ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | baet78d11 |
|---|---|
| Clone Library Name | barley_pub |
>emb|BX537134.5| Zebrafish DNA sequence from clone CH211-205J6, complete sequence Length = 192029 Score = 52.0 bits (26), Expect = 6e-04 Identities = 29/30 (96%) Strand = Plus / Plus Query: 83 tcgatcgatccatccgtccgtccgtccgtc 112 |||||| ||||||||||||||||||||||| Sbjct: 100238 tcgatccatccatccgtccgtccgtccgtc 100267 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 100637 atccatccgtccgtccgtccgtc 100659 Score = 46.1 bits (23), Expect = 0.038 Identities = 26/27 (96%) Strand = Plus / Plus Query: 86 atcgatccatccgtccgtccgtccgtc 112 |||||||||||| |||||||||||||| Sbjct: 100237 atcgatccatccatccgtccgtccgtc 100263 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 100025 atccatccgtccgtccgtccgtc 100047 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||| ||||||||||||| Sbjct: 100669 atccatccgcccgtccgtccgtc 100691 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 100641 atccgtccgtccgtccgtccgtc 100663 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 100633 atccatccatccgtccgtccgtc 100655 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 100021 atccatccatccgtccgtccgtc 100043
>gb|AF112964.1|AF112964 Triticum aestivum small GTP-binding protein (Sgp) mRNA, complete cds Length = 1136 Score = 52.0 bits (26), Expect = 6e-04 Identities = 35/38 (92%) Strand = Plus / Plus Query: 39 cacacacgcgagtcgccgagaagaaagccccaaacttt 76 ||||||| ||||||||| ||||||||||||||| |||| Sbjct: 55 cacacacccgagtcgccaagaagaaagccccaaccttt 92 Score = 46.1 bits (23), Expect = 0.038 Identities = 29/31 (93%) Strand = Plus / Plus Query: 154 agcgatcgatcggatcccgccggccggaggt 184 ||||||||||||||||||||| | ||||||| Sbjct: 199 agcgatcgatcggatcccgcccgtcggaggt 229
>gb|AC104702.2| Drosophila melanogaster 3L BAC RP98-11B4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 153146 Score = 50.1 bits (25), Expect = 0.002 Identities = 25/25 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtcgc 114 ||||||||||||||||||||||||| Sbjct: 110213 atccatccgtccgtccgtccgtcgc 110189
>gb|AC010557.4| Drosophila melanogaster 3L BAC RP98-9E21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 169425 Score = 50.1 bits (25), Expect = 0.002 Identities = 25/25 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtcgc 114 ||||||||||||||||||||||||| Sbjct: 31664 atccatccgtccgtccgtccgtcgc 31640
>ref|NM_139854.1| Drosophila melanogaster CG8583-RA (CG8583), mRNA Length = 2942 Score = 50.1 bits (25), Expect = 0.002 Identities = 25/25 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtcgc 114 ||||||||||||||||||||||||| Sbjct: 2654 atccatccgtccgtccgtccgtcgc 2630
>gb|AE003559.3| Drosophila melanogaster chromosome 3L, section 26 of 83 of the complete sequence Length = 269948 Score = 50.1 bits (25), Expect = 0.002 Identities = 25/25 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtcgc 114 ||||||||||||||||||||||||| Sbjct: 154765 atccatccgtccgtccgtccgtcgc 154741
>gb|BT001562.1| Drosophila melanogaster RE14391 full insert cDNA Length = 2957 Score = 50.1 bits (25), Expect = 0.002 Identities = 25/25 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtcgc 114 ||||||||||||||||||||||||| Sbjct: 2654 atccatccgtccgtccgtccgtcgc 2630
>emb|CR405682.23| Zebrafish DNA sequence from clone DKEYP-67E6 in linkage group 12, complete sequence Length = 192457 Score = 48.1 bits (24), Expect = 0.010 Identities = 27/28 (96%) Strand = Plus / Minus Query: 85 gatcgatccatccgtccgtccgtccgtc 112 |||| ||||||||||||||||||||||| Sbjct: 123666 gatccatccatccgtccgtccgtccgtc 123639 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 123657 atccgtccgtccgtccgtccgtc 123635
>emb|AL929467.6| Zebrafish DNA sequence from clone CH211-148E17, complete sequence Length = 156801 Score = 48.1 bits (24), Expect = 0.010 Identities = 27/28 (96%) Strand = Plus / Plus Query: 85 gatcgatccatccgtccgtccgtccgtc 112 |||| ||||||||||||||||||||||| Sbjct: 15341 gatccatccatccgtccgtccgtccgtc 15368 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 15350 atccgtccgtccgtccgtccgtc 15372
>gb|AC136372.13| Mus musculus chromosome 15, clone RP23-232G24, complete sequence Length = 201204 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 150507 atccatccgtccgtccgtccgtc 150529 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 150511 atccgtccgtccgtccgtccgtc 150533 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 150503 atccatccatccgtccgtccgtc 150525
>ref|NM_012722.1| Rattus norvegicus elastin (Eln), mRNA Length = 3615 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 3306 atccatccgtccgtccgtccgtc 3328 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 3302 atccatccatccgtccgtccgtc 3324
>gb|BC085910.1| Rattus norvegicus elastin, mRNA (cDNA clone MGC:94768 IMAGE:7097661), complete cds Length = 3615 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 3306 atccatccgtccgtccgtccgtc 3328 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 3302 atccatccatccgtccgtccgtc 3324
>gb|AC123952.5| Mus musculus BAC clone RP23-195B3 from chromosome 5, complete sequence Length = 191582 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 30448 atccatccgtccgtccgtccgtc 30426 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 30452 atccatccatccgtccgtccgtc 30430 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 30444 atccgtccgtccgtccgtccgtc 30422
>gb|AC164419.3| Mus musculus chromosome 5, clone RP23-309G12, complete sequence Length = 159565 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 114917 atccatccgtccgtccgtccgtc 114895 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 114877 atccatccgtccgtccgtccgtc 114855 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 114921 atccatccatccgtccgtccgtc 114899 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 114913 atccgtccgtccgtccgtccgtc 114891 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 114881 atccatccatccgtccgtccgtc 114859 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 114873 atccgtccgtccgtccgtccgtc 114851
>gb|AC131980.9| Mus musculus chromosome 1, clone RP24-170O7, complete sequence Length = 200100 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 53669 atccatccgtccgtccgtccgtc 53647 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 53665 atccgtccgtccgtccgtccgtc 53643
>gb|AC103550.13| Oryza sativa chromosome 3 BAC OSJNBa0079G12 genomic sequence, complete sequence Length = 163712 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 62371 atccatccgtccgtccgtccgtc 62393 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 62367 atccatccatccgtccgtccgtc 62389
>gb|AC102446.8| Mus musculus chromosome 5, clone RP24-201G17, complete sequence Length = 176748 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 169980 atccatccgtccgtccgtccgtc 169958 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 169940 atccatccgtccgtccgtccgtc 169918 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 169984 atccatccatccgtccgtccgtc 169962 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 169976 atccgtccgtccgtccgtccgtc 169954 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 169944 atccatccatccgtccgtccgtc 169922 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 169936 atccgtccgtccgtccgtccgtc 169914
>gb|AC144824.2| Danio rerio clone CH211-172M22, complete sequence Length = 127576 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 75050 atccatccgtccgtccgtccgtc 75072 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 62181 atccgtccgtccgtccgtccgtc 62203
>gb|AC159638.2| Mus musculus BAC clone RP24-78C16 from chromosome 12, complete sequence Length = 190196 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 135750 atccatccgtccgtccgtccgtc 135728 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 135754 atccatccatccgtccgtccgtc 135732 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 135746 atccgtccgtccgtccgtccgtc 135724
>gb|AC138737.10| Mus musculus chromosome 5, clone RP23-307F20, complete sequence Length = 216064 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 5458 atccatccgtccgtccgtccgtc 5480 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 5454 atccatccatccgtccgtccgtc 5476
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 29709006 atccatccgtccgtccgtccgtc 29708984 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 85 gatcgatccatccgtccgtccgt 107 ||||||||| ||||||||||||| Sbjct: 35967581 gatcgatccttccgtccgtccgt 35967603 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 29709010 atccatccatccgtccgtccgtc 29708988
>gb|AC158547.7| Mus musculus chromosome 3, clone RP23-477L20, complete sequence Length = 182793 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 101140 atccatccgtccgtccgtccgtc 101118
>gb|AC131679.2| Mus musculus BAC clone RP23-339I6 from chromosome 5, complete sequence Length = 198890 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 183514 atccatccgtccgtccgtccgtc 183492 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 183518 atccatccatccgtccgtccgtc 183496 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 183510 atccgtccgtccgtccgtccgtc 183488
>gb|AC122352.4| Mus musculus BAC clone RP23-389C11 from chromosome 16, complete sequence Length = 196519 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 92526 atccatccgtccgtccgtccgtc 92548 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 92530 atccgtccgtccgtccgtccgtc 92552 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 92522 atccatccatccgtccgtccgtc 92544
>gb|AC122499.4| Mus musculus BAC clone RP24-407O20 from chromosome 9, complete sequence Length = 186516 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 158310 atccatccgtccgtccgtccgtc 158288 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 158314 atccatccatccgtccgtccgtc 158292 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 158306 atccgtccgtccgtccgtccgtc 158284
>emb|CR925737.7| Zebrafish DNA sequence from clone DKEY-263O8 in linkage group 10, complete sequence Length = 176107 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 145471 atccatccgtccgtccgtccgtc 145493 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 145475 atccgtccgtccgtccgtccgtc 145497 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 145467 atccatccatccgtccgtccgtc 145489
>emb|CR450831.4| Zebrafish DNA sequence from clone CH211-79O8 in linkage group 11, complete sequence Length = 190163 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 156220 atccatccgtccgtccgtccgtc 156242
>gb|AC107711.13| Mus musculus chromosome 14, clone RP23-291I12, complete sequence Length = 228302 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 138934 atccatccgtccgtccgtccgtc 138956 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 138886 atccatccgtccgtccgtccgtc 138908 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 138938 atccgtccgtccgtccgtccgtc 138960 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 138882 atccatccatccgtccgtccgtc 138904
>emb|CR931792.9| Zebrafish DNA sequence from clone DKEY-180L1 in linkage group 13, complete sequence Length = 163673 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 56547 atccatccgtccgtccgtccgtc 56569 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 56551 atccgtccgtccgtccgtccgtc 56573 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 56543 atccatccatccgtccgtccgtc 56565
>emb|BX005314.35| Zebrafish DNA sequence from clone CH211-155D24 in linkage group 6, complete sequence Length = 164188 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 30962 atccatccgtccgtccgtccgtc 30984 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 30584 atccatccgtccgtccgtccgtc 30606 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 30958 atccatccatccgtccgtccgtc 30980 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 30580 atccatccatccgtccgtccgtc 30602
>emb|BX936329.9| Zebrafish DNA sequence from clone CH211-1F1 in linkage group 3, complete sequence Length = 76179 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 32660 atccatccgtccgtccgtccgtc 32638 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 32664 atccatccatccgtccgtccgtc 32642 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 32656 atccgtccgtccgtccgtccgtc 32634
>emb|BX897684.8| Zebrafish DNA sequence from clone CH211-107A4 in linkage group 7, complete sequence Length = 147920 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 88615 atccatccgtccgtccgtccgtc 88637 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 88619 atccgtccgtccgtccgtccgtc 88641 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 88611 atccatccatccgtccgtccgtc 88633
>emb|BX897749.7| Zebrafish DNA sequence from clone DKEY-26L20 in linkage group 7, complete sequence Length = 187411 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 116860 atccatccgtccgtccgtccgtc 116882 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 116864 atccgtccgtccgtccgtccgtc 116886 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 116856 atccatccatccgtccgtccgtc 116878
>gb|AC114821.4| Mus musculus BAC clone RP23-72K1 from chromosome 1, complete sequence Length = 197978 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 165652 atccatccgtccgtccgtccgtc 165630 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 165648 atccgtccgtccgtccgtccgtc 165626
>emb|BX539321.14| Zebrafish DNA sequence from clone CH211-223F3 in linkage group 9, complete sequence Length = 180633 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 15510 atccatccgtccgtccgtccgtc 15488 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 15514 atccatccatccgtccgtccgtc 15492 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 15506 atccgtccgtccgtccgtccgtc 15484
>gb|AC122913.4| Mus musculus BAC clone RP23-25J21 from 3, complete sequence Length = 205216 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 122694 atccatccgtccgtccgtccgtc 122672 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 122690 atccgtccgtccgtccgtccgtc 122668
>gb|AC125409.3| Mus musculus BAC clone RP23-127O4 from 12, complete sequence Length = 209670 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 99497 atccatccgtccgtccgtccgtc 99519 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 99425 atccatccgtccgtccgtcc 99444 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 99501 atccgtccgtccgtccgtccgtc 99523 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 99493 atccatccatccgtccgtccgtc 99515
>emb|BX649478.11| Zebrafish DNA sequence from clone DKEY-149F22 in linkage group 8, complete sequence Length = 79414 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 44764 atccatccgtccgtccgtccgtc 44786 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 44768 atccgtccgtccgtccgtccgtc 44790 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 44760 atccatccatccgtccgtccgtc 44782 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||||||| |||||| Sbjct: 44563 atccatccgtccgtccttccgtc 44585
>emb|CR847928.12| Zebrafish DNA sequence from clone DKEYP-67E7 in linkage group 1, complete sequence Length = 160252 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 55742 atccatccgtccgtccgtccgtc 55764 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 55746 atccgtccgtccgtccgtccgtc 55768 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 55738 atccatccatccgtccgtccgtc 55760
>emb|BX936420.9| Zebrafish DNA sequence from clone DKEY-7F16 in linkage group 3, complete sequence Length = 168285 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 38450 atccatccgtccgtccgtccgtc 38472 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 38454 atccgtccgtccgtccgtccgtc 38476 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 38446 atccatccatccgtccgtccgtc 38468
>emb|CR713025.2|CNS0GD4D Tetraodon nigroviridis full-length cDNA Length = 922 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 514 atccatccgtccgtccgtccgtc 492 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 518 atccatccatccgtccgtccgtc 496 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 510 atccgtccgtccgtccgtccgtc 488
>emb|CR708753.2|CNS0G9TP Tetraodon nigroviridis full-length cDNA Length = 738 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 518 atccatccgtccgtccgtccgtc 496 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 522 atccatccatccgtccgtccgtc 500 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 514 atccgtccgtccgtccgtccgtc 492
>emb|CR707722.2|CNS0G912 Tetraodon nigroviridis full-length cDNA Length = 929 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 514 atccatccgtccgtccgtccgtc 492 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 518 atccatccatccgtccgtccgtc 496 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 510 atccgtccgtccgtccgtccgtc 488
>gb|AC123883.10| Mus musculus chromosome 3, clone RP23-461P7, complete sequence Length = 199554 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 7544 atccatccgtccgtccgtccgtc 7566 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 7453 atccatccgtctgtccgtccgtc 7475
>emb|CR706288.2|CNS0G7X8 Tetraodon nigroviridis full-length cDNA Length = 908 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 500 atccatccgtccgtccgtccgtc 478 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 504 atccatccatccgtccgtccgtc 482 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 496 atccgtccgtccgtccgtccgtc 474
>gb|AC122734.6| Mus musculus chromosome 10, clone RP24-108E17, complete sequence Length = 178230 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 40312 atccatccgtccgtccgtccgtc 40290 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 40308 atccgtccgtccgtccgtccgtc 40286
>emb|CR383667.11| Zebrafish DNA sequence from clone CH211-229P19 in linkage group 10, complete sequence Length = 121560 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 74383 atccatccgtccgtccgtccgtc 74405 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 74379 atccatccatccgtccgtccgtc 74401
>emb|BX293991.12| Zebrafish DNA sequence from clone CH211-261I24 in linkage group 11, complete sequence Length = 198825 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 5375 atccatccgtccgtccgtccgtc 5353 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 5498 atccatccgtccgtccgtcc 5479 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||||||| |||||| Sbjct: 5837 atccatccgtccgtccatccgtc 5815 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 5502 atccatccatccgtccgtccgtc 5480 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 5379 atccatccatccgtccgtccgtc 5357
>emb|BX908793.14| Zebrafish DNA sequence from clone DKEY-104G4 in linkage group 3, complete sequence Length = 102377 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 60049 atccatccgtccgtccgtccgtc 60027 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 60053 atccatccatccgtccgtccgtc 60031 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 60045 atccgtccgtccgtccgtccgtc 60023
>emb|BX927365.7| Zebrafish DNA sequence from clone DKEY-161P7 in linkage group 23, complete sequence Length = 229608 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 137421 atccatccgtccgtccgtccgtc 137443 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 137425 atccgtccgtccgtccgtccgtc 137447 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 137417 atccatccatccgtccgtccgtc 137439
>emb|CR356222.24| Zebrafish DNA sequence from clone DKEY-103J14 in linkage group 13, complete sequence Length = 206656 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 156414 atccatccgtccgtccgtccgtc 156392 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 156418 atccatccatccgtccgtccgtc 156396
>gb|AC095491.7| Rattus norvegicus 4 BAC CH230-7L13 (Children's Hospital Oakland Research Institute) complete sequence Length = 293757 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 179328 atccatccgtccgtccgtccgtc 179350 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 179332 atccgtccgtccgtccgtccgtc 179354 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 179324 atccatccatccgtccgtccgtc 179346
>emb|BX571952.13| Zebrafish DNA sequence from clone DKEY-35E8 in linkage group 11, complete sequence Length = 175925 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 37240 atccatccgtccgtccgtccgtc 37218 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 37236 atccgtccgtccgtccgtccgtc 37214
>emb|BX276112.19| Zebrafish DNA sequence from clone CH211-220I12 in linkage group 24, complete sequence Length = 146065 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 19556 atccatccgtccgtccgtccgtc 19534 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 20205 atccatccgtccgtccgtcc 20186 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 20209 atccatccatccgtccgtccgtc 20187 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 19560 atccatccatccgtccgtccgtc 19538
>emb|AL512444.20| Human DNA sequence from clone RP11-69E9 on chromosome 1 Contains part of the EPHB2 gene for EphB2 and a novel gene, complete sequence Length = 126589 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 50988 atccatccgtccgtccgtccgtc 50966 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 50992 atccatccatccgtccgtccgtc 50970 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 50984 atccgtccgtccgtccgtccgtc 50962
>gb|AC091537.2| Rattus norvegicus strain Brown Norway clone RP31-78C13, complete sequence Length = 119664 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 38080 atccatccgtccgtccgtccgtc 38058 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 38084 atccatccatccgtccgtccgtc 38062
>emb|AL136100.12| Human DNA sequence from clone RP11-534P19 on chromosome 6 Contains a pseudogene similar to zinc finger proteins, complete sequence Length = 172212 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 37593 atccatccgtccgtccgtccgtc 37571 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 37597 atccatccatccgtccgtccgtc 37575 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 37589 atccgtccgtccgtccgtccgtc 37567
>emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C3 on chromosome 20 Contains the C20orf185 gene for the possible ortholog of potential ligand_binding protein RYA3 (Rat), the C20orf186 gene for the possible ortholog of potential ligand_binding protein RY2G5 (Rat), the 5' end of the SPAG4L gene for sperm associated antigen 4-like, a novel gene, a FAM16AX (family with sequence similarity 16, member A, X-linked) pseudogene, the BPIL3 gene for bactericidal/permeability-increasing protein-like 3 and a CpG island, complete sequence Length = 129502 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 37399 atccatccgtccgtccgtccgtc 37421 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 37395 atccatccatccgtccgtccgtc 37417
>emb|AL121889.8|HS1076E17 Human DNA sequence from clone RP5-1076E17 on chromosome 20 Contains part of the PPP1R16B gene for protein phosphatase 1 regulatory (inhibitory) subunit 16B, complete sequence Length = 22772 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 4629 atccatccgtccgtccgtccgtc 4651 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 4625 atccatccatccgtccgtccgtc 4647
>emb|AL096855.48|HS1115A15 Human DNA sequence from clone RP5-1115A15 on chromosome 1p36.11-36.31 Contains part of the RERE gene for arginine-glutamic acid dipeptide (RE) repeats (KIAA0458, FLJ38775), a novel gene and a CpG island, complete sequence Length = 178403 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 104934 atccatccgtccgtccgtccgtc 104956 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 104930 atccatccatccgtccgtccgtc 104952
>gb|AC136475.7| Homo sapiens chromosome 11, clone RP11-326C3, complete sequence Length = 143779 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 40807 atccatccgtccgtccgtccgtc 40785 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 40811 atccatccatccgtccgtccgtc 40789 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 40803 atccgtccgtccgtccgtccgtc 40781
>emb|BX927275.8| Zebrafish DNA sequence from clone DKEY-108P14 in linkage group 23, complete sequence Length = 133912 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 73869 atccatccgtccgtccgtccgtc 73891 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 73873 atccgtccgtccgtccgtccgtc 73895 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 73865 atccatccatccgtccgtccgtc 73887
>emb|BX927311.7| Zebrafish DNA sequence from clone CH211-235E15 in linkage group 24, complete sequence Length = 162570 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 154900 atccatccgtccgtccgtccgtc 154878 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 154896 atccgtccgtccgtccgtccgtc 154874
>emb|CR536617.9| Zebrafish DNA sequence from clone CH211-276B5 in linkage group 14, complete sequence Length = 38800 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 13058 atccatccgtccgtccgtccgtc 13036 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 13062 atccatccatccgtccgtccgtc 13040 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 13054 atccgtccgtccgtccgtccgtc 13032
>emb|BX321904.19| Zebrafish DNA sequence from clone DKEY-279K15 in linkage group 1, complete sequence Length = 153891 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 48049 atccatccgtccgtccgtccgtc 48071 Score = 42.1 bits (21), Expect = 0.60 Identities = 21/21 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgt 111 ||||||||||||||||||||| Sbjct: 47990 tccatccgtccgtccgtccgt 48010 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 48053 atccgtccgtccgtccgtccgtc 48075 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 48045 atccatccatccgtccgtccgtc 48067
>emb|BX322579.23| Zebrafish DNA sequence from clone CH211-3G21 in linkage group 1, complete sequence Length = 96025 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 325 atccatccgtccgtccgtccgtc 303 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 329 atccatccatccgtccgtccgtc 307
>emb|BX323824.17| Zebrafish DNA sequence from clone DKEY-37F18 in linkage group 25, complete sequence Length = 168743 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 1533 atccatccgtccgtccgtccgtc 1555 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 664 tccatccgtccgtccgtccgtc 685 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 1529 atccatccatccgtccgtccgtc 1551 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||| |||||||||| Sbjct: 655 atccatccgtccatccgtccgtc 677
>emb|CR812469.6| Zebrafish DNA sequence from clone DKEY-286F3 in linkage group 5, complete sequence Length = 162086 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 139234 atccatccgtccgtccgtccgtc 139256 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 139230 atccatccatccgtccgtccgtc 139252
>gb|AC164097.2| Mus musculus BAC clone RP23-141F18 from chromosome 16, complete sequence Length = 217725 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 143073 atccatccgtccgtccgtccgtc 143051 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 143145 atccatccgtctgtccgtccgtc 143123 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 143077 atccatccatccgtccgtccgtc 143055 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 143069 atccgtccgtccgtccgtccgtc 143047
>gb|AC153815.7| Mus musculus 6 BAC RP23-205F19 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 230983 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 35476 atccatccgtccgtccgtccgtc 35454
>emb|AL596022.12| Zebrafish DNA sequence from clone BUSM1-107O16 in linkage group 17 Contains part of a novel gene for a protein similar to vertebrate anaplastic lymphoma kinase (ALK) and leukocyte tyrosine kinase receptor prescursor (LTK or TYK1) and part of a novel gene for a protein similar to vertebrate inositol 1,4,5-triphosphate 3-kinase (ITPKA), complete sequence Length = 121941 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 35028 atccatccgtccgtccgtccgtc 35006 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 35024 atccgtccgtccgtccgtccgtc 35002
>emb|AL591492.11| Zebrafish DNA sequence from clone BUSM1-261O22 in linkage group 20 Contains a novel gene similar to FKBP3 (FK506 binding protein 3), a novel gene for a protein similar to pre-mRNA processing proteins, a novel retrotransposon and two CpG islands, complete sequence Length = 92083 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 3588 atccatccgtccgtccgtccgtc 3610 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 3592 atccgtccgtccgtccgtccgtc 3614
>gb|AC102586.14| Mus musculus chromosome 3, clone RP23-327I19, complete sequence Length = 194959 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 8491 atccatccgtccgtccgtccgtc 8469 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 8582 atccatccgtctgtccgtccgtc 8560
>emb|CR352225.13| Zebrafish DNA sequence from clone CH211-110E21 in linkage group 3, complete sequence Length = 60807 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 17315 atccatccgtccgtccgtccgtc 17337 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 17319 atccgtccgtccgtccgtccgtc 17341 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 17311 atccatccatccgtccgtccgtc 17333
>emb|BX296544.8| Zebrafish DNA sequence from clone DKEYP-14B8 in linkage group 21, complete sequence Length = 168838 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 122179 atccatccgtccgtccgtccgtc 122157 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 122007 atccatccgtccgtccgtccgtc 121985 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 122183 atccatccatccgtccgtccgtc 122161 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 122011 atccatccatccgtccgtccgtc 121989 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 122003 atccgtccgtccgtccgtccgtc 121981
>emb|BX072539.13| Zebrafish DNA sequence from clone CH211-286O24 in linkage group 6, complete sequence Length = 78217 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 15824 atccatccgtccgtccgtccgtc 15846 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 15828 atccgtccgtccgtccgtccgtc 15850
>emb|CR407599.9| Zebrafish DNA sequence from clone CH211-273O22 in linkage group 13, complete sequence Length = 32537 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 19291 atccatccgtccgtccgtccgtc 19269 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 86 atcgatccatccgtccgtcc 105 |||||||||||||||||||| Sbjct: 19031 atcgatccatccgtccgtcc 19012 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 18841 atccatccgtccgtccgtcc 18822 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 19295 atccatccatccgtccgtccgtc 19273 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 19287 atccgtccgtccgtccgtccgtc 19265 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 18845 atccatccatccgtccgtccgtc 18823
>emb|BX323864.8| Zebrafish DNA sequence from clone CH211-218K4 in linkage group 17, complete sequence Length = 154824 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 51499 atccatccgtccgtccgtccgtc 51477 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 51503 atccatccatccgtccgtccgtc 51481 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 51495 atccgtccgtccgtccgtccgtc 51473
>emb|BX510998.12| Zebrafish DNA sequence from clone CH211-272L18 in linkage group 12, complete sequence Length = 148753 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 15477 atccatccgtccgtccgtccgtc 15499 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 15481 atccgtccgtccgtccgtccgtc 15503 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 15473 atccatccatccgtccgtccgtc 15495
>emb|CR457462.13| Zebrafish DNA sequence from clone CH211-1O7 in linkage group 13, complete sequence Length = 166823 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 91588 atccatccgtccgtccgtccgtc 91566 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 94 atccgtccgtccgtccgtc 112 ||||||||||||||||||| Sbjct: 146367 atccgtccgtccgtccgtc 146349 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 146367 atccgtccgtccgtccgtccgtc 146345 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 91584 atccgtccgtccgtccgtccgtc 91562
>emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 in linkage group 23, complete sequence Length = 163114 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 115300 atccatccgtccgtccgtccgtc 115322 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||| ||||||||||||||| Sbjct: 115674 atccatctgtccgtccgtccgtc 115696 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 115304 atccgtccgtccgtccgtccgtc 115326
>emb|CR387989.9| Zebrafish DNA sequence from clone DKEY-101P2 in linkage group 18, complete sequence Length = 96438 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 92539 atccatccgtccgtccgtccgtc 92517 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 92543 atccatccatccgtccgtccgtc 92521 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 92535 atccgtccgtccgtccgtccgtc 92513
>emb|CR855273.7| Zebrafish DNA sequence from clone DKEYP-34E1 in linkage group 24, complete sequence Length = 161081 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 85692 atccatccgtccgtccgtccgtc 85714 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 85696 atccgtccgtccgtccgtccgtc 85718 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 85688 atccatccatccgtccgtccgtc 85710
>emb|AL645971.12| Mouse DNA sequence from clone RP23-378J19 on chromosome 11 Vontains the 5' end of the gene for novel protein similar to human RAP1 GTPase activating protein 1 RAP1GA1,,a novel gene and three CpG islands, complete sequence Length = 102898 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 80675 atccatccgtccgtccgtccgtc 80653 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 80679 atccatccatccgtccgtccgtc 80657 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 80671 atccgtccgtccgtccgtccgtc 80649
>emb|CR394562.10| Zebrafish DNA sequence from clone CH211-284D14 in linkage group 8, complete sequence Length = 134514 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 16717 atccatccgtccgtccgtccgtc 16695 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 16628 atccatccgtccgtccgtccgtc 16606 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 16713 atccgtccgtccgtccgtccgtc 16691 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 16632 atccatccatccgtccgtccgtc 16610 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 16624 atccgtccgtccgtccgtccgtc 16602 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||| |||||||||| Sbjct: 16507 atccatccgtccttccgtccgtc 16485
>emb|CR388169.7| Zebrafish DNA sequence from clone DKEYP-61H1 in linkage group 3, complete sequence Length = 89582 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 40147 atccatccgtccgtccgtccgtc 40125 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 40143 atccgtccgtccgtccgtccgtc 40121
>emb|BX511261.12| Zebrafish DNA sequence from clone DKEYP-59G7 in linkage group 1, complete sequence Length = 185266 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 57421 atccatccgtccgtccgtccgtc 57443 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 57446 tccatccgtccgtccgtccgtc 57467 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 57449 atccgtccgtccgtccgtccgtc 57471 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 57425 atccgtccgtccgtccgtccgtc 57447 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 57417 atccatccatccgtccgtccgtc 57439
>emb|CR352253.9| Zebrafish DNA sequence from clone CH211-267D1 in linkage group 13, complete sequence Length = 160748 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 74717 atccatccgtccgtccgtccgtc 74739
>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3, complete sequence Length = 198900 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 16290 atccatccgtccgtccgtccgtc 16312 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 16294 atccgtccgtccgtccgtccgtc 16316 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 16286 atccatccatccgtccgtccgtc 16308 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 15615 atccatccgtctgtccgtccgtc 15637
>emb|BX571838.9| Zebrafish DNA sequence from clone DKEY-205N7 in linkage group 13, complete sequence Length = 124398 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 107484 atccatccgtccgtccgtccgtc 107462 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 107488 atccatccatccgtccgtccgtc 107466 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 107480 atccgtccgtccgtccgtccgtc 107458
>emb|BX324164.15| Zebrafish DNA sequence from clone DKEY-14D8 in linkage group 4 Contains the gene for a novel protein similar to vertebrate selenoprotein family, the gene for a novel protein similar to vertebrate vascular endothelial growth factor (VEGF), the gene for a novel protein similar to vertebrate mitogen-activated protein kinase family, the gene for a novel protein similar to vertebrate mitogen-activated protein kinase family, the gene for a novel protein similar to vertebrate scavenger receptor protein, two genes for novel proteins similar to vertebrate protein deleted in malignant brain tumors 1, fifteen novel genes and three CpG islands, complete sequence Length = 264155 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 245085 atccatccgtccgtccgtccgtc 245107 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 245089 atccgtccgtccgtccgtccgtc 245111 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 245081 atccatccatccgtccgtccgtc 245103
>emb|AL845301.15| Zebrafish DNA sequence from clone CH211-112M17 in linkage group 20 Contains the gene for a novel mcm domain containing protein, the 5' end of a novel gene, the 3' end of a novel gene and a CpG island, complete sequence Length = 171078 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 137416 atccatccgtccgtccgtccgtc 137438 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 137420 atccgtccgtccgtccgtccgtc 137442 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 137412 atccatccatccgtccgtccgtc 137434
>emb|CR352243.7| Zebrafish DNA sequence from clone DKEYP-117H8 in linkage group 20 Contains the paics gene for phosphoribosylaminoimidazole carboxylase phosphoribosylaminoimidazole succinocarboxamide synthetase, the gene for a novel AMP-binding enzyme domain containing protein, the gene for a novel protein similar to vertebrate phosphoribosyl pyrophosphate amidotransferase (PPAT), the 3' end of the gene for a novel protein similar to cytochrome P450 family 2 subfamily J, the 5' end of a novel gene and two novel genes, complete sequence Length = 121253 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 29400 atccatccgtccgtccgtccgtc 29378 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 29404 atccatccatccgtccgtccgtc 29382 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 29396 atccgtccgtccgtccgtccgtc 29374
>emb|AL807378.5| Zebrafish DNA sequence from clone CH211-215A18 in linkage group 7 Contains three CpG islands, complete sequence Length = 198700 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 163782 atccatccgtccgtccgtccgtc 163804 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 163778 atccatccatccgtccgtccgtc 163800
>emb|CR759893.7| Zebrafish DNA sequence from clone DKEY-220K22 in linkage group 5, complete sequence Length = 213981 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 113690 atccatccgtccgtccgtccgtc 113668 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 113686 atccgtccgtccgtccgtccgtc 113664
>gb|AC150418.2| Branchiostoma floridae clone CH302-67G11, complete sequence Length = 154273 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 99188 atccatccgtccgtccgtccgtc 99166 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 99192 atccatccatccgtccgtccgtc 99170 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 99184 atccgtccgtccgtccgtccgtc 99162
>gb|AC125418.3| Homo sapiens chromosome 15, clone CTD-3114C7, complete sequence Length = 75059 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 8527 atccatccgtccgtccgtccgtc 8505 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 8531 atccatccatccgtccgtccgtc 8509 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 8523 atccgtccgtccgtccgtccgtc 8501
>gb|AC123776.5| Homo sapiens chromosome 8, clone RP11-213I2, complete sequence Length = 157633 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 132267 atccatccgtccgtccgtccgtc 132245 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 132271 atccatccatccgtccgtccgtc 132249 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 132263 atccgtccgtccgtccgtccgtc 132241
>emb|BX957314.11| Zebrafish DNA sequence from clone CH211-114K5 in linkage group 16, complete sequence Length = 90695 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 46535 atccatccgtccgtccgtccgtc 46557 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 46476 tccatccgtccgtccgtccgtc 46497 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||| |||||||||| Sbjct: 46633 atccatccgtccatccgtccgtc 46655 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 46539 atccgtccgtccgtccgtccgtc 46561 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 46531 atccatccatccgtccgtccgtc 46553
>emb|CR753844.7| Zebrafish DNA sequence from clone DKEY-193H7 in linkage group 5, complete sequence Length = 172761 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 42699 atccatccgtccgtccgtccgtc 42677 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 42695 atccgtccgtccgtccgtccgtc 42673
>emb|BX470065.7| Zebrafish DNA sequence from clone DKEY-105H11 in linkage group 24, complete sequence Length = 198444 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 105126 atccatccgtccgtccgtccgtc 105148 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 105130 atccgtccgtccgtccgtccgtc 105152 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 105122 atccatccatccgtccgtccgtc 105144
>emb|CR361551.8| Zebrafish DNA sequence from clone CH211-224M9 in linkage group 1, complete sequence Length = 177606 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 132200 atccatccgtccgtccgtccgtc 132178 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 132204 atccatccatccgtccgtccgtc 132182 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 132196 atccgtccgtccgtccgtccgtc 132174
>emb|BX537102.13| Zebrafish DNA sequence from clone DKEY-276L17 in linkage group 14, complete sequence Length = 239944 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 200646 atccatccgtccgtccgtccgtc 200668 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 200650 atccgtccgtccgtccgtccgtc 200672 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 200642 atccatccatccgtccgtccgtc 200664 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||| ||||||| Sbjct: 199991 atccatccgtccgtctgtccgtc 200013
>emb|BX005225.20| Zebrafish DNA sequence from clone DKEY-34L15 in linkage group 14, complete sequence Length = 206042 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 58326 atccatccgtccgtccgtccgtc 58348 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 58322 atccatccatccgtccgtccgtc 58344 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||| ||||||| Sbjct: 57520 atccatccgtccgtctgtccgtc 57542
>emb|CR548643.7| Zebrafish DNA sequence from clone CH211-217H15 in linkage group 13, complete sequence Length = 90157 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 18417 atccatccgtccgtccgtccgtc 18395 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 18421 atccatccatccgtccgtccgtc 18399 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 18413 atccgtccgtccgtccgtccgtc 18391
>emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, complete sequence Length = 196030 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 177937 atccatccgtccgtccgtccgtc 177915 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 177941 atccatccatccgtccgtccgtc 177919 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 177933 atccgtccgtccgtccgtccgtc 177911
>emb|BX005378.13| Zebrafish DNA sequence from clone DKEY-40H20 in linkage group 5, complete sequence Length = 168015 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 78921 atccatccgtccgtccgtccgtc 78943 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 78300 atccatccgtccgtccgtccgtc 78322 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 78917 atccatccatccgtccgtccgtc 78939 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 78296 atccatccatccgtccgtccgtc 78318
>emb|BX664752.20| Zebrafish DNA sequence from clone DKEYP-111E5 in linkage group 6, complete sequence Length = 156503 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 139776 atccatccgtccgtccgtccgtc 139798 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 139780 atccgtccgtccgtccgtccgtc 139802
>emb|BX649557.8| Zebrafish DNA sequence from clone DKEYP-61G11 in linkage group 3, complete sequence Length = 163934 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 12699 atccatccgtccgtccgtccgtc 12721 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 12695 atccatccatccgtccgtccgtc 12717
>emb|BX322638.6| Zebrafish DNA sequence from clone DKEYP-114C5 in linkage group 11, complete sequence Length = 85185 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 10990 atccatccgtccgtccgtccgtc 10968 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 35908 atccgtccgtccgtccgtccgtc 35930 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 10994 atccatccatccgtccgtccgtc 10972 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 10986 atccgtccgtccgtccgtccgtc 10964
>emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 in linkage group 18, complete sequence Length = 143863 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 11951 atccatccgtccgtccgtccgtc 11929 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 93 catccgtccgtccgtccgtc 112 |||||||||||||||||||| Sbjct: 11924 catccgtccgtccgtccgtc 11905 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 11955 atccatccatccgtccgtccgtc 11933
>gb|DQ401678.1| Cycleptus elongatus microsatellite Ce13L sequence Length = 214 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 114 atccatccgtccgtccgtccgtc 92 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 118 atccatccatccgtccgtccgtc 96 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 110 atccgtccgtccgtccgtccgtc 88
>emb|BX539348.8| Zebrafish DNA sequence from clone DKEY-273G16 in linkage group 15, complete sequence Length = 186416 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 17391 atccatccgtccgtccgtccgtc 17369 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 17395 atccatccatccgtccgtccgtc 17373 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 17387 atccgtccgtccgtccgtccgtc 17365
>emb|BX296542.12| Zebrafish DNA sequence from clone CH211-278C10 in linkage group 9, complete sequence Length = 174884 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 75425 atccatccgtccgtccgtccgtc 75447 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 75429 atccgtccgtccgtccgtccgtc 75451 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 75421 atccatccatccgtccgtccgtc 75443
>emb|BX248512.14| Zebrafish DNA sequence from clone CH211-284D12 in linkage group 2, complete sequence Length = 146757 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 71524 atccatccgtccgtccgtccgtc 71502 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 71528 atccatccatccgtccgtccgtc 71506 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 71520 atccgtccgtccgtccgtccgtc 71498
>emb|BX119930.5| Zebrafish DNA sequence from clone DKEY-18G4 in linkage group 3, complete sequence Length = 186318 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 134741 atccatccgtccgtccgtccgtc 134763 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 134745 atccgtccgtccgtccgtccgtc 134767 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 134737 atccatccatccgtccgtccgtc 134759
>emb|BX537293.9| Zebrafish DNA sequence from clone DKEYP-40D11 in linkage group 5, complete sequence Length = 134768 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 10434 atccatccgtccgtccgtccgtc 10412 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 9939 atccatccgtccgtccgtccgtc 9917 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 10438 atccatccatccgtccgtccgtc 10416 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 9943 atccatccatccgtccgtccgtc 9921
>emb|BX511223.6| Zebrafish DNA sequence from clone DKEYP-96B6 in linkage group 14, complete sequence Length = 190254 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 152726 atccatccgtccgtccgtccgtc 152704 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 152730 atccatccatccgtccgtccgtc 152708
>emb|BX294178.13| Zebrafish DNA sequence from clone CH211-271C18 in linkage group 7, complete sequence Length = 131441 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 41383 atccatccgtccgtccgtccgtc 41405 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 40333 atccatccgtccgtccgtcc 40352 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 42325 atccatccgtctgtccgtccgtc 42347 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 41387 atccgtccgtccgtccgtccgtc 41409 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 41379 atccatccatccgtccgtccgtc 41401
>emb|BX470196.6| Zebrafish DNA sequence from clone CH211-157J23 in linkage group 24, complete sequence Length = 165383 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 9162 atccatccgtccgtccgtccgtc 9140 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 9166 atccatccatccgtccgtccgtc 9144 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 9158 atccgtccgtccgtccgtccgtc 9136
>emb|BX629345.5| Zebrafish DNA sequence from clone DKEY-148A13 in linkage group 1, complete sequence Length = 133660 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 96360 atccatccgtccgtccgtccgtc 96338 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 96184 atccatccgtccgtccgtccgtc 96162 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 96364 atccatccatccgtccgtccgtc 96342 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 96356 atccgtccgtccgtccgtccgtc 96334 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||| |||||||||||||||| Sbjct: 96232 atccattcgtccgtccgtccgtc 96210 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 96188 atccatccatccgtccgtccgtc 96166 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 96180 atccgtccgtccgtccgtccgtc 96158
>emb|BX247866.12| Zebrafish DNA sequence from clone DKEY-216J12 in linkage group 1, complete sequence Length = 197473 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 81966 atccatccgtccgtccgtccgtc 81944 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 81941 tccatccgtccgtccgtccgtc 81920 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 81970 atccatccatccgtccgtccgtc 81948 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 81962 atccgtccgtccgtccgtccgtc 81940 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 81938 atccgtccgtccgtccgtccgtc 81916
>emb|BX321896.13| Zebrafish DNA sequence from clone RP71-49B22 in linkage group 23, complete sequence Length = 165985 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 129397 atccatccgtccgtccgtccgtc 129419 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 129401 atccgtccgtccgtccgtccgtc 129423 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 129393 atccatccatccgtccgtccgtc 129415
>emb|BX510306.17| Zebrafish DNA sequence from clone CH211-195F19 in linkage group 13, complete sequence Length = 194184 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 69035 atccatccgtccgtccgtccgtc 69057 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 69039 atccgtccgtccgtccgtccgtc 69061
>emb|BX004763.9| Zebrafish DNA sequence from clone CH211-131K2, complete sequence Length = 86545 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 9053 atccatccgtccgtccgtccgtc 9075 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 21740 atccatccgtccgtccgtcc 21721 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 11574 atccgtccgtccgtccgtccgtc 11596 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 11355 atccgtccgtccgtccgtccgtc 11377 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 94 atccgtccgtccgtccgtc 112 ||||||||||||||||||| Sbjct: 11267 atccgtccgtccgtccgtc 11285 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 94 atccgtccgtccgtccgtc 112 ||||||||||||||||||| Sbjct: 11121 atccgtccgtccgtccgtc 11139 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 9057 atccgtccgtccgtccgtccgtc 9079 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 9049 atccatccatccgtccgtccgtc 9071
>emb|BX539317.4| Zebrafish DNA sequence from clone DKEY-170L10 in linkage group 17, complete sequence Length = 117893 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 32123 atccatccgtccgtccgtccgtc 32101 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 32119 atccgtccgtccgtccgtccgtc 32097
>emb|BX537152.15| Zebrafish DNA sequence from clone DKEY-61N7 in linkage group 14, complete sequence Length = 243729 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 173092 atccatccgtccgtccgtccgtc 173114 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 173096 atccgtccgtccgtccgtccgtc 173118 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 173088 atccatccatccgtccgtccgtc 173110
>gb|AC160052.2| Mus musculus BAC clone RP24-173L14 from chromosome 9, complete sequence Length = 154436 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 93227 atccatccgtccgtccgtccgtc 93205 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 16646 atccatccgtccgtccgtccgtc 16624 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 93231 atccatccatccgtccgtccgtc 93209 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 16650 atccatccatccgtccgtccgtc 16628 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 16642 atccgtccgtccgtccgtccgtc 16620
>dbj|AK084979.1| Mus musculus 13 days embryo lung cDNA, RIKEN full-length enriched library, clone:D430021D02 product:unclassifiable, full insert sequence Length = 3365 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 1406 atccatccgtccgtccgtccgtc 1428 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 1410 atccgtccgtccgtccgtccgtc 1432 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 1402 atccatccatccgtccgtccgtc 1424
>ref|NG_003253.1| Homo sapiens cytochrome c oxidase, subunit 8B pseudogene (COX8B) on chromosome 11 Length = 3756 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 809 atccatccgtccgtccgtccgtc 831 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 813 atccgtccgtccgtccgtccgtc 835 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 805 atccatccatccgtccgtccgtc 827
>gb|AC145619.4| Homo sapiens BAC clone RP11-722J20 from chromosome 2, complete sequence Length = 152973 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 51724 atccatccgtccgtccgtccgtc 51702
>emb|BX649377.8| Zebrafish DNA sequence from clone CH211-196J1 in linkage group 19, complete sequence Length = 217898 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 68109 atccatccgtccgtccgtccgtc 68131 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 67957 atccatccgtccgtccgtccgtc 67979 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 160355 tccatccgtccgtccgtccgtc 160334 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 75415 atccatccgtccgtccgtcc 75434 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 75411 atccatccatccgtccgtccgtc 75433 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 68105 atccatccatccgtccgtccgtc 68127 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 67961 atccgtccgtccgtccgtccgtc 67983 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 67953 atccatccatccgtccgtccgtc 67975
>gb|AC148696.1| Macaca mulatta Major Histocompatibility Complex BAC MMU246K06, complete sequence Length = 165811 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 16769 atccatccgtccgtccgtccgtc 16747 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 16773 atccatccatccgtccgtccgtc 16751
>emb|BX120012.24| Zebrafish DNA sequence from clone CH211-205H19, complete sequence Length = 152578 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 143656 atccatccgtccgtccgtccgtc 143678 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 143652 atccatccatccgtccgtccgtc 143674
>emb|BX248522.9| Zebrafish DNA sequence from clone CH211-113B2 in linkage group 14, complete sequence Length = 104379 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 19518 atccatccgtccgtccgtccgtc 19540 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 19522 atccgtccgtccgtccgtccgtc 19544 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 19514 atccatccatccgtccgtccgtc 19536
>emb|BX120000.8| Zebrafish DNA sequence from clone CH211-214C13 in linkage group 17, complete sequence Length = 214728 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 195541 atccatccgtccgtccgtccgtc 195563 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 195537 atccatccatccgtccgtccgtc 195559
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 29800428 atccatccgtccgtccgtccgtc 29800406 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 85 gatcgatccatccgtccgtccgt 107 ||||||||| ||||||||||||| Sbjct: 36057655 gatcgatccttccgtccgtccgt 36057677 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 29800432 atccatccatccgtccgtccgtc 29800410
>gb|AC069287.7| Homo sapiens BAC clone RP11-304M2 from 11, complete sequence Length = 199487 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 3376 atccatccgtccgtccgtccgtc 3398 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 3380 atccgtccgtccgtccgtccgtc 3402 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 3372 atccatccatccgtccgtccgtc 3394
>gb|AC008306.3|AC008306 Drosophila melanogaster, chromosome 2R, region 51B-51B, BAC clone BACR27M04, complete sequence Length = 169689 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 104919 atccatccgtccgtccgtccgtc 104897 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 104923 atccatccatccgtccgtccgtc 104901
>emb|BX004760.10| Zebrafish DNA sequence from clone CH211-222O4 in linkage group 3, complete sequence Length = 190220 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 117636 atccatccgtccgtccgtccgtc 117658 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 117640 atccgtccgtccgtccgtccgtc 117662 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 117632 atccatccatccgtccgtccgtc 117654
>emb|BX005061.9| Zebrafish DNA sequence from clone CH211-158F5 in linkage group 5, complete sequence Length = 155854 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 126949 atccatccgtccgtccgtccgtc 126927 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 126953 atccatccatccgtccgtccgtc 126931
>emb|BX088526.6| Zebrafish DNA sequence from clone CH211-51H9 in linkage group 8, complete sequence Length = 187161 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 9008 atccatccgtccgtccgtccgtc 9030 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 9004 atccatccatccgtccgtccgtc 9026
>gb|AC007472.6|AC007472 Drosophila melanogaster, chromosome 2R, region 49E-49F, BAC clone BACR30D19, complete sequence Length = 163052 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 143369 atccatccgtccgtccgtccgtc 143391 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 143365 atccatccatccgtccgtccgtc 143387
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds Length = 3284914 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 2014980 atccatccgtccgtccgtccgtc 2015002 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 2014984 atccgtccgtccgtccgtccgtc 2015006 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 2014976 atccatccatccgtccgtccgtc 2014998
>emb|BX005074.10| Zebrafish DNA sequence from clone CH211-146J7 in linkage group 8, complete sequence Length = 153989 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 118340 atccatccgtccgtccgtccgtc 118318 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 117180 atccatccgtccgtccgtccgtc 117158 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 118336 atccgtccgtccgtccgtccgtc 118314 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 117184 atccatccatccgtccgtccgtc 117162 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 117176 atccgtccgtccgtccgtccgtc 117154 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 116701 tccatccgtccgtccgtcc 116683
>gb|AC021093.16|AC021093 Homo sapiens chromosome 8 clone RP11-213I2, complete sequence Length = 157604 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 132238 atccatccgtccgtccgtccgtc 132216 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 132242 atccatccatccgtccgtccgtc 132220 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 132234 atccgtccgtccgtccgtccgtc 132212
>gb|AC008282.4| Homo sapiens BAC clone RP11-516B14 from 2, complete sequence Length = 203241 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 94533 atccatccgtccgtccgtccgtc 94511 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 94537 atccatccatccgtccgtccgtc 94515
>gb|AC154296.2| Mus musculus BAC clone RP23-424C4 from chromosome 9, complete sequence Length = 194303 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 81618 atccatccgtccgtccgtccgtc 81596 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 81582 atccatccgtccgtccgtccgtc 81560 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 81622 atccatccatccgtccgtccgtc 81600 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 81614 atccgtccgtccgtccgtccgtc 81592 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 81586 atccatccatccgtccgtccgtc 81564
>gb|AC074264.3| Homo sapiens BAC clone RP11-410L9 from 2, complete sequence Length = 122472 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 87405 atccatccgtccgtccgtccgtc 87383
>gb|AC010982.5| Homo sapiens BAC clone RP11-475I16 from 2, complete sequence Length = 217107 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 51140 atccatccgtccgtccgtccgtc 51162 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 51144 atccgtccgtccgtccgtccgtc 51166 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 51136 atccatccatccgtccgtccgtc 51158
>gb|AC103776.3| Homo sapiens chromosome 8, clone RP11-42O14, complete sequence Length = 165995 Score = 46.1 bits (23), Expect = 0.038 Identities = 26/27 (96%) Strand = Plus / Plus Query: 86 atcgatccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||||||| Sbjct: 82762 atcggtccatccgtccgtccgtccgtc 82788 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 82770 atccgtccgtccgtccgtccgtc 82792
>gb|AC019257.3| Homo sapiens chromosome 8, clone RP11-439C15, complete sequence Length = 220201 Score = 46.1 bits (23), Expect = 0.038 Identities = 26/27 (96%) Strand = Plus / Minus Query: 86 atcgatccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||||||| Sbjct: 23869 atcggtccatccgtccgtccgtccgtc 23843 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 23861 atccgtccgtccgtccgtccgtc 23839
>gb|AC098806.3| Takifugu rubripes clone 208D11, complete sequence Length = 130460 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 111500 atccatccgtccgtccgtccgtc 111478 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 111496 atccgtccgtccgtccgtccgtc 111474
>gb|AC136373.5| Homo sapiens chromosome 8, clone CTD-2588I16, complete sequence Length = 51604 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 45423 atccatccgtccgtccgtccgtc 45445 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 45427 atccgtccgtccgtccgtccgtc 45449 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 45419 atccatccatccgtccgtccgtc 45441
>emb|BX571811.5| Zebrafish DNA sequence from clone CH211-194P6, complete sequence Length = 219044 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 77802 atccatccgtccgtccgtccgtc 77780 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 77806 atccatccatccgtccgtccgtc 77784
>emb|BX004974.21| Zebrafish DNA sequence from clone CH211-74A16 in linkage group 18, complete sequence Length = 186303 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 134440 atccatccgtccgtccgtccgtc 134418 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 134114 atccatccgtccgtccgtccgtc 134092 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 134444 atccatccatccgtccgtccgtc 134422 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 134436 atccgtccgtccgtccgtccgtc 134414 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 134118 atccatccatccgtccgtccgtc 134096 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 134110 atccgtccgtccgtccgtccgtc 134088
>emb|BX004843.10| Zebrafish DNA sequence from clone CH211-165E15, complete sequence Length = 131026 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 73744 atccatccgtccgtccgtccgtc 73766 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 73748 atccgtccgtccgtccgtccgtc 73770 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 73740 atccatccatccgtccgtccgtc 73762
>emb|BX248399.5| Zebrafish DNA sequence from clone CH211-233A1 in linkage group 10, complete sequence Length = 158884 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 60309 atccatccgtccgtccgtccgtc 60331 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 59950 atccatccgtccgtccgtccgtc 59972 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 59606 atccatccgtccgtccgtccgtc 59628 Score = 44.1 bits (22), Expect = 0.15 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 tcgatcgatccatccgtccgtccgtccgtc 112 |||||| |||||||| |||||||||||||| Sbjct: 59939 tcgatccatccatccatccgtccgtccgtc 59968 Score = 44.1 bits (22), Expect = 0.15 Identities = 28/30 (93%) Strand = Plus / Plus Query: 83 tcgatcgatccatccgtccgtccgtccgtc 112 |||||| |||||||| |||||||||||||| Sbjct: 59595 tcgatccatccatccatccgtccgtccgtc 59624 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 60663 atccgtccgtccgtccgtccgtc 60685 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 60313 atccgtccgtccgtccgtccgtc 60335 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 60305 atccatccatccgtccgtccgtc 60327 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 60197 atccgtccgtccgtccgtccgtc 60219 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 59954 atccgtccgtccgtccgtccgtc 59976 Score = 38.2 bits (19), Expect = 9.3 Identities = 25/27 (92%) Strand = Plus / Plus Query: 86 atcgatccatccgtccgtccgtccgtc 112 |||||||||||| ||| |||||||||| Sbjct: 59938 atcgatccatccatccatccgtccgtc 59964 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 59830 atccgtccgtccgtccgtccgtc 59852 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 59610 atccgtccgtccgtccgtccgtc 59632 Score = 38.2 bits (19), Expect = 9.3 Identities = 25/27 (92%) Strand = Plus / Plus Query: 86 atcgatccatccgtccgtccgtccgtc 112 |||||||||||| ||| |||||||||| Sbjct: 59594 atcgatccatccatccatccgtccgtc 59620
>emb|BX005481.11| Zebrafish DNA sequence from clone CH211-79C1 in linkage group 1, complete sequence Length = 170604 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 120773 atccatccgtccgtccgtccgtc 120795 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 120777 atccgtccgtccgtccgtccgtc 120799
>gb|M86376.1|RATTREL12 Rattus norvegicus tropoelastin (tropoelastin) gene, exons 28, 29, 30, 31, 32, 33, 34, 35, 36, and partial cds Length = 7486 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 6795 atccatccgtccgtccgtccgtc 6817 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 6791 atccatccatccgtccgtccgtc 6813
>emb|AL935034.18| Zebrafish DNA sequence from clone CH211-160A3 in linkage group 12, complete sequence Length = 171213 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 96768 atccatccgtccgtccgtccgtc 96746 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 99151 atccatccgtctgtccgtccgtc 99129 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 98657 atccatccgtctgtccgtccgtc 98635 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 96772 atccatccatccgtccgtccgtc 96750 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 96764 atccgtccgtccgtccgtccgtc 96742
>gb|AC022308.17|AC022308 Homo sapiens chromosome 15 clone RP11-34L4, complete sequence Length = 166226 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 88436 atccatccgtccgtccgtccgtc 88414 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 88440 atccatccatccgtccgtccgtc 88418 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 88432 atccgtccgtccgtccgtccgtc 88410
>emb|BX119315.5| Zebrafish DNA sequence from clone CH211-215F22 in linkage group 9, complete sequence Length = 210930 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 28608 atccatccgtccgtccgtccgtc 28586 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 28583 tccatccgtccgtccgtccgtc 28562 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 28604 atccgtccgtccgtccgtccgtc 28582 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 28580 atccgtccgtccgtccgtccgtc 28558
>dbj|AB075928.1| Danio rerio CNR family (zCNRv1, zCNRv2, zCNRv3, zCNRv4, zCNRv5, zCNRv6, zCNRv7, zCNRv8, zCNRv9, zCNRv10, zCNRv11,zCNRv12, zCNRc) genes, complete cds Length = 116542 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 76454 atccatccgtccgtccgtccgtc 76432 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 76875 tccatccgtccgtccgtccgtc 76854 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 76872 atccgtccgtccgtccgtccgtc 76850 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 76450 atccgtccgtccgtccgtccgtc 76428
>emb|BX004814.8| Zebrafish DNA sequence from clone CH211-103I6 in linkage group 1, complete sequence Length = 171710 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 34448 atccatccgtccgtccgtccgtc 34470 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 23176 atccatccgtccgtccgtccgtc 23198 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 21905 atccatccgtccgtccgtccgtc 21883 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 34444 atccatccatccgtccgtccgtc 34466 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 23309 tccatccgtccgtccgtcc 23327 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 21909 atccatccatccgtccgtccgtc 21887 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 21901 atccgtccgtccgtccgtccgtc 21879
>emb|BX248325.7| Zebrafish DNA sequence from clone CH211-233I11 in linkage group 9, complete sequence Length = 157207 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 154986 atccatccgtccgtccgtccgtc 155008 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 154982 atccatccatccgtccgtccgtc 155004
>emb|BX005045.10| Zebrafish DNA sequence from clone CH211-69C9 in linkage group 19, complete sequence Length = 161812 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 107317 atccatccgtccgtccgtccgtc 107339 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 catccgtccgtccgtccgtc 112 |||||||||||||||||||| Sbjct: 108196 catccgtccgtccgtccgtc 108215 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 108197 atccgtccgtccgtccgtccgtc 108219 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 107321 atccgtccgtccgtccgtccgtc 107343 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 107313 atccatccatccgtccgtccgtc 107335
>emb|BX537130.6| Zebrafish DNA sequence from clone DKEY-104I23 in linkage group 20, complete sequence Length = 188776 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 99852 atccatccgtccgtccgtccgtc 99874 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 99848 atccatccatccgtccgtccgtc 99870
>emb|BX294375.7| Zebrafish DNA sequence from clone DKEY-176M20 in linkage group 17, complete sequence Length = 188455 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 126709 atccatccgtccgtccgtccgtc 126731 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 126713 atccgtccgtccgtccgtccgtc 126735 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 126705 atccatccatccgtccgtccgtc 126727
>emb|BX004770.12| Zebrafish DNA sequence from clone DKEY-14K21 in linkage group 10, complete sequence Length = 231131 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 133825 atccatccgtccgtccgtccgtc 133803 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 133325 atccatccgtccgtccgtccgtc 133303 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 133329 atccatccatccgtccgtccgtc 133307
>emb|BX004992.13| Zebrafish DNA sequence from clone CH211-120E13 in linkage group 16, complete sequence Length = 195432 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 84711 atccatccgtccgtccgtccgtc 84689 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 84715 atccatccatccgtccgtccgtc 84693 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 84707 atccgtccgtccgtccgtccgtc 84685
>emb|BX072582.6| Zebrafish DNA sequence from clone DKEY-222O19 in linkage group 11, complete sequence Length = 194918 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 88537 atccatccgtccgtccgtccgtc 88515 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 88541 atccatccatccgtccgtccgtc 88519
>emb|BX296535.7| Zebrafish DNA sequence from clone CH211-234I2, complete sequence Length = 163120 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 25300 atccatccgtccgtccgtccgtc 25278 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 25304 atccatccatccgtccgtccgtc 25282 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 25296 atccgtccgtccgtccgtccgtc 25274
>emb|AL954130.8| Zebrafish DNA sequence from clone CH211-214D1 in linkage group 16, complete sequence Length = 235236 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 88425 atccatccgtccgtccgtccgtc 88447 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 88429 atccgtccgtccgtccgtccgtc 88451
>emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 in linkage group 6, complete sequence Length = 189742 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 115875 atccatccgtccgtccgtccgtc 115853
>emb|AL929322.6| Zebrafish DNA sequence from clone DKEY-10H23, complete sequence Length = 220527 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 112175 atccatccgtccgtccgtccgtc 112153
>emb|AL929128.4| Zebrafish DNA sequence from clone CH211-203P17 in linkage group 17, complete sequence Length = 100859 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 46867 atccatccgtccgtccgtccgtc 46845 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 46871 atccatccatccgtccgtccgtc 46849
>emb|CR762435.19| Zebrafish DNA sequence from clone CH211-238C15 in linkage group 18, complete sequence Length = 157544 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 122348 atccatccgtccgtccgtccgtc 122326 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 122206 atccatccgtccgtccgtccgtc 122184 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 94 atccgtccgtccgtccgtc 112 ||||||||||||||||||| Sbjct: 122412 atccgtccgtccgtccgtc 122394 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 122412 atccgtccgtccgtccgtccgtc 122390 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 122352 atccatccatccgtccgtccgtc 122330 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 122344 atccgtccgtccgtccgtccgtc 122322 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 122210 atccatccatccgtccgtccgtc 122188 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 122202 atccgtccgtccgtccgtccgtc 122180
>emb|BX248326.14| Zebrafish DNA sequence from clone DKEY-260N20 in linkage group 20, complete sequence Length = 182841 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 20070 atccatccgtccgtccgtccgtc 20048 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 20074 atccatccatccgtccgtccgtc 20052 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 20066 atccgtccgtccgtccgtccgtc 20044
>emb|CR628326.8| Zebrafish DNA sequence from clone CH211-247N12 in linkage group 19, complete sequence Length = 146234 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 28460 atccatccgtccgtccgtccgtc 28438 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 28241 tccatccgtccgtccgtccgtc 28220 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 28464 atccatccatccgtccgtccgtc 28442 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 28456 atccgtccgtccgtccgtccgtc 28434 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||| |||||||||| Sbjct: 28250 atccatccgtccatccgtccgtc 28228 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 28238 atccgtccgtccgtccgtccgtc 28216 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 27953 tccatccgtccgtccgtcc 27935
>emb|BX649292.16| Zebrafish DNA sequence from clone DKEY-39E8 in linkage group 22, complete sequence Length = 181688 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 171326 atccatccgtccgtccgtccgtc 171348
>emb|BX649455.14| Zebrafish DNA sequence from clone CH211-151J12 in linkage group 4, complete sequence Length = 116689 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 16756 atccatccgtccgtccgtccgtc 16778 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 16760 atccgtccgtccgtccgtccgtc 16782
>emb|BX890617.13| Zebrafish DNA sequence from clone DKEYP-84F11 in linkage group 19, complete sequence Length = 182182 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 89130 atccatccgtccgtccgtccgtc 89152 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 89203 tccatccgtccgtccgtccgtc 89224
>emb|BX649468.12| Zebrafish DNA sequence from clone CH211-152C2 in linkage group 4, complete sequence Length = 164705 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 41937 atccatccgtccgtccgtccgtc 41915 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 41941 atccatccatccgtccgtccgtc 41919 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 41933 atccgtccgtccgtccgtccgtc 41911
>emb|BX957317.12| Zebrafish DNA sequence from clone DKEY-150K17 in linkage group 19, complete sequence Length = 222684 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 96400 atccatccgtccgtccgtccgtc 96378 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 96404 atccatccatccgtccgtccgtc 96382
>emb|BX649637.10| Zebrafish DNA sequence from clone CH211-236P22 in linkage group 18, complete sequence Length = 158212 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 10443 atccatccgtccgtccgtccgtc 10465 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 10447 atccgtccgtccgtccgtccgtc 10469
>emb|BX936336.10| Zebrafish DNA sequence from clone CH211-287B5 in linkage group 19, complete sequence Length = 151787 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 109331 atccatccgtccgtccgtccgtc 109353 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 109335 atccgtccgtccgtccgtccgtc 109357 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 109327 atccatccatccgtccgtccgtc 109349
>emb|CR385023.7| Zebrafish DNA sequence from clone CH211-89E5 in linkage group 20, complete sequence Length = 19125 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 3246 atccatccgtccgtccgtccgtc 3224 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 3250 atccatccatccgtccgtccgtc 3228
>emb|AL929003.17| Zebrafish DNA sequence from clone DKEY-235D18 in linkage group 20, complete sequence Length = 175099 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 54698 atccatccgtccgtccgtccgtc 54720 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 54702 atccgtccgtccgtccgtccgtc 54724 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 54694 atccatccatccgtccgtccgtc 54716
>emb|AL929435.16| Zebrafish DNA sequence from clone CH211-153J24 in linkage group 20, complete sequence Length = 181400 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 128459 atccatccgtccgtccgtccgtc 128437 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 128455 atccgtccgtccgtccgtccgtc 128433
>emb|BX247873.15| Zebrafish DNA sequence from clone CH211-198O12 in linkage group 8, complete sequence Length = 139803 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 47093 atccatccgtccgtccgtccgtc 47071 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 111452 tccatccgtccgtccgtcc 111470 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||| ||||||||||||||| Sbjct: 111283 atccatctgtccgtccgtccgtc 111305 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 47097 atccatccatccgtccgtccgtc 47075 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 47089 atccgtccgtccgtccgtccgtc 47067
>emb|BX005202.14| Zebrafish DNA sequence from clone DKEY-224N5 in linkage group 13, complete sequence Length = 220733 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 52694 atccatccgtccgtccgtccgtc 52716 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 51213 atccatccgtccgtccgtcc 51232 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||| ||||||||||| Sbjct: 53636 atccatccgtctgtccgtccgtc 53658 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 52698 atccgtccgtccgtccgtccgtc 52720 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 52690 atccatccatccgtccgtccgtc 52712
>emb|BX004766.9| Zebrafish DNA sequence from clone DKEY-5P1 in linkage group 20, complete sequence Length = 214782 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 120914 atccatccgtccgtccgtccgtc 120892 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 120918 atccatccatccgtccgtccgtc 120896
>emb|BX296546.6| Zebrafish DNA sequence from clone CH211-234P1 in linkage group 4, complete sequence Length = 174235 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 108490 atccatccgtccgtccgtccgtc 108468 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 108486 atccgtccgtccgtccgtccgtc 108464
>emb|BX510640.4| Zebrafish DNA sequence from clone RP71-57J15 in linkage group 19, complete sequence Length = 139917 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 67339 atccatccgtccgtccgtccgtc 67317 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 67343 atccatccatccgtccgtccgtc 67321 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 67335 atccgtccgtccgtccgtccgtc 67313
>emb|BX284688.13| Zebrafish DNA sequence from clone DKEY-71K16 in linkage group 25, complete sequence Length = 236784 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 120656 atccatccgtccgtccgtccgtc 120678 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 120660 atccgtccgtccgtccgtccgtc 120682 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 120652 atccatccatccgtccgtccgtc 120674
>emb|CR392029.12| Zebrafish DNA sequence from clone DKEY-188H10 in linkage group 3, complete sequence Length = 130871 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 113724 atccatccgtccgtccgtccgtc 113746 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 113728 atccgtccgtccgtccgtccgtc 113750 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 113720 atccatccatccgtccgtccgtc 113742
>emb|CR388140.8| Zebrafish DNA sequence from clone CH211-190G11, complete sequence Length = 160541 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 90054 atccatccgtccgtccgtccgtc 90076
>emb|BX005052.6| Zebrafish DNA sequence from clone CH211-42O7 in linkage group 15, complete sequence Length = 177681 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 102654 atccatccgtccgtccgtccgtc 102632 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 102650 atccgtccgtccgtccgtccgtc 102628
>emb|CT025691.7| Zebrafish DNA sequence from clone CH211-206I4 in linkage group 4, complete sequence Length = 68685 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 27647 atccatccgtccgtccgtccgtc 27625 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 27643 atccgtccgtccgtccgtccgtc 27621
>emb|BX936463.13| Zebrafish DNA sequence from clone DKEY-4G17 in linkage group 17, complete sequence Length = 232846 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 21551 atccatccgtccgtccgtccgtc 21529 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 21555 atccatccatccgtccgtccgtc 21533
>emb|CR376776.19| Zebrafish DNA sequence from clone CH211-13I23, complete sequence Length = 179675 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 20521 atccatccgtccgtccgtccgtc 20499 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 20525 atccatccatccgtccgtccgtc 20503
>emb|BX571984.10| Zebrafish DNA sequence from clone DKEY-243I1 in linkage group 15, complete sequence Length = 184696 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 7571 atccatccgtccgtccgtccgtc 7549 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 7575 atccatccatccgtccgtccgtc 7553 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 7567 atccgtccgtccgtccgtccgtc 7545
>gb|AE003820.3| Drosophila melanogaster chromosome 2R, section 30 of 73 of the complete sequence Length = 263912 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 212581 atccatccgtccgtccgtccgtc 212603 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 212577 atccatccatccgtccgtccgtc 212599
>gb|AE003814.3| Drosophila melanogaster chromosome 2R, section 36 of 73 of the complete sequence Length = 254438 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 209193 atccatccgtccgtccgtccgtc 209171 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 209197 atccatccatccgtccgtccgtc 209175
>emb|Z98266.1|HSZ98266 Homo sapiens gene encoding plakophilin (exons 1-13) Length = 49999 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 37342 atccatccgtccgtccgtccgtc 37320 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||||||||| |||| Sbjct: 37398 atccatccgtccgtccgtacgtc 37376 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 37346 atccatccatccgtccgtccgtc 37324 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 37321 tccatccgtccgtccgtcc 37303 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||| ||||||| Sbjct: 37282 atccatccgtccgtctgtccgtc 37260
>emb|BX248100.9| Zebrafish DNA sequence from clone CH211-222O11 in linkage group 7, complete sequence Length = 223489 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 119845 atccatccgtccgtccgtccgtc 119823 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 119841 atccgtccgtccgtccgtccgtc 119819
>emb|AL445595.6|HS594J14 Homo sapiens chromosome 9 BAC RP11-594J14, complete sequence Length = 161567 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 21989 atccatccgtccgtccgtccgtc 22011 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 21993 atccgtccgtccgtccgtccgtc 22015 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 21985 atccatccatccgtccgtccgtc 22007
>emb|AL928691.7| Zebrafish DNA sequence from clone CH211-51H20 in linkage group 14, complete sequence Length = 167320 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 147016 atccatccgtccgtccgtccgtc 146994 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 147020 atccatccatccgtccgtccgtc 146998 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 147012 atccgtccgtccgtccgtccgtc 146990
>emb|AL929284.12| Zebrafish DNA sequence from clone CH211-160H23 in linkage group 15, complete sequence Length = 179458 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 98888 atccatccgtccgtccgtccgtc 98910
>emb|BX005009.11| Zebrafish DNA sequence from clone CH211-15A18 in linkage group 22, complete sequence Length = 186690 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 48131 atccatccgtccgtccgtccgtc 48153 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 48135 atccgtccgtccgtccgtccgtc 48157
>emb|AL929379.14| Zebrafish DNA sequence from clone CH211-156H6, complete sequence Length = 167232 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 131921 atccatccgtccgtccgtccgtc 131899 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 131681 atccatccgtccgtccgtccgtc 131659 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 159819 tccatccgtccgtccgtcc 159837 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 131917 atccgtccgtccgtccgtccgtc 131895 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 131685 atccatccatccgtccgtccgtc 131663 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 130826 atccatccctccgtccgtccgtc 130804
>emb|AL953893.17| Zebrafish DNA sequence from clone DKEY-60B12, complete sequence Length = 216749 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 186026 atccatccgtccgtccgtccgtc 186004 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 186593 atccatccatccgtccgtccgtc 186571
>emb|AL954861.11| Zebrafish DNA sequence from clone CH211-8I17, complete sequence Length = 175026 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 64895 atccatccgtccgtccgtccgtc 64873 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 64891 atccgtccgtccgtccgtccgtc 64869
>emb|AL928828.6| Zebrafish DNA sequence from clone CH211-30I2, complete sequence Length = 169046 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 71606 atccatccgtccgtccgtccgtc 71584
>emb|AL928864.11| Zebrafish DNA sequence from clone CH211-10P21, complete sequence Length = 181508 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 48890 atccatccgtccgtccgtccgtc 48912 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 48894 atccgtccgtccgtccgtccgtc 48916 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 48886 atccatccatccgtccgtccgtc 48908
>emb|AL935202.7| Zebrafish DNA sequence from clone CH211-197E11, complete sequence Length = 189096 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 67490 atccatccgtccgtccgtccgtc 67512 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 93 catccgtccgtccgtccgtc 112 |||||||||||||||||||| Sbjct: 68328 catccgtccgtccgtccgtc 68347 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 67494 atccgtccgtccgtccgtccgtc 67516 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 67486 atccatccatccgtccgtccgtc 67508
>emb|BX004822.12| Zebrafish DNA sequence from clone DKEY-18F18, complete sequence Length = 201902 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 43233 atccatccgtccgtccgtccgtc 43255 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 43229 atccatccatccgtccgtccgtc 43251
>emb|AL974313.6| Zebrafish DNA sequence from clone CH211-281M5, complete sequence Length = 185165 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 127996 atccatccgtccgtccgtccgtc 127974
>emb|AL929568.12| Zebrafish DNA sequence from clone CH211-59K8, complete sequence Length = 185257 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 175956 atccatccgtccgtccgtccgtc 175934 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 175952 atccgtccgtccgtccgtccgtc 175930
>gb|AF015416.1|AF015416 Homo sapiens chromosome 11 from 11p15.5 region, complete sequence Length = 95038 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 40789 atccatccgtccgtccgtccgtc 40767 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 40793 atccatccatccgtccgtccgtc 40771 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 40785 atccgtccgtccgtccgtccgtc 40763
>emb|CR855327.11| Zebrafish DNA sequence from clone DKEY-84C11 in linkage group 1, complete sequence Length = 183806 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 77967 atccatccgtccgtccgtccgtc 77989 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 77971 atccgtccgtccgtccgtccgtc 77993 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 77963 atccatccatccgtccgtccgtc 77985
>emb|BX511188.7| Zebrafish DNA sequence from clone DKEY-184A17 in linkage group 13, complete sequence Length = 233525 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 162018 atccatccgtccgtccgtccgtc 161996 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 162022 atccatccatccgtccgtccgtc 162000 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 162014 atccgtccgtccgtccgtccgtc 161992
>gb|AC091681.44| Mus musculus strain C57BL/6J chromosome 10 clone rp23-111d4, complete sequence Length = 194809 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 14160 atccatccgtccgtccgtccgtc 14138 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 14156 atccgtccgtccgtccgtccgtc 14134
>gb|AC158942.7| Mus musculus chromosome 5, clone RP23-240A11, complete sequence Length = 194039 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 45815 atccatccgtccgtccgtccgtc 45793 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 45819 atccatccatccgtccgtccgtc 45797
>emb|AL591584.14| Mouse DNA sequence from clone RP23-335N12 on chromosome 2, complete sequence Length = 177754 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 150590 atccatccgtccgtccgtccgtc 150612 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 150594 atccgtccgtccgtccgtccgtc 150616 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 150586 atccatccatccgtccgtccgtc 150608
>emb|AL844551.3| Mouse DNA sequence from clone RP23-117M21 on chromosome 2, complete sequence Length = 172378 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 7253 atccatccgtccgtccgtccgtc 7275 Score = 40.1 bits (20), Expect = 2.4 Identities = 29/32 (90%) Strand = Plus / Plus Query: 81 tctcgatcgatccatccgtccgtccgtccgtc 112 |||| ||| |||| |||||||||||||||||| Sbjct: 7248 tctccatccatccgtccgtccgtccgtccgtc 7279
>emb|AL645625.15| Mouse DNA sequence from clone RP23-183L1 on chromosome 4, complete sequence Length = 226754 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 204311 atccatccgtccgtccgtccgtc 204333 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 204307 atccatccatccgtccgtccgtc 204329
>emb|AL606967.14| Mouse DNA sequence from clone RP23-304D5 on chromosome 4, complete sequence Length = 188425 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 134457 atccatccgtccgtccgtccgtc 134435 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 134125 atccatccgtccgtccgtccgtc 134103 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 134321 atccatccgtccgtccgtcc 134302 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 134461 atccatccatccgtccgtccgtc 134439 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 134453 atccgtccgtccgtccgtccgtc 134431 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 134325 atccatccatccgtccgtccgtc 134303
>gb|J04035.1|RATTRE Rat tropoelastin mRNA, 3' end Length = 1211 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 928 atccatccgtccgtccgtccgtc 950 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 924 atccatccatccgtccgtccgtc 946
>gb|J02903.1|RATLOX Rat aorta lysyl oxidase mRNA, complete cds Length = 2678 Score = 46.1 bits (23), Expect = 0.038 Identities = 23/23 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||||||||||||||||||| Sbjct: 2481 atccatccgtccgtccgtccgtc 2503 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||| |||||||||||||| Sbjct: 2477 atccatccatccgtccgtccgtc 2499
>gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome 5, complete sequence Length = 188517 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 66555 tccatccgtccgtccgtccgtc 66576 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 66558 atccgtccgtccgtccgtccgtc 66580
>emb|AL954324.10| Zebrafish DNA sequence from clone DKEY-35P13 in linkage group 17, complete sequence Length = 69320 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 6049 tccatccgtccgtccgtccgtc 6070
>emb|CR450806.9| Zebrafish DNA sequence from clone DKEY-110O13 in linkage group 24, complete sequence Length = 217292 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 213959 tccatccgtccgtccgtccgtc 213980 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 213962 atccgtccgtccgtccgtccgtc 213984
>emb|CR762485.16| Zebrafish DNA sequence from clone DKEY-269K12 in linkage group 19, complete sequence Length = 171225 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 75003 tccatccgtccgtccgtccgtc 74982 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 75000 atccgtccgtccgtccgtccgtc 74978
>emb|CR933522.11| Zebrafish DNA sequence from clone CH211-22N13 in linkage group 1, complete sequence Length = 121726 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 103554 tccatccgtccgtccgtccgtc 103575
>emb|CR788308.9| Zebrafish DNA sequence from clone DKEY-192K19 in linkage group 3, complete sequence Length = 193615 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 12432 tccatccgtccgtccgtccgtc 12411 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 94 atccgtccgtccgtccgtc 112 ||||||||||||||||||| Sbjct: 12001 atccgtccgtccgtccgtc 11983 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 12001 atccgtccgtccgtccgtccgtc 11979
>emb|BX571802.15| Zebrafish DNA sequence from clone CH211-197A16 in linkage group 10, complete sequence Length = 196999 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 19444 tccatccgtccgtccgtccgtc 19465 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 19447 atccgtccgtccgtccgtccgtc 19469
>emb|CR376756.10| Zebrafish DNA sequence from clone CH211-87A15 in linkage group 23, complete sequence Length = 203373 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 136769 tccatccgtccgtccgtccgtc 136748 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 136766 atccgtccgtccgtccgtccgtc 136744
>emb|CR762488.16| Zebrafish DNA sequence from clone DKEY-266J7 in linkage group 18, complete sequence Length = 154489 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 153768 tccatccgtccgtccgtccgtc 153747 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 153765 atccgtccgtccgtccgtccgtc 153743 Score = 38.2 bits (19), Expect = 9.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtcc 109 ||||||||||||||||||| Sbjct: 41373 tccatccgtccgtccgtcc 41391
>gb|AC115750.9| Mus musculus chromosome 10, clone RP23-16F5, complete sequence Length = 228071 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 171608 tccatccgtccgtccgtccgtc 171587 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 171605 atccgtccgtccgtccgtccgtc 171583
>emb|BX511036.18| Zebrafish DNA sequence from clone DKEY-279D7 in linkage group 6, complete sequence Length = 164653 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 114774 tccatccgtccgtccgtccgtc 114753 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 ||||||| ||||||||||||||| Sbjct: 85209 atccatcagtccgtccgtccgtc 85187
>emb|AL031847.17|HS120G22 Human DNA sequence from clone RP1-120G22 on chromosome 1p36.21-36.33 Contains the 5' end of the CHD5 gene for chromodomain helicase DNA binding protein 5, the RPL22 gene for ribosomal protein L22, eight novel genes, the ICMT gene for isoprenylcysteine carboxyl methyltransferase, possible ortholog of rodent transcription factor HES-3, the 3' end of the gene for brain acyl-CoA hydrolase (BACH) and seven CpG islands, complete sequence Length = 166518 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 159373 tccatccgtccgtccgtccgtc 159394 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 134136 atccatccgtccgtccgtcc 134155 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 159376 atccgtccgtccgtccgtccgtc 159398
>emb|AJ250231.1|FRU250231 Fugu rubripes cdkn2A/B gene for p13 and partial mtap gene for methylthioadenosine phosphorylase Length = 8319 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 6915 tccatccgtccgtccgtccgtc 6936 Score = 42.1 bits (21), Expect = 0.60 Identities = 24/25 (96%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtcgc 114 |||| |||||||||||||||||||| Sbjct: 6918 atccgtccgtccgtccgtccgtcgc 6942
>emb|CR790377.18| Zebrafish DNA sequence from clone CH211-260M3 in linkage group 3, complete sequence Length = 147590 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 94576 tccatccgtccgtccgtccgtc 94597 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 94579 atccgtccgtccgtccgtccgtc 94601
>emb|CR376765.12| Zebrafish DNA sequence from clone DKEY-208L2 in linkage group 13, complete sequence Length = 134448 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 100701 tccatccgtccgtccgtccgtc 100680 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 100698 atccgtccgtccgtccgtccgtc 100676
>emb|CR391966.8| Zebrafish DNA sequence from clone CH211-269M15 in linkage group 8, complete sequence Length = 105854 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 41776 tccatccgtccgtccgtccgtc 41797 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 41779 atccgtccgtccgtccgtccgtc 41801
>emb|BX936305.18| Zebrafish DNA sequence from clone CH211-51N3 in linkage group 13, complete sequence Length = 150383 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 24726 tccatccgtccgtccgtccgtc 24747 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 24570 tccatccgtccgtccgtccgtc 24591 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 24729 atccgtccgtccgtccgtccgtc 24751 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 24573 atccgtccgtccgtccgtccgtc 24595
>emb|BX088597.18| Zebrafish DNA sequence from clone DKEY-171P23 in linkage group 5, complete sequence Length = 172098 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 142704 tccatccgtccgtccgtccgtc 142725 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 142707 atccgtccgtccgtccgtccgtc 142729 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 90 atccatccgtccgtccgtccgtc 112 |||||||||||| |||||||||| Sbjct: 142695 atccatccgtccatccgtccgtc 142717
>emb|CR847800.4| Zebrafish DNA sequence from clone DKEY-182M5 in linkage group 14, complete sequence Length = 187193 Score = 44.1 bits (22), Expect = 0.15 Identities = 22/22 (100%) Strand = Plus / Minus Query: 91 tccatccgtccgtccgtccgtc 112 |||||||||||||||||||||| Sbjct: 83655 tccatccgtccgtccgtccgtc 83634 Score = 40.1 bits (20), Expect = 2.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtcc 109 |||||||||||||||||||| Sbjct: 83672 atccatccgtccgtccgtcc 83653 Score = 38.2 bits (19), Expect = 9.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 atccatccgtccgtccgtccgtc 112 |||| |||||||||||||||||| Sbjct: 83652 atccgtccgtccgtccgtccgtc 83630 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,260,102 Number of Sequences: 3902068 Number of extensions: 1260102 Number of successful extensions: 107409 Number of sequences better than 10.0: 812 Number of HSP's better than 10.0 without gapping: 817 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 98764 Number of HSP's gapped (non-prelim): 7928 length of query: 189 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 167 effective length of database: 17,147,199,772 effective search space: 2863582361924 effective search space used: 2863582361924 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
