| Clone Name | baet81g09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 56.0 bits (28), Expect = 3e-05 Identities = 85/104 (81%) Strand = Plus / Plus Query: 52 caatggcggcaacgaccatgtccctctcttccccagcctttgccggcaaggtagtgaagg 111 ||||||||||| | |||||||||||||| ||| | ||||||||||||||| |||||| Sbjct: 8 caatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtgaaga 67 Query: 112 acttgccatcgtcgtctcttttcggggaggctcgcgtcaccatg 155 | | ||||| | | |||| || || ||||| |||||||||||| Sbjct: 68 atgtaccatctttggctctcttgggcgaggcccgcgtcaccatg 111
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 48.1 bits (24), Expect = 0.008 Identities = 42/48 (87%) Strand = Plus / Plus Query: 108 aaggacttgccatcgtcgtctcttttcggggaggctcgcgtcaccatg 155 |||||| |||| |||||| | || ||||||||||| |||||||||||| Sbjct: 118 aaggacctgccgtcgtcggcgctcttcggggaggcgcgcgtcaccatg 165
>gb|BC091085.1| Xenopus tropicalis MGC108424 protein, mRNA (cDNA clone MGC:108424 IMAGE:7024763), complete cds Length = 2592 Score = 44.1 bits (22), Expect = 0.12 Identities = 22/22 (100%) Strand = Plus / Minus Query: 7 attcttggagaacaaaatcagc 28 |||||||||||||||||||||| Sbjct: 1526 attcttggagaacaaaatcagc 1505
>ref|NM_001030449.1| Xenopus tropicalis MGC108424 protein (MGC108424), mRNA Length = 2592 Score = 44.1 bits (22), Expect = 0.12 Identities = 22/22 (100%) Strand = Plus / Minus Query: 7 attcttggagaacaaaatcagc 28 |||||||||||||||||||||| Sbjct: 1526 attcttggagaacaaaatcagc 1505
>emb|AL353786.16| Human DNA sequence from clone RP5-1175B15 on chromosome X Contains the gene for a protein similar to rat fertility related protein WMP1, the 3' end of the PTPN21 gene for protein tyrosine phosphatase non-receptor type 21 and CpG islands, complete sequence Length = 139565 Score = 44.1 bits (22), Expect = 0.12 Identities = 22/22 (100%) Strand = Plus / Plus Query: 69 atgtccctctcttccccagcct 90 |||||||||||||||||||||| Sbjct: 102165 atgtccctctcttccccagcct 102186
>gb|AF261102.1|AF261102 Brassica rapa thioglucoside glucohydrolase 1 gene, partial cds Length = 793 Score = 44.1 bits (22), Expect = 0.12 Identities = 25/26 (96%) Strand = Plus / Minus Query: 7 attcttggagaacaaaatcagcatac 32 ||||||||| |||||||||||||||| Sbjct: 119 attcttggaaaacaaaatcagcatac 94
>emb|AL162171.4|CNS01RHP Human chromosome 14 DNA sequence BAC R-507K2 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 197550 Score = 44.1 bits (22), Expect = 0.12 Identities = 22/22 (100%) Strand = Plus / Minus Query: 69 atgtccctctcttccccagcct 90 |||||||||||||||||||||| Sbjct: 178932 atgtccctctcttccccagcct 178911
>dbj|AB079894.1| Sus scrofa gene for T-cell receptor beta-chain, Dbeta-1 to 3' End Vbeta region Length = 34575 Score = 44.1 bits (22), Expect = 0.12 Identities = 25/26 (96%) Strand = Plus / Minus Query: 69 atgtccctctcttccccagcctttgc 94 |||||||| ||||||||||||||||| Sbjct: 29286 atgtccctttcttccccagcctttgc 29261
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 42.1 bits (21), Expect = 0.48 Identities = 27/29 (93%) Strand = Plus / Plus Query: 127 ctcttttcggggaggctcgcgtcaccatg 155 |||| ||||| |||||||||||||||||| Sbjct: 92 ctctcttcggtgaggctcgcgtcaccatg 120
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete cds Length = 1010 Score = 42.1 bits (21), Expect = 0.48 Identities = 39/45 (86%) Strand = Plus / Plus Query: 66 accatgtccctctcttccccagcctttgccggcaaggtagtgaag 110 |||||| | |||||||||||| | |||||||||||| ||||||| Sbjct: 60 accatggctctctcttccccatctcttgccggcaaggcagtgaag 104
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ccatcgacaacaatggcggc 61 |||||||||||||||||||| Sbjct: 28525526 ccatcgacaacaatggcggc 28525545 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 39 cctccatcgacaacaatggcggc 61 ||||||||||| ||||||||||| Sbjct: 34588168 cctccatcgacgacaatggcggc 34588146
>emb|AL365506.10| Human DNA sequence from clone RP11-640E12 on chromosome 10, complete sequence Length = 81831 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 102 gtagtgaaggacttgccatc 121 |||||||||||||||||||| Sbjct: 81741 gtagtgaaggacttgccatc 81722
>emb|AL355472.19| Human DNA sequence from clone RP5-827C21 on chromosome 1 Contains a ribosomal protein S15 (RPS15) pseudogene, three novel genes (LOC388753), the 3' end of the TARBP1 gene for TAR (HIV) RNA binding protein 1 and a CpG island, complete sequence Length = 92628 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 caaggtagtgaaggacttgc 117 |||||||||||||||||||| Sbjct: 11797 caaggtagtgaaggacttgc 11816
>emb|AL356464.15| Human DNA sequence from clone RP11-38O23 on chromosome Xp11.23-11.4 Contains the 3'end of the SSX6 gene for synovial sarcoma X breakpoint 6, a novel gene similar to lysozyme C (1,4-beta-N-acetylmuramidase), a zinc finger protein 21 (ZNF21) pseudogene, an ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene, a SSX2 pseudogene (psiSSX2), a S100 calcium binding protein A11 (calgizzarin)(S100A11) pseudogene, the 5'end of the SSX5 gene for synovial sarcoma X breakpoint 5 and one CpG island, complete sequence Length = 73851 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 accatgtccctctcttcccc 85 |||||||||||||||||||| Sbjct: 15180 accatgtccctctcttcccc 15199
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 ccccagcctttgccggcaag 101 |||||||||||||||||||| Sbjct: 5609702 ccccagcctttgccggcaag 5609683
>gb|AC073174.5| Homo sapiens chromosome 10 clone RP11-319F12, complete sequence Length = 161551 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 gtagtgaaggacttgccatc 121 |||||||||||||||||||| Sbjct: 159642 gtagtgaaggacttgccatc 159661
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ccatcgacaacaatggcggc 61 |||||||||||||||||||| Sbjct: 28616850 ccatcgacaacaatggcggc 28616869 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 39 cctccatcgacaacaatggcggc 61 ||||||||||| ||||||||||| Sbjct: 34678240 cctccatcgacgacaatggcggc 34678218
>gb|AF339312.1|AF339312 Hepatitis C virus isolate HCP98 polyprotein gene, E2 protein PePHD region, partial cds Length = 333 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 gccggcaaggtagtgaagga 112 |||||||||||||||||||| Sbjct: 140 gccggcaaggtagtgaagga 121
>gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence Length = 143681 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 ccatcgacaacaatggcggc 61 |||||||||||||||||||| Sbjct: 119656 ccatcgacaacaatggcggc 119675
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 46 cgacaacaatggcggcaacg 65 |||||||||||||||||||| Sbjct: 3533888 cgacaacaatggcggcaacg 3533869
>emb|Z98304.1|HS54B20 Human DNA sequence from clone RP1-54B20 on chromosome Xp11.1-11.3 Contains the 5' end of the SSX6 gene for synovial sarcoma X breakpoint 6, two novel genes similar to a C2H2 type zinc finger protein, a novel gene, a novel gene similar to lysozyme C (1,4-beta-N-acetylmuramidase), the ZNF81 gene for zinc finger protein 81 (HFZ20) and three CpG islands, complete sequence Length = 209618 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 accatgtccctctcttcccc 85 |||||||||||||||||||| Sbjct: 107790 accatgtccctctcttcccc 107771
>gb|AC122382.4| Mus musculus BAC clone RP23-479D11 from 13, complete sequence Length = 190429 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 22 aatcagcatacacaagacct 41 |||||||||||||||||||| Sbjct: 90029 aatcagcatacacaagacct 90010
>gb|AY634220.1| Oikopleura dioica transposon LTR retrotransposon Tor4a, partial sequence Length = 6823 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 45 tcgacaacaatggcggcaacgac 67 |||||||| |||||||||||||| Sbjct: 589 tcgacaacgatggcggcaacgac 611
>gb|AC108813.8| Mus musculus chromosome 1, clone RP23-320P13, complete sequence Length = 198759 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 74 cctctcttccccagccttt 92 ||||||||||||||||||| Sbjct: 69473 cctctcttccccagccttt 69455
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 36 agacctccatcgacaacaa 54 ||||||||||||||||||| Sbjct: 2187787 agacctccatcgacaacaa 2187769
>ref|XM_591416.2| PREDICTED: Bos taurus hypothetical LOC513688 (LOC513688), mRNA Length = 2194 Score = 38.2 bits (19), Expect = 7.4 Identities = 25/27 (92%) Strand = Plus / Minus Query: 88 cctttgccggcaaggtagtgaaggact 114 ||||||| |||||| |||||||||||| Sbjct: 1315 cctttgctggcaagttagtgaaggact 1289
>gb|AC124386.4| Mus musculus BAC clone RP24-422C24 from chromosome 1, complete sequence Length = 146080 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 ccatgtccctctcttcccc 85 ||||||||||||||||||| Sbjct: 45419 ccatgtccctctcttcccc 45401
>gb|AC101659.12| Mus musculus chromosome 7, clone RP23-202M11, complete sequence Length = 244819 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 228613 acaaaatcagcatacacaa 228595
>gb|AC102692.6| Mus musculus chromosome 18, clone RP24-491K18, complete sequence Length = 225042 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 tgtccctctcttccccagc 88 ||||||||||||||||||| Sbjct: 161686 tgtccctctcttccccagc 161704
>emb|BX323827.5| Human DNA sequence from clone RP4-732K23 on chromosome X, complete sequence Length = 57941 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 45019 acaaaatcagcatacacaa 45001
>emb|AL513364.10| Human DNA sequence from clone RP11-480N10 on chromosome 1, complete sequence Length = 74951 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 1224 acaaaatcagcatacacaa 1242
>emb|AL357115.24| Human DNA sequence from clone RP11-102P23 on chromosome Xq13.3-21.1 Contains the 5' end of the NSBP1 gene for nucleosomal binding protein 1 and the SH3BGRL gene for SH3 domain binding glutamic acid-rich protein like, complete sequence Length = 164012 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 82042 acaaaatcagcatacacaa 82024
>emb|AL357512.15| Human DNA sequence from clone RP11-541J2 on chromosome 1 Contains a nicotinamide nucleotide adenylyltransferase 1 (NMNAT1) pseudogene and a high-mobility group box 3 (HMGB3) pseudogene, complete sequence Length = 184024 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 777 acaaaatcagcatacacaa 759
>gb|AC133339.3| Oryza sativa chromosome 3 BAC OSJNBa0078D06 genomic sequence, complete sequence Length = 164236 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 39 cctccatcgacaacaatggcggc 61 ||||||||||| ||||||||||| Sbjct: 45885 cctccatcgacgacaatggcggc 45863
>gb|AC162904.4| Mus musculus BAC clone RP24-152H15 from chromosome 1, complete sequence Length = 147442 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 ccatgtccctctcttcccc 85 ||||||||||||||||||| Sbjct: 140898 ccatgtccctctcttcccc 140880
>dbj|AK131654.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched library, clone:1520403K13 product:unclassifiable, full insert sequence Length = 3812 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 tcctcattcttggagaaca 20 ||||||||||||||||||| Sbjct: 1926 tcctcattcttggagaaca 1944
>gb|AY055726.2| Mus musculus synovial sarcoma associated SS18 (Ss18) gene, complete cds, alternatively spliced Length = 64533 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 70 tgtccctctcttccccagc 88 ||||||||||||||||||| Sbjct: 38790 tgtccctctcttccccagc 38808
>gb|AC139426.2| Homo sapiens chromosome 15, clone RP13-395E19, complete sequence Length = 188448 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 105713 acaaaatcagcatacacaa 105731
>gb|AC133778.4| Oryza sativa chromosome 3 BAC OSJNBb0027B08 genomic sequence, complete sequence Length = 129302 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 39 cctccatcgacaacaatggcggc 61 ||||||||||| ||||||||||| Sbjct: 55165 cctccatcgacgacaatggcggc 55187
>gb|AC135731.6| Homo sapiens chromosome 15, clone RP11-261B23, complete sequence Length = 123089 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 87508 acaaaatcagcatacacaa 87490
>gb|AC021413.16| Homo sapiens chromosome 15, clone RP11-30N16, complete sequence Length = 199198 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 acaaaatcagcatacacaa 36 ||||||||||||||||||| Sbjct: 170265 acaaaatcagcatacacaa 170247
>gb|AF256078.1|AF256078 Drosophila simulans strain sim8 cut protein (ct) gene, partial cds Length = 1090 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 acaacaatggcggcaacga 66 ||||||||||||||||||| Sbjct: 859 acaacaatggcggcaacga 877
>gb|AF256077.1|AF256077 Drosophila simulans strain sim7 cut protein (ct) gene, partial cds Length = 1090 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 acaacaatggcggcaacga 66 ||||||||||||||||||| Sbjct: 859 acaacaatggcggcaacga 877
>gb|AF256076.1|AF256076 Drosophila simulans strain sim5 cut protein (ct) gene, partial cds Length = 1090 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 acaacaatggcggcaacga 66 ||||||||||||||||||| Sbjct: 859 acaacaatggcggcaacga 877
>gb|AF256075.1|AF256075 Drosophila simulans strain sim4 cut protein (ct) gene, partial cds Length = 1090 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 acaacaatggcggcaacga 66 ||||||||||||||||||| Sbjct: 859 acaacaatggcggcaacga 877
>gb|AF256074.1|AF256074 Drosophila simulans strain sim3 cut protein (ct) gene, partial cds Length = 1090 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 acaacaatggcggcaacga 66 ||||||||||||||||||| Sbjct: 859 acaacaatggcggcaacga 877
>gb|AF256073.1|AF256073 Drosophila simulans strain sim2 cut protein (ct) gene, partial cds Length = 1090 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 48 acaacaatggcggcaacga 66 ||||||||||||||||||| Sbjct: 859 acaacaatggcggcaacga 877
>emb|BX511004.9| Zebrafish DNA sequence from clone RP71-45K5 in linkage group 19, complete sequence Length = 168626 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 39 cctccatcgacaacaatgg 57 ||||||||||||||||||| Sbjct: 143076 cctccatcgacaacaatgg 143094
>gb|AC130723.4| Mus musculus BAC clone RP24-409P7 from 8, complete sequence Length = 197951 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 gtccctctcttccccagcc 89 ||||||||||||||||||| Sbjct: 103997 gtccctctcttccccagcc 104015
>emb|AL928586.10| Mouse DNA sequence from clone RP23-353H5 on chromosome 2, complete sequence Length = 105895 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 21 aaatcagcatacacaagac 39 ||||||||||||||||||| Sbjct: 34028 aaatcagcatacacaagac 34046
>emb|AL833797.6| Mouse DNA sequence from clone RP23-89B11 on chromosome 2, complete sequence Length = 165400 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 9 tcttggagaacaaaatcag 27 ||||||||||||||||||| Sbjct: 98208 tcttggagaacaaaatcag 98226
>gb|AC165249.2| Mus musculus BAC clone RP24-157P13 from chromosome 12, complete sequence Length = 193902 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 2 tcctcattcttggagaaca 20 ||||||||||||||||||| Sbjct: 131440 tcctcattcttggagaaca 131458 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,237,504 Number of Sequences: 3902068 Number of extensions: 1237504 Number of successful extensions: 90807 Number of sequences better than 10.0: 52 Number of HSP's better than 10.0 without gapping: 54 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 90490 Number of HSP's gapped (non-prelim): 316 length of query: 155 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 133 effective length of database: 17,147,199,772 effective search space: 2280577569676 effective search space used: 2280577569676 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)