ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet73e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 569 e-159
2emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 287 2e-74
3gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 250 4e-63
4gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 238 1e-59
5emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 218 1e-53
6emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 172 7e-40
7emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 170 3e-39
8emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 170 3e-39
9emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 168 1e-38
10ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 167 4e-38
11gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 167 4e-38
12dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
13dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
14dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
15dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
16dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
17dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
18gb|AY109324.1| Zea mays CL187_1 mRNA sequence 163 6e-37
19ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 159 1e-35
20dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
21dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
22dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
23dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 159 1e-35
24dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
25dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
26dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
27dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
28dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
29dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 1e-35
30gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 159 1e-35
31emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 155 2e-34
32emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 153 6e-34
33dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 151 2e-33
34dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 151 2e-33
35gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 145 2e-31
36emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 137 4e-29
37gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 137 4e-29
38emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 133 6e-28
39dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 133 6e-28
40dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 131 2e-27
41emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 129 9e-27
42emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 129 9e-27
43emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 129 9e-27
44gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl... 127 4e-26
45gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 123 6e-25
46emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 123 6e-25
47gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p... 123 6e-25
48gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p... 123 6e-25
49gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p... 123 6e-25
50gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 123 6e-25
51dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g... 123 6e-25
52emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 121 2e-24
53emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 119 9e-24
54gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 119 9e-24
55gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b... 117 3e-23
56gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p... 115 1e-22
57gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 113 5e-22
58emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 113 5e-22
59gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p... 111 2e-21
60dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 109 8e-21
61gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 107 3e-20
62dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv... 107 3e-20
63gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 105 1e-19
64gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 105 1e-19
65dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 105 1e-19
66emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 105 1e-19
67gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 103 5e-19
68dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 101 2e-18
69gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca... 100 8e-18
70gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 100 8e-18
71emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr... 100 8e-18
72gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p... 100 8e-18
73gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p... 100 8e-18
74gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 98 3e-17
75emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 98 3e-17
76emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 98 3e-17
77emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin... 98 3e-17
78emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 98 3e-17
79gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll... 98 3e-17
80gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-... 98 3e-17
81gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 98 3e-17
82dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv... 98 3e-17
83dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone... 96 1e-16
84ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 94 5e-16
85gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 94 5e-16
86gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 94 5e-16
87gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 94 5e-16
88gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 94 5e-16
89gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 94 5e-16
90gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 94 5e-16
91gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 94 5e-16
92gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 94 5e-16
93emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 94 5e-16
94gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 94 5e-16
95gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 94 5e-16
96emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ... 94 5e-16
97gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin... 92 2e-15
98gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 92 2e-15
99gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 92 2e-15
100dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 92 2e-15
101ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 90 8e-15
102gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 90 8e-15
103gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 90 8e-15
104gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 90 8e-15
105gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 90 8e-15
106emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 90 8e-15
107gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence 88 3e-14
108gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 88 3e-14
109gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec... 88 3e-14
110emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c... 88 3e-14
111emb|X16535.1|GMCAB4 G.max DNA for Cab4 88 3e-14
112emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 ... 88 3e-14
113gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 88 3e-14
114dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 88 3e-14
115gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/... 86 1e-13
116emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/... 86 1e-13
117emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind... 86 1e-13
118emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 86 1e-13
119emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/... 86 1e-13
120gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 86 1e-13
121emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW... 84 5e-13
122gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 82 2e-12
123gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 82 2e-12
124emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret... 82 2e-12
125gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 82 2e-12
126emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 82 2e-12
127gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy... 82 2e-12
128gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 82 2e-12
129dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 82 2e-12
130gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 80 7e-12
131gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein... 80 7e-12
132emb|X16536.1|GMCAB5 G.max DNA for Cab5 80 7e-12
133emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 80 7e-12
134gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 80 7e-12
135gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 80 7e-12
136emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t... 80 7e-12
137gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ... 80 7e-12
138gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li... 80 7e-12
139emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin... 78 3e-11
140emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA 78 3e-11
141emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 78 3e-11
142gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting... 78 3e-11
143gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 76 1e-10
144gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ... 76 1e-10
145emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
146emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 76 1e-10
147gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 76 1e-10
148ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 74 5e-10
149gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 74 5e-10
150gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 74 5e-10
151gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 74 5e-10
152gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 74 5e-10
153gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 74 5e-10
154emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
155emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co... 74 5e-10
156gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 74 5e-10
157gb|M64619.1|PEACAB66 Pea cab gene, complete cds 74 5e-10
158emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p... 72 2e-09
159gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ... 72 2e-09
160ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 70 7e-09
161ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 70 7e-09
162ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 70 7e-09
163ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 70 7e-09
164gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 70 7e-09
165gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 70 7e-09
166gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 70 7e-09
167gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 70 7e-09
168gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 70 7e-09
169gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 70 7e-09
170gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 70 7e-09
171gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 70 7e-09
172gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 70 7e-09
173gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 70 7e-09
174gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 70 7e-09
175emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
176emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 70 7e-09
177emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 70 7e-09
178gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 70 7e-09
179gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 68 3e-08
180gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 68 3e-08
181gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA 68 3e-08
182dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 68 3e-08
183dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 68 3e-08
184dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 68 3e-08
185dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 68 3e-08
186gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 66 1e-07
187emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co... 66 1e-07
188gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 66 1e-07
189gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein... 66 1e-07
190gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 66 1e-07
191gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 66 1e-07
192emb|X61915.1|PTCABP P.thunbergii cab gene 64 4e-07
193emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 64 4e-07
194emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll... 64 4e-07
195gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 62 2e-06
196gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 62 2e-06
197emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
198emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 62 2e-06
199emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi... 62 2e-06
200gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 60 7e-06
201emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 60 7e-06
202gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c... 60 7e-06
203gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 60 7e-06
204gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end 60 7e-06
205dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 3e-05
206gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 58 3e-05
207gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl... 58 3e-05
208dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 58 3e-05
209gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 56 1e-04
210gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 56 1e-04
211gb|L07120.1|COTIIABINB Gossypium hirsutum chloroplast photosyste... 56 1e-04
212dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 56 1e-04
213ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH... 54 4e-04
214ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA... 54 4e-04
215gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 54 4e-04
216gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 54 4e-04
217gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl... 54 4e-04
218gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN... 54 4e-04
219emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
220emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co... 54 4e-04
221gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (... 54 4e-04
222dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 54 4e-04
223emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl... 54 4e-04
224gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll... 54 4e-04
225dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 54 4e-04
226ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 52 0.002
227gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 52 0.002
228gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 52 0.002
229gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 52 0.002
230gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 52 0.002
231gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 52 0.002
232gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 52 0.002
233gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 52 0.002
234gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 52 0.002
235emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 52 0.002
236emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 52 0.002
237ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.007
238ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
239ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
240ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
241ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
242ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
243ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
244ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 50 0.007
245gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 50 0.007
246dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
247gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 50 0.007
248dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
249dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
250dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
251dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
252emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 50 0.007
253dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
254dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
255dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
256dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
257dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
258dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
259dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
260gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot... 50 0.007
261dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro... 50 0.007
262gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote... 48 0.026
263gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein... 48 0.026
264gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c... 48 0.026
265emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 48 0.026
266emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl... 48 0.026
267gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 48 0.026
268gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 48 0.026
269dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 48 0.026
270gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 46 0.10
271gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.10
272emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl... 46 0.10
273gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 46 0.10
274dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
275emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy... 46 0.10
276emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro... 46 0.10
277gb|AF207690.1|AF207690 Daucus carota cultivar Kurodagosun chloro... 46 0.10
278gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 46 0.10
279dbj|AB050126.1| Amaranthus tricolor cab3 mRNA for type III chlor... 46 0.10
280gb|AY845255.1| Pisum sativum light-harvesting chlorophyll-a/b bi... 44 0.41
281gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 44 0.41
282gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 44 0.41
283dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.41
284gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 44 0.41
285gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 42 1.6
286gb|DQ226734.1| Boechera divaricarpa isolate SLW-A-E08 mRNA sequence 42 1.6
287gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence 42 1.6
288gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 42 1.6
289gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor... 42 1.6
290emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 42 1.6
291emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III 42 1.6
292emb|AL603787.8| Mouse DNA sequence from clone RP23-169J19 on chr... 42 1.6
293gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 42 1.6
294ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 40 6.4
295ref|XM_415389.1| PREDICTED: Gallus gallus similar to crumbs homo... 40 6.4
296ref|NM_009810.1| Mus musculus caspase 3 (Casp3), mRNA 40 6.4
297emb|BX908777.15| Zebrafish DNA sequence from clone CH211-133H13 ... 40 6.4
298gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome... 40 6.4
299gb|AC121903.2| Mus musculus BAC clone RP24-174G24 from 18, compl... 40 6.4
300gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 6.4
301gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosom... 40 6.4
302gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 40 6.4
303gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 40 6.4
304dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
305gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 40 6.4
306dbj|AP004777.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
307dbj|AP004772.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.4
308dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 6.4
309emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 40 6.4
310gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 40 6.4
311gb|U19522.1|MMU19522 Mus musculus cysteine protease CPP32 (cpp32... 40 6.4
312gb|U49929.1|MMU49929 Mus musculus ICE-like cysteine protease (Li... 40 6.4
313gb|AC148012.5| Mus musculus BAC clone RP23-174D18 from 18, compl... 40 6.4
314dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 40 6.4

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  569 bits (287), Expect = e-159
 Identities = 356/379 (93%)
 Strand = Plus / Plus

                                                                       
Query: 57  ttccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtga 116
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5   ttccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtga 64

                                                                       
Query: 117 agaacgtaccatctttggctctctttggcgaggcccgagtcaccatgcgcaagaccgcag 176
           |||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
Sbjct: 65  agaatgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagaccgcag 124

                                                                       
Query: 177 caaaggcaaagcaggtttgctccggtagcccatggtacggtgctgaccgtgtgctctacc 236
           |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||
Sbjct: 125 caaaggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctctacc 184

                                                                       
Query: 237 ttggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatg 296
           | |||||||||||||||||||| ||||||||||| || || |||||||||||||||||||
Sbjct: 185 tcggcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgactatg 244

                                                                       
Query: 297 gttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctgg 356
           | ||||||||||| |||||||| ||||| || ||||||||| ||||||||||||||||||
Sbjct: 245 ggtgggacactgctggactttcggctgacccggagaccttctccaagaaccgggagctgg 304

                                                                       
Query: 357 aggtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttgc 416
           |||||||||| || || ||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 305 aggtgatccactgtcgctgggccatgcttggggcacttggttgtgtcttccctgagttgc 364

                              
Query: 417 tcgcccgcaatggcctcaa 435
           |||||||||| ||| ||||
Sbjct: 365 tcgcccgcaacggcgtcaa 383



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  287 bits (145), Expect = 2e-74
 Identities = 316/373 (84%)
 Strand = Plus / Plus

                                                                       
Query: 58  tccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtgaa 117
           ||||||||||||  ||||||||| ||||||||| ||||| || ||||| |||||||||||
Sbjct: 15  tccaatggcggccaccaccatgtacctctcctcatcgacattcgccggaaaggcggtgaa 74

                                                                       
Query: 118 gaacgtaccatctttggctctctttggcgaggcccgagtcaccatgcgcaagaccgcagc 177
           ||| || ||||  | ||||||||| || ||||| || |||||||||||||||||||| ||
Sbjct: 75  gaatgtcccattatcggctctcttcggtgaggctcgcgtcaccatgcgcaagaccgcggc 134

                                                                       
Query: 178 aaaggcaaagcaggtttgctccggtagcccatggtacggtgctgaccgtgtgctctacct 237
            || || ||||| |||| |||| | |||||||||||||| ||||| ||||||||||||||
Sbjct: 135 gaaagctaagcaagtttcctccagcagcccatggtacggagctgatcgtgtgctctacct 194

                                                                       
Query: 238 tggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatgg 297
            |||||||||||  | |||||||| ||||||||||| || || ||||| || ||||| ||
Sbjct: 195 cggcccactctctcgcgagcccccaagctacctcaccggtgatttccccggtgactacgg 254

                                                                       
Query: 298 ttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctgga 357
            |||||||| || ||||| || ||||| || ||||||||| | |||||||| ||| ||||
Sbjct: 255 gtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccgcgagttgga 314

                                                                       
Query: 358 ggtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttgct 417
           |||||| || ||||| ||||||||||| || ||||| ||||| || ||||||||||||||
Sbjct: 315 ggtgatacactgccgctgggctatgcttggtgcactgggttgcgtgttccctgagttgct 374

                        
Query: 418 cgcccgcaatggc 430
            ||||||||||||
Sbjct: 375 tgcccgcaatggc 387



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  250 bits (126), Expect = 4e-63
 Identities = 309/370 (83%)
 Strand = Plus / Plus

                                                                       
Query: 60  caatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcggtgaaga 119
           ||||||||||  |||||||||| || ||||| ||| |||| ||||||||||| || ||||
Sbjct: 199 caatggcggccaccaccatgtctctttcctcttcgtccttcgccggcaaggccgtcaaga 258

                                                                       
Query: 120 acgtaccatctttggctctctttggcgaggcccgagtcaccatgcgcaagaccgcagcaa 179
           || | || || | ||||||| |||| || || || || | |||||||||||| || || |
Sbjct: 259 acttgccctcgtcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcga 318

                                                                       
Query: 180 aggcaaagcaggtttgctccggtagcccatggtacggtgctgaccgtgtgctctaccttg 239
           |||| || || ||||  ||  | ||||| ||||||||  ||||||||||||||||||| |
Sbjct: 319 aggccaaacaagtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcg 378

                                                                       
Query: 240 gcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggtt 299
           |||| || ||||| |||||||| |||||| | ||||| |||||||| || |||||||| |
Sbjct: 379 gcccgctttccggcgagccccccagctacttgactggtgagttccccggtgactatgggt 438

                                                                       
Query: 300 gggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggagg 359
           ||||||| ||||| || || ||||| |||||||||||| |||||||||||||||| ||||
Sbjct: 439 gggacaccgccgggctctcggctgaccctgagaccttcgccaagaaccgggagctcgagg 498

                                                                       
Query: 360 tgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttgctcg 419
           ||||||| ||||| ||||| |||||||| || |||||||||||||| || |||||||| |
Sbjct: 499 tgatccactgccgatgggccatgctcggtgcgcttggttgtgtctttcccgagttgcttg 558

                     
Query: 420 cccgcaatgg 429
           ||||||||||
Sbjct: 559 cccgcaatgg 568



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  238 bits (120), Expect = 1e-59
 Identities = 303/364 (83%)
 Strand = Plus / Plus

                                                                       
Query: 83  ctctcctcctcgacctttgccggcaaggcggtgaagaacgtaccatctttggctctcttt 142
           |||||| ||||| |||| ||||| |||||||| ||| || | || || | ||| ||||| 
Sbjct: 85  ctctccccctcgtccttcgccgggaaggcggtcaaggacctgccgtcgtcggcgctcttc 144

                                                                       
Query: 143 ggcgaggcccgagtcaccatgcgcaagaccgcagcaaaggcaaagcaggtttgctccggt 202
           || ||||| || |||||||||||||||||||| || ||||| |||| ||| |  ||||| 
Sbjct: 145 ggggaggcgcgcgtcaccatgcgcaagaccgcggccaaggccaagccggtgtcgtccggc 204

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| ||||||||  | ||||| ||||||||||| ||||| |||||||| || ||||||
Sbjct: 205 agcccgtggtacgggtccgaccgcgtgctctacctcggcccgctctccggcgaccccccg 264

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 265 agctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctgtcggcc 324

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||||||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 325 gaccccgagaccttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 384

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| ||||||||||||| ||| |||| ||||| 
Sbjct: 385 ctgggcgcgctcggctgcgtcttccccgagctgctcgcccgcaacggcgtcaagttcggc 444

               
Query: 443 gagg 446
           ||||
Sbjct: 445 gagg 448



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  218 bits (110), Expect = 1e-53
 Identities = 296/358 (82%)
 Strand = Plus / Plus

                                                                       
Query: 72  ccaccatgtccctctcctcctcgacctttgccggcaaggcggtgaagaacgtaccatctt 131
           |||||||||| |  ||||| ||| |||| ||||||||||| || |||||| | || || |
Sbjct: 6   ccaccatgtctcgttcctcttcgtccttcgccggcaaggccgtcaagaacttgccctcgt 65

                                                                       
Query: 132 tggctctctttggcgaggcccgagtcaccatgcgcaagaccgcagcaaaggcaaagcagg 191
            ||||||| |||| || || || || | |||||||||||| || || ||||| || || |
Sbjct: 66  cggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcgaaggccaaacaag 125

                                                                       
Query: 192 tttgctccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccg 251
           |||  ||  | ||||| ||||||||  ||||||||||||||||||| ||| | || ||||
Sbjct: 126 tttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcggctcgctttccg 185

                                                                       
Query: 252 gtgagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgccg 311
           | || ||||| |||||| | ||||| |||||||| || |||||||| |||||||| ||||
Sbjct: 186 gcgaaccccccagctacttgactggtgagttccccggtgactatgggtgggacaccgccg 245

                                                                       
Query: 312 gactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgcc 371
           | || || ||||| |||||||||||| |||||||||||||||| ||||||||||| ||||
Sbjct: 246 ggctctcggctgaccctgagaccttcgccaagaaccgggagctcgaggtgatccactgcc 305

                                                                     
Query: 372 gttgggctatgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatgg 429
           | ||||| |||||||| || |||||||||||||| || |||||||| |||||||||||
Sbjct: 306 gatgggccatgctcggtgcgcttggttgtgtctttcccgagttgcttgcccgcaatgg 363



to top

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  172 bits (87), Expect = 7e-40
 Identities = 207/247 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||||||| ||||||||||    ||| | |||||| ||||||||||  ||
Sbjct: 372 ggtagcccatggtacggtcctgaccgtgtcaagtacttgggcccattctccggtgaagcc 431

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           || |||||| | || || ||||||||||| ||||||||||||||||| || | |||||||
Sbjct: 432 ccaagctacttgaccggtgagttccctggtgactatggttgggacaccgctgaactttca 491

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| || || ||| |||||||||| ||| ||||||||||||| ||| | ||||| 
Sbjct: 492 gctgatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggcc 551

                                                                       
Query: 380 atgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttc 439
           ||||| || || ||||||||||||||||||||  | || ||||| |||||  |||| |||
Sbjct: 552 atgcttggagctcttggttgtgtcttccctgaactccttgcccgtaatggtgtcaagttc 611

                  
Query: 440 ggtgagg 446
           |||||||
Sbjct: 612 ggtgagg 618



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  170 bits (86), Expect = 3e-39
 Identities = 209/250 (83%)
 Strand = Plus / Plus

                                                                        
Query: 197  tccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgag 256
            ||||| ||||| ||||||||  | ||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 257  cccccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactt 316
            || ||||||||||| || ||||||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 317  tcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgg 376
            || || || || ||||| ||| |||||||||||||||||||||||||||| | ||| |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                                                                        
Query: 377  gctatgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaac 436
            || ||||| || || || ||||| |||||||| ||| ||||||||||||| ||| |||| 
Sbjct: 1325 gccatgctgggcgcgctcggttgcgtcttcccggagctgctcgcccgcaacggcgtcaag 1384

                      
Query: 437  ttcggtgagg 446
            ||||| ||||
Sbjct: 1385 ttcggcgagg 1394



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 73   caccatgtccctctcctcctcgacctttgccggcaaggcggtgaa 117
            ||||||| ||||||||||| || |||| ||||||||||| |||||
Sbjct: 1024 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 1068



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  170 bits (86), Expect = 3e-39
 Identities = 209/250 (83%)
 Strand = Plus / Plus

                                                                       
Query: 197 tccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgag 256
           ||||| ||||| ||||||||  | ||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256

                                                                       
Query: 257 cccccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactt 316
           || ||||||||||| || ||||||||||| |||||||| || |||||||| || || || 
Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316

                                                                       
Query: 317 tcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgg 376
           || || || || ||||| ||| |||||||||||||||||||||||||||| ||||| |||
Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376

                                                                       
Query: 377 gctatgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaac 436
           || ||||| || || || ||||| |||||||| ||| | ||||||||||| ||| |||| 
Sbjct: 377 gccatgctgggcgcgctcggttgcgtcttcccggagcttctcgcccgcaacggcgtcaag 436

                     
Query: 437 ttcggtgagg 446
           ||||| ||||
Sbjct: 437 ttcggcgagg 446



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 73  caccatgtccctctcctcctcgacctttgccggcaaggcggtgaa 117
           ||||||| ||||||||||| || |||| ||||||||||| |||||
Sbjct: 76  caccatggccctctcctccacggccttcgccggcaaggccgtgaa 120



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  168 bits (85), Expect = 1e-38
 Identities = 258/315 (81%), Gaps = 3/315 (0%)
 Strand = Plus / Plus

                                                                       
Query: 135 ctctctttggcgaggcccgagtcaccatgcgcaagaccgcagcaaaggcaaagcaggttt 194
           ||||||| ||||||||||| || || ||||||||||| || || |||||||||| ||   
Sbjct: 80  ctctcttcggcgaggcccgcgtgacgatgcgcaagacggcggcgaaggcaaagccggcgg 139

                                                                       
Query: 195 ---gctccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccg 251
              ||||||| ||||| ||||||||  | ||||| ||||||||||| |||||||| ||||
Sbjct: 140 cgagctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccg 199

                                                                       
Query: 252 gtgagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgccg 311
           | ||||||||||||||||| || ||||||||||| |||||||| || |||||||| || |
Sbjct: 200 gcgagcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcgg 259

                                                                       
Query: 312 gactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgcc 371
           | || || || || || ||||| ||| |||||||||||||||||||||| ||||| | ||
Sbjct: 260 ggctgtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatccactccc 319

                                                                       
Query: 372 gttgggctatgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcc 431
           | ||||| ||||| || ||  | || || || ||||| ||| ||||||||||||| ||| 
Sbjct: 320 gctgggccatgctgggcgcgttgggctgcgtgttcccggagctgctcgcccgcaacggcg 379

                          
Query: 432 tcaacttcggtgagg 446
           |||| ||||| ||||
Sbjct: 380 tcaagttcggcgagg 394



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318

                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || || |||||||| ||| | |||||||||||
Sbjct: 319 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 362



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Minus

                                                                         
Query: 203   agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
             ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476

                                                                         
Query: 263   agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
               ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416

                                                                         
Query: 323   gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
             || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356

                                                         
Query: 383   ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
             || || || || || || |||||||| ||| | |||||||||||
Sbjct: 14355 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 14312



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                            
Query: 203      agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
                ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535

                                                                            
Query: 263      agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
                  ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595

                                                                            
Query: 323      gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
                || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655

                                                            
Query: 383      ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
                || || || || || || |||||||| ||| | |||||||||||
Sbjct: 30024656 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 30024699



 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                            
Query: 203      agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
                ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729

                                                                            
Query: 263      agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
                |||||||| || ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789

                                                                            
Query: 323      gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
                || || ||||| ||| |||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 23603849

                                                                            
Query: 383      ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
                ||||| || || || || || ||||| ||| | ||||||||||| ||| |||| ||||| 
Sbjct: 23603850 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 23603909

                    
Query: 443      gagg 446
                ||||
Sbjct: 23603910 gagg 23603913



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                         
Query: 203   agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
             ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525

                                                                         
Query: 263   agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
               ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585

                                                                         
Query: 323   gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
             || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645

                                                         
Query: 383   ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
             || || || || || || |||||||| ||| | |||||||||||
Sbjct: 20646 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 20689



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || || |||||||| ||| | |||||||||||
Sbjct: 400 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 443



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || || |||||||| ||| | |||||||||||
Sbjct: 400 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 443



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || || |||||||| ||| | |||||||||||
Sbjct: 402 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 445



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  167 bits (84), Expect = 4e-38
 Identities = 189/224 (84%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||| ||||||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || || |||||||| ||| | |||||||||||
Sbjct: 402 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 445



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  163 bits (82), Expect = 6e-37
 Identities = 208/250 (83%)
 Strand = Plus / Plus

                                                                        
Query: 197  tccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgag 256
            ||||| ||||| ||||||||  | ||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 257  cccccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactt 316
            || ||||||||||| || ||||||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 317  tcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgg 376
            || || || || ||||| ||| |||||||||||||||||||||||||||| | ||| |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                                                                        
Query: 377  gctatgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaac 436
            || ||||| || || || || || |||||||| ||| ||||||||||||| ||| |||| 
Sbjct: 1325 gccatgctgggcgcgctcggctgcgtcttcccggagctgctcgcccgcaacggcgtcaag 1384

                      
Query: 437  ttcggtgagg 446
            ||||| ||||
Sbjct: 1385 ttcggcgagg 1394



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 73   caccatgtccctctcctcctcgacctttgccggcaaggcggtgaa 117
            ||||||| ||||||||||| || |||| ||||||||||| |||||
Sbjct: 1024 caccatggccctctcctccacggccttcgccggcaaggccgtgaa 1068



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 306

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           ||||| || || || || || ||||| ||| | ||||||||||| ||| |||| ||||| 
Sbjct: 307 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 366

               
Query: 443 gagg 446
           ||||
Sbjct: 367 gagg 370



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                            
Query: 203      agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
                ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182

                                                                            
Query: 263      agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
                ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242

                                                                            
Query: 323      gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
                || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 10793302

                                                                            
Query: 383      ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
                || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 10793303 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 10793362

                    
Query: 443      gagg 446
                ||||
Sbjct: 10793363 gagg 10793366



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 137      ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
                ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 10793054 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 10793091



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                         
Query: 203   agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
             ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905

                                                                         
Query: 263   agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965

                                                                         
Query: 323   gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
             || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 17025

                                                                         
Query: 383   ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
             || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 17026 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 17085

                 
Query: 443   gagg 446
             ||||
Sbjct: 17086 gagg 17089



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 137   ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
             ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 16777 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 16814



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                         
Query: 203   agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
             ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428

                                                                         
Query: 263   agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             |||||||| || ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488

                                                                         
Query: 323   gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
             || || ||||| ||| |||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 66548

                                                                         
Query: 383   ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
             ||||| || || || || || ||||| ||| | ||||||||||| ||| |||| ||||| 
Sbjct: 66549 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 66608

                 
Query: 443   gagg 446
             ||||
Sbjct: 66609 gagg 66612



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                          
Query: 203    agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
              ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800

                                                                          
Query: 263    agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860

                                                                          
Query: 323    gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
              || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 129920

                                                                          
Query: 383    ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
              || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 129921 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 129980

                  
Query: 443    gagg 446
              ||||
Sbjct: 129981 gagg 129984



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 137    ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
              ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 129672 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 129709



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 377

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           ||||| || || || || || ||||| ||| | ||||||||||| ||| |||| ||||| 
Sbjct: 378 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 437

               
Query: 443 gagg 446
           ||||
Sbjct: 438 gagg 441



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 376

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           ||||| || || || || || ||||| ||| | ||||||||||| ||| |||| ||||| 
Sbjct: 377 ctcggcgcgctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttcggc 436

               
Query: 443 gagg 446
           ||||
Sbjct: 437 gagg 440



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 370

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 371 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 430

               
Query: 443 gagg 446
           ||||
Sbjct: 431 gagg 434



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 122 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 159



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 376 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 435

               
Query: 443 gagg 446
           ||||
Sbjct: 436 gagg 439



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 127 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 164



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 377

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 378 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 437

               
Query: 443 gagg 446
           ||||
Sbjct: 438 gagg 441



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 129 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 166



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  159 bits (80), Expect = 1e-35
 Identities = 203/244 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 376 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 435

               
Query: 443 gagg 446
           ||||
Sbjct: 436 gagg 439



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 127 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 164



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  159 bits (80), Expect = 1e-35
 Identities = 188/224 (83%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| ||||||||||| ||||| |||||||| ||||| |||
Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             ||||||||| ||||||||| | |||||||| || |||||||| ||||| || || || 
Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360

                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || || |||||||| ||| | |||||||||||
Sbjct: 361 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccgcaa 404



to top

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  155 bits (78), Expect = 2e-34
 Identities = 180/214 (84%)
 Strand = Plus / Plus

                                                                        
Query: 233  taccttggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgac 292
            ||||| |||||  ||||||| |||||||||||||||||||| ||||||||||| ||||||
Sbjct: 1051 tacctcggccccttctccggcgagcccccgagctacctcaccggcgagttccccggcgac 1110

                                                                        
Query: 293  tatggttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggag 352
            || || |||||||| ||||| || || || || || ||||| ||| |||||||||| |||
Sbjct: 1111 tacggctgggacaccgccgggctgtccgccgaccccgagacattcgccaagaaccgcgag 1170

                                                                        
Query: 353  ctggaggtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
            |||||||||||||| | ||| ||||| |||||||| || || || || |||||||| |||
Sbjct: 1171 ctggaggtgatccactcccgctgggccatgctcggcgcgctcggctgcgtcttccccgag 1230

                                              
Query: 413  ttgctcgcccgcaatggcctcaacttcggtgagg 446
             ||||| ||||||| ||| |||| ||||| ||||
Sbjct: 1231 ctgctctcccgcaacggcgtcaagttcggcgagg 1264



to top

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  153 bits (77), Expect = 6e-34
 Identities = 179/213 (84%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| ||
Sbjct: 205 ggtagcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtcc 264

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           || |||||| | ||||| ||||||||||| ||||| || ||||||||||| |||||||||
Sbjct: 265 ccaagctacttgactggtgagttccctggtgactacgggtgggacactgctggactttca 324

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| || || ||  ||||||| || ||| ||||||||||||| ||| | ||||| 
Sbjct: 325 gctgatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcagatgggcc 384

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           ||||| || || |||||||||||||||||||||
Sbjct: 385 atgcttggagctcttggttgtgtcttccctgag 417



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  151 bits (76), Expect = 2e-33
 Identities = 202/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || |||||  || |||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 376 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 435

               
Query: 443 gagg 446
           ||||
Sbjct: 436 gagg 439



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 127 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 164



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  151 bits (76), Expect = 2e-33
 Identities = 202/244 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| |||||||| || ||||| || |||||||| ||||| |||||||| ||||| |||
Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           ||||||||||| ||||||||||| |||||||| || |||||||| || || || || || 
Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||||||||||||| ||||||| | ||| ||||| |||
Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || || || || |||||||| ||| | |||||||| || ||| |||| ||||| 
Sbjct: 357 ctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttcggc 416

               
Query: 443 gagg 446
           ||||
Sbjct: 417 gagg 420



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 108 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 145



to top

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  145 bits (73), Expect = 2e-31
 Identities = 175/209 (83%)
 Strand = Plus / Plus

                                                                        
Query: 200  ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
            |||||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| | 
Sbjct: 1117 ggtagcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtct 1176

                                                                        
Query: 260  ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
            || |||||| | ||||| ||||| ||||| || || || |||||||||||||||||||||
Sbjct: 1177 ccaagctacttgactggtgagtttcctggtgattacgggtgggacactgccggactttca 1236

                                                                        
Query: 320  gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
            |||||||| || || ||| |||||||||| ||| ||||||||||||| ||| | ||||| 
Sbjct: 1237 gctgatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggcc 1296

                                         
Query: 380  atgctcggggcacttggttgtgtcttccc 408
            ||||| || || |||||||||||||||||
Sbjct: 1297 atgcttggagctcttggttgtgtcttccc 1325



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  137 bits (69), Expect = 4e-29
 Identities = 174/209 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| | 
Sbjct: 197 ggtagcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtct 256

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           || |||||| | ||||| ||||| ||||| || || || ||||||||||| |||||||||
Sbjct: 257 ccaagctacttgactggtgagtttcctggtgattacgggtgggacactgctggactttca 316

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| || || ||| |||||||||| ||| ||||||||||||| ||| | ||||| 
Sbjct: 317 gctgatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggcc 376

                                        
Query: 380 atgctcggggcacttggttgtgtcttccc 408
           ||||| || || |||||||||||||||||
Sbjct: 377 atgcttggagctcttggttgtgtcttccc 405



to top

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  137 bits (69), Expect = 4e-29
 Identities = 177/213 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||  ||
Sbjct: 177 ggtagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggtgaagcc 236

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           || |||||| | ||||| ||||| ||||| ||||| || ||||||||||| |||||||||
Sbjct: 237 ccaagctacttgactggtgagtttcctggtgactacggatgggacactgctggactttca 296

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| ||||| || ||| | |||||||| ||||| ||||||||||| ||| | ||||| 
Sbjct: 297 gctgaccctgaaacattcgctaagaaccgtgagcttgaggtgatccactgcagatgggcc 356

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           ||||| || || ||||| |||||||||||||||
Sbjct: 357 atgcttggtgctcttggatgtgtcttccctgag 389



to top

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  133 bits (67), Expect = 6e-28
 Identities = 142/167 (85%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           |||| |||||| |||| |||||| | ||||| ||||||||||| || ||||| |||||||
Sbjct: 418 tctctggtgaggccccaagctacttgactggtgagttccctggtgattatgggtgggaca 477

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           |||| ||||||||||||||||| || || ||| ||||||| || ||| ||||||||||||
Sbjct: 478 ctgctggactttcagctgatccagaaactttcgccaagaatcgtgagttggaggtgatcc 537

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           | ||| | ||||| ||||| || || |||||||| ||||||||||||
Sbjct: 538 actgcagatgggccatgcttggagctcttggttgcgtcttccctgag 584



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  133 bits (67), Expect = 6e-28
 Identities = 169/203 (83%)
 Strand = Plus / Plus

                                                                        
Query: 206  ccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccgagc 265
            |||||||||||  ||||||||||    ||| | |||||| |||| |||||| |||| |||
Sbjct: 1598 ccatggtacggccctgaccgtgtcaagtacttgggcccattctctggtgagtccccaagc 1657

                                                                        
Query: 266  tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
            ||| | || || ||||||||||| || ||||| ||||||||||| |||||||||||||||
Sbjct: 1658 tacttgacgggtgagttccctggtgattatggatgggacactgctggactttcagctgat 1717

                                                                        
Query: 326  cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
            || || || ||  | |||||||| ||| ||||||||||||||||| | ||||| ||||| 
Sbjct: 1718 ccagaaacttttgctaagaaccgtgagttggaggtgatccattgcagatgggccatgctt 1777

                                   
Query: 386  ggggcacttggttgtgtcttccc 408
            || || |||||||||||||||||
Sbjct: 1778 ggagctcttggttgtgtcttccc 1800



to top

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  131 bits (66), Expect = 2e-27
 Identities = 171/206 (83%)
 Strand = Plus / Minus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||| | ||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 2529 agcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggtgagtctcca 2470

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
            |||||| | ||||| ||||| || || |||||||| ||||||||||| ||||||||||||
Sbjct: 2469 agctacttgactggtgagtttccaggtgactatggatgggacactgctggactttcagct 2410

                                                                        
Query: 323  gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
            ||||| || || ||  |||||||||| ||| ||||||||||||| ||| | ||||| |||
Sbjct: 2409 gatccagaaacttttgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 2350

                                      
Query: 383  ctcggggcacttggttgtgtcttccc 408
            || || || |||||||||||||||||
Sbjct: 2349 cttggagctcttggttgtgtcttccc 2324



 Score =  121 bits (61), Expect = 2e-24
 Identities = 172/209 (82%)
 Strand = Plus / Plus

                                                                        
Query: 200  ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
            ||||||| |||||||||| |||| |||||    ||| | |||||| |||| |||||| | 
Sbjct: 4501 ggtagcctatggtacggtcctgatcgtgttaagtacttgggcccattctctggtgagtct 4560

                                                                        
Query: 260  ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
            || |||||| | ||||| || |||||||| ||||| || ||||||||||| |||||||||
Sbjct: 4561 ccaagctacttgactggtgaattccctggtgactacgggtgggacactgctggactttca 4620

                                                                        
Query: 320  gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
            |||||||| || || ||  | |||||||| ||| ||||||||||||| ||| | ||||| 
Sbjct: 4621 gctgatccagaaacttttgctaagaaccgtgagttggaggtgatccactgcagatgggca 4680

                                         
Query: 380  atgctcggggcacttggttgtgtcttccc 408
            ||||| || || |||||||||||||||||
Sbjct: 4681 atgcttggagctcttggttgtgtcttccc 4709



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  129 bits (65), Expect = 9e-27
 Identities = 202/247 (81%), Gaps = 3/247 (1%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggt---gagccc 259
           ||||| |||||||| || ||||| || |||||||| ||||| ||||| ||    ||||| 
Sbjct: 585 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           |||||||||||||| ||||||||||| |||||||| || |||||||| || || || || 
Sbjct: 645 ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           || || || ||||| ||| |||||||||||||||||||||||||||| | ||| ||||| 
Sbjct: 705 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcg 764

                                                                       
Query: 380 atgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttc 439
           ||||| || || || || || |||||||| ||| | |||||||| || ||| |||| |||
Sbjct: 765 atgctgggcgcgctcggctgcgtcttcccggagctcctcgcccggaacggcgtcaagttc 824

                  
Query: 440 ggtgagg 446
           || ||||
Sbjct: 825 ggcgagg 831



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 137 ctctttggcgaggcccgagtcaccatgcgcaagaccgc 174
           ||||| |||||||| ||  |||||||||||||||||||
Sbjct: 516 ctcttcggcgaggcgcggatcaccatgcgcaagaccgc 553



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  129 bits (65), Expect = 9e-27
 Identities = 197/241 (81%)
 Strand = Plus / Plus

                                                                        
Query: 138  tctttggcgaggcccgagtcaccatgcgcaagaccgcagcaaaggcaaagcaggtttgct 197
            |||| ||||||| |||  ||||||||||||||||||| || ||| | |||| ||   |||
Sbjct: 1997 tcttcggcgagggccgcatcaccatgcgcaagaccgccgccaagcccaagccggcgcgct 2056

                                                                        
Query: 198  ccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagc 257
            |||| ||||| ||||||||||| ||||| || || ||||| ||||| || |||||    |
Sbjct: 2057 ccggcagcccctggtacggtgccgaccgcgtcctgtacctgggcccgctgtccggctcac 2116

                                                                        
Query: 258  ccccgagctacctcactggcgagttccctggcgactatggttgggacactgccggacttt 317
            | ||||||||||| || ||||||||||| |||||||| || |||||||| |  || || |
Sbjct: 2117 ctccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgaggggctgt 2176

                                                                        
Query: 318  cagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttggg 377
            | || || || ||||||||| |||||||||| ||||||||||||||||| ||||| ||||
Sbjct: 2177 cggcggacccggagaccttcgccaagaaccgcgagctggaggtgatccactgccgctggg 2236

             
Query: 378  c 378
            |
Sbjct: 2237 c 2237



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 404  ttccctgagttgctcgcccgcaatggcctcaacttcggtgaggg 447
            ||||| ||| ||||||||||||| ||| |||| ||||| |||||
Sbjct: 2263 ttcccggagctgctcgcccgcaacggcgtcaagttcggcgaggg 2306



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  129 bits (65), Expect = 9e-27
 Identities = 202/247 (81%), Gaps = 3/247 (1%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggt---gagccc 259
           ||||| |||||||| || ||||| ||||||||||| ||||| ||||||||    ||||| 
Sbjct: 624 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || ||||||||||| |||||||| || |||||||| || || || || 
Sbjct: 684 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           || || || ||||| ||| |||||||||||||||||||||||||||| | | | ||||| 
Sbjct: 744 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcg 803

                                                                       
Query: 380 atgctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttc 439
           |||||||| |  || || || || ||||| ||| | ||||||||||| ||| |||| |||
Sbjct: 804 atgctcggcgggctgggctgcgtgttcccggagctcctcgcccgcaacggcgtcaagttc 863

                  
Query: 440 ggtgagg 446
           || ||||
Sbjct: 864 ggggagg 870



to top

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score =  127 bits (64), Expect = 4e-26
 Identities = 124/144 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           ||||||||| || || || |||||||||||||||||||||||||||||||| ||||||||
Sbjct: 207 ctacctcacaggagaatttcctggcgactatggttgggacactgccggactctcagctga 266

                                                                       
Query: 325 tcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            || ||||| ||| | |||||||| ||||| || ||||||||||  || ||||| |||||
Sbjct: 267 cccggagacattcgctaagaaccgtgagctcgaagtgatccattcacgatgggccatgct 326

                                   
Query: 385 cggggcacttggttgtgtcttccc 408
            ||||| ||||||||||| |||||
Sbjct: 327 tggggctcttggttgtgttttccc 350



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  123 bits (62), Expect = 6e-25
 Identities = 152/182 (83%)
 Strand = Plus / Plus

                                                                       
Query: 185 aagcaggtttgctccggtagcccatggtacggtgctgaccgtgtgctctaccttggccca 244
           |||||||||| |||||| ||||||||||||||  | ||||||||    ||| | ||||||
Sbjct: 173 aagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggccca 232

                                                                       
Query: 245 ctctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggac 304
            ||||||| |||||||||  ||||||||| ||||||||||| || ||||| |||||||||
Sbjct: 233 ttctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggac 292

                                                                       
Query: 305 actgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatc 364
           ||||| || ||||| ||||| || ||||||||| ||| |||||| ||| |||| || |||
Sbjct: 293 actgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtcatc 352

             
Query: 365 ca 366
           ||
Sbjct: 353 ca 354



to top

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||| |||| |||||    ||| | |||||| | || |||||| |||| 
Sbjct: 372 agcccatggtatggtcctgatcgtgtcaagtacttgggcccattttctggtgaggcccca 431

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | ||||| ||||| ||||| |||||||| ||||| ||||| ||||||||||| 
Sbjct: 432 agctacttgactggtgagtttcctggtgactatgggtgggatactgctggactttcagca 491

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || || || ||| |||||||||||||| ||||||||||||| ||| | ||||| |||
Sbjct: 492 gacccagaaactttcgccaagaaccgggagttggaggtgatccactgcagatgggccatg 551

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || |||||||| ||||||||||||
Sbjct: 552 cttggagctcttggttgcgtcttccctgag 581



to top

>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 405

 Score =  123 bits (62), Expect = 6e-25
 Identities = 146/174 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||| |||||| |||| |||||| | || || || |||||||| ||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||| ||||| ||||||||||| || ||||| |||||  |||||||||| || || |||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                                                 
Query: 359 gtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |||||||||||| | ||||||||||| || || ||||| |||||||||||||||
Sbjct: 295 gtgatccattgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 348



to top

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||| ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 139 agcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggtgagtcccca 198

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           || ||| | || || || |||||||| |||||||| ||||| ||||| ||||||||||| 
Sbjct: 199 agttacttgaccggtgaattccctggtgactatggctgggatactgctggactttcagca 258

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || ||||| |||||  |||||||||| || || ||||||||||| ||| | |||||||||
Sbjct: 259 gaccctgaaacctttgccaagaaccgtgaactagaggtgatccactgcaggtgggctatg 318

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 319 cttggtgctcttggatgtgtcttccctgag 348



to top

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  123 bits (62), Expect = 6e-25
 Identities = 173/210 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 139 agcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtcccca 198

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           || ||| | ||||| || |||||||| |||||||| ||||| || || ||||||||||| 
Sbjct: 199 agttacttgactggtgaattccctggtgactatggatgggataccgctggactttcagca 258

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || |||||||||||  |||||||||| || || ||||||||||| ||| | |||||||||
Sbjct: 259 gaccctgagacctttgccaagaaccgtgaacttgaggtgatccactgcagatgggctatg 318

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 319 cttggtgctcttggatgtgtcttccctgag 348



to top

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  123 bits (62), Expect = 6e-25
 Identities = 143/170 (84%)
 Strand = Plus / Plus

                                                                       
Query: 197 tccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgag 256
           ||||| ||||| ||||| ||| ||||||||||    ||| | |||||| |||| ||||||
Sbjct: 103 tccggcagcccgtggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgag 162

                                                                       
Query: 257 cccccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactt 316
           || ||   |||||| || || ||||||||||| ||||| |||||||||||||| ||||||
Sbjct: 163 ccaccatcctaccttaccggagagttccctggtgactacggttgggacactgctggactt 222

                                                             
Query: 317 tcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
           ||||||||||| ||||||||| |||||||||| ||| |||| ||||||||
Sbjct: 223 tcagctgatcccgagaccttcgccaagaaccgtgagttggaagtgatcca 272



to top

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  123 bits (62), Expect = 6e-25
 Identities = 170/206 (82%)
 Strand = Plus / Plus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||| | ||||||||    ||| | |||||| ||||||||||| |||| 
Sbjct: 4473 agcccatggtacggtccagaccgtgttaagtacttgggcccattctccggtgagtcccca 4532

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
            |||||| | || || || || || || |||||||| ||||| ||||| ||||||||||| 
Sbjct: 4533 agctacttgaccggtgaatttcccggtgactatgggtgggatactgctggactttcagca 4592

                                                                        
Query: 323  gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
            ||||| || |||||  |||||||||| ||||| ||||||||||| ||| | |||||||||
Sbjct: 4593 gatccagaaacctttgccaagaaccgtgagctcgaggtgatccactgcagatgggctatg 4652

                                      
Query: 383  ctcggggcacttggttgtgtcttccc 408
            || || || ||||| |||||||||||
Sbjct: 4653 cttggtgctcttggatgtgtcttccc 4678



 Score =  107 bits (54), Expect = 3e-20
 Identities = 171/210 (81%)
 Strand = Plus / Plus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| |||| 
Sbjct: 7013 agcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgaggcccca 7072

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
            |||||| | || || || ||||| || || || || ||||| ||||| ||||||||||| 
Sbjct: 7073 agctacttgaccggtgaattcccaggtgattacgggtgggatactgctggactttcagcg 7132

                                                                        
Query: 323  gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
            ||||| || |||||  |||||||||| || || ||||||||||| ||| | |||||||||
Sbjct: 7133 gatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggctatg 7192

                                          
Query: 383  ctcggggcacttggttgtgtcttccctgag 412
            || || || ||||| |||||||||||||||
Sbjct: 7193 cttggtgctcttggatgtgtcttccctgag 7222



 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 193/244 (79%)
 Strand = Plus / Plus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||| | ||||||||    ||| | |||||| | || |||||| | || 
Sbjct: 2020 agcccatggtacggtccagaccgtgttaagtacttgggcccattttctggtgagtctcca 2079

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
            |||||  | ||||| || |||||||| |||||||| ||||| ||||| ||||||||||| 
Sbjct: 2080 agctatttgactggtgaattccctggtgactatgggtgggatactgctggactttcagcc 2139

                                                                        
Query: 323  gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
            || || || || ||  |||||||||| || || |||||||| || ||| | |||||||||
Sbjct: 2140 gacccagaaacttttgccaagaaccgtgaactcgaggtgattcactgcagatgggctatg 2199

                                                                        
Query: 383  ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
            || || || ||||| ||||| ||||| ||| |  | ||||| |||||| |||| || |||
Sbjct: 2200 cttggtgctcttggatgtgttttccccgagctcttggcccgtaatggcgtcaagtttggt 2259

                
Query: 443  gagg 446
            ||||
Sbjct: 2260 gagg 2263



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  121 bits (61), Expect = 2e-24
 Identities = 172/209 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||| ||||||||||    ||| | || ||| |||| |||||| | || 
Sbjct: 375 agcccatggtatggtcctgaccgtgtcaagtacttgggaccattctctggtgaggcacca 434

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | ||||| ||||||||| | |||||||| ||||| ||||| |||||||| |||
Sbjct: 435 agctacttgactggtgagttccctagtgactatggatgggatactgctggactttcggct 494

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           |||||||| || ||  |||||||||| ||||||||||| ||||| ||  | ||||| |||
Sbjct: 495 gatcctgaaacttttgccaagaaccgtgagctggaggtcatccactgtagatgggccatg 554

                                        
Query: 383 ctcggggcacttggttgtgtcttccctga 411
           || || || ||||||||||||||||||||
Sbjct: 555 cttggagctcttggttgtgtcttccctga 583



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score =  119 bits (60), Expect = 9e-24
 Identities = 111/128 (86%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           |||||||| |||||||| ||||||||||| ||||||||||||||||| || || ||  ||
Sbjct: 290 ttccctggtgactatggatgggacactgctggactttcagctgatccagaaacttttgcc 349

                                                                       
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttgt 400
           ||||| || ||| ||||||||||||| ||| | ||||||||||| || || |||||||||
Sbjct: 350 aagaatcgtgagttggaggtgatccactgcagatgggctatgcttggagctcttggttgt 409

                   
Query: 401 gtcttccc 408
           ||||||||
Sbjct: 410 gtcttccc 417



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  119 bits (60), Expect = 9e-24
 Identities = 135/160 (84%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           |||| |||||| | || |||||| | ||||| ||||||||||| |||||||| ||||| |
Sbjct: 624 tctctggtgagtctccaagctacttgactggtgagttccctggtgactatggatgggata 683

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           |||| |||||||||||||||||||| || ||  |||||||||| ||| ||||||||||||
Sbjct: 684 ctgctggactttcagctgatcctgaaacttttgccaagaaccgtgagttggaggtgatcc 743

                                                   
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtctt 405
           | ||  | ||||| ||||| || || ||||||||||||||
Sbjct: 744 actgtagatgggccatgcttggagctcttggttgtgtctt 783



to top

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  117 bits (59), Expect = 3e-23
 Identities = 110/127 (86%)
 Strand = Plus / Plus

                                                                       
Query: 240 gcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggtt 299
           ||||| |||| |||||||| ||   |||||| || || ||||||||||| ||||| ||||
Sbjct: 1   gcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggtt 60

                                                                       
Query: 300 gggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggagg 359
           |||||||||| ||||||||||||||||| ||||||||| |||||||||| ||| |||| |
Sbjct: 61  gggacactgctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaag 120

                  
Query: 360 tgatcca 366
           |||||||
Sbjct: 121 tgatcca 127



to top

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  115 bits (58), Expect = 1e-22
 Identities = 172/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 139 agcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtcccca 198

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | ||||| || |||||||| ||||| || ||||| || || ||||||||||| 
Sbjct: 199 agctacttgactggtgaattccctggtgactacgggtgggataccgctggactttcagca 258

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || ||||| |||||  |||||||||| || || ||||||||||| ||| | |||||||||
Sbjct: 259 gaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggctatg 318

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 319 cttggtgctcttggatgtgtcttccctgag 348



to top

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  113 bits (57), Expect = 5e-22
 Identities = 135/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| ||||| ||||| |||||||| || |||||||| ||||| || || || || 
Sbjct: 259 tacctcaccggcgaattccccggcgactacgggtgggacaccgccgggctctccgccgac 318

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||||||| |||||||||||||||| ||||||||||| ||||| ||||| ||||| 
Sbjct: 319 cccgagaccttctccaagaaccgggagctcgaggtgatccactgccggtgggccatgctg 378

                                                    
Query: 386 ggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || |||||||| ||| | |||||||||||
Sbjct: 379 ggtgctctcggctgcgtcttccccgagctcctcgcccgcaa 419



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  113 bits (57), Expect = 5e-22
 Identities = 105/121 (86%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||| ||||||||||| | || || |||||||| || ||||| || |||||||
Sbjct: 74  tctccggtgagtccccgagctacttgaccggtgagttccccggtgactacggctgggaca 133

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           |||| ||||| |||||||| || ||||||||| |||||||||| ||||| ||||||||||
Sbjct: 134 ctgctggactctcagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatcc 193

            
Query: 366 a 366
           |
Sbjct: 194 a 194



to top

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score =  111 bits (56), Expect = 2e-21
 Identities = 173/212 (81%)
 Strand = Plus / Plus

                                                                       
Query: 197 tccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgag 256
           ||||| ||||||||||||||  | ||||||||    ||| | |||||| |||||||||||
Sbjct: 142 tccggcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgag 201

                                                                       
Query: 257 cccccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactt 316
           ||||| |||||| | || || || ||||| || |||||||| ||||||||||||||||| 
Sbjct: 202 cccccaagctacttgaccggtgaattccccggtgactatggctgggacactgccggactc 261

                                                                       
Query: 317 tcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgg 376
           |||||||| || || |||||  |||||||||| ||||| || |||||||| |   | |||
Sbjct: 262 tcagctgacccagaaacctttgccaagaaccgtgagctcgaagtgatccactcaagatgg 321

                                           
Query: 377 gctatgctcggggcacttggttgtgtcttccc 408
           |||||||| || || ||||| ||||| |||||
Sbjct: 322 gctatgcttggagctcttggatgtgttttccc 353



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
           protein, complete cds
          Length = 1500

 Score =  109 bits (55), Expect = 8e-21
 Identities = 133/159 (83%)
 Strand = Plus / Plus

                                                                       
Query: 210 ggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccgagctacc 269
           |||||||||| |||||  | |||||||| |||||| |||| |||   |||||   |||||
Sbjct: 667 ggtacggtgccgaccgccttctctacctgggcccattctctggttctcccccatcctacc 726

                                                                       
Query: 270 tcactggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctg 329
           ||||||| ||||||||||| |||||||| |||||||| || || || || || || || |
Sbjct: 727 tcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcagacccag 786

                                                  
Query: 330 agaccttcaccaagaaccgggagctggaggtgatccatt 368
           |||||||| |||||||| |||||||||||||||||||||
Sbjct: 787 agaccttcgccaagaacagggagctggaggtgatccatt 825



to top

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score =  107 bits (54), Expect = 3e-20
 Identities = 171/210 (81%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 127 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 186

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              ||||| ||||| || |||||||| |||||||| ||||||||||| || |||||||||
Sbjct: 187 tcttaccttactggtgaattccctggtgactatggctgggacactgctgggctttcagct 246

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || || |||||  |||||||||| ||||| || |||||||| | | | ||||| |||
Sbjct: 247 gacccagaaacctttgccaagaaccgtgagcttgaagtgatccactccagatgggccatg 306

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 307 cttggagctcttgggtgtgtcttccctgag 336



to top

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score =  107 bits (54), Expect = 3e-20
 Identities = 144/174 (82%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| ||||||||||| | || |||||| | ||  | || |||||||| || ||||| 
Sbjct: 311 ggcccattctccggtgagtctccaagctacttgaccagtgaattccctggtgattatggg 370

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||| ||||| ||||||||||| ||||| || |||||  |||||||||| || || |||
Sbjct: 371 tgggatactgctggactttcagcagatccagaaacctttgccaagaaccgtgaactcgag 430

                                                                 
Query: 359 gtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |||||||| ||| | ||||||||||| || || ||||| |||||||||||||||
Sbjct: 431 gtgatccactgcagatgggctatgcttggtgctcttggatgtgtcttccctgag 484



to top

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  105 bits (53), Expect = 1e-19
 Identities = 134/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| || |||||||| |||||||| || |||||||| ||||| || ||||| || 
Sbjct: 243 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggac 302

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||| ||| |||||||||||||||| ||||||||||| ||| | ||||| ||||| 
Sbjct: 303 cccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctg 362

                                                    
Query: 386 ggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || |||||||| ||| | |||||||||||
Sbjct: 363 ggcgctctcggctgcgtcttccccgagctcctcgcccgcaa 403



to top

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  105 bits (53), Expect = 1e-19
 Identities = 134/161 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| || |||||||| |||||||| || |||||||| ||||| || ||||| || 
Sbjct: 78  tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctcagcggac 137

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||| ||| |||||||||||||||| ||||||||||| ||| | ||||| ||||| 
Sbjct: 138 cccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgggcaatgctg 197

                                                    
Query: 386 ggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || |||||||| ||| | |||||||||||
Sbjct: 198 ggcgctctcggctgcgtcttccccgagctcctcgcccgcaa 238



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  105 bits (53), Expect = 1e-19
 Identities = 149/181 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| ||||||||| | |||||||| || |||||||| ||||| || || || || 
Sbjct: 113 tacctcaccggcgagttcgccggcgactacggctgggacaccgccgggctctccgccgac 172

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||||||| |||||||||| |||||||||||||||||     | ||||| ||||||
Sbjct: 173 cccgagaccttcgccaagaaccgcgagctggaggtgatccacgcgaggtgggccatgctc 232

                                                                       
Query: 386 ggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggtgag 445
           || || || || || |||||||| ||| ||||||||||||| ||| |||| ||||| |||
Sbjct: 233 ggcgcgctcggctgcgtcttccccgagctgctcgcccgcaacggcgtcaagttcggcgag 292

            
Query: 446 g 446
           |
Sbjct: 293 g 293



to top

>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score =  105 bits (53), Expect = 1e-19
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                       
Query: 272 actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
           ||||||||||||||||| |||||||| ||||| ||||| ||||| ||||| || ||||| 
Sbjct: 556 actggcgagttccctggtgactatggatgggatactgctggactctcagccgaccctgaa 615

                                                                
Query: 332 accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
           || ||  ||| |||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 616 acatttgccaggaaccgtgagcttgaggtgatccattgccgttgggcaatgct 668



to top

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score =  103 bits (52), Expect = 5e-19
 Identities = 118/140 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| || |||||||| || |||||||||||||||||||| ||||| |||||||| 
Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||| ||| | |  ||||| || || ||||||||||||||||||||||| ||||| 
Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgctt 380

                               
Query: 386 ggggcacttggttgtgtctt 405
           || ||  | |||||||||||
Sbjct: 381 ggtgctttgggttgtgtctt 400



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  101 bits (51), Expect = 2e-18
 Identities = 111/131 (84%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           |||||||| |||||||| ||||||||||| |||||||||||||| || ||||| ||  ||
Sbjct: 239 ttccctggagactatgggtgggacactgctggactttcagctgacccagagacatttgcc 298

                                                                       
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttgt 400
           |||||||| ||||| || ||||||||  || | ||||| ||||| || ||||| || |||
Sbjct: 299 aagaaccgtgagctcgaagtgatccacagcagatgggccatgcttggtgcactaggctgt 358

                      
Query: 401 gtcttccctga 411
           |||||||||||
Sbjct: 359 gtcttccctga 369



to top

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 113/134 (84%)
 Strand = Plus / Plus

                                                                       
Query: 296 ggttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctg 355
           |||||||||||||| ||||| |||||||| || || |||||  |||||||||| ||||| 
Sbjct: 9   ggttgggacactgctggactctcagctgacccagaaacctttgccaagaaccgtgagctt 68

                                                                       
Query: 356 gaggtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttg 415
           ||||||||||||||| | ||||| ||| | || ||| | |||||||| ||||| ||||||
Sbjct: 69  gaggtgatccattgcagatgggccatgttgggcgcattaggttgtgtattcccagagttg 128

                         
Query: 416 ctcgcccgcaatgg 429
            | |||||||||||
Sbjct: 129 ttagcccgcaatgg 142



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 137/166 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| |||||||| ||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 224 tctccggagagcccccaagctacctcacaggagagttccccggtgactacggatgggaca 283

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | ||||| ||||| ||||| || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 284 ccgccggtctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatcc 343

                                                         
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctga 411
           | ||| | ||||| ||||| || || || || ||||| ||||||||
Sbjct: 344 actgcagatgggccatgcttggagccctaggctgtgttttccctga 389



to top

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 170/210 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||| |||| |||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 263 agcccatggtatggtcctgatcgtgtcaagtacttgggcccattctctggtgaggcccca 322

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | ||||| ||||||||||| |||||||| ||||| ||||| ||||||||||| 
Sbjct: 323 agctacttgactggtgagttccctggtgactatggatgggatactgctggactttcagcc 382

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || |  || ||| ||||||||||| | |||||||| ||||| ||  | ||| | |||
Sbjct: 383 gacccagcaactttcgccaagaaccggaaactggaggtaatccactgtagatggaccatg 442

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || |||||||| ||||||||||||
Sbjct: 443 cttggagctcttggttgcgtcttccctgag 472



to top

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 170/210 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 139 agcccatggtatggccctgaccgtgttaagtacttaggcccattctctggtgagtcccca 198

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | || || || |||||||| ||||| || ||||| || || ||||||||||| 
Sbjct: 199 agctacttgaccggtgaattccctggtgactacgggtgggataccgctggactttcagca 258

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || ||||| |||||  |||||||||| || || ||||||||||| ||| | ||||| |||
Sbjct: 259 gaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcaatg 318

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 319 cttggtgctcttggatgtgtcttccctgag 348



to top

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 170/210 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 139 agcccatggtatggccctgaccgtgttaagtacttaggcccattctctggtgagtcccca 198

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | || || || |||||||| ||||| || ||||| || || ||||||||||| 
Sbjct: 199 agctacttgaccggtgaattccctggtgactacgggtgggataccgctggactttcagca 258

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || ||||| |||||  |||||||||| || || ||||||||||| ||| | ||||| |||
Sbjct: 259 gaccctgaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcaatg 318

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 319 cttggtgctcttggatgtgtcttccctgag 348



to top

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                       
Query: 248 tccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggacact 307
           ||||| |||||||||||||||||||| || |||||||| || ||||| || |||||||| 
Sbjct: 1   tccggagagcccccgagctacctcaccggagagttccccggagactacggatgggacacc 60

                                                                       
Query: 308 gccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccat 367
           ||||| || || ||||| || ||||||||| ||| |||||| ||||| || || ||||| 
Sbjct: 61  gccggtctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccac 120

                                                        
Query: 368 tgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           ||| | ||||| |||||||| || || || || || |||||||||
Sbjct: 121 tgcagatgggccatgctcggagccctaggctgcgttttccctgag 165



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||| ||||| ||||||||||| ||||| |||||||||||||| ||||| ||||| || 
Sbjct: 277 taccttactggagagttccctggtgactacggttgggacactgctggactatcagcagac 336

                                                    
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatcca 366
           ||||| |||||| | |||||||| ||||| |||||||||||
Sbjct: 337 cctgaaaccttcgctaagaaccgtgagctcgaggtgatcca 377



to top

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Plus

                                                                        
Query: 272  actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
            ||||| |||||||| || || || || ||||||||||| |||||||||||||| || |||
Sbjct: 942  actggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccagag 1001

                                                                 
Query: 332  accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            || ||| | | |||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 1002 acattcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgct 1054



to top

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 272 actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
           ||||| ||||||||||| || ||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 715 actggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaa 774

                                                                       
Query: 332 accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcggggca 391
           || ||  | |||||||| ||||| |||||||| || ||  | ||||||||||| || || 
Sbjct: 775 acttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgcttggagct 834

                            
Query: 392 cttggttgtgtcttccc 408
           || ||||||||||||||
Sbjct: 835 ctcggttgtgtcttccc 851



to top

>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Plus

                                                                        
Query: 272  actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
            ||||| ||||||||||| ||||| || ||||||||||| ||||| |||||||| ||||||
Sbjct: 2319 actggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctgag 2378

                                                                 
Query: 332  accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            || ||  | | ||||| |||||| |||||||||||||| |||||||| |||||
Sbjct: 2379 acatttgctaggaacctggagcttgaggtgatccattgtcgttgggccatgct 2431



to top

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccccc 261
           |||||||||||||||  | ||||||||    ||||| |||||| ||||||||||| | ||
Sbjct: 200 tagcccatggtacggcccagaccgtgtcaagtacctaggcccattctccggtgaggcacc 259

                                                                       
Query: 262 gagctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagc 321
               ||||||||||| || |||||||| |||||||||||||||||||| || || |||||
Sbjct: 260 atcttacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagc 319

                                                        
Query: 322 tgatcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
           ||| || ||||| ||  | |||||||| ||||| |||||||||||
Sbjct: 320 tgaccccgagacttttgctaagaaccgtgagcttgaggtgatcca 364



to top

>gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-binding protein, 3' end
          Length = 810

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 97/113 (85%)
 Strand = Plus / Plus

                                                                       
Query: 272 actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
           ||||| ||||| || || |||||||| ||||||||||||||||| |||||||| ||||||
Sbjct: 126 actggtgagtttccaggtgactatggatgggacactgccggactctcagctgaccctgag 185

                                                                
Query: 332 accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
           || ||  | | |||||| ||||| |||||||| ||||| ||||||||||||||
Sbjct: 186 acatttgcaaggaaccgtgagcttgaggtgatacattgtcgttgggctatgct 238



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||||||| ||||||| ||  | ||| | || ||||| ||||||||||| 
Sbjct: 330 ggtagcccatggtacggtcctgaccgagttttgtacttgggtccactttccggtgagcca 389

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||    ||| | || || ||||||||||| |||||||||||||||||||| ||||| |||
Sbjct: 390 ccatcttacttgaccggtgagttccctggtgactatggttgggacactgctggactctca 449

                            
Query: 320 gctgatcctgagacctt 336
           |||||||| ||||||||
Sbjct: 450 gctgatcccgagacctt 466



to top

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 115/137 (83%)
 Strand = Plus / Plus

                                                                        
Query: 272  actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
            ||||| ||||||||||| || ||||| ||||||||||| ||||||||||||||||| || 
Sbjct: 2118 actggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaa 2177

                                                                        
Query: 332  accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcggggca 391
            || ||  | |||||||| ||||| |||||||| || ||  | ||||||||||| || || 
Sbjct: 2178 acttttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgcttggagct 2237

                             
Query: 392  cttggttgtgtcttccc 408
            || ||||||||||||||
Sbjct: 2238 ctcggttgtgtcttccc 2254



to top

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                         
Query: 239   ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
             |||||| |||||||||||||||||  |||| | || || |||||||| || ||||| || 
Sbjct: 66182 ggcccattctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggc 66123

                                                                         
Query: 299   tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
             ||||||||||| || ||||| ||||| || ||||| ||| |||||||||| ||||| |||
Sbjct: 66122 tgggacactgctgggctttctgctgaccccgagacattcgccaagaaccgtgagcttgag 66063

                     
Query: 359   gtgatcca 366
             ||||||||
Sbjct: 66062 gtgatcca 66055



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 363

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 364 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||| ||||||||||| || || |||||||| || |||||||| |||||||
Sbjct: 13  tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | ||||| || || |||||||| ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 73  ccgccggtctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatcc 132

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 133 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 179



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 182 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 241

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 242 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 301

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 302 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 348



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 363

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 364 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 363

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 364 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                         
Query: 246   tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
             ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 95486 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 95545

                                                                         
Query: 306   ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
             ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 95546 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 95605

                                                            
Query: 366   attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
             |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 95606 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 95652



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                         
Query: 246   tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
             ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 93822 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 93763

                                                                         
Query: 306   ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
             | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 93762 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 93703

                                                            
Query: 366   attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
             |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 93702 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 93656



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Minus

                                                                         
Query: 246   tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
             ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 78716 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 78657

                                                                         
Query: 306   ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
             ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 78656 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 78597

                                                            
Query: 366   attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
             |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 78596 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 78550



 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                         
Query: 246   tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
             ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 80380 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 80439

                                                                         
Query: 306   ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
             | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 80440 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 80499

                                                            
Query: 366   attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
             |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 80500 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 80546



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 363

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 364 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 410



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 244 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 303

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 304 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 363

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 364 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 410



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 482 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 541

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 542 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 601

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 602 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 648



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 137/167 (82%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||||| ||||||||||||||||| |||||||| || || || || |||||||
Sbjct: 182 tctccggtgagcctccgagctacctcactggagagttccccggtgattacgggtgggaca 241

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           ||||||| || || || ||||| ||||||||| | | |||||| ||||| || || ||||
Sbjct: 242 ctgccggtctatccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatcc 301

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 302 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 348



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||||||||| ||||| || || || || |||||||||||||| || ||||| ||||||
Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||| ||| |||||||||| ||||| |||||||| ||  || | ||||| ||||| 
Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgctt 347

                                  
Query: 386 ggggcacttggttgtgtcttccc 408
           || || ||||| |||||||||||
Sbjct: 348 ggagcccttggatgtgtcttccc 370



to top

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 119/143 (83%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| || ||||||||||| ||||| |||||||||||||| || ||||||||||| 
Sbjct: 257 tacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcagctgac 316

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || || |||||| | |||||||| ||||| || || ||||| ||| | ||||||||| | 
Sbjct: 317 ccagaaaccttcgctaagaaccgtgagcttgaagttatccactgcaggtgggctatgttg 376

                                  
Query: 386 ggggcacttggttgtgtcttccc 408
           || ||| | |||||||| |||||
Sbjct: 377 ggagcattgggttgtgttttccc 399



to top

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 121/146 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 81  agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 140

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             |||||||||||| || ||||| || |||||||||||||||||||| || ||||| |||
Sbjct: 141 tcctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 200

                                     
Query: 323 gatcctgagaccttcaccaagaaccg 348
           || || ||||||||  ||||||||||
Sbjct: 201 gacccagagacctttgccaagaaccg 226



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| || ||||||||| | |||||||| || |||||||| ||||| || || || ||
Sbjct: 598 ctacctgaccggcgagttcgccggcgactacggctgggacaccgccgggctctcggccga 657

                                                     
Query: 325 tcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
            || ||||||||| ||||||||||||||||||||||||||||
Sbjct: 658 ccccgagaccttcgccaagaaccgggagctggaggtgatcca 699



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                        
Query: 266  tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
            ||||| || ||||||||||| |||||||| || |||||||| ||||| || || || || 
Sbjct: 938  tacctgacgggcgagttccccggcgactacgggtgggacacggccggcctctccgccgac 997

                                                                        
Query: 326  cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
            || ||||||||| |||||||||| ||||||||||| |||||  |||| ||||| ||||||
Sbjct: 998  ccggagaccttcgccaagaaccgcgagctggaggtcatccacagccggtgggccatgctc 1057

              
Query: 386  gg 387
            ||
Sbjct: 1058 gg 1059



to top

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 169/210 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 183 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 242

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              ||||| ||||| || |||||||| |||||||| ||||||||||| || || ||||||
Sbjct: 243 tcttaccttactggtgaattccctggtgactatggctgggacactgctgggctatcagct 302

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || || |||||  | |||||||| ||||| || |||||||| | | | ||||| |||
Sbjct: 303 gacccagaaacctttgctaagaaccgtgagcttgaagtgatccactccagatgggccatg 362

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           || || || ||||| |||||||||||||||
Sbjct: 363 cttggagctcttgggtgtgtcttccctgag 392



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 126/153 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| ||||| ||| | | |||||| ||||| || || |||||  || | ||||||
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 371

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 372 atgctcggagccctaggctgcgtcttccctgag 404



to top

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 132/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           |||||||| || |||||||| |||||||| || |||||||| ||||| || || || || 
Sbjct: 163 tacctcaccggtgagttccccggcgactacggctgggacaccgccgggctctccgcggac 222

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           || ||||| ||  |||||||||||||||| ||||||||||| ||||| ||||| ||||| 
Sbjct: 223 cccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgggcaatgctg 282

                                                    
Query: 386 ggggcacttggttgtgtcttccctgagttgctcgcccgcaa 426
           || || || || || |||||||| ||| | || ||||||||
Sbjct: 283 ggtgctctcggctgcgtcttccccgagctccttgcccgcaa 323



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 126/153 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| ||||| ||| | | |||||| ||||| || || |||||  || | ||||||
Sbjct: 259 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 318

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 319 atgctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 126/153 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| ||||| ||| | | |||||| ||||| || || |||||  || | ||||||
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 371

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 372 atgctcggagccctaggctgcgtcttccctgag 404



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 126/153 (82%)
 Strand = Plus / Plus

                                                                         
Query: 260   ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
             ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996

                                                                         
Query: 320   gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
             |||||||| ||||| ||| | | |||||| ||||| || || |||||  || | ||||||
Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 22056

                                              
Query: 380   atgctcggggcacttggttgtgtcttccctgag 412
             |||||||| || || || || ||||||||||||
Sbjct: 22057 atgctcggagccctaggctgcgtcttccctgag 22089



 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Minus

                                                                         
Query: 260   ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
             ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657

                                                                         
Query: 320   gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
             ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597

                                              
Query: 380   atgctcggggcacttggttgtgtcttccctgag 412
             |||||||| || || || || ||||||||||||
Sbjct: 16596 atgctcggagccctaggctgcgtcttccctgag 16564



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                         
Query: 263   agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353

                                                                         
Query: 323   gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
             || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 19354 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 19413

                                           
Query: 383   ctcggggcacttggttgtgtcttccctgag 412
             ||||| || || || || ||||||||||||
Sbjct: 19414 ctcggagccctaggctgcgtcttccctgag 19443



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 126/153 (82%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| ||||| ||| | | |||||| ||||| || || |||||  || | ||||||
Sbjct: 465 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 524

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 525 atgctcggagccctaggctgcgtcttccctgag 557



to top

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 194/244 (79%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 183 agcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtcccca 242

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | || || || || ||||| || || || ||||| || || ||||||||||| 
Sbjct: 243 agctacttgaccggtgaatttcctggtgattacgggtgggataccgctggactttcagca 302

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || ||||| || ||  |||||||||| || || ||||||||||| ||| | |||||||||
Sbjct: 303 gaccctgaaacttttgccaagaaccgtgaacttgaggtgatccactgcagatgggctatg 362

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || ||||| ||||||||||||||| |  | ||||| |||||  |||| ||||||
Sbjct: 363 cttggtgctcttggatgtgtcttccctgagctcttggcccgtaatggtgtcaagttcggt 422

               
Query: 443 gagg 446
           ||||
Sbjct: 423 gagg 426



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||||
Sbjct: 194 agcccatggtacggcccagaccgtgttaagtacttaggcccattctctggtgagcccccg 253

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              ||| | ||||| |||||||| || ||||| |||||||||||||| |||||||| |||
Sbjct: 254 tcttacttgactggagagttcccaggtgactacggttgggacactgctggactttctgct 313

                                           
Query: 323 gatcctgagaccttcaccaagaaccgggagct 354
           || || ||||| ||| |||||||||| |||||
Sbjct: 314 gacccagagacattcgccaagaaccgtgagct 345



to top

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 167/208 (80%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||| || |||||||| |||||| | || || ||||||||||||||||| |||
Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           |||||||| ||||| ||||||||||| || || |||||  ||||||| || || || || 
Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctttgccaagaatcgtgaactcgaa 291

                                                                       
Query: 359 gtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttgctc 418
           || ||||| ||| | ||||| ||| | || || ||||| || |||||||| ||| |  | 
Sbjct: 292 gtcatccactgcagatgggccatgttgggagctcttggatgcgtcttcccggagctcttg 351

                                       
Query: 419 gcccgcaatggcctcaacttcggtgagg 446
           |||||||| ||  |||| ||||||||||
Sbjct: 352 gcccgcaacggagtcaagttcggtgagg 379



to top

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| | |||
Sbjct: 1458 agcccatggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctccg 1517

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              |||| | ||||| |||||||| || ||||| |||||||||||||||||||| || |||
Sbjct: 1518 tcctacttgactggagagttccccggtgactacggttgggacactgccggactctctgct 1577

                                            
Query: 323  gatcctgagaccttcaccaagaaccgggagct 354
            || || ||||| ||| |||||||||| |||||
Sbjct: 1578 gacccagagacattctccaagaaccgtgagct 1609



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||| |||||||||||   |||||||||||| || ||||| || |||||||||
Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||||||||| || ||||| ||||| || ||||||||  |||| ||||| || ||||| 
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaaaaaccgtgaactggaa 621

                   
Query: 359 gtgatcca 366
           || |||||
Sbjct: 622 gtcatcca 629



to top

>emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 gene for chlorophyll
           a/b-binding protein
          Length = 741

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 59/64 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atctccacactcactcatctccttgagaacccatagagctgacacttttcttagcgttcc 60
           ||||||||||||||||||||||||||||||||||| ||| |||||||  |||||| ||||
Sbjct: 678 atctccacactcactcatctccttgagaacccatatagcagacacttcgcttagctttcc 737

               
Query: 61  aatg 64
           ||||
Sbjct: 738 aatg 741



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 119/144 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||||||||| || |||||||| ||||| || ||||||||||| ||||| || |||||
Sbjct: 231 ctacctcactggtgaattccctggtgactacgggtgggacactgctggactctctgctga 290

                                                                       
Query: 325 tcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            || ||||||||  | |||||||| || || ||||||||||| ||| | ||||||||| |
Sbjct: 291 cccagagacctttgctaagaaccgcgaacttgaggtgatccactgcagatgggctatgtt 350

                                   
Query: 385 cggggcacttggttgtgtcttccc 408
            || || || || |||||||||||
Sbjct: 351 gggtgctctgggatgtgtcttccc 374



to top

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 110/132 (83%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           ||||| || ||||| || |||||||| ||||||||||| |||||||| ||||| ||  ||
Sbjct: 264 ttcccaggtgactacggctgggacaccgccggactttctgctgatccagagacattttcc 323

                                                                       
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttgt 400
           |||||||| ||||| ||||| ||||| ||| | ||||| ||||| || || ||||| || 
Sbjct: 324 aagaaccgtgagcttgaggtcatccactgcagatgggcaatgcttggagctcttggctgc 383

                       
Query: 401 gtcttccctgag 412
           ||||||||||||
Sbjct: 384 gtcttccctgag 395



to top

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| ||||||||||| ||||    ||||||||||| || ||||| || |||||||||
Sbjct: 227 ggcccattctccggtgaggccccatcttacctcactggtgaattcccaggtgactatggt 286

                                              
Query: 299 tgggacactgccggactttcagctgatcctgagac 333
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 287 tgggacactgccgggctttctgctgaccctgagac 321



to top

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 136/167 (81%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||||||| | |||||||||   ||| | || ||| |||| |||||||||
Sbjct: 153 ggtagcccatggtacggtccagaccgtgtgaagtacttagggccattctctggtgagccc 212

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           |||   ||| | ||||| |||||||| || |||||||||||||||||||| || ||||| 
Sbjct: 213 ccgtcgtacttgactggagagttcccaggtgactatggttgggacactgctgggctttct 272

                                                          
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
           ||||| || ||||| ||  | || ||||| || |||||||| |||||
Sbjct: 273 gctgacccagagacatttgcgaaaaaccgtgaactggaggtaatcca 319



to top

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 109/131 (83%)
 Strand = Plus / Plus

                                                                        
Query: 239  ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
            |||||| |||| |||||  |||| |||||| | ||||| |||   ||||| ||||| || 
Sbjct: 1081 ggcccattctctggtgaagccccaagctacttgactggtgagaaacctggtgactacgga 1140

                                                                        
Query: 299  tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
            ||||||||||| ||||||||||||||||| || || ||  |||||||||| ||| |||||
Sbjct: 1141 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 1200

                       
Query: 359  gtgatccattg 369
            |||||||||||
Sbjct: 1201 gtgatccattg 1211



to top

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 121/147 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||| ||||| ||||| || || |||||||| ||||||||||| || ||||| ||||| 
Sbjct: 241 taccttactggtgagtttccaggtgactatggctgggacactgctgggctttcggctgac 300

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           |||||||| ||  |||||||||| || || || |||||||| | | | ||||| ||||| 
Sbjct: 301 cctgagacttttgccaagaaccgtgaacttgaagtgatccactccagatgggccatgctt 360

                                      
Query: 386 ggggcacttggttgtgtcttccctgag 412
           || || ||||| |||||||||||||||
Sbjct: 361 ggagcccttgggtgtgtcttccctgag 387



to top

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 133/163 (81%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||||||| |||| |||||| | || || || ||||| || || || || ||||| |
Sbjct: 244 tctccggtgagtccccaagctacttgaccggtgaattccccggtgattacgggtgggata 303

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           |||| ||||||||||| || || || |||||  |||||||||| || || ||||||||||
Sbjct: 304 ctgctggactttcagcagacccagaaacctttgccaagaaccgtgaactcgaggtgatcc 363

                                                      
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccc 408
           | ||| | ||||||||||| || || ||||| |||||||||||
Sbjct: 364 actgcagatgggctatgcttggtgctcttggatgtgtcttccc 406



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 290 gactatggttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgg 349
           ||||| || ||||||||||| || ||||| ||||| |||||||| || || |||||||| 
Sbjct: 244 gactacggctgggacactgctgggctttcggctgaccctgagacttttactaagaaccgt 303

                                                                      
Query: 350 gagctggaggtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccc 408
           ||||| |||||||| |||||||| ||||||||| | || || || || |||||||||||
Sbjct: 304 gagctcgaggtgattcattgccgatgggctatgttgggtgctctaggatgtgtcttccc 362



to top

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 72/82 (87%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||| ||||||||  | ||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 180 agcccgtggtacggccccgaccgcgtgctctacctcggcccgctctccggcgagcccccg 239

                                 
Query: 263 agctacctcactggcgagttcc 284
           ||||||||||  ||||||||||
Sbjct: 240 agctacctcagcggcgagttcc 261



 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 156 tcaccatgcgcaagaccgcagcaaaggc 183
           ||||||||||||||||||| || |||||
Sbjct: 139 tcaccatgcgcaagaccgcggccaaggc 166



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 125/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           |||||||| ||||| ||| | | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 217 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggcc 276

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 277 atgctcggagccctaggctgcgtcttccctgag 309



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 254 gagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgccgga 313
           ||||||||||||||||| |||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 186 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 245

                                    
Query: 314 ctttcagctgatcctgagaccttca 338
           || || ||||| || ||||||||||
Sbjct: 246 ctgtccgctgacccggagaccttca 270



to top

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Minus

                                                                       
Query: 254 gagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgccgga 313
           ||||||||||||||||| |||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 236 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggc 177

                                    
Query: 314 ctttcagctgatcctgagaccttca 338
           || || ||||| || ||||||||||
Sbjct: 176 ctgtccgctgacccggagaccttca 152



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 254 gagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgccgga 313
           ||||||||||||||||| |||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 184 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 243

                                    
Query: 314 ctttcagctgatcctgagaccttca 338
           || || ||||| || ||||||||||
Sbjct: 244 ctgtccgctgacccggagaccttca 268



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 125/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||||
Sbjct: 476 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggct 535

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 536 atgctcggagccctaggctgcgtcttccctgag 568



to top

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 280 gttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcac 339
           |||||| || ||||| |||||||||||||| || || || ||||||||||| || ||| |
Sbjct: 47  gttccccggtgactacggttgggacactgctgggctctctgctgatcctgaaacattcgc 106

                                                                       
Query: 340 caagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttg 399
           ||||||||| ||||| ||||| |||||  || | ||||| |||||||| || ||||| ||
Sbjct: 107 caagaaccgtgagcttgaggtcatccacagcagatgggccatgctcggagctcttgggtg 166

                    
Query: 400 tgtcttccc 408
            ||||||||
Sbjct: 167 cgtcttccc 175



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 167/209 (79%)
 Strand = Plus / Plus

                                                                       
Query: 200 ggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagccc 259
           |||||||||||||| ||| ||||||||||    ||| | || ||| |||| || ||| ||
Sbjct: 344 ggtagcccatggtatggtcctgaccgtgttaagtacttgggtccattctctggggagtcc 403

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           || |||||| | || || ||||| ||||| || || || ||||||||||| |||||||||
Sbjct: 404 ccaagctacttgaccggtgagtttcctggtgattacggatgggacactgctggactttca 463

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| ||||| || ||| | |||||||| ||| ||||||| || |||||  | ||||| 
Sbjct: 464 gctgaccctgaaacattcgctaagaaccgtgagttggaggttattcattgtagatgggcc 523

                                        
Query: 380 atgctcggggcacttggttgtgtcttccc 408
           ||||| || || ||||| ||||| |||||
Sbjct: 524 atgcttggtgctcttggatgtgtattccc 552



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                       
Query: 254 gagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgccgga 313
           ||||||||||||||||| |||||||||||||| || ||||| || |||||||| ||||| 
Sbjct: 170 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 229

                                    
Query: 314 ctttcagctgatcctgagaccttca 338
           || || ||||| || ||||||||||
Sbjct: 230 ctgtccgctgacccggagaccttca 254



to top

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 124/152 (81%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| | || 
Sbjct: 142 agcccatggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctcca 201

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
             |||| | ||||| |||||||| || ||||| |||||||||||||||||||| || |||
Sbjct: 202 tcctacttgactggagagttccccggtgactacggttgggacactgccggactctctgct 261

                                           
Query: 323 gatcctgagaccttcaccaagaaccgggagct 354
           || || ||||| ||| |||||||||| |||||
Sbjct: 262 gacccagagacattctccaagaaccgtgagct 293



to top

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           ||||| || ||||| || ||||||||||| ||||| |||||||| || || |||||| ||
Sbjct: 532 ttccccggtgactacggatgggacactgctggactatcagctgacccggaaaccttcgcc 591

                                                                   
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttgg 396
           | ||||||||||||||||||||| ||  || | ||||| ||||| || ||||||||
Sbjct: 592 aggaaccgggagctggaggtgattcacagcagatgggccatgcttggtgcacttgg 647



to top

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 120/146 (82%), Gaps = 3/146 (2%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| |||| |||||||||   
Sbjct: 466 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccc--- 522

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           | |||||||||||| || ||||| || |||||||||||||||||||| || ||||| |||
Sbjct: 523 atctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 582

                                     
Query: 323 gatcctgagaccttcaccaagaaccg 348
           || || ||||||||  ||||||||||
Sbjct: 583 gacccagagacctttgccaagaaccg 608



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 151/188 (80%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||| || |||||||||  |||||| || || |||||||| |||||||| || 
Sbjct: 419 ggcccattctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggc 478

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||||||||| || ||||| || || || || |||||| |||||||||| || || || 
Sbjct: 479 tgggacactgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaa 538

                                                                       
Query: 359 gtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttgctc 418
           |||||||| | | | ||||| |||||||| ||  | || || |||||||| |||||||| 
Sbjct: 539 gtgatccactccaggtgggccatgctcggagccttgggctgcgtcttcccggagttgctg 598

                   
Query: 419 gcccgcaa 426
            |||||||
Sbjct: 599 tcccgcaa 606



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 145/180 (80%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||||
Sbjct: 193 agcccatggtacggcccagaccgtgttaagtacttaggcccattctctggtgagcccccg 252

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              ||| | ||||| |||||||| || ||||| || ||||||||||| |||||||| |||
Sbjct: 253 tcttacttgactggagagttcccaggtgactacggatgggacactgctggactttctgct 312

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| |||||||||| || || || || |||||| || | |||||||||
Sbjct: 313 gacccagagacattcgccaagaaccgtgaacttgaagtcatccatagcaggtgggctatg 372



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 124/152 (81%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||| || |||||||||  ||||||||||||||||||||| || ||||| || 
Sbjct: 200 ggcccattctctggcgagcccccgtcctacctcactggcgagttcccaggtgactacggc 259

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||||||||| || ||||| || || || || |||||| |||  ||||  ||||| || 
Sbjct: 260 tgggacactgctgggctttcggccgacccagaaaccttcgccagaaaccctgagctcgaa 319

                                           
Query: 359 gtgatccattgccgttgggctatgctcggggc 390
           |||||||| | | | ||||| |||||||||||
Sbjct: 320 gtgatccactccaggtgggccatgctcggggc 351



to top

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 168/208 (80%), Gaps = 2/208 (0%)
 Strand = Plus / Minus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||| |||||| |||| |||||| | || || || |||||||| ||||| || 
Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||| || || ||||||||||| || ||||| |||||  |||||||||| || || |||
Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499

                                                                       
Query: 359 gtgatccattgccgttgggctatgctcggggcacttggttgtgtcttccctgagttgctc 418
           |||||||| ||| | | ||||||||| || || ||| | ||||||||||||||| |  | 
Sbjct: 498 gtgatccactgcagat-ggctatgcttggtgctctt-gatgtgtcttccctgagctattg 441

                                       
Query: 419 gcccgcaatggcctcaacttcggtgagg 446
           ||||| |||||  |||| ||||||||||
Sbjct: 440 gcccgtaatggtgtcaagttcggtgagg 413



to top

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 193/244 (79%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||| ||  ||||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 329 agcccatggtatggccctgaccgtgttaagtacttgggcccattctctggtgagtcccca 388

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||| | || || || || ||||| || || || ||||| || || ||||||||||| 
Sbjct: 389 agctacttgaccggtgaatttcctggtgattacgggtgggataccgctggactttcagca 448

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || ||||| || ||  |||||||||| || || || |||||||| ||| | |||||||||
Sbjct: 449 gaccctgaaacttttgccaagaaccgtgaacttgaagtgatccactgcagatgggctatg 508

                                                                       
Query: 383 ctcggggcacttggttgtgtcttccctgagttgctcgcccgcaatggcctcaacttcggt 442
           || || || ||||| ||||||||||||||| |  | ||||| |||||  |||| ||||||
Sbjct: 509 cttggtgctcttggatgtgtcttccctgagctcttggcccgtaatggtgtcaagttcggt 568

               
Query: 443 gagg 446
           ||||
Sbjct: 569 gagg 572



to top

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 124/152 (81%)
 Strand = Plus / Plus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| | || 
Sbjct: 1161 agcccatggtacggaccagaccgtgttaagtacttaggcccattctccggtgagtctcca 1220

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              |||| | ||||| |||||||| || ||||| |||||||||||||||||||| || |||
Sbjct: 1221 tcctacttgactggagagttccccggtgactacggttgggacactgccggactctctgct 1280

                                            
Query: 323  gatcctgagaccttcaccaagaaccgggagct 354
            || || ||||| ||| |||||||||| |||||
Sbjct: 1281 gacccagagacattctccaagaaccgtgagct 1312



to top

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           |||||||| ||||| || ||||| ||||| ||| | |||||||| || ||||| ||  ||
Sbjct: 760 ttccctggggactacgggtgggatactgctggattatcagctgacccagagacatttgcc 819

                                                                       
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttgt 400
           |||||||| ||||| ||||||||||| ||  | ||||||||||| || || ||||| |||
Sbjct: 820 aagaaccgtgagcttgaggtgatccactgtaggtgggctatgcttggtgcccttggctgt 879

                      
Query: 401 gtcttccctga 411
           || ||||||||
Sbjct: 880 gttttccctga 890



to top

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           |||||||| |||||||||||||||||||| ||||||||||| || || || |||||  ||
Sbjct: 383 ttccctggtgactatggttgggacactgctggactttcagcagacccagaaacctttgcc 442

                                                                       
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttgt 400
           |  ||||| ||||| |||||||||||  || | ||||| ||||| || ||  | ||||||
Sbjct: 443 agaaaccgtgagcttgaggtgatccacagcaggtgggccatgcttggtgccttaggttgt 502

                      
Query: 401 gtcttccctga 411
           || ||||||||
Sbjct: 503 gtattccctga 513



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 129/159 (81%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| || ||||||||||| || ||||| || |||||||| ||||| ||    || ||
Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437

                                                                       
Query: 325 tcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            || ||||||||| |||||||||| |||||||||||||||||  | || ||||| |||||
Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatccacgggcgctgggcgatgct 497

                                                  
Query: 385 cggggcacttggttgtgtcttccctgagttgctcgcccg 423
            ||||| || || || |||||||| ||| | ||||||||
Sbjct: 498 gggggcgctcgggtgcgtcttcccggagctcctcgcccg 536



to top

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||||||||| || |||||||| || || |||||||||||||| || || |||||||| 
Sbjct: 543 tacctcactggagaattccctggtgattacggttgggacactgctgggctctcagctgac 602

                                                      
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccatt 368
           || ||||||||  |||||||||| ||||| || || |||||||
Sbjct: 603 ccagagacctttgccaagaaccgtgagcttgaagttatccatt 645



to top

>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 732

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 119/146 (81%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||| ||||| || ||||| || || ||||| ||||||||||| ||  | || || |||
Sbjct: 136 taccttactggtgaattccccggtgattatggatgggacactgctggtttatctgcagat 195

                                                                       
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctc 385
           ||||| || ||  |||||||||| ||||| || |||||||| ||| | ||||||||||| 
Sbjct: 196 cctgaaacatttgccaagaaccgtgagcttgaagtgatccactgcagatgggctatgctt 255

                                     
Query: 386 ggggcacttggttgtgtcttccctga 411
           || |||||||| || |||||||||||
Sbjct: 256 ggtgcacttggctgcgtcttccctga 281



to top

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 196 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 255

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 256 cccggagaccttca 269



to top

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 167/210 (79%)
 Strand = Plus / Minus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  ||||||| |||   ||| | || ||| ||||||| |||||||||
Sbjct: 282 agcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagcccccg 223

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || |||||||| || ||||| || |||||||| || || || || || 
Sbjct: 222 agctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatccgcc 163

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||||||| ||| |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 162 gacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggccatg 103

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || || |||||||||
Sbjct: 102 ctcggagccctaggctgcgttttccctgag 73



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 86/102 (84%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| || ||||||||||| || ||||| || ||||||||||| || || || |||||
Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262

                                                     
Query: 325 tcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
            || ||||||||||  ||| |||| |||||||||||||||||
Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatcca 304



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 201 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 260

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 261 cccggagaccttca 274



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 319 atgctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 385 atgctcggagccctaggctgcgtcttccctgag 417



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 354 atgctcggagccctaggctgcgtcttccctgag 386



to top

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 369 atgctcggagccctaggctgcgtcttccctgag 401



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 124/153 (81%)
 Strand = Plus / Plus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204

                                                                       
Query: 320 gctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggct 379
           ||||| || ||||| ||| | | |||||| || || || || |||||  || | ||||| 
Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264

                                            
Query: 380 atgctcggggcacttggttgtgtcttccctgag 412
           |||||||| || || || || ||||||||||||
Sbjct: 265 atgctcggagccctaggctgcgtcttccctgag 297



to top

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                        
Query: 278  gagttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttc 337
            |||||||| || ||||| |||||||||||||||||||| || ||||| || ||||| |||
Sbjct: 935  gagttccccggtgactacggttgggacactgccggactctctgctgacccagagacattc 994

                             
Query: 338  accaagaaccgggagct 354
             |||||||||| |||||
Sbjct: 995  tccaagaaccgtgagct 1011



to top

>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein
          Length = 928

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 117/144 (81%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| ||||| ||||| || || || ||| | 
Sbjct: 244 ggcgagttccccggcgactacggctgggacaccgccgggctttctgccgacccggaggcg 303

                                                                       
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcactt 394
           ||| | | |||| ||| ||| |||||||||||  |||| ||||| |||||||| || |||
Sbjct: 304 ttcgctaggaacagggcgctagaggtgatccacggccggtgggcgatgctcggcgctctt 363

                                   
Query: 395 ggttgtgtcttccctgagttgctc 418
           || || |||||||| ||| |||||
Sbjct: 364 gggtgcgtcttccccgaggtgctc 387



to top

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 132/164 (80%)
 Strand = Plus / Plus

                                                                        
Query: 203  agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
            ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 893  agcccatggtacggcccagaccgtgtcaagtacttgggcccattctcaggtgagcccccc 952

                                                                        
Query: 263  agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
              ||| |||||||| || ||||| || |||||||||||||||||||| || ||||| |||
Sbjct: 953  tcctatctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 1012

                                                        
Query: 323  gatcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
            || || ||||| ||  |||| ||||| || ||||| || |||||
Sbjct: 1013 gacccagagacttttgccaaaaaccgtgaactggaagtcatcca 1056



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 246  tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
            ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 3065 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3006

                                                                        
Query: 306  ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
            | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 3005 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 2946

                                                           
Query: 366  attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
            |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 2945 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 2899



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                        
Query: 246  tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
            ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 3104 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3045

                                                                        
Query: 306  ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
            | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 3044 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 2985

                                                           
Query: 366  attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
            |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 2984 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 2938



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 354 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 400



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 354 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 400



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 299 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 354 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 400



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 299 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 299 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 299 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 345



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 350 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 350 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 350 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 350 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 350 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 396



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 350 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 396



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 211 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 270

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 271 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 330

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 331 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 377



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 214 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 273

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 274 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 333

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 334 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 380



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 134/167 (80%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 479 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 538

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| |||||| ||||| || || ||||
Sbjct: 539 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 598

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 599 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 645



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 107/131 (81%)
 Strand = Plus / Plus

                                                                       
Query: 278 gagttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttc 337
           |||||||| |||||||| || ||||||||||| || || || || || || ||||| |||
Sbjct: 265 gagttccccggcgactacggatgggacactgctgggctgtcggcggacccagagactttc 324

                                                                       
Query: 338 accaagaaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggt 397
            ||| |||||| ||||||||||||||||| |   | ||||| |||||||| || || |||
Sbjct: 325 gccaggaaccgtgagctggaggtgatccactcgaggtgggccatgctcggcgctctcggt 384

                      
Query: 398 tgtgtcttccc 408
           || ||||||||
Sbjct: 385 tgcgtcttccc 395



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||| ||||| || || |||||
Sbjct: 177 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 236

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 237 cccggagaccttca 250



to top

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 82/98 (83%)
 Strand = Plus / Plus

                                                                       
Query: 269 ctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgatcct 328
           ||||| ||||| || || |||||||| || |||||||| ||||| || || || || |||
Sbjct: 282 ctcaccggcgaatttcccggcgactacgggtgggacaccgccgggctctctgccgaccct 341

                                                 
Query: 329 gagaccttcaccaagaaccgggagctggaggtgatcca 366
           ||||||||| |||| ||| | |||||||||||||||||
Sbjct: 342 gagaccttcgccaaaaacagagagctggaggtgatcca 379



to top

>gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA
          Length = 454

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 74/86 (86%), Gaps = 1/86 (1%)
 Strand = Plus / Plus

                                                                       
Query: 239 ggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatggt 298
           |||||| |||||||||||||||||  |||||||||||| |||||||| || |||||  | 
Sbjct: 265 ggcccattctccggtgagcccccgtcctacctcactggtgagttcccaggtgacta-cgc 323

                                     
Query: 299 tgggacactgccggactttcagctga 324
           ||||||||||| || ||||| |||||
Sbjct: 324 tgggacactgctgggctttccgctga 349



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||| ||||| || || |||||
Sbjct: 193 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 252

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 253 cccggagaccttca 266



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||| ||||| || || |||||
Sbjct: 223 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 282

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 283 cccggagaccttca 296



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1508

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||| ||||| || || |||||
Sbjct: 641 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 700

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 701 cccggagaccttca 714



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||||| ||||| || || |||||
Sbjct: 851 ctacctgactggcgagttccccggcgactacggctgggacaccgccggtctgtcggctga 910

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 911 cccggagaccttca 924



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||| |||||||||||||| |||||||| || |||||||| ||||| || || ||||| 
Sbjct: 205 tacctgactggcgagttccccggcgactacggctgggacaccgccggcctgtccgctgac 264

                        
Query: 326 cctgagaccttca 338
           || ||||||||||
Sbjct: 265 ccggagaccttca 277



to top

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Minus

                                                                       
Query: 260 ccgagctacctcactggcgagttccctggcgactatggttgggacactgccggactttca 319
           ||||||||||| || || |||||||| || ||||| || ||||||||||| | |||||||
Sbjct: 677 ccgagctaccttaccggagagttccccggagactacggatgggacactgctgtactttca 618

                        
Query: 320 gctgatcctgaga 332
           |||||||| ||||
Sbjct: 617 gctgatcccgaga 605



to top

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Plus

                                                                       
Query: 272 actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
           ||||| || |||||||| ||||| || ||||||||||| ||||| || || || ||||||
Sbjct: 208 actggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctgag 267

                                                                       
Query: 332 accttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcggggca 391
           || ||  | || ||| | ||||| |||||||||||  |||| ||||| ||||| || |||
Sbjct: 268 acatttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgcttggtgca 327

                            
Query: 392 cttggttgtgtcttccc 408
           || || |||||||||||
Sbjct: 328 ctgggatgtgtcttccc 344



to top

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 75/89 (84%)
 Strand = Plus / Plus

                                                                       
Query: 296 ggttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctg 355
           |||||||||||||| ||||| |||||||| || || || ||| | |||||||| ||||| 
Sbjct: 256 ggttgggacactgctggactctcagctgacccagaaacattcgctaagaaccgtgagcta 315

                                        
Query: 356 gaggtgatccattgccgttgggctatgct 384
           ||||||||||| ||| | ||||| |||||
Sbjct: 316 gaggtgatccactgcagatgggcaatgct 344



to top

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 278 gagttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttc 337
           |||||||| || ||||| |||||||||||||| |||||||| || ||||| ||||| || 
Sbjct: 104 gagttcccaggtgactacggttgggacactgctggactttctgccgatccagagacattt 163

                            
Query: 338 accaagaaccgggagct 354
            |||||||||| |||||
Sbjct: 164 gccaagaaccgtgagct 180



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 266  tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
            ||||| |||||||||||||| |||||||| || |||||||| ||||| || || ||||| 
Sbjct: 980  tacctgactggcgagttccccggcgactacggctgggacaccgccggcctgtccgctgac 1039

                         
Query: 326  cctgagaccttca 338
            || ||||||||||
Sbjct: 1040 ccggagaccttca 1052



to top

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                        
Query: 287  ggcgactatggttgggacactgccggactttcagctgatcctgagaccttcaccaagaac 346
            |||||||| || |||||||||||||| || || || ||||| ||||||||| | || |||
Sbjct: 2494 ggcgactacgggtgggacactgccggcctctcggcggatccagagaccttcgcaaaaaac 2553

                                
Query: 347  cgggagctggaggtgatcca 366
             | |||||||||||||||||
Sbjct: 2554 agagagctggaggtgatcca 2573



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 203 agcccatggtacggtgctgaccgtgtgctctaccttggcccactctccggtgagcccccg 262
           ||||||||||||||  ||||||| |||   ||| | || ||| ||||||| |||||||||
Sbjct: 171 agcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagcccccg 230

                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacac 306
           |||||||| || || |||||||| || ||||| || ||||||||
Sbjct: 231 agctaccttaccggtgagttccccggtgactacggatgggacac 274



to top

>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein
          Length = 686

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 314 ctttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgt 373
           ||||| |||||||| ||||| ||| |||||||||| ||||| |||||||||||  |  | 
Sbjct: 34  ctttctgctgatcccgagactttcgccaagaaccgtgagctcgaggtgatccacagtaga 93

                                           
Query: 374 tgggctatgctcggggcacttggttgtgtctt 405
           ||||||||||| || || ||||| ||||||||
Sbjct: 94  tgggctatgcttggagcccttggctgtgtctt 125



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||| |||||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 13  tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || ||||| || ||||| ||  | | |||||| ||||| || || ||||
Sbjct: 73  cagctggcctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatcc 132

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || ||||||||||||
Sbjct: 133 acagcaggtgggccatgctcggagccctaggctgcgtcttccctgag 179



to top

>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA,
           partial cds
          Length = 446

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                       
Query: 290 gactatggttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgg 349
           |||||||| ||||||||||| ||| | || || || |||||||| ||  | |||||||| 
Sbjct: 312 gactatggctgggacactgctggattatccgcagaccctgagacatttgctaagaaccgt 371

                                              
Query: 350 gagctggaggtgatccattgccgttgggctatgct 384
           |||||||||||||||||  |||| ||||| |||||
Sbjct: 372 gagctggaggtgatccacagccgatgggccatgct 406



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 221 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 280

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || || |||||| ||| |||||| ||||| || || ||||
Sbjct: 281 ccgctggtctatccgccgacccagaaaccttcgccaggaaccgtgagctagaagttatcc 340

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 341 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 387



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 133/167 (79%)
 Strand = Plus / Minus

                                                                       
Query: 246 tctccggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggaca 305
           ||||||| ||||||||||||||||| || || |||||||| || ||||| || |||||||
Sbjct: 705 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 646

                                                                       
Query: 306 ctgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggaggtgatcc 365
           | || || || || || || || ||||||||| ||| | |||| ||||| || || ||||
Sbjct: 645 ccgctggtctatccgccgacccagagaccttcgccagggaccgtgagctagaagttatcc 586

                                                          
Query: 366 attgccgttgggctatgctcggggcacttggttgtgtcttccctgag 412
           |  || | ||||| |||||||| || || || || || |||||||||
Sbjct: 585 acagcagatgggccatgctcggagccctaggctgcgttttccctgag 539



to top

>emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b binding polypeptide of
           photosystem II (LHCP-II AB10)
          Length = 1306

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctgat 325
           ||||||||||| || |||||||| || || |||||||||||||| || || |||||  | 
Sbjct: 555 tacctcactggagaattccctggtgattacggttgggacactgctggcctctcagcctac 614

                                                      
Query: 326 cctgagaccttcaccaagaaccgggagctggaggtgatccatt 368
           || ||||||||| | |||||||| ||||| || || |||||||
Sbjct: 615 ccagagaccttcgctaagaaccgtgagcttgaagtcatccatt 657



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| |||||||||||||| |||||||| || |||||| | ||||| || || |||||
Sbjct: 246 ctacctgactggcgagttccccggcgactacggctgggactccgccggtctgtcggctga 305

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 306 ccccgagaccttca 319



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 60/70 (85%)
 Strand = Plus / Plus

                                                                       
Query: 237 ttggcccactctccggtgagcccccgagctacctcactggcgagttccctggcgactatg 296
           |||| ||| ||||||| ||||||||||||||||| || || |||||||| || ||||| |
Sbjct: 200 ttggtccattctccggcgagcccccgagctaccttaccggtgagttccccggtgactacg 259

                     
Query: 297 gttgggacac 306
           | ||||||||
Sbjct: 260 gatgggacac 269



to top

>gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative chlorophyll a/b-binding
           protein mRNA, complete cds
          Length = 1118

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           ||||||||||||||||||||| || || || || ||||||||||| ||  | || || ||
Sbjct: 290 ctacctcactggcgagttccccggtgattacggctgggacactgctggcttgtcggcgga 349

                                                     
Query: 325 tcctgagaccttcaccaagaaccgggagctggaggtgatcca 366
            || || |||||| | ||||| |||||||||||||| |||||
Sbjct: 350 cccagaaaccttcgctaagaatcgggagctggaggtcatcca 391



to top

>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein,
           complete cds
          Length = 895

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 72/86 (83%)
 Strand = Plus / Plus

                                                                       
Query: 299 tgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgggagctggag 358
           ||||||||||| ||||| |||||||| || ||||| ||  | |  ||||| ||||| |||
Sbjct: 293 tgggacactgctggactctcagctgaccccgagacatttgctagaaaccgtgagcttgag 352

                                     
Query: 359 gtgatccattgccgttgggctatgct 384
           ||||| |||||||||||||| |||||
Sbjct: 353 gtgattcattgccgttgggccatgct 378



to top

>gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end
          Length = 1919

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 281 ttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcacc 340
           ||||| || ||||| |||||||||||||| |||||||| |||||||| ||||| ||  ||
Sbjct: 4   ttccccggtgactacggttgggacactgctggactttctgctgatccagagactttttcc 63

                                                     
Query: 341 aagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || || || || ||||| |||||| || | |||||||||
Sbjct: 64  aaaaatcgtgaactagaggtcatccatagcaggtgggctatg 105



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| ||||||||||| |||||||| || || || || || || || ||| | 
Sbjct: 271 ggcgagttcccgggcgactatgggtgggacacggcggggctctccgcggacccggaggcg 330

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 331 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                        
Query: 265  ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
            ||||||||||||||||||||| || ||||| || |||||||| ||||| || || || ||
Sbjct: 1146 ctacctcactggcgagttccccggtgactacggctgggacaccgccggcctgtccgccga 1205

                         
Query: 325  tcctgagaccttc 337
             || |||||||||
Sbjct: 1206 ccccgagaccttc 1218



to top

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 290 gactatggttgggacactgccggactttcagctgatcctgagaccttcaccaagaaccgg 349
           ||||| || |||||||| ||||| || || || ||||| ||||||||| |||| ||| | 
Sbjct: 169 gactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaaaaacaga 228

                            
Query: 350 gagctggaggtgatcca 366
           |||||||||||||||||
Sbjct: 229 gagctggaggtgatcca 245



to top

>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 104/129 (80%)
 Strand = Plus / Plus

                                                                        
Query: 284  cctggcgactatggttgggacactgccggactttcagctgatcctgagaccttcaccaag 343
            ||||| || ||||||||||| ||||| |||||||| || ||||| || || ||  |||| 
Sbjct: 2771 cctggtgattatggttgggatactgctggactttcggccgatccagaaacttttgccaaa 2830

                                                                        
Query: 344  aaccgggagctggaggtgatccattgccgttgggctatgctcggggcacttggttgtgtc 403
            ||||| ||||| ||||| || || ||| | ||||| ||||| || || |||||||| |||
Sbjct: 2831 aaccgtgagctagaggttattcactgcagatgggccatgcttggagctcttggttgcgtc 2890

                     
Query: 404  ttccctgag 412
            || ||||||
Sbjct: 2891 tttcctgag 2899



to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m1 gene, complete cds; nuclear gene for chloroplast
           product
          Length = 1934

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 254 gagcccccgagctacctcactggcgagttccc 285
           ||||||||||||||||| ||||||||||||||
Sbjct: 493 gagcccccgagctacctgactggcgagttccc 524



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 115/144 (79%)
 Strand = Plus / Plus

                                                                       
Query: 190 ggtttgctccggtagcccatggtacggtgctgaccgtgtgctctaccttggcccactctc 249
           ||||| ||| || ||||||||||||||  | |||||||||   ||||| |||||| ||||
Sbjct: 179 ggtttcctctggaagcccatggtacggcccagaccgtgtgaagtacctgggcccattctc 238

                                                                       
Query: 250 cggtgagcccccgagctacctcactggcgagttccctggcgactatggttgggacactgc 309
            |||||| | ||    ||||| || || || ||||| || |||||||| |||||||||||
Sbjct: 239 gggtgaggctccttcttacctgacgggggaattcccaggtgactatgggtgggacactgc 298

                                   
Query: 310 cggactttcagctgatcctgagac 333
           ||| ||||| ||||| || |||||
Sbjct: 299 cgggctttcggctgacccggagac 322



to top

>gb|L07120.1|COTIIABINB Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, exons 1-3
          Length = 1820

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 272 actggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgag 331
           ||||| || |||||||| |||||||||||||||||||| ||  | ||||| |||||||||
Sbjct: 633 actggagaattccctggtgactatggttgggacactgctggtttgtcagccgatcctgag 692



to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 1781

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 254 gagcccccgagctacctcactggcgagttccc 285
           ||||||||||||||||| ||||||||||||||
Sbjct: 406 gagcccccgagctacctgactggcgagttccc 437



to top

>ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CHLOROPHYLL BINDING
           PROTEIN 3) AT5G54270 (LHCB3) mRNA, complete cds
          Length = 1078

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 291 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 337



to top

>ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA MYOSIN 4) AT5G54280
            (ATM2) mRNA, complete cds
          Length = 4559

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 266  tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
            |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 4199 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 4153



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 87/107 (81%)
 Strand = Plus / Plus

                                                                       
Query: 278 gagttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttc 337
           |||||||| || ||||| || ||||||||||| || ||||| || ||||| ||||| || 
Sbjct: 234 gagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggagactttt 293

                                                          
Query: 338 accaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            | |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 294 gcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340



to top

>gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, complete cds
          Length = 952

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 263 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 309



to top

>gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, complete cds
          Length = 798

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 196 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 242



to top

>gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, complete cds
          Length = 936

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 269 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 315



to top

>emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB58ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 248 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 294



to top

>emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS60ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 920

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 245 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 291



to top

>gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (Lhcb3) mRNA,
           complete cds
          Length = 939

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 259 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 305



to top

>dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDK4
          Length = 78596

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 266   tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
             |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 41479 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 41525



to top

>emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyll a/b-binding protein,
            partial
          Length = 2036

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 266  tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
            |||||||| || ||||| || |||||||||||||||||||| |||||
Sbjct: 1568 tacctcaccggagagtttcccggcgactatggttgggacaccgccgg 1614



to top

>gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll a/b binding protein
           (LHCB3*1) mRNA, complete cds
          Length = 942

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           |||||||| || || ||||||||||| |||||||||||||| |||||
Sbjct: 220 tacctcaccggagaattccctggcgattatggttgggacaccgccgg 266



to top

>dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat
           inducible, partial cds, clone:M26
          Length = 476

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                          
Query: 266 tacctcactggcgagttccctggcgactatggttgggacactgccgg 312
           ||||| || ||||||||||| |||||||| || ||||||||||||||
Sbjct: 253 tacctgaccggcgagttccccggcgactacggctgggacactgccgg 299



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 389 ctcggagccctaggctgcgtcttccctgag 418



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 375 ctcggagccctaggctgcgtcttccctgag 404



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 375 ctcggagccctaggctgcgtcttccctgag 404



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagctga 324
           |||||| || ||||||||||| || ||||| || |||||||| ||||| || || |||||
Sbjct: 189 ctacctgaccggcgagttccccggtgactacggctgggacaccgccggcctgtcggctga 248

                         
Query: 325 tcctgagaccttca 338
            || ||||||||||
Sbjct: 249 cccggagaccttca 262



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 322 ctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 374 ctcggagccctaggctgcgtcttccctgag 403



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 322 ctcggagccctaggctgcgtcttccctgag 351



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 248 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 307

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 308 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 367

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 368 ctcggagccctaggctgcgtcttccctgag 397



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 374 ctcggagccctaggctgcgtcttccctgag 403



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 240 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 299

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 300 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 359

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 360 ctcggagccctaggctgcgtcttccctgag 389



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 119/150 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 347 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 406

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 407 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 466

                                         
Query: 383 ctcggggcacttggttgtgtcttccctgag 412
           ||||| || || || || ||||||||||||
Sbjct: 467 ctcggagccctaggctgcgtcttccctgag 496



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 242 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 301

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 302 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 354



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 266 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 325

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 326 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 378



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 266 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 325

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 326 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 378



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 268 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 327

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 328 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 380



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 330

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 331 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 330

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 331 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 273 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 332

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 333 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 385



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 306 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 365

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 366 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 418



to top

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 86/107 (80%)
 Strand = Plus / Plus

                                                                       
Query: 278 gagttccctggcgactatggttgggacactgccggactttcagctgatcctgagaccttc 337
           |||||||| || ||||| || |||||||| || || ||||| || ||||| ||||| || 
Sbjct: 223 gagttcccgggtgactacgggtgggacacwgcggggctttcggcggatccggagactttt 282

                                                          
Query: 338 accaagaaccgggagctggaggtgatccattgccgttgggctatgct 384
            | |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 283 gcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                            
Query: 275      ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
                ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 22434279 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 22434338

                                                                     
Query: 335      ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
                ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 22434339 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 22434391



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 118/149 (79%)
 Strand = Plus / Plus

                                                                       
Query: 263 agctacctcactggcgagttccctggcgactatggttgggacactgccggactttcagct 322
           |||||||| || || ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 323 gatcctgagaccttcaccaagaaccgggagctggaggtgatccattgccgttgggctatg 382
           || || ||||| ||| | | |||||| ||||| || || |||||  || | ||||| |||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                                        
Query: 383 ctcggggcacttggttgtgtcttccctga 411
           ||||| || || || || |||||||||||
Sbjct: 389 ctcggagccctaggctgcgtcttccctga 417



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                         
Query: 275   ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
             ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 95346 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 95405

                                                                  
Query: 335   ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
             ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 95406 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 95458



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 330

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 331 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 91/113 (80%)
 Strand = Plus / Plus

                                                                       
Query: 275 ggcgagttccctggcgactatggttgggacactgccggactttcagctgatcctgagacc 334
           ||||||||||| |||||||| || |||||||| || || || || || || || ||| | 
Sbjct: 271 ggcgagttcccgggcgactacgggtgggacacggcggggctctccgcggacccggaggcg 330

                                                                
Query: 335 ttcaccaagaaccgggagctggaggtgatccattgccgttgggctatgctcgg 387
           ||| | | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 331 ttcgcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,343,872
Number of Sequences: 3902068
Number of extensions: 3343872
Number of successful extensions: 59219
Number of sequences better than 10.0: 314
Number of HSP's better than 10.0 without gapping: 312
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 58359
Number of HSP's gapped (non-prelim): 808
length of query: 475
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 453
effective length of database: 17,147,199,772
effective search space: 7767681496716
effective search space used: 7767681496716
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top