ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet72b10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT017621.1| Zea mays clone EL01N0435E12.c mRNA sequence 100 4e-18
2gb|AY105052.1| Zea mays PCO138078 mRNA sequence 92 1e-15
3dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 54 2e-04
4dbj|AK103126.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
5gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome... 54 2e-04
6dbj|AB026564.1| Oryza sativa (japonica cultivar-group) OsPBB1 mR... 54 2e-04
7ref|XM_476072.1| Oryza sativa (japonica cultivar-group), predic... 50 0.003
8gb|AF011889.1|AF011889 Human Xq28 cosmids U126G1, U142F2, U69B6,... 42 0.79
9emb|CT574592.2| Pan troglodytes chromosome X clone PTB-082B15 ma... 42 0.79
10emb|CT573418.2| Pan troglodytes chromosome X clone PTB-046H01 ma... 42 0.79
11gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 3.1
12emb|AJ132364.1|PST132364 Pseudomonas stutzeri (strain JM300) pil... 40 3.1
13gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 3.1
14gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 40 3.1
15gb|BC098835.1| Rattus norvegicus proteasome (prosome, macropain)... 40 3.1
16ref|NM_001025637.1| Rattus norvegicus proteasome (prosome, macro... 40 3.1
17gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete ge... 40 3.1

>gb|BT017621.1| Zea mays clone EL01N0435E12.c mRNA sequence
          Length = 1144

 Score = 99.6 bits (50), Expect = 4e-18
 Identities = 104/122 (85%)
 Strand = Plus / Plus

                                                                       
Query: 108 atggaactccctaccaagggcggcttcagcttcgacctgtgccgcaggaacgccatgctg 167
           ||||| |||||  |||||||||| ||||||||||||||||||||| |||||  |||||||
Sbjct: 112 atggatctcccggccaagggcgggttcagcttcgacctgtgccgccggaacaacatgctg 171

                                                                       
Query: 168 gagaagacgggccacacgatgcccgggttcaggaagaccgggactaccatcgtcggtctc 227
           |||||||  || | || | | || || ||||||||||||||||| ||||||||||| |||
Sbjct: 172 gagaagaacgggctcaaggtcccgggattcaggaagaccgggacaaccatcgtcggcctc 231

             
Query: 228 gt 229
           ||
Sbjct: 232 gt 233



to top

>gb|AY105052.1| Zea mays PCO138078 mRNA sequence
          Length = 1368

 Score = 91.7 bits (46), Expect = 1e-15
 Identities = 103/122 (84%)
 Strand = Plus / Plus

                                                                       
Query: 108 atggaactccctaccaagggcggcttcagcttcgacctgtgccgcaggaacgccatgctg 167
           ||||| |||||  |||||||||| ||||||||||||||||| ||| |||||  |||||||
Sbjct: 206 atggatctcccggccaagggcgggttcagcttcgacctgtgtcgccggaacaacatgctg 265

                                                                       
Query: 168 gagaagacgggccacacgatgcccgggttcaggaagaccgggactaccatcgtcggtctc 227
           |||||||  || | || | | || || ||||||||||||||||| ||||||||||| |||
Sbjct: 266 gagaagaacggactcaaggtcccgggattcaggaagaccgggacaaccatcgtcggcctc 325

             
Query: 228 gt 229
           ||
Sbjct: 326 gt 327



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                           
Query: 94      ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 153
               ||||||||||| ||| ||| |||||  | |||||||| ||||||| ||||   |||   |
Sbjct: 5278011 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 5278070

                                                                           
Query: 154     ggaacgccatgctggagaagacgggccacacgatgcccgggttcaggaagaccgggacta 213
               ||||||||||||| | | ||| ||||   | |||||| ||||||   |||||||||||||
Sbjct: 5278071 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 5278130

                          
Query: 214     ccatcgtcggt 224
               |||||||||||
Sbjct: 5278131 ccatcgtcggt 5278141



to top

>dbj|AK103126.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119N09, full
           insert sequence
          Length = 1195

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 94  ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 153
           ||||||||||| ||| ||| |||||  | |||||||| ||||||| ||||   |||   |
Sbjct: 216 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 275

                                                                       
Query: 154 ggaacgccatgctggagaagacgggccacacgatgcccgggttcaggaagaccgggacta 213
           ||||||||||||| | | ||| ||||   | |||||| ||||||   |||||||||||||
Sbjct: 276 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 335

                      
Query: 214 ccatcgtcggt 224
           |||||||||||
Sbjct: 336 ccatcgtcggt 346



to top

>gb|AC093954.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1097_A12,
             complete sequence
          Length = 88725

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                         
Query: 94    ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 153
             ||||||||||| ||| ||| |||||  | |||||||| ||||||| ||||   |||   |
Sbjct: 14712 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 14771

                                                                         
Query: 154   ggaacgccatgctggagaagacgggccacacgatgcccgggttcaggaagaccgggacta 213
             ||||||||||||| | | ||| ||||   | |||||| ||||||   |||||||||||||
Sbjct: 14772 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 14831

                        
Query: 214   ccatcgtcggt 224
             |||||||||||
Sbjct: 14832 ccatcgtcggt 14842



to top

>dbj|AB026564.1| Oryza sativa (japonica cultivar-group) OsPBB1 mRNA for beta 2
           subunit of 20S proteasome, complete cds
          Length = 1122

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 94  ggatggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgca 153
           ||||||||||| ||| ||| |||||  | |||||||| ||||||| ||||   |||   |
Sbjct: 109 ggatggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcga 168

                                                                       
Query: 154 ggaacgccatgctggagaagacgggccacacgatgcccgggttcaggaagaccgggacta 213
           ||||||||||||| | | ||| ||||   | |||||| ||||||   |||||||||||||
Sbjct: 169 ggaacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggacta 228

                      
Query: 214 ccatcgtcggt 224
           |||||||||||
Sbjct: 229 ccatcgtcggt 239



to top

>ref|XM_476072.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 819

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 103/129 (79%)
 Strand = Plus / Plus

                                                                       
Query: 96  atggccggatcgatggaactccctaccaagggcggcttcagcttcgacctgtgccgcagg 155
           ||||||||| ||| ||| |||||  | |||||||| ||||||| ||||   |||   |||
Sbjct: 1   atggccggagcgacggatctccccccgaagggcgggttcagctacgacaattgcgcgagg 60

                                                                       
Query: 156 aacgccatgctggagaagacgggccacacgatgcccgggttcaggaagaccgggactacc 215
           ||||||||||| | | ||| ||||   | |||||| ||||||   |||||||||||||||
Sbjct: 61  aacgccatgcttgtggagaagggcttgaagatgcctgggttcctcaagaccgggactacc 120

                    
Query: 216 atcgtcggt 224
           |||||||||
Sbjct: 121 atcgtcggt 129



to top

>gb|AF011889.1|AF011889 Human Xq28 cosmids U126G1, U142F2, U69B6, U145C10, U169A5, U84H1,
             U24D12, U80A7, U153E6, L35485, and R7-163A8 containing
             iduronate 2-sulfatase gene and pseudogene, complete
             sequence
          Length = 326663

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 81    gagatcagccgcaggatggcc 101
             |||||||||||||||||||||
Sbjct: 78362 gagatcagccgcaggatggcc 78342



to top

>emb|CT574592.2| Pan troglodytes chromosome X clone PTB-082B15 map Xq28, complete
             sequence
          Length = 228540

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 81    gagatcagccgcaggatggcc 101
             |||||||||||||||||||||
Sbjct: 38105 gagatcagccgcaggatggcc 38085



to top

>emb|CT573418.2| Pan troglodytes chromosome X clone PTB-046H01 map Xq28, complete sequence
          Length = 161084

 Score = 42.1 bits (21), Expect = 0.79
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 81     gagatcagccgcaggatggcc 101
              |||||||||||||||||||||
Sbjct: 123648 gagatcagccgcaggatggcc 123628



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 78      tccgagatcagccgcaggat 97
               ||||||||||||||||||||
Sbjct: 1791914 tccgagatcagccgcaggat 1791895



to top

>emb|AJ132364.1|PST132364 Pseudomonas stutzeri (strain JM300) pilD, pilC, pilB and pilA genes
            and ORFX
          Length = 5625

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 87   agccgcaggatggccggatc 106
            ||||||||||||||||||||
Sbjct: 4045 agccgcaggatggccggatc 4026



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 78      tccgagatcagccgcaggat 97
               ||||||||||||||||||||
Sbjct: 4616281 tccgagatcagccgcaggat 4616300



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 78      tccgagatcagccgcaggat 97
               ||||||||||||||||||||
Sbjct: 1789597 tccgagatcagccgcaggat 1789578



to top

>gb|BC098835.1| Rattus norvegicus proteasome (prosome, macropain) subunit, beta
           type 10, mRNA (cDNA clone MGC:112890 IMAGE:7378841),
           complete cds
          Length = 1021

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 201 aagaccgggactaccatcgtcggtctcgtgtt 232
           ||||||||||||||||||| ||| || |||||
Sbjct: 223 aagaccgggactaccatcgccggacttgtgtt 254



to top

>ref|NM_001025637.1| Rattus norvegicus proteasome (prosome, macropain) subunit, beta
           type 10 (Psmb10), mRNA
          Length = 1021

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 201 aagaccgggactaccatcgtcggtctcgtgtt 232
           ||||||||||||||||||| ||| || |||||
Sbjct: 223 aagaccgggactaccatcgccggacttgtgtt 254



to top

>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 40.1 bits (20), Expect = 3.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 80     cgagatcagccgcaggatggccggatcg 107
              |||||||||||||||  |||||||||||
Sbjct: 880828 cgagatcagccgcagtctggccggatcg 880801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,083,210
Number of Sequences: 3902068
Number of extensions: 1083210
Number of successful extensions: 17002
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 16854
Number of HSP's gapped (non-prelim): 139
length of query: 242
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 220
effective length of database: 17,147,199,772
effective search space: 3772383949840
effective search space used: 3772383949840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top