>gb|AC149571.3| Rhinolophus ferrumequinum clone VMRC7-305L23, complete sequence
          Length = 190426

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      ctggattcccgggtccctcc 27
              ||||||||||||||||||||
Sbjct: 178894 ctggattcccgggtccctcc 178875

>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold
          Length = 1756392

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      ctggattcccgggtccctcc 27
              ||||||||||||||||||||
Sbjct: 794738 ctggattcccgggtccctcc 794719

>gb|AC012527.7| Homo sapiens chromosome 15, clone RP11-44J20, complete sequence
          Length = 162955

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    gtggggagggtagggggatg 67
             ||||||||||||||||||||
Sbjct: 77934 gtggggagggtagggggatg 77953

>gb|AC006367.3|AC006367 Homo sapiens BAC clone RP11-167L9 from 7p14-p15, complete sequence
          Length = 130469

 Score = 40.1 bits (20), Expect = 0.84
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     gtggggagggtagggggatg 67
              ||||||||||||||||||||
Sbjct: 113221 gtggggagggtagggggatg 113202

>gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases 501860 to 700960 (section 3 of 3)
              of the complete sequence
          Length = 199101

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggtggggagggtaggggga 65
              |||||||||||||||||||
Sbjct: 106654 ggtggggagggtaggggga 106636

>gb|AC134561.5| Mus musculus BAC clone RP24-111C16 from chromosome 8, complete sequence
          Length = 179978

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggtggggagggtaggggga 65
             |||||||||||||||||||
Sbjct: 13062 ggtggggagggtaggggga 13080

>gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, complete sequence
          Length = 204437

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 47   ggtggggagggtaggggga 65
            |||||||||||||||||||
Sbjct: 8730 ggtggggagggtaggggga 8712

>gb|AC122865.3| Mus musculus BAC clone RP23-143B2 from 8, complete sequence
          Length = 201139

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ggtggggagggtaggggga 65
             |||||||||||||||||||
Sbjct: 53226 ggtggggagggtaggggga 53208

>emb|AL031010.1|HS422F24 Human DNA sequence from clone RP3-422F24 on chromosome 6q24.1-25.2
             Contains the C6orf71 gene and a signal sequence receptor,
             alpha (translocon-associated protein alpha) (SSR1) (TRAPA)
             pseudogene, complete sequence
          Length = 107159

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 47    ggtggggagggtagggggatggatttg 73
             ||||||||||| |||||||||| ||||
Sbjct: 19587 ggtggggagggaagggggatggctttg 19613

>emb|AL596095.18| Mouse DNA sequence from clone RP23-188H3 on chromosome 11 Contains the
             3' end of the Il4 gene for interleukin 4, the Kif3a gene
             for kinesin family member 3A, a novel gene, the Sept8 gene
             for septin 8, a ribosomal protein L9 (RPL9) pseudogene,
             three novel genes (A830006N08) (1300007L22Rik) and six CpG
             islands, complete sequence
          Length = 170943

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 47    ggtggggagggtagggggatgga 69
             ||||||| |||||||||||||||
Sbjct: 22264 ggtggggtgggtagggggatgga 22286

>gb|AC153854.7| Mus musculus 10 BAC RP23-203H5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 181264

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggtggggagggtaggggga 65
              |||||||||||||||||||
Sbjct: 141297 ggtggggagggtaggggga 141279

>gb|AC008951.6| Homo sapiens chromosome 5 clone CTD-2337A12, complete sequence
          Length = 124151

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggtggggagggtaggggga 65
             |||||||||||||||||||
Sbjct: 74701 ggtggggagggtaggggga 74719

>gb|AC149092.6| Pan troglodytes BAC clone CH251-553I6 from chromosome 7, complete
             sequence
          Length = 194702

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 49    tggggagggtagggggatg 67
             |||||||||||||||||||
Sbjct: 70099 tggggagggtagggggatg 70081

>gb|AC161019.3| Pan troglodytes BAC clone CH251-7O2 from chromosome 7, complete
             sequence
          Length = 165769

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 49    tggggagggtagggggatg 67
             |||||||||||||||||||
Sbjct: 65387 tggggagggtagggggatg 65405

>gb|AC073057.6| Homo sapiens BAC clone RP11-114G11 from 7, complete sequence
          Length = 178105

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 49     tggggagggtagggggatg 67
              |||||||||||||||||||
Sbjct: 166744 tggggagggtagggggatg 166762

>dbj|AK035462.1| Mus musculus adult male urinary bladder cDNA, RIKEN full-length
            enriched library, clone:9530051L07 product:hypothetical
            protein, full insert sequence
          Length = 4551

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 47   ggtggggagggtagggggatgga 69
            ||||||| |||||||||||||||
Sbjct: 3067 ggtggggtgggtagggggatgga 3089

>gb|AC018866.9| Homo sapiens BAC clone RP11-57J18 from 2, complete sequence
          Length = 154983

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    gggagggtagggggatgga 69
             |||||||||||||||||||
Sbjct: 93766 gggagggtagggggatgga 93748

>gb|AC011013.17|AC011013 Mus musculus chromosome 11, clone RP23-218N2, complete sequence
          Length = 201728

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 47     ggtggggagggtagggggatgga 69
              ||||||| |||||||||||||||
Sbjct: 184116 ggtggggtgggtagggggatgga 184138

>gb|AC148935.6| Pan troglodytes BAC clone CH251-485J2 from chromosome 7, complete
             sequence
          Length = 215177

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 49    tggggagggtagggggatg 67
             |||||||||||||||||||
Sbjct: 81788 tggggagggtagggggatg 81770

>gb|AF107342.1|AF107342 Mus musculus Balb/c trypsinogen 16 gene, complete cds
          Length = 42794

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ggtggggagggtaggggga 65
             |||||||||||||||||||
Sbjct: 37885 ggtggggagggtaggggga 37867

>gb|AC002128.1|AC002128 Human DNA from chromosome 19 cosmid F19410, genomic sequence, complete
             sequence
          Length = 45328

 Score = 38.2 bits (19), Expect = 3.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    gtggggagggtagggggat 66
             |||||||||||||||||||
Sbjct: 15274 gtggggagggtagggggat 15292


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 382,658
Number of Sequences: 3902068
Number of extensions: 382658
Number of successful extensions: 29838
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29807
Number of HSP's gapped (non-prelim): 31
length of query: 80
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 59
effective length of database: 17,151,101,840
effective search space: 1011915008560
effective search space used: 1011915008560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)