||||| ||||| | |||| |||||||||| ||||||||
Sbjct: 21808308 ccggagacgttcgcgaggaacagggagctggaggtgatcca 21808348



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 197      ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
                |||| ||||||||||||  ||||||| ||  |||||||| |||| ||||| ||||||
Sbjct: 18189193 ggcaacccatggtacggccccgaccgcgtcatctacctccgcccgctctctggtgag 18189137



to top

>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1042

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 120/149 (80%)
 Strand = Plus / Plus

                                                                       
Query: 236 ggcccactctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatggg 295
           |||||| ||||||| ||||| ||||||||||| |||||  ||||||| || ||||| || 
Sbjct: 250 ggcccattctccggcgagccaccgagctaccttaccggacagttccccggagactacgga 309

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           |||||||| || || || ||||| |  || ||||| ||||  | |||||| ||||| |||
Sbjct: 310 tgggacaccgcaggtctctcagccgtacccgagacgttcgtgaggaaccgtgagctagaa 369

                                        
Query: 356 gtgatccattgtcgatgggccatgctcgg 384
           || ||||| ||  | ||||||||||||||
Sbjct: 370 gttatccactgcaggtgggccatgctcgg 398



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           |||||| || || |||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 196 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 255

                        
Query: 322 ccctgagaccttc 334
           ||| |||||||||
Sbjct: 256 cccggagaccttc 268



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacagcggggctttcggcggatccggag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || ||||| |||||| | ||  ||||||||||||| || || ||||| |||||
Sbjct: 288 actttcgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| |||||||||||||| || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | ||  ||||||||||||| || || ||||| |||||
Sbjct: 288 acttttgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                            
Query: 263      tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
                ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 21801277 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21801336

                                                         
Query: 323      cctgagaccttcgccaagaaccgggagctggaagtgatcca 363
                || ||||| ||||| | |||| |||||||||| ||||||||
Sbjct: 21801337 ccggagacgttcgcgaggaacagggagctggaggtgatcca 21801377



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 197      ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 253
                |||| ||||||||||||  ||||||| ||  |||||||| |||| ||||| ||||||
Sbjct: 18182734 ggcaacccatggtacggccccgaccgcgtcatctacctccgcccgctctctggtgag 18182678



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 257 ccgagctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttca 316
           ||||||||||| ||||| |||||||| || ||||| || ||||||||||| | |||||||
Sbjct: 677 ccgagctaccttaccggagagttccccggagactacggatgggacactgctgtactttca 618

                
Query: 317 gctga 321
           |||||
Sbjct: 617 gctga 613



to top

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 299 gacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaagtg 358
           |||||||| ||||| |||||||||||||| || || || |||||||| ||| ||||||||
Sbjct: 1   gacactgctggactgtcagctgaccctgaaacttttgctaagaaccgtgagttggaagtg 60

                
Query: 359 atcca 363
           |||||
Sbjct: 61  atcca 65



to top

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 287 gactatgggtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgg 346
           ||||| ||||||||||| ||||| || || || ||||| |||||||||||||| ||  | 
Sbjct: 18  gactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaaaaataga 77

                                            
Query: 347 gagctggaagtgatccattgtcgatgggccatg 379
           |||||||| |||||||| ||  |||||||||||
Sbjct: 78  gagctggaggtgatccactgcagatgggccatg 110



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 283 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 342

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           |  || || |||||| | ||||||||||||||||| || || ||||| |||||
Sbjct: 343 aattttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 395



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 262 ctacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctga 321
           |||||| || || |||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 201 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 260

                        
Query: 322 ccctgagaccttc 334
           ||| |||||||||
Sbjct: 261 cccggagaccttc 273



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 236 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 295

                                                    
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatcca 363
           || ||||| ||||| | |||| |||||||||| ||||||||
Sbjct: 296 ccggagacgttcgcgaggaacagggagctggaggtgatcca 336



to top

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 97/116 (83%), Gaps = 2/116 (1%)
 Strand = Plus / Plus

                                                                       
Query: 243 tctccggtgagcccccgagctacctcaccggtgagttcccaggcgactatgggtgggaca 302
           |||| |||||||||||   |||||| |||||||| ||||| || ||||| ||||||||||
Sbjct: 196 tctctggtgagcccccatcctacctgaccggtgaattccc-ggtgactacgggtgggaca 254

                                                                   
Query: 303 ctgccggactttcagct-gaccctgagaccttcgccaagaaccgggagctggaagt 357
           | ||||| || |||||  ||||| ||||| || ||||||||| | |||||||||||
Sbjct: 255 ccgccggtctgtcagccagacccagagacttttgccaagaacagagagctggaagt 310



to top

>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 732

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           ||||| || ||||| ||||| || || ||||| ||||||||||| ||  | || || || 
Sbjct: 136 taccttactggtgaattccccggtgattatggatgggacactgctggtttatctgcagat 195

                                                                       
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctc 382
           ||||| || || ||||||||||| ||||| ||||||||||| ||  ||||||| ||||| 
Sbjct: 196 cctgaaacatttgccaagaaccgtgagcttgaagtgatccactgcagatgggctatgctt 255

                      
Query: 383 ggagcacttgg 393
           || ||||||||
Sbjct: 256 ggtgcacttgg 266



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           ||||||||||||||||| ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 225 accggtgagttcccaggtgactacgggtgggacacggcggggctttcggcggatccggag 284

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || | |||| | || ||||||||||||||
Sbjct: 285 acttttgcgaggaacagagaactggaagtgatcca 319



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | || ||||||||||||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatcca 322



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | || ||||||||||||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatcca 322



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | || ||||||||||||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatcca 322



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | || ||||||||||||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatcca 322



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                              
Query: 329 accttcgccaagaaccgggagctggaagtgatcca 363
           || || || |||||| | || ||||||||||||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatcca 322



to top

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 272 ggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagacc 331
           ||||| ||||| || ||||| || ||||||||||| ||||| || || ||||||||||| 
Sbjct: 211 ggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctgagaca 270

                                                                      
Query: 332 ttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgctcggagcact 390
           || || || ||| | ||||| || ||||||||  | |||||||||||||| || |||||
Sbjct: 271 tttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgcttggtgcact 329



to top

>emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b binding polypeptide of
           photosystem II (LHCP-II AB10)
          Length = 1306

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
           |||||||| || || ||||| || || || || ||||||||||| || || |||||  ||
Sbjct: 555 tacctcactggagaattccctggtgattacggttgggacactgctggcctctcagcctac 614

                                                      
Query: 323 cctgagaccttcgccaagaaccgggagctggaagtgatccatt 365
           || ||||||||||| |||||||| ||||| ||||| |||||||
Sbjct: 615 ccagagaccttcgctaagaaccgtgagcttgaagtcatccatt 657



to top

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 293 gggtgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctg 352
           ||||||||||| |||||||| || || ||||| |||||||||||||| ||  | ||||||
Sbjct: 141 gggtgggacaccgccggactctcggccgacccagagaccttcgccaaaaatagagagctg 200

                      
Query: 353 gaagtgatcca 363
           || ||||||||
Sbjct: 201 gaggtgatcca 211



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 311 ctttcagctgaccctgagaccttcgccaagaaccgggagctggaagtgatccattgtcga 370
           ||||| ||||| || ||||| |||||||||||||| ||||| || ||||||||  || ||
Sbjct: 34  ctttctgctgatcccgagactttcgccaagaaccgtgagctcgaggtgatccacagtaga 93

                                  
Query: 371 tgggccatgctcggagcacttgg 393
           ||||| ||||| ||||| |||||
Sbjct: 94  tgggctatgcttggagcccttgg 116



to top

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 93/114 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 ctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccct 325
           |||||||| || || || |||||||| ||||||||||||||||   | || || || || 
Sbjct: 257 ctcaccggagaatttcccggcgactacgggtgggacactgccgccgtctcggcggatcca 316

                                                                 
Query: 326 gagaccttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatg 379
           ||||||||||| || ||| | |||||||| |||||||| ||  |||||||||||
Sbjct: 317 gagaccttcgcaaaaaacagagagctggaggtgatccactgcagatgggccatg 370



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 90/110 (81%)
 Strand = Plus / Plus

                                                                       
Query: 275 gagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgagaccttc 334
           |||||||| |||||||||||||||||||| || || || || || ||||| ||| | |||
Sbjct: 274 gagttcccgggcgactatgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                             
Query: 335 gccaagaaccgggagctggaagtgatccattgtcgatgggccatgctcgg 384
           || | |||| ||| |||||| ||||||||  | || ||||| ||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein,
           complete cds
          Length = 895

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 296 tgggacactgccggactttcagctgaccctgagaccttcgccaagaaccgggagctggaa 355
           ||||||||||| ||||| ||||||||||| ||||| || || |  ||||| ||||| || 
Sbjct: 293 tgggacactgctggactctcagctgaccccgagacatttgctagaaaccgtgagcttgag 352

                                     
Query: 356 gtgatccattgtcgatgggccatgct 381
           ||||| ||||| || |||||||||||
Sbjct: 353 gtgattcattgccgttgggccatgct 378



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 269 accggtgagttcccaggcgactatgggtgggacactgccggactttcagctgaccctgag 328
           |||||||||||||| || ||||| |||||||| || || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcggatccggag 287

                                                                
Query: 329 accttcgccaagaaccgggagctggaagtgatccattgtcgatgggccatgct 381
           || || || |||||| | || |||||||||||||| || || ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyll a/b-binding protein,
            partial
          Length = 2036

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                        
Query: 263  tacctcaccggtgagttcccaggcgactatgggtgggacactgccggactttcagctgac 322
            ||||||||||| ||||| || ||||||||||| |||||||| |||||  | || || |||
Sbjct: 1568 tacctcaccggagagtttcccggcgactatggttgggacaccgccggtttatccgcagac 1627

                                 
Query: 323  cctgagaccttcgccaagaac 343
            |||||  |||| |||||||||
Sbjct: 1628 cctgaagcctttgccaagaac 1648


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,624,187
Number of Sequences: 3902068
Number of extensions: 2624187
Number of successful extensions: 46865
Number of sequences better than 10.0: 331
Number of HSP's better than 10.0 without gapping: 321
Number of HSP's successfully gapped in prelim test: 14
Number of HSP's that attempted gapping in prelim test: 46099
Number of HSP's gapped (non-prelim): 708
length of query: 396
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 374
effective length of database: 17,147,199,772
effective search space: 6413052714728
effective search space used: 6413052714728
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top