ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet78f09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M27303.1|BLYCAMA Barley cam gene encoding calmodulin, complet... 285 3e-74
2gb|U49103.1|TAU49103 Triticum aestivum calmodulin TaCaM3-2 mRNA,... 216 2e-53
3gb|U49104.1|TAU49104 Triticum aestivum calmodulin TaCaM3-3 mRNA,... 208 6e-51
4gb|U48693.1|TAU48693 Triticum aestivum calmodulin TaCaM3-1 mRNA,... 208 6e-51
5dbj|AK070090.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 5e-45
6dbj|AK059756.1| Oryza sativa (japonica cultivar-group) cDNA clon... 188 5e-45
7gb|AF042840.1|AF042840 Oryza sativa clone F14605 calmodulin (CaM... 188 5e-45
8ref|XM_479602.1| Oryza sativa (japonica cultivar-group), mRNA 180 1e-42
9gb|AF441191.1|AF441191 Oryza sativa clone 15079 calmodulin (CaM)... 180 1e-42
10dbj|AK071852.1| Oryza sativa (japonica cultivar-group) cDNA clon... 180 1e-42
11gb|BT017532.1| Zea mays clone EL01N0421H06.c mRNA sequence 178 5e-42
12gb|U48689.1|TAU48689 Triticum aestivum calmodulin TaCaM1-3 mRNA,... 172 3e-40
13emb|Z12827.1|OSCALMOD1 O.sativa gene encoding calmodulin 170 1e-39
14gb|AY104071.1| Zea mays PCO074293 mRNA sequence 170 1e-39
15gb|L18913.1|RICCALMODU Oryza sativa calmodulin gene, complete cds 170 1e-39
16ref|NM_188025.1| Oryza sativa (japonica cultivar-group), Ozsa844... 163 3e-37
17gb|U48688.1|TAU48688 Triticum aestivum calmodulin TaCaM1-2 mRNA,... 159 5e-36
18gb|U48242.1|TAU48242 Triticum aestivum calmodulin TaCaM1-1 mRNA,... 159 5e-36
19emb|X77396.1|ZMCAM1 Z.mays CaM1 mRNA for calmodulin 157 2e-35
20gb|U48692.1|TAU48692 Triticum aestivum calmodulin TaCaM2-3 mRNA,... 155 7e-35
21emb|X65016.1|OSCALM O.sativa mRNA for calmodulin 153 3e-34
22emb|X77397.1|ZMCAM2 Z.mays CaM2 mRNA for calmodulin 151 1e-33
23gb|BT017909.1| Zea mays clone EL01N0517D03.c mRNA sequence 149 4e-33
24gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 149 4e-33
25gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare str... 149 4e-33
26gb|S81594.1| auxin-regulated calmodulin [Vigna radiata=mung bean... 149 4e-33
27dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 149 4e-33
28dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 149 4e-33
29dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic D... 149 4e-33
30dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic D... 149 4e-33
31dbj|AK063566.1| Oryza sativa (japonica cultivar-group) cDNA clon... 149 4e-33
32gb|U48691.1|TAU48691 Triticum aestivum calmodulin TaCaM2-2 mRNA,... 147 2e-32
33gb|AY106452.1| Zea mays PCO074292 mRNA sequence 143 3e-31
34gb|U49105.1|TAU49105 Triticum aestivum calmodulin TaCaM4-1 mRNA,... 143 3e-31
35gb|AF441190.1|AF441190 Oryza sativa clone 15295 calmodulin (CaM)... 141 1e-30
36gb|L20691.1|VIRCALMOD Vigna radiata calmodulin mRNA, complete cds 141 1e-30
37dbj|AK121606.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
38dbj|AK119167.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
39dbj|AK059534.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 1e-30
40gb|AY103899.1| Zea mays PCO074294 mRNA sequence 141 1e-30
41gb|AF042839.1|AF042839 Oryza sativa calmodulin (CaM2) mRNA, comp... 141 1e-30
42ref|NM_188123.1| Oryza sativa (japonica cultivar-group), Ozsa855... 139 4e-30
43ref|XM_475464.1| Oryza sativa (japonica cultivar-group), predic... 139 4e-30
44emb|AJ427338.1|BOL427338 Brassica oleracea mRNA for calmodulin 2... 139 4e-30
45gb|AY752882.1| Aegiceras corniculatum calmodulin mRNA, complete cds 139 4e-30
46gb|AF292108.1|AF292108 Prunus avium calmodulin mRNA, complete cds 139 4e-30
47dbj|AK058646.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 4e-30
48gb|U20297.1|STU20297 Solanum tuberosum clone PCM8 calmodulin gen... 139 4e-30
49dbj|AB050840.1| Nicotiana tabacum mRNA for calmodulin NtCaM4, co... 139 4e-30
50gb|AF466266.1| Sonneratia paracaseolaris calmodulin gene, comple... 137 2e-29
51gb|AY275526.1| Pyrus communis calmodulin mRNA, partial cds 137 2e-29
52dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 135 7e-29
53dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic D... 135 7e-29
54gb|L01431.1|SOYSCAM2X Soybean calmodulin (SCaM-2) mRNA, complete... 135 7e-29
55gb|AY517930.1| Arachis hypogaea calmodulin (CaM1) mRNA, complete... 133 3e-28
56emb|Z12828.1|OSCALMOD2 O.sativa gene encoding calmodulin 133 3e-28
57dbj|AP000815.1| Oryza sativa (japonica cultivar-group) genomic D... 133 3e-28
58gb|DQ180316.1| Fragaria x ananassa clone PBCESTFXA11 SSR marker 133 3e-28
59gb|L18914.1|RICCALMODL Oryza sativa calmodulin gene, complete cds 133 3e-28
60dbj|AB050839.1| Nicotiana tabacum mRNA for calmodulin NtCaM3, co... 131 1e-27
61emb|Y13974.1|ZMCALMODU Zea mays mRNA for calmodulin 125 6e-26
62emb|X74490.1|ZMRNCAL Z.mays mRNA for calmodulin 125 6e-26
63emb|AJ271913.1|OSA271913 Oryza sativa partial mRNA for putative ... 125 6e-26
64gb|AF030034.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-3... 125 6e-26
65gb|AY109837.1| Zea mays CL1769_2 mRNA sequence 125 6e-26
66ref|NM_180529.2| Arabidopsis thaliana CAM6 (CALMODULIN 6); calci... 123 3e-25
67gb|AY656687.1| Daucus carota calmodulin cam-204 mRNA, complete cds 123 3e-25
68gb|AY656686.1| Daucus carota calmodulin cam-203 mRNA, complete cds 123 3e-25
69gb|DQ186610.1| Catharanthus roseus calmodulin 2 mRNA, complete cds 123 3e-25
70gb|AY517933.1| Arachis hypogaea calmodulin (CaM1) gene, complete... 123 3e-25
71gb|AY364012.1| Daucus carota calmodulin 8 mRNA, partial cds 123 3e-25
72emb|Z12024.1|ATCMACAM6 A.thaliana mRNA (clone ACaM6) for calmodulin 123 3e-25
73emb|X59751.1|DCCAM1G Carrot Ccam-1 gene for calmodulin 123 3e-25
74gb|AY094037.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, co... 123 3e-25
75gb|AY050350.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, co... 123 3e-25
76emb|BX822955.1|CNS0A7H5 Arabidopsis thaliana Full-length cDNA Co... 123 3e-25
77emb|BX825155.1|CNS0A68K Arabidopsis thaliana Full-length cDNA Co... 123 3e-25
78gb|M88307.1|BNACALM Brassica juncea calmodulin mRNA, complete cds 123 3e-25
79gb|U10150.1|BNU10150 Brassica napus Naehan calmodulin (bcm1) mRN... 123 3e-25
80gb|BT018042.1| Zea mays clone EL01N0531A07.c mRNA sequence 119 4e-24
81gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome... 119 4e-24
82gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL03... 119 4e-24
83dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 119 4e-24
84gb|AY572856.1| Arachis hypogaea calmodulin (CaM-3) gene, complet... 117 2e-23
85emb|AJ843115.1| Plantago major mRNA for calmodulin (cam2 gene) 117 2e-23
86gb|AF030033.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-2... 117 2e-23
87gb|AF031482.1|AF031482 Zea mays calmodulin (Zmrcalm) mRNA, compl... 117 2e-23
88ref|NM_114249.2| Arabidopsis thaliana CAM7 (CALMODULIN 7); calci... 115 6e-23
89gb|DQ207852.1| Solanum tuberosum clone 075A11 calmodulin-like mR... 115 6e-23
90gb|BT025511.1| Arabidopsis thaliana At3g43810 mRNA, complete cds 115 6e-23
91gb|AY656694.1| Daucus carota calmodulin cam-211 mRNA, complete cds 115 6e-23
92gb|AY656693.1| Daucus carota calmodulin cam-210 mRNA, complete cds 115 6e-23
93gb|AY656691.1| Daucus carota calmodulin cam-208 mRNA, complete cds 115 6e-23
94gb|AY656689.1| Daucus carota calmodulin cam-206 mRNA, complete cds 115 6e-23
95gb|AY656688.1| Daucus carota calmodulin cam-205 mRNA, complete cds 115 6e-23
96gb|AY656685.1| Daucus carota calmodulin cam-202 mRNA, complete cds 115 6e-23
97gb|AY656684.1| Daucus carota calmodulin cam-201 mRNA, complete cds 115 6e-23
98gb|AY543015.1| Daucus carota calmodulin cam-16 mRNA, complete cds 115 6e-23
99gb|AF178073.1| Arabidopsis thaliana calmodulin 7 (CAM7) mRNA, co... 115 6e-23
100gb|AY364011.1| Daucus carota calmodulin 4 mRNA, partial cds 115 6e-23
101gb|DQ450840.1| Solanum chacoense calmodulin (CAM1) mRNA, complet... 115 6e-23
102emb|Z12839.1|LLCALMOD L.longiflorum mRNA encoding calmodulin 115 6e-23
103emb|X85091.1|MPCAM M.pyrifera mRNA for calmodulin 115 6e-23
104emb|X60738.1|MDCAMR M.domestica CaM mRNA for calmodulin 115 6e-23
105emb|AJ318521.1|SCO318521 Solanum commersonii mRNA for putative c... 115 6e-23
106gb|AY070232.1| Vitis vinifera calmodulin mRNA, complete cds 115 6e-23
107gb|AF295637.1|AF295637 Elaeis guineensis calmodulin mRNA, comple... 115 6e-23
108gb|AY088477.1| Arabidopsis thaliana clone 7008 mRNA, complete se... 115 6e-23
109gb|U20294.1|STU20294 Solanum tuberosum clone PCM5 calmodulin gen... 115 6e-23
110gb|L01432.1|SOYSCAM3X Soybean calmodulin (SCaM-3) mRNA, complete... 115 6e-23
111gb|L18912.1|LILCALMODU Lilium longiflorum calmodulin mRNA, compl... 115 6e-23
112gb|L14071.1|BYNCALMOD Bryonia dioica calmodulin (Bc329) mRNA, co... 115 6e-23
113dbj|AB050842.1| Nicotiana tabacum mRNA for calmodulin NtCaM6, co... 115 6e-23
114ref|NM_115539.2| Arabidopsis thaliana CAM3 (CALMODULIN 3); calci... 113 2e-22
115gb|AY091301.1| Arabidopsis thaliana putative calmodulin-3 protei... 113 2e-22
116gb|AY046048.1| Arabidopsis thaliana putative calmodulin-3 protei... 113 2e-22
117gb|DQ398935.1| Vigna unguiculata calmodulin mRNA, complete cds 113 2e-22
118gb|AY057567.1| Arabidopsis thaliana AT3g56800/T8M16_130 mRNA, co... 113 2e-22
119emb|BX824588.1|CNS0A7R3 Arabidopsis thaliana Full-length cDNA Co... 113 2e-22
120emb|BX822741.1|CNS0A78I Arabidopsis thaliana Full-length cDNA Co... 113 2e-22
121emb|BX823583.1|CNS0A6LJ Arabidopsis thaliana Full-length cDNA Co... 113 2e-22
122emb|BX823557.1|CNS0A6N7 Arabidopsis thaliana Full-length cDNA Co... 113 2e-22
123gb|AY085660.1| Arabidopsis thaliana clone 16715 mRNA, complete s... 113 2e-22
124gb|U79736.1|HAU79736 Helianthus annuus calmodulin (HaCaM) mRNA, ... 109 4e-21
125gb|AY656692.1| Daucus carota calmodulin cam-209 mRNA, complete cds 107 2e-20
126gb|AY656690.1| Daucus carota caomodulin cam-207 mRNA, complete cds 107 2e-20
127gb|U20296.1|STU20296 Solanum tuberosum clone PCM7 calmodulin gen... 107 2e-20
128dbj|AB050844.1| Nicotiana tabacum mRNA for calmodulin NtCaM8, co... 107 2e-20
129dbj|AB050841.1| Nicotiana tabacum mRNA for calmodulin NtCaM5, co... 107 2e-20
130gb|DQ200375.1| Solanum tuberosum clone 060G04 putative calmoduli... 101 9e-19
131gb|DQ191657.1| Solanum tuberosum calmodulin 5/6/7/8-like protein... 101 9e-19
132emb|Y09853.1|CACAM Cicer arietinum mRNA for CaM protein 101 9e-19
133emb|AJ318520.1|SCO318520 Solanum commersonii mRNA for putative c... 101 9e-19
134gb|AF150059.1|AF150059 Brassica napus calmodulin (CaM1) mRNA, co... 101 9e-19
135gb|AF231026.1|AF231026 Oryza sativa calmodulin-like protein mRNA... 101 9e-19
136dbj|AK070889.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 9e-19
137gb|U37936.1|OSU37936 Oryza sativa clone pFDRSC61 novel calmoduli... 101 9e-19
138gb|U20295.1|STU20295 Solanum tuberosum clone PCM6 calmodulin mRN... 101 9e-19
139ref|NM_105312.2| Arabidopsis thaliana CAM4 (CALMODULIN 4); calci... 100 4e-18
140ref|NM_180013.1| Arabidopsis thaliana ATCAL4; calcium ion bindin... 100 4e-18
141ref|NM_191034.1| Oryza sativa (japonica cultivar-group), predic... 100 4e-18
142gb|BT014541.1| Lycopersicon esculentum clone 133956F, mRNA sequence 100 4e-18
143gb|AY517931.1| Arachis hypogaea calmodulin (CaM2) mRNA, complete... 100 4e-18
144ref|XM_754964.1| Ustilago maydis 521 calmodulin (UM03910.1) part... 100 4e-18
145emb|Z12022.1|ATCMACAM4 A.thaliana mRNA (clone ACaM4) for calmodulin 100 4e-18
146emb|X98404.1|CACAM2 C.annuum mRNA for calmodulin-2 100 4e-18
147gb|AY113902.1| Arabidopsis thaliana putative calmodulin-4 protei... 100 4e-18
148gb|AF370293.1| Arabidopsis thaliana putative calmodulin-4 protei... 100 4e-18
149emb|AJ843113.1| Quercus petraea mRNA for calmodulin (caM-3 gene) 100 4e-18
150emb|AJ843114.1| Plantago major mRNA for calmodulin (cam1 gene) 100 4e-18
151gb|AY128752.1| Arabidopsis thaliana calmodulin cam2 (At2g41110) ... 100 4e-18
152gb|AY065179.1| Arabidopsis thaliana calmodulin (cam2) (At2g41110... 100 4e-18
153gb|L20507.1|VIRCALMODU Vigna radiata calmodulin mRNA, complete cds 100 4e-18
154emb|BX813969.1|CNS0ADRS Arabidopsis thaliana Full-length cDNA Co... 100 4e-18
155gb|AY088476.1| Arabidopsis thaliana clone 6982 mRNA, complete se... 100 4e-18
156gb|AF108889.1|AF108889 Capsicum annuum calmodulin mRNA, complete... 100 4e-18
157gb|U83402.1|CAU83402 Capsicum annuum calmodulin mRNA, complete cds 100 4e-18
158dbj|AB050846.1| Nicotiana tabacum mRNA for calmodulin NtCaM10, c... 100 4e-18
159dbj|AB050845.1| Nicotiana tabacum mRNA for calmodulin NtCaM9, co... 100 4e-18
160dbj|AB050843.1| Nicotiana tabacum mRNA for calmodulin NtCaM7, co... 100 4e-18
161gb|AY657030.1| Salvia miltiorrhiza calmodulin mRNA, complete cds 98 1e-17
162gb|AY830128.1| Hevea brasiliensis calmodulin (CaM) mRNA, complet... 94 2e-16
163emb|X97546.1|FSCAMFPRO F.sylvatica mRNA for CaMF protein 94 2e-16
164emb|X97612.1|FSCAMF1 F.sylvatica mRNA for CaMF-1 protein 94 2e-16
165emb|X60737.1|MDCAMG M.domestica CaM gene for calmodulin 94 2e-16
166ref|NM_128261.3| Arabidopsis thaliana CAM2 (CALMODULIN-2); calci... 92 9e-16
167ref|NM_179766.1| Arabidopsis thaliana CAM2 (CALMODULIN-2); calci... 92 9e-16
168ref|NM_123137.2| Arabidopsis thaliana CAM1 (CALMODULIN 1); calci... 92 9e-16
169gb|AY830129.1| Hevea brasiliensis calmodulin (CaM) gene, complet... 92 9e-16
170gb|AY456265.1| Nicotiana attenuata calmodulin mRNA, complete cds 92 9e-16
171gb|BC105380.1| Bos taurus calmodulin 1 (phosphorylase kinase, de... 92 9e-16
172gb|AF494220.1| Medicago truncatula calmodulin 2 mRNA, complete cds 92 9e-16
173gb|AF494219.1| Medicago truncatula calmodulin 1 mRNA, complete cds 92 9e-16
174emb|Y14764.1|LEY14764 Lycopersicon esculentum mRNA for calmoduli... 92 9e-16
175emb|AL162691.1|ATT28A8 Arabidopsis thaliana DNA chromosome 3, BA... 92 9e-16
176emb|AJ843112.1| Quercus petraea mRNA for calmodulin (caM-2 gene) 92 9e-16
177emb|AJ843111.1| Quercus petraea mRNA for calmodulin (caM-1 gene) 92 9e-16
178gb|AF474074.1| Stevia rebaudiana calmodulin mRNA, complete cds 92 9e-16
179gb|AY072520.1| Arabidopsis thaliana unknown protein mRNA, comple... 92 9e-16
180gb|AY072628.1| Arabidopsis thaliana AT5g37780/K22F20_20 mRNA, co... 92 9e-16
181gb|AY059809.1| Arabidopsis thaliana Unknown protein mRNA, comple... 92 9e-16
182gb|AY048276.1| Arabidopsis thaliana AT5g37780/K22F20_20 mRNA, co... 92 9e-16
183emb|BX830458.1|CNS0A1LN Arabidopsis thaliana Full-length cDNA Co... 92 9e-16
184gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 geno... 92 9e-16
185gb|BT002351.1| Arabidopsis thaliana clone C105327 putative calmo... 92 9e-16
186dbj|AK176855.1| Arabidopsis thaliana mRNA for calmodulin, comple... 92 9e-16
187dbj|AK175278.1| Arabidopsis thaliana mRNA for calmodulin, comple... 92 9e-16
188gb|M80836.1|PETCAM81 Petunia hybrida CAM81 mRNA, 92 9e-16
189gb|M38380.1|ATHCAM2 A.thaliana calmodulin-2 (cam2) mRNA, complet... 92 9e-16
190emb|Y14765.1|LEY14765 Lycopersicon esculentum mRNA for calmoduli... 90 4e-15
191ref|XM_598515.2| PREDICTED: Bos taurus similar to calmodulin 1 (... 88 1e-14
192gb|BT013612.1| Lycopersicon esculentum clone 132384F, mRNA sequence 86 6e-14
193emb|AJ427337.1|BOL427337 Brassica oleracea mRNA for calmodulin 1... 86 6e-14
194gb|AF468661.1| Stevia rebaudiana calmodulin mRNA, complete cds 86 6e-14
195emb|BX821238.1|CNS0A8AH Arabidopsis thaliana Full-length cDNA Co... 86 6e-14
196gb|AF030032.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-1... 84 2e-13
197gb|U13882.1|PSU13882 Pisum sativum Alaska calmodulin mRNA, compl... 84 2e-13
198dbj|AB050847.1| Nicotiana tabacum mRNA for calmodulin NtCaM11, c... 84 2e-13
199gb|DQ186609.1| Catharanthus roseus calmodulin 1 mRNA, complete cds 82 9e-13
200gb|AY269783.1| Branchiostoma belcheri tsingtaunese calmodulin mR... 82 9e-13
201emb|Y09863.1|BFRNAC B.floridae mRNA for calmodulin 82 9e-13
202gb|DQ122882.1| Chlamydomonas incerta calmodulin mRNA, complete cds 82 9e-13
203dbj|AB003082.1| Branchiostoma floridae mRNA for calmodulin, comp... 82 9e-13
204dbj|AP003260.5| Oryza sativa (japonica cultivar-group) genomic D... 80 3e-12
205gb|M73712.1|ATHCAM3COL Arabidopsis thaliana calmodulin-3 mRNA, 3... 80 3e-12
206ref|NM_179765.1| Arabidopsis thaliana CAM2 (CALMODULIN-2); calci... 78 1e-11
207gb|AY543014.1| Daucus carota calmodulin cam-11 mRNA, complete cds 78 1e-11
208gb|AY090987.1| Arabidopsis thaliana At2g27030 mRNA sequence 78 1e-11
209gb|AC005623.3| Arabidopsis thaliana chromosome 2 clone T20P8 map... 78 1e-11
210dbj|AK062496.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 1e-11
211gb|AF064456.1|AF064456 Oryza sativa subsp. indica calmodulin-lik... 78 1e-11
212gb|AF064552.1|AF064552 Apium graveolens calmodulin mRNA, complet... 78 1e-11
213gb|AY297816.2| Euphorbia characias calmodulin mRNA, complete cds 78 1e-11
214dbj|AB050838.1| Nicotiana tabacum mRNA for calmodulin NtCaM2, co... 78 1e-11
215dbj|AB050837.1| Nicotiana tabacum mRNA for calmodulin NtCaM1, co... 78 1e-11
216dbj|AB044286.1| Chara corallina ccam mRNA for calmodulin, comple... 78 1e-11
217dbj|AB041712.1| Chara corallina cccam2 mRNA for calmodulin, comp... 78 1e-11
218dbj|AB041711.1| Chara corallina cccam1 mRNA for calmodulin, comp... 78 1e-11
219ref|NM_012518.2| Rattus norvegicus calmodulin 3 (Calm3), mRNA 76 5e-11
220gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomi... 76 5e-11
221ref|XM_860423.1| PREDICTED: Canis familiaris similar to calmodul... 76 5e-11
222ref|XM_860405.1| PREDICTED: Canis familiaris similar to calmodul... 76 5e-11
223ref|XM_533635.2| PREDICTED: Canis familiaris similar to calmodul... 76 5e-11
224emb|X97558.1|CACAM1 C.annuum mRNA for calmodulin-1 76 5e-11
225emb|X67273.1|ATCAL A.thaliana gene for calmodulin 76 5e-11
226emb|X52398.1|MSCAL1 Alfalfa cal1 mRNA for calmodulin 76 5e-11
227emb|CR859453.1| Pongo pygmaeus mRNA; cDNA DKFZp469E1312 (from cl... 76 5e-11
228emb|AL390921.1|ATT8M16 Arabidopsis thaliana DNA chromosome 3, BA... 76 5e-11
229gb|BC063187.1| Rattus norvegicus calmodulin 3, mRNA (cDNA clone ... 76 5e-11
230gb|AC004261.3| Arabidopsis thaliana chromosome 2 clone T3K9 map ... 76 5e-11
231dbj|AK152754.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 76 5e-11
232dbj|AK151610.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 76 5e-11
233dbj|AK165568.1| Mus musculus nullipotent stem cell CRL-2070 NE c... 76 5e-11
234dbj|AK153179.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 76 5e-11
235dbj|AK169630.1| Mus musculus 2 days neonate thymus thymic cells ... 76 5e-11
236dbj|AB169886.1| Macaca fascicularis brain cDNA, clone: QnpA-1517... 76 5e-11
237ref|NM_007590.2| Mus musculus calmodulin 3 (Calm3), mRNA 76 5e-11
238emb|BX814324.1|CNS0ADP9 Arabidopsis thaliana Full-length cDNA Co... 76 5e-11
239gb|BC050926.1| Mus musculus calmodulin 3, mRNA (cDNA clone MGC:6... 76 5e-11
240emb|X13817.1|RSPRCM4 R.norvegicus mRNA for calmodulin 76 5e-11
241gb|M19380.1|MUSCALMDA Mouse calmodulin (Cam III) mRNA, complete cds 76 5e-11
242gb|M16659.1|RATCAMB Rat calmodulin mRNA, complete cds, clone prCM79 76 5e-11
243gb|L01430.1|SOYSCAM1X Soybean calmodulin (SCaM-1) mRNA, complete... 76 5e-11
244gb|M73711.1|ATHCAM3 Arabidopsis thaliana cam-3 gene, complete cds 76 5e-11
245gb|M83535.1|PHTCALPIA P.infestans calmodulin (calA) gene, comple... 76 5e-11
246dbj|D45848.1|ATHCRP Arabidopsis thaliana genes for calmodulin an... 76 5e-11
247dbj|AB050848.1| Nicotiana tabacum mRNA for calmodulin NtCaM12, c... 76 5e-11
248ref|NM_182967.1| Danio rerio calmodulin 3a (phosphorylase kinase... 74 2e-10
249gb|DQ226765.1| Boechera divaricarpa isolate SLW-D-B04 mRNA sequence 74 2e-10
250emb|Y09880.1|BLRNAC B.lanceolatum mRNA for calmodulin 74 2e-10
251gb|BC045298.1| Danio rerio calmodulin 2, gamma, mRNA (cDNA clone... 74 2e-10
252gb|M20729.1|CRECAM C.reinhardtii calmodulin gene, complete cds 74 2e-10
253dbj|D10364.1|ORZCAMB O. latipes (killifish) mRNA for calmodulin,... 74 2e-10
254dbj|AB003081.1| Branchiostoma lanceolatum mRNA for calmodulin, c... 74 2e-10
255gb|AY052527.1| Glycine max calmodulin isoform-1 (cam-1) gene, pr... 72 8e-10
256gb|AC165955.3| Mus musculus BAC clone RP23-458A8 from chromosome... 72 8e-10
257gb|AF007889.1|AF007889 Symbiodinium microadriaticum calmodulin (... 72 8e-10
258emb|X89890.1|BPCALMGEN B.pilosa mRNA for calmodulin 70 3e-09
259dbj|AB016873.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 70 3e-09
260ref|XM_512771.1| PREDICTED: Pan troglodytes LOC456153 (LOC456153... 68 1e-08
261ref|NM_005184.2| Homo sapiens calmodulin 3 (phosphorylase kinase... 68 1e-08
262gb|BC006182.1| Homo sapiens calmodulin 3 (phosphorylase kinase, ... 68 1e-08
263emb|Z12023.1|ATCMACAM5 A.thaliana mRNA (clone ACaM5) for calmodu... 68 1e-08
264emb|AJ318522.1|SCO318522 Solanum commersonii mRNA for putative c... 68 1e-08
265gb|BC005137.2| Homo sapiens calmodulin 3 (phosphorylase kinase, ... 68 1e-08
266emb|CR626367.1| full-length cDNA clone CS0DN005YF02 of Adult bra... 68 1e-08
267emb|X90560.1|PPCAMPROT Physcomitrella patens mRNA for calmodulin 68 1e-08
268gb|AF034964.1|AF034964 Glomerella cingulata calmodulin (cam) mRN... 68 1e-08
269gb|J04559.1|POTCAM Solanum tuberosum clone PCM1 calmodulin mRNA,... 68 1e-08
270gb|J04046.1|HUMCAMA Human calmodulin mRNA, complete cds 68 1e-08
271gb|M80831.1|PETCALPRO Petunia hybrida CAM53 mRNA, complete cds 68 1e-08
272gb|BT007567.1| Synthetic construct Homo sapiens calmodulin 3 (ph... 66 5e-08
273gb|BT006855.1| Homo sapiens calmodulin 3 (phosphorylase kinase, ... 66 5e-08
274gb|DQ311341.1| Bombyx mori calmodulin mRNA, complete cds 66 5e-08
275gb|AY891944.1| Synthetic construct Homo sapiens clone FLH012892.... 66 5e-08
276gb|AY891943.1| Synthetic construct Homo sapiens clone FLH012891.... 66 5e-08
277gb|AY889473.1| Synthetic construct Homo sapiens clone FLH012896.... 66 5e-08
278gb|AY889472.1| Synthetic construct Homo sapiens clone FLH012895.... 66 5e-08
279gb|BC071404.1| Danio rerio calmodulin 2, gamma, mRNA (cDNA clone... 66 5e-08
280dbj|AB063184.1| Halichondria okadai CaM gene for calmodulin, com... 66 5e-08
281dbj|AB063182.1| Halichondria okadai CaM mRNA for calmodulin, com... 66 5e-08
282dbj|AK094964.1| Homo sapiens cDNA FLJ37645 fis, clone BRHIP2000245 64 2e-07
283gb|AC093503.2| Homo sapiens chromosome 19 clone CTB-12A17, compl... 64 2e-07
284emb|X14265.1|RNCAMIII R.norvegicus CaMIII gene for calmodulin III 64 2e-07
285emb|X52608.1|HSCAM3X3 H.sapiens CaMIII gene, exons 3-6 64 2e-07
286gb|AY835929.1| Codonopsis lanceolata calmodulin 2 (CAM2) mRNA, c... 62 8e-07
287ref|XM_800150.1| Trypanosoma cruzi strain CL Brener calmodulin (... 62 8e-07
288ref|XM_800151.1| Trypanosoma cruzi strain CL Brener calmodulin (... 62 8e-07
289ref|XM_803589.1| Trypanosoma cruzi strain CL Brener calmodulin (... 62 8e-07
290emb|Y08373.1|TGCM T.gondii mRNA for calmodulin 62 8e-07
291ref|NM_070985.3| Caenorhabditis elegans T21H3.3 (calmodulin) mRN... 62 8e-07
292gb|AC020665.6|AC020665 Arabidopsis thaliana chromosome 1 BAC T27... 62 8e-07
293gb|AC074025.1|AC074025 Arabidopsis thaliana chromosome 1 BAC F28... 62 8e-07
294emb|AJ132193.1|CEL132193 Caenorhabditis elegans mRNA for calmodulin 62 8e-07
295ref|NM_001032461.1| Ciona intestinalis calmodulin homologue (CaM... 60 3e-06
296emb|Y13578.1|CICAM Ciona intestinalis mRNA for calmodulin 60 3e-06
297emb|AJ010645.1|CAN010645 Capsicum annuum mRNA for calmodulin 3 60 3e-06
298emb|AJ001093.1|BLCAML2 Branchiostoma lanceolatum CaML-2 gene 60 3e-06
299dbj|AB225535.1| Aspergillus oryzae cDNA, contig sequence: AoEST2389 60 3e-06
300dbj|AB076905.1| Ciona intestinalis Ci-CaM mRNA for calmodulin ho... 60 3e-06
301gb|M67472.1|TOMCALM1LE Tomato (L.esculentum) calmodulin mRNA, co... 60 3e-06
302gb|DQ503481.1| Phytomonas serpens strain 15 calmodulin (calmP) g... 58 1e-05
303ref|XM_531631.2| PREDICTED: Canis familiaris similar to myosin, ... 58 1e-05
304emb|CR717313.2|CNS0GGFB Tetraodon nigroviridis full-length cDNA 58 1e-05
305emb|CR715454.1|CNS0GEZU Tetraodon nigroviridis full-length cDNA 58 1e-05
306emb|X80231.1|LTCAMA L.tarentolae CAM A gene for calmodulin 58 1e-05
307emb|X70923.1|NCCALMOE N.crassa mRNA for calmodulin 58 1e-05
308gb|AF085250.1|AF085250 Perca flavescens calmodulin (CAL1) mRNA, ... 58 1e-05
309gb|L02963.1|NEUCLMDLN Neurospora crassa calmodulin mRNA, complet... 58 1e-05
310dbj|AB055386.1| Clemmys japonica CaM-C III mRNA for calmodulin, ... 58 1e-05
311dbj|AB081568.1| Strongylocentrotus intermedius CaM mRNA for calm... 58 1e-05
312gb|AY231835.1| Drosophila yakuba clone yak-em_sqh mRNA sequence 56 5e-05
313gb|AF252793.1|AF252793 Drosophila simulans strain sim8 myosin II... 56 5e-05
314gb|AF252792.1|AF252792 Drosophila simulans strain sim7 myosin II... 56 5e-05
315gb|AF252791.1|AF252791 Drosophila simulans strain sim6 myosin II... 56 5e-05
316gb|AF252790.1|AF252790 Drosophila simulans strain sim5 myosin II... 56 5e-05
317gb|AF252789.1|AF252789 Drosophila simulans strain sim4 myosin II... 56 5e-05
318gb|AF252788.1|AF252788 Drosophila simulans strain sim3 myosin II... 56 5e-05
319gb|AF252787.1|AF252787 Drosophila simulans strain sim2 myosin II... 56 5e-05
320gb|BT011346.1| Drosophila melanogaster RH35841 full insert cDNA 54 2e-04
321ref|XM_382067.1| Gibberella zeae PH-1 chromosome 1 CALM_NEUCR Ca... 54 2e-04
322gb|AY232005.1| Drosophila yakuba clone yak-ad_Mlc2 mRNA sequence 54 2e-04
323gb|AY231768.1| Drosophila yakuba clone yak-em_Mlc2 mRNA sequence 54 2e-04
324gb|DQ416033.1| Acyrthosiphon pisum putative calmodulin mRNA, com... 54 2e-04
325ref|NM_170474.2| Drosophila melanogaster Myosin light chain 2 CG... 54 2e-04
326ref|NM_079847.3| Drosophila melanogaster Myosin light chain 2 CG... 54 2e-04
327gb|AY060369.1| Drosophila melanogaster LD22691 full length cDNA 54 2e-04
328ref|XM_577597.1| PREDICTED: Rattus norvegicus calmodulin-like 3 ... 54 2e-04
329gb|BC086350.1| Rattus norvegicus calmodulin-like 3, mRNA (cDNA c... 54 2e-04
330ref|NM_001012054.1| Rattus norvegicus calmodulin-like 3 (Calml3)... 54 2e-04
331gb|M38379.1|ATHCAM1 A.thaliana calmodulin-1 (cam1) mRNA, complet... 54 2e-04
332gb|M28643.1|DROGMLC2 D.melanogaster myosin light chain 2 (MLC2) ... 54 2e-04
333dbj|AB081567.1| Strongylocentrotus intermedius exCaM mRNA for ca... 54 2e-04
334ref|XM_523703.1| PREDICTED: Pan troglodytes similar to Myosin li... 52 8e-04
335ref|XM_528841.1| PREDICTED: Pan troglodytes similar to Myosin li... 52 8e-04
336gb|BC017455.1| Homo sapiens myosin, light polypeptide 6, alkali,... 52 8e-04
337ref|NM_021019.3| Homo sapiens myosin, light polypeptide 6, alkal... 52 8e-04
338ref|NM_079423.2| Homo sapiens myosin, light polypeptide 6, alkal... 52 8e-04
339gb|AF016429.1| Caenorhabditis elegans cosmid T21H3, complete seq... 52 8e-04
340emb|CR689378.2|CNS0FUVI Tetraodon nigroviridis full-length cDNA 52 8e-04
341gb|BC093066.1| Homo sapiens myosin, light polypeptide 6, alkali,... 52 8e-04
342gb|BC071661.1| Homo sapiens myosin, light polypeptide 6, alkali,... 52 8e-04
343gb|BC006781.1| Homo sapiens myosin, light polypeptide 6, alkali,... 52 8e-04
344ref|XM_967063.1| PREDICTED: Tribolium castaneum similar to CG847... 52 8e-04
345emb|CR457014.1| Homo sapiens full open reading frame cDNA clone ... 52 8e-04
346emb|CR859910.1| Pongo pygmaeus mRNA; cDNA DKFZp468L132 (from clo... 52 8e-04
347emb|CR626743.1| full-length cDNA clone CS0DI020YH21 of Placenta ... 52 8e-04
348emb|CR625614.1| full-length cDNA clone CS0DI069YN13 of Placenta ... 52 8e-04
349emb|CR620884.1| full-length cDNA clone CS0DI011YB19 of Placenta ... 52 8e-04
350emb|CR621220.1| full-length cDNA clone CS0DB009YH09 of Neuroblas... 52 8e-04
351emb|CR605452.1| full-length cDNA clone CS0DI063YH12 of Placenta ... 52 8e-04
352emb|CR605329.1| full-length cDNA clone CS0DI049YD04 of Placenta ... 52 8e-04
353emb|CR600357.1| full-length cDNA clone CS0DJ009YH02 of T cells (... 52 8e-04
354emb|CR598874.1| full-length cDNA clone CS0DB007YM19 of Neuroblas... 52 8e-04
355emb|CR594305.1| full-length cDNA clone CS0DE002YH23 of Placenta ... 52 8e-04
356emb|CR592135.1| full-length cDNA clone CS0DI008YF20 of Placenta ... 52 8e-04
357emb|CR591507.1| full-length cDNA clone CS0DH005YM01 of T cells (... 52 8e-04
358gb|AF264065.1|AF264065 Blastocladiella emersonii calmodulin (CaM... 52 8e-04
359emb|BX832026.1|CNS0A24Z Arabidopsis thaliana Full-length cDNA Co... 52 8e-04
360dbj|AK026164.1| Homo sapiens cDNA: FLJ22511 fis, clone HRC11837,... 52 8e-04
361gb|J04729.1|SYNARBCAL A.punctulata synthetic calmodulin mRNA, co... 52 8e-04
362gb|M31212.1|HUMMLC3NM Human myosin light chain 3 non-muscle (MLC... 52 8e-04
363gb|M22920.1|HUMMYLCC Human smooth muscle myosin alkali light cha... 52 8e-04
364gb|M22918.1|HUMMYLCB Human non-muscle myosin alkali light chain ... 52 8e-04
365gb|M80832.1|PETRCAM72A Petunia hybrida calmodulin (CAM72) mRNA, ... 52 8e-04
366dbj|AB046613.1| Homo sapiens MLC-3 mRNA for nonmuscle myosin lig... 52 8e-04
367gb|AY341376.1| Pinctada fucata calmodulin mRNA, complete cds 50 0.003
368gb|AY232217.1| Drosophila yakuba clone yak-ad_Cam mRNA sequence 50 0.003
369ref|XM_961587.1| PREDICTED: Tribolium castaneum similar to CG359... 50 0.003
370gb|AY281363.1| Epinephelus akaara calmodulin (CAL1) mRNA, comple... 50 0.003
371gb|AY118890.1| Drosophila melanogaster LD01127 full insert cDNA 50 0.003
372ref|NM_165870.1| Drosophila melanogaster Calmodulin CG8472-RB, t... 50 0.003
373ref|NM_078986.2| Drosophila melanogaster Calmodulin CG8472-RA, t... 50 0.003
374gb|BT003282.1| Drosophila melanogaster LD02334 full insert cDNA 50 0.003
375gb|M76407.1|SLECALMODU Stylonychia lemnae calmodulin gene, compl... 50 0.003
376ref|XM_482909.1| Oryza sativa (japonica cultivar-group), mRNA 48 0.012
377gb|AY023201.1| Oryza sativa microsatellite MRG5526 containing (G... 48 0.012
378gb|AC084159.2| Caenorhabditis elegans cosmid Y73B3A, complete se... 48 0.012
379gb|AY232003.1| Drosophila yakuba clone yak-ad_sqh mRNA sequence 48 0.012
380ref|XM_775961.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.012
381emb|BX927291.8| Zebrafish DNA sequence from clone CH211-261A10 i... 48 0.012
382gb|DQ145932.1| Hordeum vulgare subsp. vulgare ABA 8'-hydroxylase... 48 0.012
383dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.012
384dbj|AP004457.2| Oryza sativa (japonica cultivar-group) genomic D... 48 0.012
385dbj|AK120757.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.012
386ref|XM_414988.1| PREDICTED: Gallus gallus similar to calmodulin,... 46 0.048
387ref|XM_802996.1| Trypanosoma cruzi strain CL Brener calmodulin (... 46 0.048
388ref|XM_802997.1| Trypanosoma cruzi strain CL Brener calmodulin (... 46 0.048
389gb|AF494215.1| Medicago truncatula calmodulin-like protein 4 mRN... 46 0.048
390emb|CR733384.2|CNS0GSOC Tetraodon nigroviridis full-length cDNA 46 0.048
391emb|CR730244.2|CNS0GQEH Tetraodon nigroviridis full-length cDNA 46 0.048
392emb|CR730083.2|CNS0GQA1 Tetraodon nigroviridis full-length cDNA 46 0.048
393emb|CR718886.2|CNS0GHN0 Tetraodon nigroviridis full-length cDNA 46 0.048
394emb|CR712586.2|CNS0GCS6 Tetraodon nigroviridis full-length cDNA 46 0.048
395emb|CR710310.2|CNS0GB0Y Tetraodon nigroviridis full-length cDNA 46 0.048
396emb|CR705969.2|CNS0G7OD Tetraodon nigroviridis full-length cDNA 46 0.048
397emb|CR705827.2|CNS0G7KF Tetraodon nigroviridis full-length cDNA 46 0.048
398emb|CR681462.2|CNS0FORM Tetraodon nigroviridis full-length cDNA 46 0.048
399gb|DQ140391.1| Culex pipiens pallens putative myosin light chain... 46 0.048
400gb|AY829799.1| Lonomia obliqua myosin 3 light chain mRNA, comple... 46 0.048
401ref|XM_790588.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.048
402ref|XM_776612.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.048
403emb|Y00133.1|DMCAMR Drosophila melanogaster calmodulin mRNA 46 0.048
404emb|X52096.1|TCCALB2 Trypanosoma cruzi CalA2 calmodulin gene 46 0.048
405emb|X05949.1|DMCALM2 Drosophila melanogaster calmodulin gene exo... 46 0.048
406emb|AJ131662.1|BLA131662 Branchiostoma lanceolatum mRNA for calm... 46 0.048
407gb|AY700062.1| Gryllotalpa orientalis myosin light chain (MLC) m... 46 0.048
408gb|AF493614.1| Acetabularia acetabulum calmodulin 2 mRNA, partia... 46 0.048
409gb|AY789863.1| Obelia longissima voucher 857IC calmodulin gene, ... 46 0.048
410gb|AY789862.1| Obelia longissima voucher 868WS calmodulin gene, ... 46 0.048
411gb|AY789861.1| Obelia longissima voucher 235NZ calmodulin gene, ... 46 0.048
412emb|AL116760.1|CNS01DFK Botrytis cinerea strain T4 cDNA library 46 0.048
413emb|AL116067.1|CNS01CWB Botrytis cinerea strain T4 cDNA library 46 0.048
414emb|AL115056.1|CNS01C48 Botrytis cinerea strain T4 cDNA library 46 0.048
415emb|AL114582.1|CNS01BR2 Botrytis cinerea strain T4 cDNA library 46 0.048
416emb|AL114124.1|CNS01BEC Botrytis cinerea strain T4 cDNA library 46 0.048
417emb|AL113315.1|CNS01ARV Botrytis cinerea strain T4 cDNA library 46 0.048
418emb|AL112713.1|CNS01AB5 Botrytis cinerea strain T4 cDNA library 46 0.048
419emb|AL112170.1|CNS019W2 Botrytis cinerea strain T4 cDNA library 46 0.048
420gb|AC007440.6|AC007440 Drosophila melanogaster, chromosome 2R, r... 46 0.048
421gb|AC171018.2| Gallus gallus BAC clone CH261-11F14 from chromoso... 46 0.048
422gb|AE003823.3| Drosophila melanogaster chromosome 2R, section 27... 46 0.048
423gb|U48690.1|TAU48690 Triticum aestivum calmodulin TaCaM2-1 mRNA,... 46 0.048
424ref|XM_521410.1| PREDICTED: Pan troglodytes similar to Calmoduli... 44 0.19
425ref|NM_200082.1| Danio rerio calmodulin 1b (calm1b), mRNA 44 0.19
426gb|BC059500.1| Danio rerio calmodulin 1b, mRNA (cDNA clone MGC:7... 44 0.19
427gb|BC031889.1| Homo sapiens calmodulin-like 3, mRNA (cDNA clone ... 44 0.19
428ref|NM_005185.2| Homo sapiens calmodulin-like 3 (CALML3), mRNA 44 0.19
429ref|NM_175780.1| Bos taurus myosin, light peptide 6, alkali, smo... 44 0.19
430ref|XM_854221.1| PREDICTED: Canis familiaris similar to troponin... 44 0.19
431ref|XM_854183.1| PREDICTED: Canis familiaris similar to troponin... 44 0.19
432ref|XM_533799.2| PREDICTED: Canis familiaris similar to troponin... 44 0.19
433emb|CR679443.2|CNS0FN7J Tetraodon nigroviridis full-length cDNA 44 0.19
434emb|CR667254.2|CNS0FDTO Tetraodon nigroviridis full-length cDNA 44 0.19
435emb|CR643367.2|CNS0EVE5 Tetraodon nigroviridis full-length cDNA 44 0.19
436emb|CR636166.2|CNS0EPU4 Tetraodon nigroviridis full-length cDNA 44 0.19
437emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chr... 44 0.19
438gb|AF334833.1| Castanea sativa calmodulin mRNA, complete cds 44 0.19
439emb|X54978.1|BTMYO17R Bovine mRNA for 17,000 dalton myosin light... 44 0.19
440emb|X54977.1|BTMYO217 Bovine mRNA for 17,000 dalton myosin light... 44 0.19
441emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genom... 44 0.19
442emb|AJ133836.2|BFL133836 Branchiostoma floridae mRNA for calmodu... 44 0.19
443emb|AJ133486.1|BLA133486 Branchiostoma lanceolatum mRNA for calm... 44 0.19
444emb|AJ001092.1|BLCAML1 Branchiostoma lanceolatum partial CaM2 ge... 44 0.19
445gb|BC065426.1| Danio rerio calmodulin 1b, mRNA (cDNA clone MGC:7... 44 0.19
446gb|AC118653.6| Homo sapiens chromosome 17, clone CTD-2319F6, com... 44 0.19
447gb|BC103428.1| Bos taurus cDNA clone MGC:127726 IMAGE:7963645, c... 44 0.19
448ref|XM_940535.1| PREDICTED: Homo sapiens similar to Myosin light... 44 0.19
449ref|XM_064265.1| PREDICTED: Homo sapiens similar to Myosin light... 44 0.19
450dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.19
451gb|AC006448.14|AC006448 Homo sapiens chromosome 17, clone RP11-4... 44 0.19
452gb|AC009733.5|AC009733 Drosophila melanogaster, chromosome 3R, r... 44 0.19
453gb|AF085344.1|AF085344 Pythium splendens calmodulin mRNA, comple... 44 0.19
454gb|AY893101.1| Synthetic construct Homo sapiens clone FLH141246.... 44 0.19
455gb|AY890619.1| Synthetic construct Homo sapiens clone FLH141253.... 44 0.19
456gb|AY890618.1| Synthetic construct Homo sapiens clone FLH141252.... 44 0.19
457gb|AY890617.1| Synthetic construct Homo sapiens clone FLH141251.... 44 0.19
458dbj|AK119956.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.19
459dbj|AK111834.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.19
460gb|AF187305.1|AF187305 Myxine glutinosa calmodulin (CaM) mRNA, c... 44 0.19
461gb|U91642.1|POU91642 Pleurotus ostreatus calmodulin mRNA, comple... 44 0.19
462gb|AE003772.2| Drosophila melanogaster chromosome 3R, section 11... 44 0.19
463gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.19
464emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 44 0.19
465gb|M80839.1|HUMPSMYLA Human myosin light chain processed pseudog... 44 0.19
466gb|M11947.1|DROMYLA D.melanogaster myosin light chain 2 (MLC-2) ... 44 0.19
467emb|X13461.1|HSCAMPSG H.sapiens intronless calmodulin-like gene ... 44 0.19
468gb|M58026.1|HUMNB1 Human NB-1 mRNA, complete cds 44 0.19
469gb|M36707.1|HUMCALPS Human calmodulin-like processed pseudogene,... 44 0.19
470ref|NM_205133.1| Gallus gallus troponin C type 1 (slow) (TNNC1),... 42 0.75
471ref|XM_516513.1| PREDICTED: Pan troglodytes similar to semaphori... 42 0.75
472ref|XM_469690.1| Oryza sativa (japonica cultivar-group), mRNA 42 0.75
473gb|AF121781.1| Homo sapiens chromosome 21q22.3 PAC 1031P17, comp... 42 0.75
474gb|BC061172.1| Mus musculus troponin C, cardiac/slow skeletal, m... 42 0.75
475gb|BC030244.1| Homo sapiens troponin C type 1 (slow), mRNA (cDNA... 42 0.75
476ref|XM_537537.2| PREDICTED: Canis familiaris similar to calmodul... 42 0.75
477emb|CR732365.2|CNS0GS1E Tetraodon nigroviridis full-length cDNA 42 0.75
478emb|CR729728.1|CNS0GQ06 Tetraodon nigroviridis full-length cDNA 42 0.75
479emb|CR726003.2|CNS0GN4P Tetraodon nigroviridis full-length cDNA 42 0.75
480emb|CR724983.2|CNS0GMCD Tetraodon nigroviridis full-length cDNA 42 0.75
481emb|CR721921.2|CNS0GJZB Tetraodon nigroviridis full-length cDNA 42 0.75
482emb|CR721572.2|CNS0GJPM Tetraodon nigroviridis full-length cDNA 42 0.75
483gb|AC108416.5| Mus musculus chromosome 14, clone RP23-114J12, co... 42 0.75
484emb|CR703200.2|CNS0G5JG Tetraodon nigroviridis full-length cDNA 42 0.75
485emb|CR702497.2|CNS0G4ZX Tetraodon nigroviridis full-length cDNA 42 0.75
486emb|CR700978.2|CNS0G3TQ Tetraodon nigroviridis full-length cDNA 42 0.75
487emb|CR701203.1|CNS0G3ZZ Tetraodon nigroviridis full-length cDNA 42 0.75
488emb|CR700723.2|CNS0G3MN Tetraodon nigroviridis full-length cDNA 42 0.75
489emb|CR699855.2|CNS0G2YJ Tetraodon nigroviridis full-length cDNA 42 0.75
490emb|CR698078.2|CNS0G1L6 Tetraodon nigroviridis full-length cDNA 42 0.75
491emb|CR697586.2|CNS0G17I Tetraodon nigroviridis full-length cDNA 42 0.75
492emb|CR696387.2|CNS0G0A7 Tetraodon nigroviridis full-length cDNA 42 0.75
493emb|CR695426.2|CNS0FZJI Tetraodon nigroviridis full-length cDNA 42 0.75
494emb|CR695074.2|CNS0FZ9Q Tetraodon nigroviridis full-length cDNA 42 0.75
495emb|CR693879.2|CNS0FYCJ Tetraodon nigroviridis full-length cDNA 42 0.75
496emb|CR692488.2|CNS0FX9W Tetraodon nigroviridis full-length cDNA 42 0.75
497emb|CR691872.1|CNS0FWSS Tetraodon nigroviridis full-length cDNA 42 0.75
498emb|CR691181.1|CNS0FW9L Tetraodon nigroviridis full-length cDNA 42 0.75
499emb|CR688739.2|CNS0FUDR Tetraodon nigroviridis full-length cDNA 42 0.75
500emb|CR688409.1|CNS0FU4L Tetraodon nigroviridis full-length cDNA 42 0.75

>gb|M27303.1|BLYCAMA Barley cam gene encoding calmodulin, complete cds
          Length = 1086

 Score =  285 bits (144), Expect = 3e-74
 Identities = 144/144 (100%)
 Strand = Plus / Plus

                                                                       
Query: 88  agccgcctccgtcggtccaccgggccaccgcaccgcggcggcatggcggatcagctcacc 147
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 214 agccgcctccgtcggtccaccgggccaccgcaccgcggcggcatggcggatcagctcacc 273

                                                                       
Query: 148 gacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggt 207
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 274 gacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggt 333

                                   
Query: 208 tgcatcaccaccaaggagctggga 231
           ||||||||||||||||||||||||
Sbjct: 334 tgcatcaccaccaaggagctggga 357



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           ||||||||||||||||  | ||||||||||||
Sbjct: 512 tcaaggaggccttcagggtgttcgacaaggac 543



to top

>gb|U49103.1|TAU49103 Triticum aestivum calmodulin TaCaM3-2 mRNA, complete cds
          Length = 811

 Score =  216 bits (109), Expect = 2e-53
 Identities = 109/109 (100%)
 Strand = Plus / Plus

                                                                       
Query: 123 cggcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcag 182
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 96  cggcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcag 155

                                                            
Query: 183 cctcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 156 cctcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 204



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           ||||||||||||||||  | ||||||||||||
Sbjct: 359 tcaaggaggccttcagggtgttcgacaaggac 390



to top

>gb|U49104.1|TAU49104 Triticum aestivum calmodulin TaCaM3-3 mRNA, complete cds
          Length = 846

 Score =  208 bits (105), Expect = 6e-51
 Identities = 108/109 (99%)
 Strand = Plus / Plus

                                                                       
Query: 123 cggcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcag 182
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98  cggcggtatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcag 157

                                                            
Query: 183 cctcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 158 cctcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 206



to top

>gb|U48693.1|TAU48693 Triticum aestivum calmodulin TaCaM3-1 mRNA, complete cds
          Length = 1529

 Score =  208 bits (105), Expect = 6e-51
 Identities = 108/109 (99%)
 Strand = Plus / Plus

                                                                       
Query: 123 cggcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcag 182
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 864 cggcggtatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcag 923

                                                            
Query: 183 cctcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 924 cctcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 972



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 167  tcaaggaggccttcagcctcttcgacaaggac 198
            ||||||||||||||||  | ||||||||||||
Sbjct: 1127 tcaaggaggccttcagggtgttcgacaaggac 1158



to top

>dbj|AK070090.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023040P16, full
           insert sequence
          Length = 851

 Score =  188 bits (95), Expect = 5e-45
 Identities = 104/107 (97%)
 Strand = Plus / Plus

                                                                       
Query: 125 gcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 184
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 131 gcggcatggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 190

                                                          
Query: 185 tcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 191 tcttcgacaaggacggcgatggttgcatcacaaccaaggagctggga 237



to top

>dbj|AK059756.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C05, full
           insert sequence
          Length = 948

 Score =  188 bits (95), Expect = 5e-45
 Identities = 104/107 (97%)
 Strand = Plus / Plus

                                                                       
Query: 125 gcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 184
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 127 gcggcatggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 186

                                                          
Query: 185 tcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 187 tcttcgacaaggacggcgatggttgcatcacaaccaaggagctggga 233



to top

>gb|AF042840.1|AF042840 Oryza sativa clone F14605 calmodulin (CaM1) mRNA, complete cds
          Length = 824

 Score =  188 bits (95), Expect = 5e-45
 Identities = 104/107 (97%)
 Strand = Plus / Plus

                                                                       
Query: 125 gcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 184
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 111 gcggcatggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 170

                                                          
Query: 185 tcttcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 171 tcttcgacaaggacggcgatggttgcatcacaaccaaggagctggga 217



to top

>ref|XM_479602.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 732

 Score =  180 bits (91), Expect = 1e-42
 Identities = 100/103 (97%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 14  catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 73

                                                      
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||| |||||||||||||| ||||||||| |||||
Sbjct: 74  cgacaaggacggcgatggttgcatcacaaccaaggagttggga 116



to top

>gb|AF441191.1|AF441191 Oryza sativa clone 15079 calmodulin (CaM) mRNA, complete cds
          Length = 813

 Score =  180 bits (91), Expect = 1e-42
 Identities = 100/103 (97%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 80  catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 139

                                                      
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||| |||||||||||||| ||||||||| |||||
Sbjct: 140 cgacaaggacggcgatggttgcatcacaaccaaggagttggga 182



to top

>dbj|AK071852.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023117O08, full
           insert sequence
          Length = 731

 Score =  180 bits (91), Expect = 1e-42
 Identities = 100/103 (97%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13  catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 72

                                                      
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||||||| |||||||||||||| ||||||||| |||||
Sbjct: 73  cgacaaggacggcgatggttgcatcacaaccaaggagttggga 115



to top

>gb|BT017532.1| Zea mays clone EL01N0421H06.c mRNA sequence
          Length = 843

 Score =  178 bits (90), Expect = 5e-42
 Identities = 99/102 (97%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56  catggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 115

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 116 cgacaaggacggggatggttgcatcacgaccaaggagctggg 157



to top

>gb|U48689.1|TAU48689 Triticum aestivum calmodulin TaCaM1-3 mRNA, complete cds
          Length = 779

 Score =  172 bits (87), Expect = 3e-40
 Identities = 96/99 (96%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22  catggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 81

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||||||| || ||||||||||||||||||||
Sbjct: 82  cgacaaggacggagacggctgcatcaccaccaaggagct 120



to top

>emb|Z12827.1|OSCALMOD1 O.sativa gene encoding calmodulin
          Length = 450

 Score =  170 bits (86), Expect = 1e-39
 Identities = 98/102 (96%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atggcagatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 60

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||||||||| |||||||||||||| ||||||||| |||||
Sbjct: 61  gacaaggacggcgatggttgcatcacaaccaaggagttggga 102



to top

>gb|AY104071.1| Zea mays PCO074293 mRNA sequence
          Length = 1001

 Score =  170 bits (86), Expect = 1e-39
 Identities = 98/102 (96%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 175 catggcggaccaactcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 234

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 235 cgacaaggacggggatggttgcatcacgaccaaggagctggg 276



to top

>gb|L18913.1|RICCALMODU Oryza sativa calmodulin gene, complete cds
          Length = 450

 Score =  170 bits (86), Expect = 1e-39
 Identities = 98/102 (96%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atggcagatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 60

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||||||||| |||||||||||||| ||||||||| |||||
Sbjct: 61  gacaaggacggcgatggttgcatcacaaccaaggagttggga 102



to top

>ref|NM_188025.1| Oryza sativa (japonica cultivar-group), Ozsa8445 predicted mRNA
          Length = 450

 Score =  163 bits (82), Expect = 3e-37
 Identities = 94/98 (95%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| || || ||||||||||||||||||||
Sbjct: 61  gacaaggacggcgacggctgcatcaccaccaaggagct 98



to top

>gb|U48688.1|TAU48688 Triticum aestivum calmodulin TaCaM1-2 mRNA, complete cds
          Length = 796

 Score =  159 bits (80), Expect = 5e-36
 Identities = 92/96 (95%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 128 catggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 187

                                               
Query: 189 cgacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||| ||||| || |||||||||||||||||
Sbjct: 188 cgacaaggatggagacggctgcatcaccaccaagga 223



to top

>gb|U48242.1|TAU48242 Triticum aestivum calmodulin TaCaM1-1 mRNA, complete cds
          Length = 816

 Score =  159 bits (80), Expect = 5e-36
 Identities = 92/96 (95%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 124 catggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 183

                                               
Query: 189 cgacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||| ||||| || |||||||||||||||||
Sbjct: 184 cgacaaggatggagacggctgcatcaccaccaagga 219



to top

>emb|X77396.1|ZMCAM1 Z.mays CaM1 mRNA for calmodulin
          Length = 942

 Score =  157 bits (79), Expect = 2e-35
 Identities = 94/99 (94%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 130 catggcggaccagctcaccgacgaccagaccgccgagttcaaggaggccttcagcctctt 189

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| |||||||||||
Sbjct: 190 cgacaaggacggcgacggttgcatcacaaccaaggagct 228



to top

>gb|U48692.1|TAU48692 Triticum aestivum calmodulin TaCaM2-3 mRNA, complete cds
          Length = 909

 Score =  155 bits (78), Expect = 7e-35
 Identities = 96/102 (94%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 69  atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggctttcagcctcttc 128

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||| || || |||||||| ||||||||||||||||||
Sbjct: 129 gacaaggatggggacggttgcattaccaccaaggagctggga 170



to top

>emb|X65016.1|OSCALM O.sativa mRNA for calmodulin
          Length = 453

 Score =  153 bits (77), Expect = 3e-34
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                       
Query: 127 ggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctc 186
           |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 1   ggcatggcggatcagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctc 60

                                                    
Query: 187 ttcgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||||| || ||||||||||| || ||||||||
Sbjct: 61  ttcgacaaggacggcgacggttgcatcactactaaggagct 101



to top

>emb|X77397.1|ZMCAM2 Z.mays CaM2 mRNA for calmodulin
          Length = 775

 Score =  151 bits (76), Expect = 1e-33
 Identities = 91/96 (94%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 71  catggcggaccagctcaccgacgaacagatcgccgagttcaaggaggccttcagcctctt 130

                                               
Query: 189 cgacaaggacggagatggttgcatcaccaccaagga 224
           |||||||||||| || || |||||||||||||||||
Sbjct: 131 cgacaaggacggcgacggctgcatcaccaccaagga 166



to top

>gb|BT017909.1| Zea mays clone EL01N0517D03.c mRNA sequence
          Length = 924

 Score =  149 bits (75), Expect = 4e-33
 Identities = 93/99 (93%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95  catggcgtatccactcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 154

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| |||||||||||
Sbjct: 155 cgacaaggacggcgacggttgcatcacaaccaaggagct 193



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  149 bits (75), Expect = 4e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                            
Query: 125      gcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 184
                ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 11495931 gcggcatggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 11495990

                                       
Query: 185      tcttcgacaaggacggagatggt 207
                |||||||||||||||| ||||||
Sbjct: 11495991 tcttcgacaaggacggcgatggt 11496013



 Score = 46.1 bits (23), Expect = 0.048
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 205      ggttgcatcaccaccaaggagctggga 231
                ||||||||||| |||||||||||||||
Sbjct: 11496841 ggttgcatcacaaccaaggagctggga 11496867



to top

>gb|AC119748.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0042L15, from chromosome 3, complete sequence
          Length = 172475

 Score =  149 bits (75), Expect = 4e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                         
Query: 125   gcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 184
             ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 46503 gcggcatggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 46562

                                    
Query: 185   tcttcgacaaggacggagatggt 207
             |||||||||||||||| ||||||
Sbjct: 46563 tcttcgacaaggacggcgatggt 46585



 Score = 46.1 bits (23), Expect = 0.048
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 205   ggttgcatcaccaccaaggagctggga 231
             ||||||||||| |||||||||||||||
Sbjct: 47413 ggttgcatcacaaccaaggagctggga 47439



to top

>gb|S81594.1| auxin-regulated calmodulin [Vigna radiata=mung bean, Wilczek,
           seedling, mRNA, 921 nt]
          Length = 921

 Score =  149 bits (75), Expect = 4e-33
 Identities = 90/95 (94%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 43  atggccgaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 102

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||||| ||||||||||| || ||||||||
Sbjct: 103 gacaaggacggcgatggttgcattactaccaagga 137



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  149 bits (75), Expect = 4e-33
 Identities = 78/79 (98%)
 Strand = Plus / Minus

                                                                            
Query: 129      catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29146651 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 29146592

                                   
Query: 189      cgacaaggacggagatggt 207
                |||||||||||| ||||||
Sbjct: 29146591 cgacaaggacggcgatggt 29146573



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  149 bits (75), Expect = 4e-33
 Identities = 81/83 (97%)
 Strand = Plus / Plus

                                                                            
Query: 125      gcggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 184
                ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 11492694 gcggcatggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcc 11492753

                                       
Query: 185      tcttcgacaaggacggagatggt 207
                |||||||||||||||| ||||||
Sbjct: 11492754 tcttcgacaaggacggcgatggt 11492776



 Score = 46.1 bits (23), Expect = 0.048
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                           
Query: 205      ggttgcatcaccaccaaggagctggga 231
                ||||||||||| |||||||||||||||
Sbjct: 11493604 ggttgcatcacaaccaaggagctggga 11493630



to top

>dbj|AP003813.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1150_E04
          Length = 130973

 Score =  149 bits (75), Expect = 4e-33
 Identities = 78/79 (98%)
 Strand = Plus / Minus

                                                                         
Query: 129   catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 81769 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 81710

                                
Query: 189   cgacaaggacggagatggt 207
             |||||||||||| ||||||
Sbjct: 81709 cgacaaggacggcgatggt 81691



to top

>dbj|AP003818.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1200_C08
          Length = 106214

 Score =  149 bits (75), Expect = 4e-33
 Identities = 78/79 (98%)
 Strand = Plus / Minus

                                                                         
Query: 129   catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 94608 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 94549

                                
Query: 189   cgacaaggacggagatggt 207
             |||||||||||| ||||||
Sbjct: 94548 cgacaaggacggcgatggt 94530



to top

>dbj|AK063566.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-117-F09, full
           insert sequence
          Length = 1470

 Score =  149 bits (75), Expect = 4e-33
 Identities = 78/79 (98%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 89  catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 148

                              
Query: 189 cgacaaggacggagatggt 207
           |||||||||||| ||||||
Sbjct: 149 cgacaaggacggcgatggt 167



to top

>gb|U48691.1|TAU48691 Triticum aestivum calmodulin TaCaM2-2 mRNA, complete cds
          Length = 1023

 Score =  147 bits (74), Expect = 2e-32
 Identities = 95/102 (93%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 57  atggcggaccagctcaccgacgaccagatcgccgaattcaaggaggctttcagcctcttc 116

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||| || || |||||||| ||||||||||||||||||
Sbjct: 117 gacaaggatggggacggttgcattaccaccaaggagctggga 158



to top

>gb|AY106452.1| Zea mays PCO074292 mRNA sequence
          Length = 929

 Score =  143 bits (72), Expect = 3e-31
 Identities = 90/96 (93%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||
Sbjct: 136 catggcggaccagctcaccgacgaccagatcgccgagttcaaggaagcattcagcctctt 195

                                               
Query: 189 cgacaaggacggagatggttgcatcaccaccaagga 224
           |||||||||||| || || |||||||||||||||||
Sbjct: 196 cgacaaggacggcgacggctgcatcaccaccaagga 231



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           |||||||||||||| || | ||||||||||||
Sbjct: 393 tcaaggaggccttccgcgtgttcgacaaggac 424



to top

>gb|U49105.1|TAU49105 Triticum aestivum calmodulin TaCaM4-1 mRNA, complete cds
          Length = 841

 Score =  143 bits (72), Expect = 3e-31
 Identities = 96/104 (92%)
 Strand = Plus / Plus

                                                                       
Query: 128 gcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctct 187
           |||||||||| || |||||||||||||||||||||||||||||||| ||||||||||| |
Sbjct: 111 gcatggcggaccaactcaccgacgaccagatcgccgagttcaaggaagccttcagcctat 170

                                                       
Query: 188 tcgacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||| |||||||| || ||||||||||| |||||||||||||||
Sbjct: 171 tcgataaggacggcgacggttgcatcacaaccaaggagctggga 214



to top

>gb|AF441190.1|AF441190 Oryza sativa clone 15295 calmodulin (CaM) mRNA, complete cds
          Length = 633

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 74  catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 133

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| || ||||||||
Sbjct: 134 cgacaaggacggcgacggttgcatcactactaaggagct 172



to top

>gb|L20691.1|VIRCALMOD Vigna radiata calmodulin mRNA, complete cds
          Length = 878

 Score =  141 bits (71), Expect = 1e-30
 Identities = 89/95 (93%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 26  atggccgaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 85

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||| || ||||||||||| || ||||||||
Sbjct: 86  gacaaggatggcgatggttgcattactaccaagga 120



to top

>dbj|AK121606.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042G12, full
           insert sequence
          Length = 876

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 146 catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 205

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| || ||||||||
Sbjct: 206 cgacaaggacggcgacggttgcatcactactaaggagct 244



to top

>dbj|AK119167.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-036-F05, full
           insert sequence
          Length = 830

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 101 catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 160

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| || ||||||||
Sbjct: 161 cgacaaggacggcgacggttgcatcactactaaggagct 199



to top

>dbj|AK059534.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-029-D11, full
           insert sequence
          Length = 968

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 99  catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 158

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| || ||||||||
Sbjct: 159 cgacaaggacggcgacggttgcatcactactaaggagct 197



to top

>gb|AY103899.1| Zea mays PCO074294 mRNA sequence
          Length = 1076

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 242 catggcggaccagctcactgacgaccaaatcgccgagttcaaggaggccttcagcctctt 301

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||| |||||||| || ||||||||||| |||||||||||
Sbjct: 302 cgataaggacggcgacggttgcatcacaaccaaggagct 340



to top

>gb|AF042839.1|AF042839 Oryza sativa calmodulin (CaM2) mRNA, complete cds
          Length = 671

 Score =  141 bits (71), Expect = 1e-30
 Identities = 92/99 (92%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 90  catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 149

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||||||||| || ||||||||
Sbjct: 150 cgacaaggacggcgacggttgcatcactactaaggagct 188



to top

>ref|NM_188123.1| Oryza sativa (japonica cultivar-group), Ozsa8555 predicted mRNA
          Length = 450

 Score =  139 bits (70), Expect = 4e-30
 Identities = 94/102 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 60

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||||||||| || ||||| || || || |||||| |||||
Sbjct: 61  gacaaggacggcgacggttgtattactactaaggagttggga 102



to top

>ref|XM_475464.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 450

 Score =  139 bits (70), Expect = 4e-30
 Identities = 91/98 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 1   atggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctcttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| || ||||||||||| || ||||||||
Sbjct: 61  gacaaggacggcgacggttgcatcactactaaggagct 98



to top

>emb|AJ427338.1|BOL427338 Brassica oleracea mRNA for calmodulin 2 (cam2 gene)
          Length = 560

 Score =  139 bits (70), Expect = 4e-30
 Identities = 91/98 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| | ||||||||||| |||||||||||||||
Sbjct: 1   atggcggatcagctgaccgatgaccagatctcagagttcaaggaagccttcagcctcttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| || ||||||||||||||||||||||||||
Sbjct: 61  gacaaggatggcgatggttgcatcaccaccaaggagct 98



to top

>gb|AY752882.1| Aegiceras corniculatum calmodulin mRNA, complete cds
          Length = 655

 Score =  139 bits (70), Expect = 4e-30
 Identities = 94/102 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| || |||||| ||||||||| ||||||||||||||| |||
Sbjct: 51  atggcggatcagctaaccgaagatcagatctccgagttcagggaggccttcagcctattc 110

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||||||||||||||||||||| |||||||| |||||||||
Sbjct: 111 gacaaggacggagatggttgcattaccaccaaagagctggga 152



to top

>gb|AF292108.1|AF292108 Prunus avium calmodulin mRNA, complete cds
          Length = 495

 Score =  139 bits (70), Expect = 4e-30
 Identities = 91/98 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||||||||| |||||||||||| | |||||||||||||| ||||||||||||
Sbjct: 15  atggccgatcagctcacagacgaccagatctcagagttcaaggaggctttcagcctcttc 74

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 75  gacaaggacggcgatggttgcatcactaccaaggagct 112



to top

>dbj|AK058646.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-E09, full
           insert sequence
          Length = 694

 Score =  139 bits (70), Expect = 4e-30
 Identities = 94/102 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 85  atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 144

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||||||||| || ||||| || || || |||||| |||||
Sbjct: 145 gacaaggacggcgacggttgtattactactaaggagttggga 186



to top

>gb|U20297.1|STU20297 Solanum tuberosum clone PCM8 calmodulin gene, complete cds
          Length = 450

 Score =  139 bits (70), Expect = 4e-30
 Identities = 91/98 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| ||||||||| | |||||||||||||| |||||||| |||
Sbjct: 1   atggcagatcagctcaccgaagaccagatctctgagttcaaggaggctttcagcctattc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||||||||||||||||||||| ||||||||
Sbjct: 61  gacaaggacggagatggttgcatcaccactaaggagct 98



to top

>dbj|AB050840.1| Nicotiana tabacum mRNA for calmodulin NtCaM4, complete cds
          Length = 650

 Score =  139 bits (70), Expect = 4e-30
 Identities = 91/98 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| | ||||||||||||||||||||||| |||
Sbjct: 59  atggcggatcagctaaccgatgaccagatctctgagttcaaggaggccttcagcctattc 118

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||||||||||||||||| || ||||||||
Sbjct: 119 gacaaggacggagatggttgcatcacgactaaggagct 156



to top

>gb|AF466266.1| Sonneratia paracaseolaris calmodulin gene, complete cds
          Length = 1299

 Score =  137 bits (69), Expect = 2e-29
 Identities = 75/77 (97%)
 Strand = Plus / Plus

                                                                       
Query: 127 ggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctc 186
           ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1   ggcatggcggatccgctcaccgacgaccagatctccgagttcaaggaggccttcagcctc 60

                            
Query: 187 ttcgacaaggacggaga 203
           |||||||||||||||||
Sbjct: 61  ttcgacaaggacggaga 77



to top

>gb|AY275526.1| Pyrus communis calmodulin mRNA, partial cds
          Length = 416

 Score =  137 bits (69), Expect = 2e-29
 Identities = 93/101 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||||||||||||| |||||||||||||||| |||||||| |||
Sbjct: 24  atggccgatcagctcaccgacgaccagatctccgagttcaaggaggcgttcagcctattc 83

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||||| |||||||||||||| || |||||| ||||
Sbjct: 84  gacaaggacggcgatggttgcatcactacaaaggagttggg 124



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  135 bits (68), Expect = 7e-29
 Identities = 71/72 (98%)
 Strand = Plus / Minus

                                                                           
Query: 129     catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
               ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9197859 catggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 9197800

                           
Query: 189     cgacaaggacgg 200
               ||||||||||||
Sbjct: 9197799 cgacaaggacgg 9197788



 Score =  133 bits (67), Expect = 3e-28
 Identities = 70/71 (98%)
 Strand = Plus / Plus

                                                                           
Query: 130     atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 9886709 atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 9886768

                          
Query: 190     gacaaggacgg 200
               |||||||||||
Sbjct: 9886769 gacaaggacgg 9886779



 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                            
Query: 129      catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
                ||||||||| |||||| |||| || ||||| |  ||||||| ||||||||||||||||||
Sbjct: 34414352 catggcggaccagctctccgaagagcagattggagagttcagggaggccttcagcctctt 34414411

                            
Query: 189      cgacaaggacgg 200
                ||||||||||||
Sbjct: 34414412 cgacaaggacgg 34414423



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 208     tgcatcaccaccaaggagct 227
               ||||||||||||||||||||
Sbjct: 9195154 tgcatcaccaccaaggagct 9195135



to top

>dbj|AP000969.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0011D01
          Length = 168655

 Score =  135 bits (68), Expect = 7e-29
 Identities = 71/72 (98%)
 Strand = Plus / Minus

                                                                         
Query: 129   catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
             ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 98241 catggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 98182

                         
Query: 189   cgacaaggacgg 200
             ||||||||||||
Sbjct: 98181 cgacaaggacgg 98170



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 208   tgcatcaccaccaaggagct 227
             ||||||||||||||||||||
Sbjct: 95536 tgcatcaccaccaaggagct 95517



to top

>gb|L01431.1|SOYSCAM2X Soybean calmodulin (SCaM-2) mRNA, complete cds
          Length = 859

 Score =  135 bits (68), Expect = 7e-29
 Identities = 77/80 (96%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 59  atggccgaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 118

                               
Query: 190 gacaaggacggagatggttg 209
           ||||||||||| ||||||||
Sbjct: 119 gacaaggacggcgatggttg 138



to top

>gb|AY517930.1| Arachis hypogaea calmodulin (CaM1) mRNA, complete cds
          Length = 447

 Score =  133 bits (67), Expect = 3e-28
 Identities = 88/95 (92%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||
Sbjct: 1   atggcggatccgctcaccgacgaacagatctccgagttcaaggaggccttcagcctcttc 60

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||||| |||||||| || || ||||||||
Sbjct: 61  gacaaggacggcgatggttgtattactaccaagga 95



to top

>emb|Z12828.1|OSCALMOD2 O.sativa gene encoding calmodulin
          Length = 1927

 Score =  133 bits (67), Expect = 3e-28
 Identities = 70/71 (98%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 687 atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 746

                      
Query: 190 gacaaggacgg 200
           |||||||||||
Sbjct: 747 gacaaggacgg 757



to top

>dbj|AP000815.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
             clone:P0003H10
          Length = 142418

 Score =  133 bits (67), Expect = 3e-28
 Identities = 70/71 (98%)
 Strand = Plus / Plus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 22475 atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 22534

                        
Query: 190   gacaaggacgg 200
             |||||||||||
Sbjct: 22535 gacaaggacgg 22545



to top

>gb|DQ180316.1| Fragaria x ananassa clone PBCESTFXA11 SSR marker
          Length = 724

 Score =  133 bits (67), Expect = 3e-28
 Identities = 91/99 (91%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| |||||||||||||||||||||||| | |||||||||||||| |||||||||||
Sbjct: 44  catggccgatcagctcaccgacgaccagatctctgagttcaaggaggctttcagcctctt 103

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| ||||| ||||| || |||||||||||
Sbjct: 104 cgacaaggacggcgatggctgcattactaccaaggagct 142



to top

>gb|L18914.1|RICCALMODL Oryza sativa calmodulin gene, complete cds
          Length = 1927

 Score =  133 bits (67), Expect = 3e-28
 Identities = 70/71 (98%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 687 atggcggaccagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 746

                      
Query: 190 gacaaggacgg 200
           |||||||||||
Sbjct: 747 gacaaggacgg 757



to top

>dbj|AB050839.1| Nicotiana tabacum mRNA for calmodulin NtCaM3, complete cds
          Length = 748

 Score =  131 bits (66), Expect = 1e-27
 Identities = 90/98 (91%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| | ||||||||||||||||||||||| || 
Sbjct: 81  atggcggatcagctaaccgatgaccagatctctgagttcaaggaggccttcagcctattt 140

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||||||||||||||||| || ||||||||
Sbjct: 141 gacaaggacggagatggttgcatcacgactaaggagct 178



to top

>emb|Y13974.1|ZMCALMODU Zea mays mRNA for calmodulin
          Length = 450

 Score =  125 bits (63), Expect = 6e-26
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||||||||||| |||||||||||||||||||| || ||||||||||||
Sbjct: 1   atggcggaccagctcaccgacgagcagatcgccgagttcaaggaagcattcagcctcttc 60

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           || |||||||| || || |||||||||||||||||
Sbjct: 61  gataaggacggcgacggctgcatcaccaccaagga 95



 Score = 40.1 bits (20), Expect = 3.0
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           |||||||||||||| || | ||||||||||||
Sbjct: 257 tcaaggaggccttccgcgtgttcgacaaggac 288



to top

>emb|X74490.1|ZMRNCAL Z.mays mRNA for calmodulin
          Length = 743

 Score =  125 bits (63), Expect = 6e-26
 Identities = 90/99 (90%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 13  catggcggaccagctcaccgacgagcagatcgcggagttcaaggaggccttcagcctctt 72

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||| ||||| || || || |||||||| |||||||||||
Sbjct: 73  cgataaggatggcgacggctgcatcactaccaaggagct 111



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           |||||||||||||| || ||||||||||||||
Sbjct: 270 tcaaggaggccttccgcgtcttcgacaaggac 301



to top

>emb|AJ271913.1|OSA271913 Oryza sativa partial mRNA for putative calmodulin (caM gene)
          Length = 406

 Score =  125 bits (63), Expect = 6e-26
 Identities = 75/79 (94%)
 Strand = Plus / Plus

                                                                       
Query: 153 ccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcat 212
           |||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 1   ccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggcgacggttgcat 60

                              
Query: 213 caccaccaaggagctggga 231
           ||| ||||||||| |||||
Sbjct: 61  cacaaccaaggagttggga 79



to top

>gb|AF030034.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-3 allele, complete
           cds
          Length = 822

 Score =  125 bits (63), Expect = 6e-26
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || |||||||||||||| |||||||||||||| |||||||||||||||||||||
Sbjct: 20  atggccgaccagctcaccgacgaacagatcgccgagtttaaggaggccttcagcctcttc 79

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||| || ||||||||||| || ||||||||
Sbjct: 80  gacaaggatggcgatggttgcattactaccaagga 114



to top

>gb|AY109837.1| Zea mays CL1769_2 mRNA sequence
          Length = 1030

 Score =  125 bits (63), Expect = 6e-26
 Identities = 90/99 (90%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 140 catggcggaccagctcaccgacgagcagatcgcggagttcaaggaggccttcagcctctt 199

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||| ||||| || || || |||||||| |||||||||||
Sbjct: 200 cgataaggatggcgacggctgcatcactaccaaggagct 238



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           |||||||||||||| || ||||||||||||||
Sbjct: 397 tcaaggaggccttccgcgtcttcgacaaggac 428



to top

>ref|NM_180529.2| Arabidopsis thaliana CAM6 (CALMODULIN 6); calcium ion binding
           AT5G21274 (CAM6) mRNA, complete cds
          Length = 758

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 69  atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 128

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| |||||||||||||||||
Sbjct: 129 gataaggatggtgatggttgtatcaccaccaaggagct 166



to top

>gb|AY656687.1| Daucus carota calmodulin cam-204 mRNA, complete cds
          Length = 450

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcactaccaaggagct 98



to top

>gb|AY656686.1| Daucus carota calmodulin cam-203 mRNA, complete cds
          Length = 450

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcactaccaaggagct 98



to top

>gb|DQ186610.1| Catharanthus roseus calmodulin 2 mRNA, complete cds
          Length = 741

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| |||||||| |||||| | ||||||||||||||||| ||||| || 
Sbjct: 95  atggcagatcagctgaccgacgatcagatctctgagttcaaggaggcctttagccttttt 154

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||||||||||||||| ||||||||||||||
Sbjct: 155 gacaaggacggagatggttgcattaccaccaaggagct 192



to top

>gb|AY517933.1| Arachis hypogaea calmodulin (CaM1) gene, complete cds
          Length = 1425

 Score =  123 bits (62), Expect = 3e-25
 Identities = 74/78 (94%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||
Sbjct: 1   atggcggatccgctcaccgacgaacagatctccgagttcaaggaggccttcagcctcttc 60

                             
Query: 190 gacaaggacggagatggt 207
           ||||||||||| ||||||
Sbjct: 61  gacaaggacggcgatggt 78



to top

>gb|AY364012.1| Daucus carota calmodulin 8 mRNA, partial cds
          Length = 450

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcactaccaaggagct 98



to top

>emb|Z12024.1|ATCMACAM6 A.thaliana mRNA (clone ACaM6) for calmodulin
          Length = 660

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 38  atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 97

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| |||||||||||||||||
Sbjct: 98  gataaggatggtgatggttgtatcaccaccaaggagct 135



to top

>emb|X59751.1|DCCAM1G Carrot Ccam-1 gene for calmodulin
          Length = 704

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||||||||| |||||| ||||||||||||| || |||||||| |||
Sbjct: 40  atggccgatcaactcaccgacgatcagatctccgagttcaaggaagctttcagcctgttc 99

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 100 gacaaggacggcgatggttgcatcactaccaaggagct 137



to top

>gb|AY094037.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, complete cds
          Length = 450

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 1   atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| |||||||||||||||||
Sbjct: 61  gataaggatggtgatggttgtatcaccaccaaggagct 98



to top

>gb|AY050350.1| Arabidopsis thaliana AT3g43810/T28A8_100 mRNA, complete cds
          Length = 759

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 69  atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 128

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| |||||||||||||||||
Sbjct: 129 gataaggatggtgatggttgtatcaccaccaaggagct 166



to top

>emb|BX822955.1|CNS0A7H5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB76ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 455

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 4   atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 63

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| |||||||||||||||||
Sbjct: 64  gataaggatggtgatggttgtatcaccaccaaggagct 101



to top

>emb|BX825155.1|CNS0A68K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL16ZF10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 455

 Score =  123 bits (62), Expect = 3e-25
 Identities = 89/98 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 4   atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 63

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| |||||||||||||||||
Sbjct: 64  gataaggatggtgatggttgtatcaccaccaaggagct 101



to top

>gb|M88307.1|BNACALM Brassica juncea calmodulin mRNA, complete cds
          Length = 834

 Score =  123 bits (62), Expect = 3e-25
 Identities = 92/102 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||||||||| ||||||||| | |||
Sbjct: 48  atggcggatcagctcaccgacgatcagatctctgagttcaaggaagccttcagcttattc 107

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||| || || |||||||| ||||||||||||||||||
Sbjct: 108 gacaaggatggtgacggttgcattaccaccaaggagctggga 149



to top

>gb|U10150.1|BNU10150 Brassica napus Naehan calmodulin (bcm1) mRNA, complete cds
          Length = 637

 Score =  123 bits (62), Expect = 3e-25
 Identities = 92/102 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| ||||||||||||| ||||||||| | |||
Sbjct: 76  atggcggatcagctcaccgacgatcagatctccgagttcaaggaagccttcagcttattc 135

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || || |||||||| ||||||||||||||||||
Sbjct: 136 gacaaagatggtgacggttgcattaccaccaaggagctggga 177



to top

>gb|BT018042.1| Zea mays clone EL01N0531A07.c mRNA sequence
          Length = 864

 Score =  119 bits (60), Expect = 4e-24
 Identities = 87/96 (90%)
 Strand = Plus / Plus

                                                                       
Query: 132 ggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcga 191
           |||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 5   ggcggaccagctcaccgacgagcagatcgcggagttcaaggaggccttcagcctcttcga 64

                                               
Query: 192 caaggacggagatggttgcatcaccaccaaggagct 227
            ||||| || || || |||||||| |||||||||||
Sbjct: 65  taaggatggcgacggctgcatcactaccaaggagct 100



 Score = 48.1 bits (24), Expect = 0.012
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 167 tcaaggaggccttcagcctcttcgacaaggac 198
           |||||||||||||| || ||||||||||||||
Sbjct: 259 tcaaggaggccttccgcgtcttcgacaaggac 290



to top

>gb|AC129718.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0088I06, complete sequence
          Length = 187651

 Score =  119 bits (60), Expect = 4e-24
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                         
Query: 129   catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
             ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 58050 catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 57991

                         
Query: 189   cgacaaggacgg 200
             ||||||||||||
Sbjct: 57990 cgacaaggacgg 57979



to top

>gb|AY459341.1| Oryza sativa (japonica cultivar-group) clone CL031105.6 R2R3-MYB gene
             region
          Length = 58956

 Score =  119 bits (60), Expect = 4e-24
 Identities = 69/72 (95%)
 Strand = Plus / Plus

                                                                         
Query: 129   catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
             ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 22848 catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 22907

                         
Query: 189   cgacaaggacgg 200
             ||||||||||||
Sbjct: 22908 cgacaaggacgg 22919



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  119 bits (60), Expect = 4e-24
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                            
Query: 129      catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
                ||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||
Sbjct: 23989561 catggcggaccagctcaccgacgagcagatcgccgagttcaaggaggcgttcagcctctt 23989502

                            
Query: 189      cgacaaggacgg 200
                ||||||||||||
Sbjct: 23989501 cgacaaggacgg 23989490



to top

>gb|AY572856.1| Arachis hypogaea calmodulin (CaM-3) gene, complete cds
          Length = 447

 Score =  117 bits (59), Expect = 2e-23
 Identities = 86/95 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| |||||||||||| |||||| | |||||||||||||||||||||||||||
Sbjct: 1   atggcggatccgctcaccgacgaacagatctctgagttcaaggaggccttcagcctcttc 60

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           || |||||||| |||||||| || || ||||||||
Sbjct: 61  gataaggacggcgatggttgtattactaccaagga 95



to top

>emb|AJ843115.1| Plantago major mRNA for calmodulin (cam2 gene)
          Length = 792

 Score =  117 bits (59), Expect = 2e-23
 Identities = 89/99 (89%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||||||| | || |||||||||||| | || ||||||||||| |||||||| ||
Sbjct: 65  catggcggatcagttgacagacgaccagatctctgaattcaaggaggctttcagcctatt 124

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||| || ||||||||||||||||||||||||||
Sbjct: 125 cgacaaggatggcgatggttgcatcaccaccaaggagct 163



to top

>gb|AF030033.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-2 allele, complete
           cds
          Length = 852

 Score =  117 bits (59), Expect = 2e-23
 Identities = 86/95 (90%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||||||||| |||||| ||||||||||||| |||||||||||||||
Sbjct: 39  atggccgatcaactcaccgacgagcagatctccgagttcaaggaagccttcagcctcttc 98

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||||| |||||||| || || ||||||||
Sbjct: 99  gacaaggacggcgatggttgtattacaaccaagga 133



to top

>gb|AF031482.1|AF031482 Zea mays calmodulin (Zmrcalm) mRNA, complete cds
          Length = 480

 Score =  117 bits (59), Expect = 2e-23
 Identities = 89/99 (89%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||| ||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 13  catggcggaccagctcacggacgagcagatcgcggagttcaaggaggccttcagcctctt 72

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||| ||||| || || || |||||||| |||||||||||
Sbjct: 73  cgataaggatggcgacggctgcatcactaccaaggagct 111



to top

>ref|NM_114249.2| Arabidopsis thaliana CAM7 (CALMODULIN 7); calcium ion binding
           AT3G43810 (CAM7) mRNA, complete cds
          Length = 801

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| ||||||||||||| || || ||||| |||
Sbjct: 104 atggcggatcagctaaccgatgaccagatctccgagttcaaggaagcttttagcctattc 163

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 164 gacaaagacggagatggttgtatcaccacaaaggagct 201



to top

>gb|DQ207852.1| Solanum tuberosum clone 075A11 calmodulin-like mRNA, complete cds
          Length = 1109

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | |||||||||||||| |||||||| |||
Sbjct: 40  atggcagatcagctcaccgatgatcagatctctgagttcaaggaggctttcagcctattc 99

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||||||||||||||| || || ||||||||
Sbjct: 100 gacaaggacggagatggttgcattacaactaaggagct 137



to top

>gb|BT025511.1| Arabidopsis thaliana At3g43810 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| ||||||||||||| || || ||||| |||
Sbjct: 1   atggcggatcagctaaccgatgaccagatctccgagttcaaggaagcttttagcctattc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 61  gacaaagacggagatggttgtatcaccacaaaggagct 98



to top

>gb|AY656694.1| Daucus carota calmodulin cam-211 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 121 atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 180

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 181 gacaaggacggcgatggttgtatcactaccaaggagct 218



 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcactaccaaggagct 98



to top

>gb|AY656693.1| Daucus carota calmodulin cam-210 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcactaccaaggagct 98



to top

>gb|AY656691.1| Daucus carota calmodulin cam-208 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcactaccaaggagct 98



to top

>gb|AY656689.1| Daucus carota calmodulin cam-206 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcactaccaaggagct 98



to top

>gb|AY656688.1| Daucus carota calmodulin cam-205 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||| | |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcgctaccaaggagct 98



to top

>gb|AY656685.1| Daucus carota calmodulin cam-202 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| || 
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttt 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcactaccaaggagct 98



to top

>gb|AY656684.1| Daucus carota calmodulin cam-201 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| || 
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttt 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcactaccaaggagct 98



to top

>gb|AY543015.1| Daucus carota calmodulin cam-16 mRNA, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || ||||||||| |||||||||||||||| |||||||| |||
Sbjct: 1   atggcagatcagctaacagatgaccagatctccgagttcaaggaggctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcactaccaaggagct 98



to top

>gb|AF178073.1| Arabidopsis thaliana calmodulin 7 (CAM7) mRNA, complete cds
          Length = 753

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| ||||||||||||| || || ||||| |||
Sbjct: 43  atggcggatcagctaaccgatgaccagatctccgagttcaaggaagcttttagcctattc 102

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 103 gacaaagacggagatggttgtatcaccacaaaggagct 140



to top

>gb|AY364011.1| Daucus carota calmodulin 4 mRNA, partial cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || ||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggcagatcagctaacagatgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| |||||||||||
Sbjct: 61  gacaaggacggcgatggttgcatcactaccaaggagct 98



to top

>gb|DQ450840.1| Solanum chacoense calmodulin (CAM1) mRNA, complete cds
          Length = 831

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | |||||||||||||| |||||||| |||
Sbjct: 77  atggcagatcagctcaccgatgatcagatctctgagttcaaggaggctttcagcctattc 136

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||||||||||||||| || || ||||||||
Sbjct: 137 gacaaggacggagatggttgcattacaactaaggagct 174



to top

>emb|Z12839.1|LLCALMOD L.longiflorum mRNA encoding calmodulin
          Length = 681

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||| ||||| |||||| ||||||| |||||||| |||||||| |||
Sbjct: 9   atggcggatcagctcactgacgatcagatctccgagtttaaggaggcgttcagcctgttc 68

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||| |||||||||||||| ||||| |||||
Sbjct: 69  gataaggacggcgatggttgcatcacaaccaaagagct 106



to top

>emb|X85091.1|MPCAM M.pyrifera mRNA for calmodulin
          Length = 1519

 Score =  115 bits (58), Expect = 6e-23
 Identities = 91/102 (89%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| |||||| | ||||| || |||||||| ||||||||||||||||||||||| ||
Sbjct: 694 catggctgatcagttgaccgaggagcagatcgctgagttcaaggaggccttcagcctgtt 753

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||||||| |||||   |||||||||||||||||||||
Sbjct: 754 cgacaaggacggcgatgggaccatcaccaccaaggagctggg 795



to top

>emb|X60738.1|MDCAMR M.domestica CaM mRNA for calmodulin
          Length = 665

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || ||||| |||||| | ||||||||||||||||||||||| |||
Sbjct: 49  atggcggatcagctgactgacgatcagatctctgagttcaaggaggccttcagccttttc 108

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| || |||||||| |||||||| ||||||||
Sbjct: 109 gacaaggatggcgatggttgtatcaccacaaaggagct 146



to top

>emb|AJ318521.1|SCO318521 Solanum commersonii mRNA for putative calmodulin (caM3 gene)
          Length = 807

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || ||||||||| | |||||||| ||||| |||||| | |||
Sbjct: 67  atggcggatcagcttactgatgaccagatctctgagttcaaagaggctttcagcttgttc 126

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||||||||||||||||| |||||||||||
Sbjct: 127 gacaaggacggagatggttgcatcacgaccaaggagct 164



to top

>gb|AY070232.1| Vitis vinifera calmodulin mRNA, complete cds
          Length = 685

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| ||||||||| ||||||||||||||||||||||| | |||
Sbjct: 97  atggctgatcagctcaccgatgaccagatctccgagttcaaggaggccttcagcttgttc 156

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| || ||||||||||| ||| | |||||||||||
Sbjct: 157 gacaaagatggagatggttgtatcgctaccaaggagct 194



to top

>gb|AF295637.1|AF295637 Elaeis guineensis calmodulin mRNA, complete cds
          Length = 846

 Score =  115 bits (58), Expect = 6e-23
 Identities = 91/102 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||||||||| |||||||||||| | ||||||||||| ||||||||| | |||
Sbjct: 103 atggccgatcagctcacggacgaccagatctctgagttcaaggaagccttcagcttgttc 162

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||| ||||| ||||||||||| |||||||| ||||||
Sbjct: 163 gacaaggatggagacggttgcatcacaaccaaggaactggga 204



to top

>gb|AY088477.1| Arabidopsis thaliana clone 7008 mRNA, complete sequence
          Length = 754

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| ||||||||| ||||||||||||| || || ||||| |||
Sbjct: 104 atggcggatcagctaaccgatgaccagatctccgagttcaaggaagcttttagcctattc 163

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| |||||||||||||| |||||||| ||||||||
Sbjct: 164 gacaaagacggagatggttgtatcaccacaaaggagct 201



to top

>gb|U20294.1|STU20294 Solanum tuberosum clone PCM5 calmodulin gene, complete cds
          Length = 450

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | |||||||||||||| |||||||| |||
Sbjct: 1   atggcagatcagctcaccgaagatcagatctctgagttcaaggaggctttcagcctattc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||||||||||||||| || || ||||||||
Sbjct: 61  gacaaggacggagatggttgcattacaactaaggagct 98



to top

>gb|L01432.1|SOYSCAM3X Soybean calmodulin (SCaM-3) mRNA, complete cds
          Length = 856

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| |||||||| || |||||| ||||||||||||| ||||||||| | |||
Sbjct: 41  atggcggatcaactcaccgatgaacagatctccgagttcaaggaagccttcagcttgttc 100

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||| |||||||||||||| |||||||||||
Sbjct: 101 gataaggacggcgatggttgcatcacaaccaaggagct 138



to top

>gb|L18912.1|LILCALMODU Lilium longiflorum calmodulin mRNA, complete cds
          Length = 681

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||| ||||| |||||| ||||||| |||||||| |||||||| |||
Sbjct: 9   atggcggatcagctcactgacgatcagatctccgagtttaaggaggcgttcagcctgttc 68

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||| |||||||||||||| ||||| |||||
Sbjct: 69  gataaggacggcgatggttgcatcacaaccaaagagct 106



to top

>gb|L14071.1|BYNCALMOD Bryonia dioica calmodulin (Bc329) mRNA, complete cds
          Length = 899

 Score =  115 bits (58), Expect = 6e-23
 Identities = 91/102 (89%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| |||||||| |||||| |||||||||||||||| |||||| | ||
Sbjct: 71  catggctgaccagcttaccgacgatcagatctccgagttcaaggaggcattcagcttgtt 130

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||||||| ||||| ||||||||||||||||| |||||
Sbjct: 131 cgacaaggacggcgatggctgcatcaccaccaaggaactggg 172



to top

>dbj|AB050842.1| Nicotiana tabacum mRNA for calmodulin NtCaM6, complete cds
          Length = 813

 Score =  115 bits (58), Expect = 6e-23
 Identities = 88/98 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | |||||||| || ||||| || ||||| 
Sbjct: 54  atggcggatcagctcaccgacgatcagatctctgagttcaaagaagcctttagtctcttt 113

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||||||||||||||||| || ||||||||
Sbjct: 114 gacaaggacggagatggttgcatcacaactaaggagct 151



to top

>ref|NM_115539.2| Arabidopsis thaliana CAM3 (CALMODULIN 3); calcium ion binding
           AT3G56800 (CAM3) mRNA, complete cds
          Length = 908

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 155 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 214

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 215 gacaaggatggtgatggttgcattaccaccaaggagctggg 255



to top

>gb|AY091301.1| Arabidopsis thaliana putative calmodulin-3 protein (At3g56800)
           mRNA, complete cds
          Length = 481

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 1   atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 60

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 61  gacaaggatggtgatggttgcattaccaccaaggagctggg 101



to top

>gb|AY046048.1| Arabidopsis thaliana putative calmodulin-3 protein (At3g56800)
           mRNA, complete cds
          Length = 832

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 107 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 166

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 167 gacaaggatggtgatggttgcattaccaccaaggagctggg 207



to top

>gb|DQ398935.1| Vigna unguiculata calmodulin mRNA, complete cds
          Length = 464

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 127 ggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctc 186
           ||||||||||||| |||||||||||| |||||| ||||||||||||| ||||||||| | 
Sbjct: 5   ggcatggcggatccgctcaccgacgatcagatctccgagttcaaggaagccttcagcttg 64

                                                    
Query: 187 ttcgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| ||||| || |||||||||||||| || ||||||||
Sbjct: 65  ttcgataaggatggcgatggttgcatcacaacaaaggagct 105



to top

>gb|AY057567.1| Arabidopsis thaliana AT3g56800/T8M16_130 mRNA, complete cds
          Length = 810

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 155 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 214

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 215 gacaaggatggtgatggttgcattaccaccaaggagctggg 255



to top

>emb|BX824588.1|CNS0A7R3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH58ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 985

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 101 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 160

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 161 gacaaggatggtgatggttgcattaccaccaaggagctggg 201



to top

>emb|BX822741.1|CNS0A78I Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB60ZF11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 782

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 91  atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 150

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 151 gacaaggatggtgatggttgcattaccaccaaggagctggg 191



to top

>emb|BX823583.1|CNS0A6LJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS53ZC08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 709

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 83  atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 142

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 143 gacaaggatggtgatggttgcattaccaccaaggagctggg 183



to top

>emb|BX823557.1|CNS0A6N7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS50ZG02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 722

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 56  atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 115

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 116 gacaaggatggtgatggttgcattaccaccaaggagctggg 156



to top

>gb|AY085660.1| Arabidopsis thaliana clone 16715 mRNA, complete sequence
          Length = 740

 Score =  113 bits (57), Expect = 2e-22
 Identities = 90/101 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 155 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 214

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||||| || ||||||||||| |||||||||||||||||
Sbjct: 215 gacaaggatggtgatggttgcattaccaccaaggagctggg 255



to top

>gb|U79736.1|HAU79736 Helianthus annuus calmodulin (HaCaM) mRNA, complete cds
          Length = 494

 Score =  109 bits (55), Expect = 4e-21
 Identities = 85/95 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | || ||||||||||| ||||||||||||
Sbjct: 1   atggcggatcagcttacagaagatcagatctctgaattcaaggaggctttcagcctcttc 60

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||||| |||||||| ||||||||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcaccaccaagga 95



to top

>gb|AY656692.1| Daucus carota calmodulin cam-209 mRNA, complete cds
          Length = 450

 Score =  107 bits (54), Expect = 2e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| || ||||||||
Sbjct: 61  gacaaggacggcgatggttgtatcactacaaaggagct 98



to top

>gb|AY656690.1| Daucus carota caomodulin cam-207 mRNA, complete cds
          Length = 450

 Score =  107 bits (54), Expect = 2e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || |||||||||||| ||||||||||||| || |||||||| |||
Sbjct: 1   atggccgatcagctgacggacgaccagatctccgagttcaaggaagctttcagcctgttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||| |||||||| ||||| |||||||||||
Sbjct: 61  gataaggacggcgatggttgtatcactaccaaggagct 98



to top

>gb|U20296.1|STU20296 Solanum tuberosum clone PCM7 calmodulin gene, complete cds
          Length = 450

 Score =  107 bits (54), Expect = 2e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| ||||||||||| || 
Sbjct: 1   atggcagatcagctcaccgaagatcagatctctgagttcaaggaagccttcagccttttt 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||| ||||||||||||||||||||||| || |||||
Sbjct: 61  gacaaagacggagatggttgcatcaccactaaagagct 98



to top

>dbj|AB050844.1| Nicotiana tabacum mRNA for calmodulin NtCaM8, complete cds
          Length = 820

 Score =  107 bits (54), Expect = 2e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || ||||| |||||| | ||||| || || |||||||||||||||
Sbjct: 52  atggcggatcagctgactgacgatcagatctctgagtttaaagaagccttcagcctcttc 111

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| || ||||||||
Sbjct: 112 gacaaggacggcgatggttgcatcactactaaggagct 149



to top

>dbj|AB050841.1| Nicotiana tabacum mRNA for calmodulin NtCaM5, complete cds
          Length = 823

 Score =  107 bits (54), Expect = 2e-20
 Identities = 87/98 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | |||||||| || ||||| || ||||| 
Sbjct: 61  atggcggatcagctcaccgacgatcagatctctgagttcaaagaagcctttagtctcttt 120

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||||||||||||||||||||| || ||||||||
Sbjct: 121 gataaggacggagatggttgcatcacaactaaggagct 158



to top

>gb|DQ200375.1| Solanum tuberosum clone 060G04 putative calmodulin-like protein
           mRNA, complete cds
          Length = 806

 Score =  101 bits (51), Expect = 9e-19
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| || |||||| | ||||||||||| |||||||| || || 
Sbjct: 12  atggcggatcagctcaccgaagatcagatctctgagttcaaggaagccttcagtcttttt 71

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||||||||||||||| ||||| || |||||
Sbjct: 72  gacaaggacggagatggttgtatcacaactaagga 106



to top

>gb|DQ191657.1| Solanum tuberosum calmodulin 5/6/7/8-like protein mRNA, complete
           cds
          Length = 876

 Score =  101 bits (51), Expect = 9e-19
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| || |||||| | ||||||||||| |||||||| || || 
Sbjct: 93  atggcggatcagctcaccgaagatcagatctctgagttcaaggaagccttcagtcttttt 152

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||||||||||||||| ||||| || |||||
Sbjct: 153 gacaaggacggagatggttgtatcacaactaagga 187



to top

>emb|Y09853.1|CACAM Cicer arietinum mRNA for CaM protein
          Length = 858

 Score =  101 bits (51), Expect = 9e-19
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || |||||||||||||| |||||||| ||||||||||| |||||||| ||||||
Sbjct: 96  atggccgaccagctcaccgacgatcagatcgctgagttcaaggaagccttcagtctcttc 155

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           || |||||||| |||||||| || || ||||||||
Sbjct: 156 gataaggacggcgatggttgtattactaccaagga 190



to top

>emb|AJ318520.1|SCO318520 Solanum commersonii mRNA for putative calmodulin (caM1 gene)
          Length = 807

 Score =  101 bits (51), Expect = 9e-19
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| || |||||| | ||||||||||| |||||||| || || 
Sbjct: 28  atggcggatcagctcaccgaagatcagatctctgagttcaaggaagccttcagtcttttt 87

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||||||||||||||| ||||| || |||||
Sbjct: 88  gacaaggacggagatggttgtatcacaactaagga 122



to top

>gb|AF150059.1|AF150059 Brassica napus calmodulin (CaM1) mRNA, complete cds
          Length = 533

 Score =  101 bits (51), Expect = 9e-19
 Identities = 75/83 (90%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacgga 201
           |||||||||||||||||| | ||||||||||||||||||||| | ||||||||||| || 
Sbjct: 33  ctcaccgacgaccagatctctgagttcaaggaggccttcagcttgttcgacaaggatggc 92

                                  
Query: 202 gatggttgcatcaccaccaagga 224
           || ||||||||||| ||||||||
Sbjct: 93  gacggttgcatcactaccaagga 115



to top

>gb|AF231026.1|AF231026 Oryza sativa calmodulin-like protein mRNA, complete cds
          Length = 961

 Score =  101 bits (51), Expect = 9e-19
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||| |||| || ||||| |  ||||||| ||||||||||||||||||
Sbjct: 105 catggcggaccagctctccgaagagcagattgtagagttcagggaggccttcagcctctt 164

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||  |||||||||||||||||
Sbjct: 165 cgacaaggacggcgacggttctatcaccaccaaggagct 203



to top

>dbj|AK070889.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074P12, full
           insert sequence
          Length = 791

 Score =  101 bits (51), Expect = 9e-19
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||| |||| || ||||| |  ||||||| ||||||||||||||||||
Sbjct: 83  catggcggaccagctctccgaagagcagattggagagttcagggaggccttcagcctctt 142

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||  |||||||||||||||||
Sbjct: 143 cgacaaggacggcgacggttctatcaccaccaaggagct 181



to top

>gb|U37936.1|OSU37936 Oryza sativa clone pFDRSC61 novel calmodulin-like protein mRNA,
           complete cds
          Length = 775

 Score =  101 bits (51), Expect = 9e-19
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||| |||| || ||||| |  ||||||| ||||||||||||||||||
Sbjct: 70  catggcggaccagctctccgaagagcagattgtagagttcagggaggccttcagcctctt 129

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| || ||||  |||||||||||||||||
Sbjct: 130 cgacaaggacggcgacggttctatcaccaccaaggagct 168



to top

>gb|U20295.1|STU20295 Solanum tuberosum clone PCM6 calmodulin mRNA, complete cds
          Length = 536

 Score =  101 bits (51), Expect = 9e-19
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| || |||||| | ||||||||||| |||||||| || || 
Sbjct: 79  atggcggatcagctcaccgaagatcagatctctgagttcaaggaagccttcagtcttttt 138

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||||||||||||||| ||||| || |||||
Sbjct: 139 gacaaggacggagatggttgtatcacaactaagga 173



to top

>ref|NM_105312.2| Arabidopsis thaliana CAM4 (CALMODULIN 4); calcium ion binding
           AT1G66410 (CAM4) mRNA, complete cds
          Length = 732

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 69  atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 128

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 129 gacaaagatggagatggttgcatcaccacaaaggagctggga 170



to top

>ref|NM_180013.1| Arabidopsis thaliana ATCAL4; calcium ion binding AT2G41110 (ATCAL4)
           mRNA, complete cds
          Length = 1009

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||| ||||| |||||| | || |||||||| ||||||||| | |||
Sbjct: 67  atggcggatcagctcacagacgatcagatctcagaattcaaggaagccttcagcttattc 126

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| || ||||||||||| ||||| ||||||||
Sbjct: 127 gacaaggatggtgatggttgcattaccacaaaggagct 164



to top

>ref|NM_191034.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 564

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||| |||| || ||||| |  ||||||| |||||||||||||||||||
Sbjct: 1   atggcggaccagctctccgaagagcagattggagagttcagggaggccttcagcctcttc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| || ||||  |||||||||||||||||
Sbjct: 61  gacaaggacggcgacggttctatcaccaccaaggagct 98



to top

>gb|BT014541.1| Lycopersicon esculentum clone 133956F, mRNA sequence
          Length = 712

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || ||||||||| | |||||||| ||||| |||||  | |||
Sbjct: 92  atggcggatcagctgacggatgaccagatctctgagttcaaagaggctttcagtttgttc 151

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||||||||||||||||| || ||||||||
Sbjct: 152 gacaaggacggagatggttgcatcacgactaaggagct 189



to top

>gb|AY517931.1| Arachis hypogaea calmodulin (CaM2) mRNA, complete cds
          Length = 447

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| |||||||||||| |||||| | || |||||||| ||||||||| |  ||
Sbjct: 1   atggcggatccgctcaccgacgaacagatctctgaattcaaggaagccttcagcttgctc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||| |||||||||||||| |||||||||||
Sbjct: 61  gataaggacggcgatggttgcatcacgaccaaggagct 98



to top

>ref|XM_754964.1| Ustilago maydis 521 calmodulin (UM03910.1) partial mRNA
          Length = 450

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || ||||| ||||| ||||||||||||||||||||||||||||||  ||| || 
Sbjct: 1   atggccgaccagcttaccgaagaccagatcgccgagttcaaggaggccttctccctgttt 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||   ||||||||||||||||||
Sbjct: 61  gacaaggacggcgatggcaccatcaccaccaaggagct 98



to top

>emb|Z12022.1|ATCMACAM4 A.thaliana mRNA (clone ACaM4) for calmodulin
          Length = 743

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 71  atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 130

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 131 gacaaagatggagatggttgcatcaccacaaaggagctggga 172



to top

>emb|X98404.1|CACAM2 C.annuum mRNA for calmodulin-2
          Length = 641

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||| |||||||| |||||||| |||
Sbjct: 38  atggcagatcagctcaccgatgatcagatctctgagtttaaggaggctttcagcctattc 97

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||||||||||||||| || || ||||||||
Sbjct: 98  gataaggacggagatggttgcattacaactaaggagct 135



to top

>gb|AY113902.1| Arabidopsis thaliana putative calmodulin-4 protein (At1g66410)
           mRNA, complete cds
          Length = 481

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 1   atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 60

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 61  gacaaagatggagatggttgcatcaccacaaaggagctggga 102



to top

>gb|AF370293.1| Arabidopsis thaliana putative calmodulin-4 protein (At1g66410)
           mRNA, complete cds
          Length = 729

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 52  atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 111

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 112 gacaaagatggagatggttgcatcaccacaaaggagctggga 153



to top

>emb|AJ843113.1| Quercus petraea mRNA for calmodulin (caM-3 gene)
          Length = 795

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacgga 201
           |||||||||||||||||| | ||||||||||||||||||||  | ||||||||||| || 
Sbjct: 132 ctcaccgacgaccagatctctgagttcaaggaggccttcagtttgttcgacaaggatggc 191

                                     
Query: 202 gatggttgcatcaccaccaaggagct 227
           || ||||||||||| |||||||||||
Sbjct: 192 gacggttgcatcactaccaaggagct 217



to top

>emb|AJ843114.1| Plantago major mRNA for calmodulin (cam1 gene)
          Length = 867

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| |||||||| |||||| ||||||| ||||| || |||   || |||
Sbjct: 100 atggcagatcagcttaccgacgatcagatctccgagtttaaggaagctttctctctattc 159

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||||| || ||||||||||||||||||||||||||||||
Sbjct: 160 gacaaggatggcgatggttgcatcaccaccaaggagctggga 201



to top

>gb|AY128752.1| Arabidopsis thaliana calmodulin cam2 (At2g41110) mRNA, complete cds
          Length = 562

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||| ||||| |||||| | || |||||||| ||||||||| | |||
Sbjct: 1   atggcggatcagctcacagacgatcagatctcagaattcaaggaagccttcagcttattc 60

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| || ||||||||||| ||||| ||||||||
Sbjct: 61  gacaaggatggtgatggttgcattaccacaaaggagct 98



to top

>gb|AY065179.1| Arabidopsis thaliana calmodulin (cam2) (At2g41110; T3K9.12) mRNA,
           complete cds
          Length = 695

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||| ||||| |||||| | || |||||||| ||||||||| | |||
Sbjct: 67  atggcggatcagctcacagacgatcagatctcagaattcaaggaagccttcagcttattc 126

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| || ||||||||||| ||||| ||||||||
Sbjct: 127 gacaaggatggtgatggttgcattaccacaaaggagct 164



to top

>gb|L20507.1|VIRCALMODU Vigna radiata calmodulin mRNA, complete cds
          Length = 820

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||||||||| |||||| ||||||| ||||||||||| ||| | |||
Sbjct: 83  atggccgatcaactcaccgacgagcagatctccgagtttaaggaggcctttagcttgttc 142

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||| ||||| || ||||||||
Sbjct: 143 gacaaggacggcgatggttgtatcacaactaaggagct 180



to top

>emb|BX813969.1|CNS0ADRS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB50ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 677

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 57  atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 116

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 117 gacaaagatggagatggttgcatcaccacaaaggagctggga 158



to top

>gb|AY088476.1| Arabidopsis thaliana clone 6982 mRNA, complete sequence
          Length = 719

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 58  atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 117

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || |||||||||||||||||||| ||||||||||||
Sbjct: 118 gacaaagatggagatggttgcatcaccacaaaggagctggga 159



to top

>gb|AF108889.1|AF108889 Capsicum annuum calmodulin mRNA, complete cds
          Length = 916

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||| |||||||| |||||||| |||
Sbjct: 73  atggcagatcagctcaccgatgatcagatctctgagtttaaggaggctttcagcctattc 132

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||||||||||||||| || || ||||||||
Sbjct: 133 gataaggacggagatggttgcattacaactaaggagct 170



to top

>gb|U83402.1|CAU83402 Capsicum annuum calmodulin mRNA, complete cds
          Length = 657

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||| |||||||| |||||||| |||
Sbjct: 27  atggcagatcagctcaccgatgatcagatctctgagtttaaggaggctttcagcctattc 86

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||||||||||||||| || || ||||||||
Sbjct: 87  gataaggacggagatggttgcattacaactaaggagct 124



to top

>dbj|AB050846.1| Nicotiana tabacum mRNA for calmodulin NtCaM10, complete cds
          Length = 802

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| || |||||| | ||||| |||||||| |||||||| |||
Sbjct: 54  atggcggatcagctgaccgatgatcagatctctgagtttaaggaggctttcagccttttc 113

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| ||||||||||| || || ||||||||
Sbjct: 114 gacaaggacggcgatggttgcattacaactaaggagct 151



to top

>dbj|AB050845.1| Nicotiana tabacum mRNA for calmodulin NtCaM9, complete cds
          Length = 804

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| || |||||| | ||||| |||||||| |||||||| |||
Sbjct: 55  atggcggatcagctgaccgatgatcagatctctgagtttaaggaggctttcagcctattc 114

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| ||||||||||| || || ||||||||
Sbjct: 115 gacaaggacggcgatggttgcattacaactaaggagct 152



to top

>dbj|AB050843.1| Nicotiana tabacum mRNA for calmodulin NtCaM7, complete cds
          Length = 823

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 86/98 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || ||||| |||||| | |||||||| || ||||| ||||| |||
Sbjct: 54  atggcggatcagctgactgacgatcagatctctgagttcaaagaagcctttagccttttc 113

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||||| || ||||||||
Sbjct: 114 gacaaggacggcgatggttgcatcactacgaaggagct 151



to top

>gb|AY657030.1| Salvia miltiorrhiza calmodulin mRNA, complete cds
          Length = 454

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 127 ggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctc 186
           ||||||||||||| |||||||||||| |||||| |||| |||||||| ||||||   || 
Sbjct: 1   ggcatggcggatccgctcaccgacgagcagatctccgaattcaaggaagccttctcgcta 60

                                                    
Query: 187 ttcgacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| || ||||| |||||||| |||||||||||
Sbjct: 61  ttcgacaaggatggcgatggctgcatcactaccaaggagct 101



to top

>gb|AY830128.1| Hevea brasiliensis calmodulin (CaM) mRNA, complete cds
          Length = 447

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| ||||||||||||||||||| | ||||||||||| |||||||||||||| 
Sbjct: 1   atggcggatccgctcaccgacgaccagatctctgagttcaaggaagccttcagcctcttt 60

                                  
Query: 190 gacaaggacggagatggttgcat 212
           || ||||| || ||||| |||||
Sbjct: 61  gataaggatggcgatggctgcat 83



to top

>emb|X97546.1|FSCAMFPRO F.sylvatica mRNA for CaMF protein
          Length = 524

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacgga 201
           |||||||||||||||||| | ||||||||||||||||||||| | ||||||||||| || 
Sbjct: 40  ctcaccgacgaccagatctctgagttcaaggaggccttcagcttgttcgacaaggatggc 99

                                  
Query: 202 gatggttgcatcaccaccaagga 224
           || ||||||||||| || |||||
Sbjct: 100 gacggttgcatcactacgaagga 122



to top

>emb|X97612.1|FSCAMF1 F.sylvatica mRNA for CaMF-1 protein
          Length = 524

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacgga 201
           |||||||||||||||||| | ||||||||||||||||||||| | ||||||||||| || 
Sbjct: 40  ctcaccgacgaccagatctctgagttcaaggaggccttcagcttgttcgacaaggatggc 99

                                  
Query: 202 gatggttgcatcaccaccaagga 224
           || ||||||||||| || |||||
Sbjct: 100 gacggttgcatcactacgaagga 122



to top

>emb|X60737.1|MDCAMG M.domestica CaM gene for calmodulin
          Length = 2458

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 130  atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
            |||||||||||||| || ||||| |||||| | ||||||||||||||||||||||| |||
Sbjct: 982  atggcggatcagctgactgacgatcagatctctgagttcaaggaggccttcagccttttc 1041

                               
Query: 190  gacaaggacggagatggtt 208
            |||||||| || |||||||
Sbjct: 1042 gacaaggatggcgatggtt 1060



to top

>ref|NM_128261.3| Arabidopsis thaliana CAM2 (CALMODULIN-2); calcium ion binding
           AT2G27030 (CAM2) transcript variant AT2G27030.1 mRNA,
           complete cds
          Length = 688

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 36  atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 95

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           ||||| ||||||||||||||||||||
Sbjct: 96  gacaaagacggagatggttgcatcac 121



to top

>ref|NM_179766.1| Arabidopsis thaliana CAM2 (CALMODULIN-2); calcium ion binding
           AT2G27030 (CAM2) transcript variant AT2G27030.3 mRNA,
           complete cds
          Length = 709

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 36  atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 95

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           ||||| ||||||||||||||||||||
Sbjct: 96  gacaaagacggagatggttgcatcac 121



to top

>ref|NM_123137.2| Arabidopsis thaliana CAM1 (CALMODULIN 1); calcium ion binding
           AT5G37780 (CAM1) mRNA, complete cds
          Length = 774

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| ||||| ||||| |||||| |||| |||||||| || || |||||||||
Sbjct: 89  atggcggatcaactcactgacgaacagatctccgaattcaaggaagcttttagcctcttc 148

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || |||||||||||||| || || |||||||||
Sbjct: 149 gacaaagatggcgatggttgcatcacaacaaaagagctggga 190



to top

>gb|AY830129.1| Hevea brasiliensis calmodulin (CaM) gene, complete cds
          Length = 1947

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| ||||||||||||||||||| | ||||||||||| |||||||||||||| 
Sbjct: 1   atggcggatccgctcaccgacgaccagatctctgagttcaaggaagccttcagcctcttt 60

                             
Query: 190 gacaaggacggagatggt 207
           || ||||| || ||||||
Sbjct: 61  gataaggatggcgatggt 78



to top

>gb|AY456265.1| Nicotiana attenuata calmodulin mRNA, complete cds
          Length = 568

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| ||||| || |||||| | ||||| |||||||| |||||||| |||
Sbjct: 48  atggcggatcagctgaccgatgatcagatctctgagtttaaggaggctttcagcctgttc 107

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || |||||||| ||||||||||| || || ||||||||
Sbjct: 108 gataaggacggcgatggttgcattacaactaaggagct 145



to top

>gb|BC105380.1| Bos taurus calmodulin 1 (phosphorylase kinase, delta), mRNA (cDNA
           clone MGC:128137 IMAGE:7929315), complete cds
          Length = 2173

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| ||||| || |||||||| ||||||||||||||||||  ||||||
Sbjct: 88  catggctgaccagctgaccgaggagcagatcgcagagttcaaggaggccttctccctctt 147

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           |||||| ||||| || ||   |||||||||||||||||||||
Sbjct: 148 cgacaaagacggggacggcaccatcaccaccaaggagctggg 189



to top

>gb|AF494220.1| Medicago truncatula calmodulin 2 mRNA, complete cds
          Length = 984

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||||||||| |||||| | ||||||||||| || |||||||| |||
Sbjct: 69  atggccgatcaactcaccgacgagcagatctctgagttcaaggaagctttcagcctattc 128

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| || ||||||||||||||
Sbjct: 129 gataaggatggcgatggttgtattaccaccaaggagct 166



to top

>gb|AF494219.1| Medicago truncatula calmodulin 1 mRNA, complete cds
          Length = 940

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||| ||||| |||||| | ||||||||||| || |||||| | |||
Sbjct: 103 atggcagatcaactcacagacgatcagatctctgagttcaaggaagctttcagcttattc 162

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| || |||||||||||||| |||||||||||
Sbjct: 163 gacaaggatggcgatggttgcatcacaaccaaggagct 200



to top

>emb|Y14764.1|LEY14764 Lycopersicon esculentum mRNA for calmodulin N6, partial
          Length = 354

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 67/74 (90%)
 Strand = Plus / Plus

                                                                       
Query: 154 cagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatc 213
           |||||||| |||||||||||||| |||||  | |||||||||||||||||||||||||||
Sbjct: 1   cagatcgctgagttcaaggaggctttcagtttgttcgacaaggacggagatggttgcatc 60

                         
Query: 214 accaccaaggagct 227
           || || ||||||||
Sbjct: 61  acgactaaggagct 74



to top

>emb|AL162691.1|ATT28A8 Arabidopsis thaliana DNA chromosome 3, BAC clone T28A8
          Length = 97371

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 70/78 (89%)
 Strand = Plus / Minus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             |||||||||||||| ||||| ||||||||| ||||||||||||| || || ||||| |||
Sbjct: 52745 atggcggatcagctaaccgatgaccagatctccgagttcaaggaagcttttagcctattc 52686

                               
Query: 190   gacaaggacggagatggt 207
             ||||| ||||||||||||
Sbjct: 52685 gacaaagacggagatggt 52668



to top

>emb|AJ843112.1| Quercus petraea mRNA for calmodulin (caM-2 gene)
          Length = 676

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 142 ctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacgga 201
           |||||||||||||||||| | |||||||||||||| |||||| | ||||||||||| || 
Sbjct: 33  ctcaccgacgaccagatctctgagttcaaggaggctttcagcttgttcgacaaggatggc 92

                                     
Query: 202 gatggttgcatcaccaccaaggagct 227
           || ||||||||||| || ||||||||
Sbjct: 93  gacggttgcatcactactaaggagct 118



to top

>emb|AJ843111.1| Quercus petraea mRNA for calmodulin (caM-1 gene)
          Length = 813

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                       
Query: 154 cagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatc 213
           |||||||| ||||||||||| |||||||||||||| ||||||||||| ||||| ||||||
Sbjct: 196 cagatcgctgagttcaaggaagccttcagcctctttgacaaggacggcgatggctgcatc 255

                             
Query: 214 accaccaaggagctggga 231
           || ||||| ||| |||||
Sbjct: 256 actaccaaagagttggga 273



to top

>gb|AF474074.1| Stevia rebaudiana calmodulin mRNA, complete cds
          Length = 450

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 127 ggcatggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctc 186
           ||||||||||||| |||||||||||| |||||| |||| || ||||| || |||||||| 
Sbjct: 1   ggcatggcggatccgctcaccgacgatcagatctccgaatttaaggaagctttcagccta 60

                                                 
Query: 187 ttcgacaaggacggagatggttgcatcaccaccaagga 224
           |||||||| || ||||||||||| ||||| || |||||
Sbjct: 61  ttcgacaaagatggagatggttgtatcacaactaagga 98



to top

>gb|AY072520.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 524

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| ||||| ||||| |||||| |||| |||||||| || || |||||||||
Sbjct: 1   atggcggatcaactcactgacgaacagatctccgaattcaaggaagcttttagcctcttc 60

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || |||||||||||||| || || |||||||||
Sbjct: 61  gacaaagatggcgatggttgcatcacaacaaaagagctggga 102



to top

>gb|AY072628.1| Arabidopsis thaliana AT5g37780/K22F20_20 mRNA, complete cds
          Length = 450

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| ||||| ||||| |||||| |||| |||||||| || || |||||||||
Sbjct: 1   atggcggatcaactcactgacgaacagatctccgaattcaaggaagcttttagcctcttc 60

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || |||||||||||||| || || |||||||||
Sbjct: 61  gacaaagatggcgatggttgcatcacaacaaaagagctggga 102



to top

>gb|AY059809.1| Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 761

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| ||||| ||||| |||||| |||| |||||||| || || |||||||||
Sbjct: 90  atggcggatcaactcactgacgaacagatctccgaattcaaggaagcttttagcctcttc 149

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || |||||||||||||| || || |||||||||
Sbjct: 150 gacaaagatggcgatggttgcatcacaacaaaagagctggga 191



to top

>gb|AY048276.1| Arabidopsis thaliana AT5g37780/K22F20_20 mRNA, complete cds
          Length = 640

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| ||||| ||||| |||||| |||| |||||||| || || |||||||||
Sbjct: 7   atggcggatcaactcactgacgaacagatctccgaattcaaggaagcttttagcctcttc 66

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || |||||||||||||| || || |||||||||
Sbjct: 67  gacaaagatggcgatggttgcatcacaacaaaagagctggga 108



to top

>emb|BX830458.1|CNS0A1LN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB83ZA05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 690

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||| ||||| ||||| |||||| |||| |||||||| || || |||||||||
Sbjct: 38  atggcggatcaactcactgacgaacagatctccgaattcaaggaagcttttagcctcttc 97

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           ||||| || || |||||||||||||| || || |||||||||
Sbjct: 98  gacaaagatggcgatggttgcatcacaacaaaagagctggga 139



to top

>gb|AC140977.1| Arabidopsis thaliana chromosome 5 BAC F13M11 genomic sequence, complete
             sequence
          Length = 112600

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 70/78 (89%)
 Strand = Plus / Plus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             |||||||||||||||||||| ||||||||| | ||||||||||| ||||| |||||||||
Sbjct: 58986 atggcggatcagctcaccgatgaccagatctcagagttcaaggaagcctttagcctcttc 59045

                               
Query: 190   gacaaggacggagatggt 207
             || ||||| || ||||||
Sbjct: 59046 gataaggatggtgatggt 59063



to top

>gb|BT002351.1| Arabidopsis thaliana clone C105327 putative calmodulin (At2g27030)
           mRNA, complete cds
          Length = 481

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 1   atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 60

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           ||||| ||||||||||||||||||||
Sbjct: 61  gacaaagacggagatggttgcatcac 86



to top

>dbj|AK176855.1| Arabidopsis thaliana mRNA for calmodulin, complete cds, clone:
           RAFL25-41-D23
          Length = 708

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 61  atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 120

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           ||||| ||||||||||||||||||||
Sbjct: 121 gacaaagacggagatggttgcatcac 146



to top

>dbj|AK175278.1| Arabidopsis thaliana mRNA for calmodulin, complete cds, clone:
           RAFL21-71-H09
          Length = 745

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 63  atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 122

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           ||||| ||||||||||||||||||||
Sbjct: 123 gacaaagacggagatggttgcatcac 148



to top

>gb|M80836.1|PETCAM81 Petunia hybrida CAM81 mRNA,
          Length = 815

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| ||||| ||||| || 
Sbjct: 13  atggcggatcagcttacagatgatcagatctctgagtttaaggaagcctttagccttttt 72

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||| |||||||||||||||||||| ||||||||
Sbjct: 73  gacaaggatggagatggttgcatcaccactaaggagct 110



to top

>gb|M38380.1|ATHCAM2 A.thaliana calmodulin-2 (cam2) mRNA, complete cds
          Length = 1400

 Score = 91.7 bits (46), Expect = 9e-16
 Identities = 76/86 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 718 atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 777

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           ||||| ||||||||||||||||||||
Sbjct: 778 gacaaagacggagatggttgcatcac 803



to top

>emb|Y14765.1|LEY14765 Lycopersicon esculentum mRNA for calmodulin TOMCALM2LE, partial
          Length = 334

 Score = 89.7 bits (45), Expect = 4e-15
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                       
Query: 163 gagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatcaccaccaag 222
           |||||||||||||| |||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 34  gagttcaaggaggctttcagcctattcgacaaggacggagatggttgcattacaactaag 93

                
Query: 223 gagct 227
           |||||
Sbjct: 94  gagct 98



to top

>ref|XM_598515.2| PREDICTED: Bos taurus similar to calmodulin 1 (LOC520277), mRNA
          Length = 2075

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 cagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggac 198
           ||||| ||||| || |||||||| ||||||||||||||||||  |||||||||||| |||
Sbjct: 25  cagctgaccgaggagcagatcgcagagttcaaggaggccttctccctcttcgacaaagac 84

                                           
Query: 199 ggagatggttgcatcaccaccaaggagctggg 230
           || || ||   |||||||||||||||||||||
Sbjct: 85  ggggacggcaccatcaccaccaaggagctggg 116



to top

>gb|BT013612.1| Lycopersicon esculentum clone 132384F, mRNA sequence
          Length = 826

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||||||||| || |||||| | ||||||||||| || ||||| || || 
Sbjct: 74  atggcggatcagctcaccgaagatcagatctctgagttcaaggaagctttcagtcttttt 133

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||| |||||||||||||| ||||| || |||||
Sbjct: 134 gacaaagacggagatggttgtatcacaactaagga 168



to top

>emb|AJ427337.1|BOL427337 Brassica oleracea mRNA for calmodulin 1 (cam1 gene)
          Length = 681

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 58/63 (92%)
 Strand = Plus / Plus

                                                                       
Query: 165 gttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||| ||||| ||||||||||||||||| || || ||||||||||||||||||||
Sbjct: 1   gttcaaggaagcctttagcctcttcgacaaggatggtgacggttgcatcaccaccaagga 60

              
Query: 225 gct 227
           |||
Sbjct: 61  gct 63



to top

>gb|AF468661.1| Stevia rebaudiana calmodulin mRNA, complete cds
          Length = 447

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||| |||||||||||| |||||| |||| || ||||| || |||||||| |||
Sbjct: 1   atggcggatccgctcaccgacgatcagatctccgaatttaaggaagctttcagcctattc 60

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||| || ||||||||||| ||||| || |||||
Sbjct: 61  gacaaagatggagatggttgtatcacaactaagga 95



to top

>emb|BX821238.1|CNS0A8AH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL28ZD11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 572

 Score = 85.7 bits (43), Expect = 6e-14
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 7   atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 66

                                  
Query: 190 gacaaggacggagatggttgcat 212
           ||||| |||||||||||||||||
Sbjct: 67  gacaaagacggagatggttgcat 89



to top

>gb|AF030032.1| Phaseolus vulgaris calmodulin (CaM) mRNA, PvCaM-1 allele, complete
           cds
          Length = 859

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||||||||| |||||| ||||||| ||||||||||| ||| | |||
Sbjct: 95  atggctgatcaactcaccgacgagcagatctccgagtttaaggaggcctttagcttgttc 154

                                     
Query: 190 gacaaggacggagatggttgcatcac 215
           || |||||||| |||||||| |||||
Sbjct: 155 gataaggacggcgatggttgtatcac 180



to top

>gb|U13882.1|PSU13882 Pisum sativum Alaska calmodulin mRNA, complete cds
          Length = 692

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||| ||||| |||||| | ||||| ||||| || |||||||| |||
Sbjct: 70  atggcagatcaactcacagacgatcagatctctgagtttaaggaagctttcagcctattc 129

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||||||||| |||||||||||
Sbjct: 130 gataaggatggcgatggttgcatcacaaccaaggagct 167



to top

>dbj|AB050847.1| Nicotiana tabacum mRNA for calmodulin NtCaM11, complete cds
          Length = 810

 Score = 83.8 bits (42), Expect = 2e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||||||||| || || |||||| | || ||||| || || |||||||| |||
Sbjct: 59  atggcagatcagctcacagatgatcagatctctgaattcaaagaagctttcagccttttc 118

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| |||||||||||||||||||| ||||||||
Sbjct: 119 gataaggatggagatggttgcatcaccactaaggagct 156



to top

>gb|DQ186609.1| Catharanthus roseus calmodulin 1 mRNA, complete cds
          Length = 734

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 154 cagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatc 213
           |||||||| ||||||||||| || || ||||||||||||||||| |||| ||| ||||||
Sbjct: 128 cagatcgcggagttcaaggaagcttttagcctcttcgacaaggatggaggtggctgcatc 187

                            
Query: 214 accaccaaggagctggg 230
           || || |||||||||||
Sbjct: 188 actacaaaggagctggg 204



to top

>gb|AY269783.1| Branchiostoma belcheri tsingtaunese calmodulin mRNA, complete cds
          Length = 1412

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || || |||||||| || ||||||||||||||||||||||||
Sbjct: 65  atggcagatcagctgacagaggaacagatcgctgaattcaaggaggccttcagcctcttc 124

                            
Query: 190 gacaaggacggagatgg 206
           |||||||| || |||||
Sbjct: 125 gacaaggatggggatgg 141



to top

>emb|Y09863.1|BFRNAC B.floridae mRNA for calmodulin
          Length = 1405

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || || |||||||| || ||||||||||||||||||||||||
Sbjct: 90  atggcagatcagctgacagaggaacagatcgctgaattcaaggaggccttcagcctcttc 149

                            
Query: 190 gacaaggacggagatgg 206
           |||||||| || |||||
Sbjct: 150 gacaaggatggtgatgg 166



to top

>gb|DQ122882.1| Chlamydomonas incerta calmodulin mRNA, complete cds
          Length = 995

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 154 cagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatc 213
           |||||||||||||||||||||||||||  ||||||||| |||||||| |||||    || 
Sbjct: 85  cagatcgccgagttcaaggaggccttcgccctcttcgataaggacggcgatggcacgatt 144

                            
Query: 214 accaccaaggagctggg 230
           |||||||||||||||||
Sbjct: 145 accaccaaggagctggg 161



to top

>dbj|AB003082.1| Branchiostoma floridae mRNA for calmodulin, complete cds
          Length = 1375

 Score = 81.8 bits (41), Expect = 9e-13
 Identities = 68/77 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || || |||||||| || ||||||||||||||||||||||||
Sbjct: 74  atggcagatcagctgacagaggaacagatcgctgaattcaaggaggccttcagcctcttc 133

                            
Query: 190 gacaaggacggagatgg 206
           |||||||| || |||||
Sbjct: 134 gacaaggatggtgatgg 150



to top

>dbj|AP003260.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0468B07
          Length = 169071

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                         
Query: 129   catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
             ||||||||| |||||| |||| || ||||| |  ||||||| ||||||||||||||||||
Sbjct: 96696 catggcggaccagctctccgaagagcagattggagagttcagggaggccttcagcctctt 96755

                         
Query: 189   cgacaaggacgg 200
             ||||||||||||
Sbjct: 96756 cgacaaggacgg 96767



to top

>gb|M73712.1|ATHCAM3COL Arabidopsis thaliana calmodulin-3 mRNA, 3' end
          Length = 738

 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 73/84 (86%)
 Strand = Plus / Plus

                                                                       
Query: 147 cgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatgg 206
           |||||| |||||| | ||||| ||||| || |||||| | ||||||||||| || |||||
Sbjct: 1   cgacgatcagatctctgagtttaaggaagctttcagcttattcgacaaggatggtgatgg 60

                                   
Query: 207 ttgcatcaccaccaaggagctggg 230
           |||||| |||||||||||||||||
Sbjct: 61  ttgcattaccaccaaggagctggg 84



to top

>ref|NM_179765.1| Arabidopsis thaliana CAM2 (CALMODULIN-2); calcium ion binding
           AT2G27030 (CAM2) transcript variant AT2G27030.2 mRNA,
           complete cds
          Length = 2266

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 63  atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 122

                              
Query: 190 gacaaggacggagatggtt 208
           ||||| |||||||||||||
Sbjct: 123 gacaaagacggagatggtt 141



to top

>gb|AY543014.1| Daucus carota calmodulin cam-11 mRNA, complete cds
          Length = 450

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || ||||||||| | ||||||||||| || |||||||| || 
Sbjct: 1   atggcagatcagctaacagatgaccagatctctgagttcaaggaagctttcagcctgttt 60

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           ||||||||||| ||||| ||||| || ||||||||
Sbjct: 61  gacaaggacggcgatggctgcattactaccaagga 95



to top

>gb|AY090987.1| Arabidopsis thaliana At2g27030 mRNA sequence
          Length = 2287

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 67  atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 126

                              
Query: 190 gacaaggacggagatggtt 208
           ||||| |||||||||||||
Sbjct: 127 gacaaagacggagatggtt 145



to top

>gb|AC005623.3| Arabidopsis thaliana chromosome 2 clone T20P8 map B68, complete
             sequence
          Length = 99345

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 69/79 (87%)
 Strand = Plus / Plus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             ||||| |||||||||||||| || |||||| | ||||||||||| || || ||||| |||
Sbjct: 31544 atggcagatcagctcaccgatgatcagatctctgagttcaaggaagcttttagccttttc 31603

                                
Query: 190   gacaaggacggagatggtt 208
             ||||| |||||||||||||
Sbjct: 31604 gacaaagacggagatggtt 31622



to top

>dbj|AK062496.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A02, full
           insert sequence
          Length = 740

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           ||||||||| |||||||| || || ||||| || |||||||||||||| |||   |||||
Sbjct: 40  catggcggaccagctcacggaagaacagattgcggagttcaaggaggcgttctcgctctt 99

                                                  
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagct 227
           |||||||||||| |||||   |||||| |||||||||||
Sbjct: 100 cgacaaggacggcgatggcaccatcacgaccaaggagct 138



to top

>gb|AF064456.1|AF064456 Oryza sativa subsp. indica calmodulin-like protein gene, complete
           cds
          Length = 2408

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| |||||| |||| || ||||| |  ||||||| |||||||||||||||||||
Sbjct: 1   atggcggaccagctctccgaagagcagattgtagagttcagggaggccttcagcctcttc 60

                      
Query: 190 gacaaggacgg 200
           |||||||||||
Sbjct: 61  gacaaggacgg 71



to top

>gb|AF064552.1|AF064552 Apium graveolens calmodulin mRNA, complete cds
          Length = 957

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 145 accgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagat 204
           |||||||| || ||| ||||||||||||| || |||||||| || || || ||||| |||
Sbjct: 122 accgacgatcaaatctccgagttcaaggaagctttcagcctgtttgataaagacggcgat 181

                                  
Query: 205 ggttgcatcaccaccaaggagct 227
           ||||||||||| |||||||||||
Sbjct: 182 ggttgcatcactaccaaggagct 204



to top

>gb|AY297816.2| Euphorbia characias calmodulin mRNA, complete cds
          Length = 792

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||| ||||| |||||| | ||||| ||||| || ||||||||||||
Sbjct: 71  atggcagatcaactcacagacgatcagatctctgagtttaaggaagctttcagcctcttc 130

                                              
Query: 190 gacaaggacggagatggttgcatcaccaccaagga 224
           |||||||| || |||||||| ||||| || |||||
Sbjct: 131 gacaaggatggcgatggttgtatcactactaagga 165



to top

>dbj|AB050838.1| Nicotiana tabacum mRNA for calmodulin NtCaM2, complete cds
          Length = 743

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 154 cagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatc 213
           |||||||| ||||||||||||||||| ||||| |||||||||||||| ||||| || || 
Sbjct: 65  cagatcgctgagttcaaggaggcctttagccttttcgacaaggacggtgatggctgtatt 124

                      
Query: 214 accaccaagga 224
           || ||||||||
Sbjct: 125 actaccaagga 135



to top

>dbj|AB050837.1| Nicotiana tabacum mRNA for calmodulin NtCaM1, complete cds
          Length = 876

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                       
Query: 154 cagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagatggttgcatc 213
           |||||||| ||||||||||||||||| ||||| |||||||||||||| ||||| || || 
Sbjct: 57  cagatcgctgagttcaaggaggcctttagccttttcgacaaggacggcgatggctgtatt 116

                      
Query: 214 accaccaagga 224
           || ||||||||
Sbjct: 117 actaccaagga 127



to top

>dbj|AB044286.1| Chara corallina ccam mRNA for calmodulin, complete cds
          Length = 1862

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 145 accgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagat 204
           |||||||| |||||| |||||||||||||||| ||||| || || |||||||| || |||
Sbjct: 137 accgacgagcagatctccgagttcaaggaggctttcagtctttttgacaaggatggcgat 196

                                  
Query: 205 ggttgcatcaccaccaaggagct 227
           ||  |||||||||| ||||||||
Sbjct: 197 gggagcatcaccacgaaggagct 219



to top

>dbj|AB041712.1| Chara corallina cccam2 mRNA for calmodulin, complete cds
          Length = 1505

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 145 accgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagat 204
           |||||||| |||||| |||||||||||||||| ||||| || || |||||||| || |||
Sbjct: 132 accgacgagcagatctccgagttcaaggaggctttcagtctttttgacaaggatggcgat 191

                                  
Query: 205 ggttgcatcaccaccaaggagct 227
           ||  |||||||||| ||||||||
Sbjct: 192 gggagcatcaccacgaaggagct 214



to top

>dbj|AB041711.1| Chara corallina cccam1 mRNA for calmodulin, complete cds
          Length = 1430

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 72/83 (86%)
 Strand = Plus / Plus

                                                                       
Query: 145 accgacgaccagatcgccgagttcaaggaggccttcagcctcttcgacaaggacggagat 204
           |||||||| |||||| |||||||||||||||| ||||| || || |||||||| || |||
Sbjct: 95  accgacgagcagatctccgagttcaaggaggctttcagtctttttgacaaggatggcgat 154

                                  
Query: 205 ggttgcatcaccaccaaggagct 227
           ||  |||||||||| ||||||||
Sbjct: 155 gggagcatcaccacgaaggagct 177



to top

>ref|NM_012518.2| Rattus norvegicus calmodulin 3 (Calm3), mRNA
          Length = 1145

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| ||||| || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 105 catggctgaccagctgaccgaagaacagattgcagagttcaaggaagccttctccctctt 164

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 165 tgacaaggatggagatggcaccattaccaccaaggagctggg 206



to top

>gb|AC136471.1| Solanum demissum chromosome 11 BAC PGEC561 genomic sequence, complete
             sequence
          Length = 123428

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             ||||||||||||||||| ||||| |||||| | |||||||| || || || ||||| |||
Sbjct: 54366 atggcggatcagctcactgacgatcagatctcggagttcaaagaagcttttagcctattc 54307

                               
Query: 190   gacaaggacggagatggt 207
             |||||||| |||||||||
Sbjct: 54306 gacaaggatggagatggt 54289



to top

>ref|XM_860423.1| PREDICTED: Canis familiaris similar to calmodulin 1, transcript
           variant 3 (LOC476428), mRNA
          Length = 2328

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||||||||||  ||||||
Sbjct: 140 catggctgaccagctgactgaggagcagattgcagagttcaaggaggccttctccctctt 199

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||||||||||||    ||||||||||||||| ||||
Sbjct: 200 tgacaaggacggagatggcactatcaccaccaaggagttggg 241



to top

>ref|XM_860405.1| PREDICTED: Canis familiaris similar to calmodulin 1, transcript
           variant 2 (LOC476428), mRNA
          Length = 2274

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||||||||||  ||||||
Sbjct: 140 catggctgaccagctgactgaggagcagattgcagagttcaaggaggccttctccctctt 199

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||||||||||||    ||||||||||||||| ||||
Sbjct: 200 tgacaaggacggagatggcactatcaccaccaaggagttggg 241



to top

>ref|XM_533635.2| PREDICTED: Canis familiaris similar to calmodulin 1, transcript
           variant 1 (LOC476428), mRNA
          Length = 2332

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||||||||||  ||||||
Sbjct: 216 catggctgaccagctgactgaggagcagattgcagagttcaaggaggccttctccctctt 275

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||||||||||||    ||||||||||||||| ||||
Sbjct: 276 tgacaaggacggagatggcactatcaccaccaaggagttggg 317



to top

>emb|X97558.1|CACAM1 C.annuum mRNA for calmodulin-1
          Length = 680

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || || |||||| | |||||||| || || || |||||||||
Sbjct: 14  atggcagatcagctaactgatgatcagatctctgagttcaaagaagcttttagcctcttc 73

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| ||||||||||||||||| || ||||||||
Sbjct: 74  gataaggatggagatggttgcatcacaactaaggagct 111



to top

>emb|X67273.1|ATCAL A.thaliana gene for calmodulin
          Length = 1651

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||| ||||| |||||| | || |||||||| ||||||||| | |||
Sbjct: 199 atggcggatcagctcacagacgatcagatctcagaattcaaggaagccttcagcttattc 258

                             
Query: 190 gacaaggacggagatggt 207
           |||||||| || ||||||
Sbjct: 259 gacaaggatggtgatggt 276



to top

>emb|X52398.1|MSCAL1 Alfalfa cal1 mRNA for calmodulin
          Length = 807

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| ||||||||||| |||||| | ||||| ||||| || |||||||| |||
Sbjct: 48  atggccgatcaactcaccgacgagcagatctctgagtttaaggaagctttcagcctattc 107

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||| || || |||||||||||
Sbjct: 108 gataaggatggcgatggttgtattactaccaaggagct 145



to top

>emb|CR859453.1| Pongo pygmaeus mRNA; cDNA DKFZp469E1312 (from clone DKFZp469E1312)
          Length = 806

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || |||||||| ||||||||||||||||||  ||||||
Sbjct: 118 catggctgaccagctgactgaggagcagatcgcagagttcaaggaggccttctccctctt 177

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||| ||||||||    ||||||||||||||| ||||
Sbjct: 178 tgacaaggatggagatggcactatcaccaccaaggagttggg 219



to top

>emb|AL390921.1|ATT8M16 Arabidopsis thaliana DNA chromosome 3, BAC clone T8M16
          Length = 107271

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 51843 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 51784

                               
Query: 190   gacaaggacggagatggt 207
             |||||||| || ||||||
Sbjct: 51783 gacaaggatggtgatggt 51766



 Score = 44.1 bits (22), Expect = 0.19
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 205   ggttgcatcaccaccaaggagctggg 230
             |||||||| |||||||||||||||||
Sbjct: 51278 ggttgcattaccaccaaggagctggg 51253



to top

>gb|BC063187.1| Rattus norvegicus calmodulin 3, mRNA (cDNA clone MGC:73021
           IMAGE:6890866), complete cds
          Length = 1145

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| ||||| || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 105 catggctgaccagctgaccgaagaacagattgcagagttcaaggaagccttctccctctt 164

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 165 tgacaaggatggagatggcaccattaccaccaaggagctggg 206



to top

>gb|AC004261.3| Arabidopsis thaliana chromosome 2 clone T3K9 map CIC11C08, complete
             sequence
          Length = 91539

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 68/78 (87%)
 Strand = Plus / Minus

                                                                         
Query: 130   atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
             ||||||||||||||||| ||||| |||||| | || |||||||| ||||||||| | |||
Sbjct: 45329 atggcggatcagctcacagacgatcagatctcagaattcaaggaagccttcagcttattc 45270

                               
Query: 190   gacaaggacggagatggt 207
             |||||||| || ||||||
Sbjct: 45269 gacaaggatggtgatggt 45252



to top

>dbj|AK152754.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830083N02 product:calmodulin 3,
           full insert sequence
          Length = 727

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 138 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 197

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 198 cgacaaggatggagatggcaccattaccaccaaggagctggg 239



to top

>dbj|AK151610.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830032D08 product:calmodulin 2,
           full insert sequence
          Length = 2172

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 153 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 212

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 213 cgacaaggatggagatggcaccattaccaccaaggagctggg 254



to top

>dbj|AK165568.1| Mus musculus nullipotent stem cell CRL-2070 NE cDNA, RIKEN
           full-length enriched library, clone:G430009L06
           product:calmodulin 2, full insert sequence
          Length = 2142

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| ||||| || ||||| || ||||||||||| ||||||   |||||
Sbjct: 126 catggctgaccagctgaccgaggaacagattgcagagttcaaggaagccttctctctctt 185

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 186 cgacaaggatggagatggcaccattaccaccaaggagctggg 227



to top

>dbj|AK153179.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830126L24 product:calmodulin 2,
           full insert sequence
          Length = 715

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 126 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 185

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 186 cgacaaggatggagatggcaccattaccaccaaggagctggg 227



to top

>dbj|AK169630.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430002O22
           product:calmodulin 2, full insert sequence
          Length = 2146

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 104 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 163

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 164 cgacaaggatggagatggcaccattaccaccaaggagctggg 205



to top

>dbj|AB169886.1| Macaca fascicularis brain cDNA, clone: QnpA-15172, similar to human
           calmodulin 3 (phosphorylase kinase, delta) (CALM3),
           mRNA, RefSeq: NM_005184.1
          Length = 2213

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || |||||||| ||||||||||||||||||  ||||||
Sbjct: 116 catggctgaccagctgactgaggagcagatcgcagagttcaaggaggccttctccctctt 175

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||| ||||||||    ||||||||||||||| ||||
Sbjct: 176 tgacaaggatggagatggcactatcaccaccaaggagttggg 217



to top

>ref|NM_007590.2| Mus musculus calmodulin 3 (Calm3), mRNA
          Length = 2155

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 111 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 170

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 171 cgacaaggatggagatggcaccattaccaccaaggagctggg 212



to top

>emb|BX814324.1|CNS0ADP9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB68ZC06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 748

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||||||||| || || || |||||| | ||||| ||||| || || |||||||||
Sbjct: 84  atggcggatcagctaactgatgaacagatctctgagtttaaggaagcttttagcctcttc 143

                                                     
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggga 231
           |||||  | ||||| |||||||||||||| ||||||| ||||
Sbjct: 144 gacaaaaatggagagggttgcatcaccacaaaggagcgggga 185



to top

>gb|BC050926.1| Mus musculus calmodulin 3, mRNA (cDNA clone MGC:61409
           IMAGE:6411878), complete cds
          Length = 2155

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 111 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 170

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 171 cgacaaggatggagatggcaccattaccaccaaggagctggg 212



to top

>emb|X13817.1|RSPRCM4 R.norvegicus mRNA for calmodulin
          Length = 691

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| ||||| || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 102 catggctgaccagctgaccgaagaacagattgcagagttcaaggaagccttctccctctt 161

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 162 tgacaaggatggagatggcaccattaccaccaaggagctggg 203



to top

>gb|M19380.1|MUSCALMDA Mouse calmodulin (Cam III) mRNA, complete cds
          Length = 722

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| || || || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 109 catggctgaccagctgactgaggaacagattgcagagttcaaggaagccttctccctctt 168

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 169 cgacaaggatggagatggcaccattaccaccaaggagctggg 210



to top

>gb|M16659.1|RATCAMB Rat calmodulin mRNA, complete cds, clone prCM79
          Length = 599

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 129 catggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctctt 188
           |||||| || ||||| ||||| || ||||| || ||||||||||| ||||||  ||||||
Sbjct: 10  catggctgaccagctgaccgaagaacagattgcagagttcaaggaagccttctccctctt 69

                                                     
Query: 189 cgacaaggacggagatggttgcatcaccaccaaggagctggg 230
            |||||||| ||||||||   ||| |||||||||||||||||
Sbjct: 70  tgacaaggatggagatggcaccattaccaccaaggagctggg 111



to top

>gb|L01430.1|SOYSCAM1X Soybean calmodulin (SCaM-1) mRNA, complete cds
          Length = 795

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||| |||||||| || |||||| | ||||||||||| ||||||||  | |||
Sbjct: 79  atggcagatcaactcaccgatgaacagatctcggagttcaaggaagccttcagtttgttc 138

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| || |||||||||||||| || ||||||||
Sbjct: 139 gataaggatggcgatggttgcatcacaacaaaggagct 176



to top

>gb|M73711.1|ATHCAM3 Arabidopsis thaliana cam-3 gene, complete cds
          Length = 2308

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||||||||||||||||||||| |||||| | ||||| ||||| || |||||| | |||
Sbjct: 791 atggcggatcagctcaccgacgatcagatctctgagtttaaggaagctttcagcttattc 850

                             
Query: 190 gacaaggacggagatggt 207
           |||||||| || ||||||
Sbjct: 851 gacaaggatggtgatggt 868



 Score = 44.1 bits (22), Expect = 0.19
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 205  ggttgcatcaccaccaaggagctggg 230
            |||||||| |||||||||||||||||
Sbjct: 1358 ggttgcattaccaccaaggagctggg 1383



to top

>gb|M83535.1|PHTCALPIA P.infestans calmodulin (calA) gene, complete cds
          Length = 1358

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| || ||||| ||||| || ||||| ||||||||||||||||| |||  ||| |||
Sbjct: 721 atggctgaccagctgaccgaagagcagattgccgagttcaaggaggcgttctccctgttc 780

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           ||||||||||| |||||   ||| ||||||||||||||
Sbjct: 781 gacaaggacggcgatggaaccattaccaccaaggagct 818



to top

>dbj|D45848.1|ATHCRP Arabidopsis thaliana genes for calmodulin and calmodulin-related
            protein, complete cds
          Length = 4036

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 68/78 (87%)
 Strand = Plus / Plus

                                                                        
Query: 130  atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
            ||||||||||||||||| ||||| |||||| | || |||||||| ||||||||| | |||
Sbjct: 2584 atggcggatcagctcacagacgatcagatctcagaattcaaggaagccttcagcttattc 2643

                              
Query: 190  gacaaggacggagatggt 207
            |||||||| || ||||||
Sbjct: 2644 gacaaggatggtgatggt 2661



to top

>dbj|AB050848.1| Nicotiana tabacum mRNA for calmodulin NtCaM12, complete cds
          Length = 817

 Score = 75.8 bits (38), Expect = 5e-11
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| ||||||||||| || || |||||| | || ||||| || || |||||||| || 
Sbjct: 84  atggcagatcagctcacagatgatcagatctctgaattcaaagaagctttcagccttttt 143

                                                 
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagct 227
           || ||||| |||||||||||||||||||| ||||||||
Sbjct: 144 gataaggatggagatggttgcatcaccactaaggagct 181



to top

>ref|NM_182967.1| Danio rerio calmodulin 3a (phosphorylase kinase, delta) (calm3a),
           mRNA
          Length = 2180

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| ||||| || ||||| || |||||||||||||| |||   || |||
Sbjct: 113 atggcagatcagctgaccgaggaacagattgctgagttcaaggaggcgttctcactgttc 172

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||| ||||| |||||   |||||||||||||||||||||
Sbjct: 173 gacaaagacggcgatggcaccatcaccaccaaggagctggg 213



to top

>gb|DQ226765.1| Boechera divaricarpa isolate SLW-D-B04 mRNA sequence
          Length = 736

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           |||||||| || |||||  |||| |||||| | || |||||||| || || |||||||||
Sbjct: 61  atggcggaacaactcactaacgaacagatctctgaattcaaggaagcttttagcctcttc 120

                                                    
Query: 190 gacaaggacggagatggttgcatcaccaccaaggagctggg 230
           ||||| || || |||||||||||||| ||||| ||||||||
Sbjct: 121 gacaaagatggcgatggttgcatcacaaccaaagagctggg 161



to top

>emb|Y09880.1|BLRNAC B.lanceolatum mRNA for calmodulin
          Length = 450

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 130 atggcggatcagctcaccgacgaccagatcgccgagttcaaggaggccttcagcctcttc 189
           ||||| |||||||| || || || |||||||| || ||||||||||| |||||||| || 
Sbjct: 1   atggcagatcagctgacagaggaacagatcgctgaattcaaggaggcgttcagccttttt 60

                            
Query: 190 gacaaggacggagatgg 206
           |||||||||||||||||
Sbjct: 61  gacaaggacggagatgg 77


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,122,525
Number of Sequences: 3902068
Number of extensions: 1122525
Number of successful extensions: 27974
Number of sequences better than 10.0: 811
Number of HSP's better than 10.0 without gapping: 760
Number of HSP's successfully gapped in prelim test: 52
Number of HSP's that attempted gapping in prelim test: 26553
Number of HSP's gapped (non-prelim): 1435
length of query: 231
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 209
effective length of database: 17,147,199,772
effective search space: 3583764752348
effective search space used: 3583764752348
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top