ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name baet68c08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_464478.1| Oryza sativa (japonica cultivar-group), mRNA 88 1e-14
2ref|XM_507457.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
3ref|XM_507456.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
4ref|XM_507455.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
5ref|XM_507454.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
6ref|XM_507453.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
7ref|XM_507452.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
8ref|XM_507451.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
9ref|XM_507450.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
10ref|XM_507449.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
11ref|XM_507448.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
12ref|XM_464480.1| Oryza sativa (japonica cultivar-group), mRNA 88 1e-14
13ref|XM_507447.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
14ref|XM_507446.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
15ref|XM_507445.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
16ref|XM_507444.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
17ref|XM_507443.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
18ref|XM_507442.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
19ref|XM_507441.1| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
20ref|XM_506748.2| PREDICTED Oryza sativa (japonica cultivar-group... 88 1e-14
21dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
22dbj|AP004191.3| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
23dbj|AP004812.3| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-14
24dbj|AK109398.2| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
25dbj|AK119554.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
26dbj|AK104557.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
27dbj|AK104535.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
28dbj|AK104522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
29dbj|AK104734.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
30dbj|AK104646.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
31dbj|AK104636.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
32dbj|AK104469.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
33dbj|AK104458.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
34dbj|AK104446.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
35dbj|AK104392.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
36dbj|AK104385.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
37dbj|AK104348.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
38dbj|AK104215.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
39dbj|AK104096.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
40dbj|AK068102.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
41dbj|AK060970.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
42dbj|AK060143.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-14
43ref|XM_464479.1| Oryza sativa (japonica cultivar-group), mRNA 80 2e-12
44dbj|AK106085.1| Oryza sativa (japonica cultivar-group) cDNA clon... 80 2e-12
45ref|NM_137518.2| Drosophila melanogaster CG15073-RA (CG15073), mRNA 46 0.033
46gb|AY071304.1| Drosophila melanogaster RE33093 full length cDNA 46 0.033
47gb|AC099028.1| Drosophila melanogaster, chromosome 2R, region 55... 46 0.033
48gb|AE003798.3| Drosophila melanogaster chromosome 2R, section 52... 46 0.033
49gb|AC004657.1|AC004657 Drosophila melanogaster DNA sequence (P1s... 46 0.033
50emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chr... 44 0.13
51emb|AL713880.1|CNS07YOW Mus musculus chromosome 11 region in the... 44 0.13
52emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the... 44 0.13
53gb|AC146163.3| Pan troglodytes BAC clone RP43-24D16 from 7, comp... 42 0.51
54emb|CR704545.2|CNS0G6KT Tetraodon nigroviridis full-length cDNA 42 0.51
55gb|AC004745.2| Homo sapiens BAC clone CTA-281B9 from 7, complete... 42 0.51
56gb|AY104614.1| Zea mays PCO084486 mRNA sequence 42 0.51
57gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 40 2.0
58gb|AC164620.5| Mus musculus BAC clone RP23-64H20 from chromosome... 40 2.0
59gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosom... 40 2.0
60gb|AC154521.2| Mus musculus BAC clone RP23-473O6 from chromosome... 40 2.0
61gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome... 40 2.0
62gb|AC154623.2| Mus musculus BAC clone RP23-327K7 from chromosome... 40 2.0
63gb|AC127171.54| Mus musculus strain C57BL/6J clone rp23-202i7 ma... 40 2.0
64gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complet... 40 2.0
65ref|XM_369854.1| Magnaporthe grisea 70-15 hypothetical protein (... 40 2.0
66gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome... 40 2.0
67ref|XM_322263.1| Neurospora crassa OR74A hypothetical protein (N... 40 2.0
68ref|XM_951308.1| Neurospora crassa OR74A hypothetical protein (N... 40 2.0
69gb|AC125275.8| Mus musculus chromosome 7, clone RP24-165E9, comp... 40 2.0
70gb|AC131690.3| Mus musculus BAC clone RP23-386P10 from chromosom... 40 2.0
71gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 2.0
72gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, com... 40 2.0
73ref|XM_545636.2| PREDICTED: Canis familiaris similar to membrane... 40 2.0
74gb|BC042932.1| Xenopus laevis hypothetical protein LOC398528, mR... 40 2.0
75gb|AC122851.4| Mus musculus BAC clone RP23-171C17 from chromosom... 40 2.0
76gb|AC122232.3| Mus musculus BAC clone RP23-136G1 from chromosome... 40 2.0
77gb|AC084389.1| Mus musculus BAC clone RP23-247A1 from 1, complet... 40 2.0
78emb|CR716490.2|CNS0GFSJ Tetraodon nigroviridis full-length cDNA 40 2.0
79emb|CR710272.2|CNS0GAZW Tetraodon nigroviridis full-length cDNA 40 2.0
80emb|CR687164.2|CNS0FT60 Tetraodon nigroviridis full-length cDNA 40 2.0
81emb|CR684139.2|CNS0FQTZ Tetraodon nigroviridis full-length cDNA 40 2.0
82emb|CR662227.2|CNS0F9Y1 Tetraodon nigroviridis full-length cDNA 40 2.0
83emb|CR657246.2|CNS0F63O Tetraodon nigroviridis full-length cDNA 40 2.0
84gb|AC101879.8| Mus musculus chromosome 7, clone RP23-378H21, com... 40 2.0
85emb|CR650451.2|CNS0F0UX Tetraodon nigroviridis full-length cDNA 40 2.0
86gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Can... 40 2.0
87gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosom... 40 2.0
88emb|AL157398.6| Human DNA sequence from clone RP11-56H7 on chrom... 40 2.0
89emb|AL035694.8|HS33L1 Human DNA sequence from clone RP1-33L1 on ... 40 2.0
90emb|AL022398.1|HS434O14 Human DNA sequence from clone RP3-434O14... 40 2.0
91gb|AC160391.2| Mus musculus BAC clone RP24-235G7 from chromosome... 40 2.0
92emb|AL596444.10| Mouse DNA sequence from clone RP23-354D12 on ch... 40 2.0
93dbj|AB251575.1| Oryzias latipes gene for mesp, complete cds 40 2.0
94gb|AC015743.9| Homo sapiens chromosome 8, clone RP11-1G11, compl... 40 2.0
95gb|AC116427.1| Homo sapiens chromosome 5 clone CTD-2316N20, comp... 40 2.0
96gb|AC093835.3| Homo sapiens BAC clone RP11-425A23 from 4, comple... 40 2.0
97gb|AC140322.4| Mus musculus BAC clone RP23-413F14 from chromosom... 40 2.0
98gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 40 2.0
99gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, r... 40 2.0
100gb|AC102038.9| Mus musculus chromosome 19, clone RP23-248G20, co... 40 2.0
101gb|AC160402.8| Mus musculus 10 BAC RP23-115L17 (Roswell Park Can... 40 2.0
102dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.0
103gb|AC139493.3| Homo sapiens chromosome 5 clone RP11-844P9, compl... 40 2.0
104dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.0
105emb|AL928891.20| Mouse DNA sequence from clone RP23-17O9 on chro... 40 2.0
106emb|AL929550.7| Mouse DNA sequence from clone RP23-77A2 on chrom... 40 2.0
107gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone... 40 2.0
108gb|AC122714.2| Homo sapiens chromosome 5 clone RP11-451H23, comp... 40 2.0
109gb|AC135608.7| Mus musculus strain C57BL/6J clone rp23-408d14, c... 40 2.0
110gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H2... 40 2.0
111gb|AC153997.3| Mus musculus 6 BAC RP24-571G22 (Roswell Park Canc... 40 2.0
112gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 40 2.0
113gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Can... 40 2.0
114gb|AC102602.9| Mus musculus chromosome 9, clone RP23-381L11, com... 40 2.0
115emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chr... 40 2.0
116gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 2.0
117emb|AL844161.18| Mouse DNA sequence from clone RP23-343K11 on ch... 40 2.0
118emb|AL713932.4|CNS07YPD Oryza sativa chromosome 12, . BAC OSJNBb... 40 2.0
119emb|AL713937.3|CNS07YPI Oryza sativa chromosome 12, . BAC OJ1103... 40 2.0
120gb|AC135118.3| Mus musculus BAC clone RP24-450N10 from 3, comple... 40 2.0
121gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, compl... 40 2.0
122gb|AC159106.2| Mus musculus chromosome 14 clone RP23-244I11, com... 40 2.0
123gb|AC121990.3| Mus musculus BAC clone RP24-298L8 from chromosome... 40 2.0
124emb|AL626773.18| Mouse DNA sequence from clone RP23-273M9 on chr... 40 2.0
125emb|Y14822.1|MMY14822 Mus musculus mRNA containing B1 element, c... 40 2.0
126dbj|AP002892.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 2.0
127gb|AC102398.12| Mus musculus chromosome 8, clone RP24-213P1, com... 38 8.0
128gb|AC102739.7| Mus musculus chromosome 5, clone RP24-309H3, comp... 38 8.0
129gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome... 38 8.0
130ref|XM_511852.1| PREDICTED: Pan troglodytes similar to nonmuscle... 38 8.0
131gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome ... 38 8.0
132gb|BC106248.1| Xenopus laevis hypothetical protein LOC446941, mR... 38 8.0
133ref|NM_192045.1| Oryza sativa (japonica cultivar-group), predic... 38 8.0
134ref|NM_131221.1| Danio rerio ATPase, Na+/K+ transporting, beta 3... 38 8.0
135ref|NM_000841.1| Homo sapiens glutamate receptor, metabotropic 4... 38 8.0
136gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map ... 38 8.0
137gb|AC137842.8| Mus musculus chromosome 15, clone RP23-91M6, comp... 38 8.0
138gb|AC099743.3| Papio anubis clone RP41-450I16, complete sequence 38 8.0
139gb|BT016123.1| Drosophila melanogaster LD01328 full insert cDNA 38 8.0
140gb|AF498323.1| Equus caballus papillomavirus type 1, complete ge... 38 8.0
141ref|NM_001020781.1| Danio rerio zgc:112167 (zgc:112167), mRNA 38 8.0
142ref|NG_002433.1| Homo sapiens major histocompatibility complex, ... 38 8.0
143gb|AC139231.11| Mus musculus chromosome 1, clone RP24-87I22, com... 38 8.0
144gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosom... 38 8.0
145gb|AC159247.2| Mus musculus BAC clone RP24-249C9 from chromosome... 38 8.0
146gb|BC081203.1| Xenopus laevis hypothetical protein LOC446941, mR... 38 8.0
147gb|AC007581.6| Drosophila melanogaster clone BACR03I24, complete... 38 8.0
148gb|AC099037.2| Drosophila melanogaster clone BACR27P17, complete... 38 8.0
149gb|AC091454.2| Mus musculus chromosome X, clones RP21-438P10, RP... 38 8.0
150ref|NM_175260.1| Mus musculus myosin, heavy polypeptide 10, non-... 38 8.0
151gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosom... 38 8.0
152ref|NM_198429.1| Mus musculus nuclear factor of activated T-cell... 38 8.0
153ref|XM_952298.1| Neurospora crassa OR74A hypothetical protein (N... 38 8.0
154ref|XM_327451.1| Neurospora crassa OR74A hypothetical protein (N... 38 8.0
155gb|AC007387.4| Homo sapiens BAC clone RP11-372J12 from 2, comple... 38 8.0
156gb|AC161283.2| Pan troglodytes BAC clone CH251-354N8 from chromo... 38 8.0
157gb|AC147390.4| Pan troglodytes BAC clone RP43-51G14 from 7, comp... 38 8.0
158gb|AC146249.2| Pan troglodytes BAC clone CH251-140O11 from Y, co... 38 8.0
159ref|XM_657915.1| Aspergillus nidulans FGSC A4 hypothetical prote... 38 8.0
160gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, co... 38 8.0
161gb|AC109151.9| Mus musculus chromosome 1, clone RP24-530O9, comp... 38 8.0
162gb|AC163995.4| Mus musculus chromosome 5, clone RP24-242C19, com... 38 8.0
163gb|BC065944.1| Danio rerio ATPase, Na+/K+ transporting, beta 3a ... 38 8.0
164ref|XM_974458.1| PREDICTED: Mus musculus hypothetical protein LO... 38 8.0
165gb|AC185244.2| Pan troglodytes BAC clone CH251-245L20 from chrom... 38 8.0
166gb|AY528411.1| Homo sapiens G protein coupled receptor 158 (GPR1... 38 8.0
167gb|AC117630.11| Mus musculus chromosome 9, clone RP23-181A16, co... 38 8.0
168gb|AC132106.4| Mus musculus BAC clone RP24-240D2 from chromosome... 38 8.0
169gb|BC059426.1| Danio rerio ATPase, Na+/K+ transporting, beta 3a ... 38 8.0
170gb|AC002457.2| Homo sapiens BAC clone CTB-60P12 from 7, complete... 38 8.0
171ref|XM_986250.1| PREDICTED: Mus musculus hypothetical protein LO... 38 8.0
172gb|AC127547.2| Mus musculus BAC clone RP24-498C13 from chromosom... 38 8.0
173gb|AC146257.3| Pan troglodytes BAC clone CH251-113A6 from Y, com... 38 8.0
174gb|AC146054.3| Pan troglodytes BAC clone RP43-78A13 from 7, comp... 38 8.0
175ref|XM_853292.1| PREDICTED: Canis familiaris similar to Nucleola... 38 8.0
176ref|XM_853256.1| PREDICTED: Canis familiaris similar to Nucleola... 38 8.0
177ref|XM_853214.1| PREDICTED: Canis familiaris similar to Nucleola... 38 8.0
178ref|XM_532556.2| PREDICTED: Canis familiaris similar to Nucleola... 38 8.0
179gb|AC123818.4| Mus musculus BAC clone RP24-266A12 from chromosom... 38 8.0
180gb|AC122509.2| Mus musculus BAC clone RP24-443G20 from chromosom... 38 8.0
181ref|XM_799011.1| Trypanosoma cruzi strain CL Brener SUMO1/Ulp2 (... 38 8.0
182gb|AC106820.4| Homo sapiens chromosome 16 clone RP11-715J22, com... 38 8.0
183gb|AC127304.4| Mus musculus BAC clone RP23-285C13 from chromosom... 38 8.0
184gb|AC090691.16| Homo sapiens chromosome 8, clone RP11-338B22, co... 38 8.0
185gb|AC131151.2| Homo sapiens 3 BAC RP11-219E24 (Roswell Park Canc... 38 8.0
186ref|XM_810772.1| Trypanosoma cruzi strain CL Brener mucin-associ... 38 8.0
187gb|AC124798.5| Homo sapiens chromosome 11, clone RP1-239B22, com... 38 8.0
188gb|AF493067.2| Drosophila melanogaster UDP-N-acetylgalactosamine... 38 8.0
189gb|AC121890.3| Mus musculus BAC clone RP24-146K18 from chromosom... 38 8.0
190gb|AC129603.3| Mus musculus BAC clone RP23-63E1 from 18, complet... 38 8.0
191emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A... 38 8.0
192ref|NM_020752.2| Homo sapiens G protein-coupled receptor 158 (GP... 38 8.0
193ref|XM_547642.2| PREDICTED: Canis familiaris similar to Transcri... 38 8.0
194gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, com... 38 8.0
195gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, co... 38 8.0
196gb|AC113123.8| Mus musculus chromosome 8, clone RP23-349O15, com... 38 8.0
197ref|XM_855761.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
198ref|XM_855732.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
199ref|XM_855701.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
200ref|XM_855666.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
201ref|XM_855631.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
202ref|XM_855599.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
203ref|XM_845005.1| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
204ref|XM_536636.2| PREDICTED: Canis familiaris similar to myosin, ... 38 8.0
205gb|AC095067.4| Homo sapiens BAC clone RP11-655F21 from 7, comple... 38 8.0
206gb|AC005998.3| Homo sapiens PAC clone RP4-622E21 from 7, complet... 38 8.0
207gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complet... 38 8.0
208gb|AC006008.2| Homo sapiens PAC clone RP5-820A21 from 7, complet... 38 8.0
209gb|AC018557.9| Homo sapiens chromosome 16 clone RP11-63M22, comp... 38 8.0
210gb|AC115735.8| Mus musculus chromosome 15, clone RP23-470I4, com... 38 8.0
211gb|AC162940.4| Mus musculus BAC clone RP23-95D3 from chromosome ... 38 8.0
212emb|AL163285.2|HS21C085 Homo sapiens chromosome 21 segment HS21C085 38 8.0
213gb|BC098465.1| Mus musculus myosin, heavy polypeptide 10, non-mu... 38 8.0
214emb|Z98052.1|HS505B13 Human DNA sequence from clone RP3-505B13 o... 38 8.0
215emb|Z73416.2|HSN114B2 Human DNA sequence from clone LL22NC03-114... 38 8.0
216emb|Z81363.2|HS179D3 Human DNA sequence from clone RP1-179D3 on ... 38 8.0
217emb|Z97988.1|HS491M17 Human DNA sequence from clone RP3-491M17 o... 38 8.0
218emb|Z93928.1|HS127B14 Human DNA sequence from clone RP1-127B14 o... 38 8.0
219emb|BX571807.5| Human DNA sequence from clone DASS-218M11 on chr... 38 8.0
220emb|AL807752.10| Human DNA sequence from clone RP11-229P13 on ch... 38 8.0
221emb|AL360267.10| Human DNA sequence from clone RP11-342C20 on ch... 38 8.0
222emb|AL731568.7| Human DNA sequence from clone RP11-367B6 on chro... 38 8.0
223emb|AL627395.14| Human DNA sequence from clone RP11-575E4 on chr... 38 8.0
224emb|AL607082.9| Human DNA sequence from clone RP11-166O7 on chro... 38 8.0
225emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on ch... 38 8.0
226emb|AL596222.13| Human DNA sequence from clone RP11-114O18 on ch... 38 8.0
227emb|AL596225.11| Human DNA sequence from clone RP11-30D7 on chro... 38 8.0
228emb|AL589987.25| Human DNA sequence from clone RP11-364B14 on ch... 38 8.0
229emb|AL589822.18| Human DNA sequence from clone RP11-109G10 on ch... 38 8.0
230emb|AL590683.16| Human DNA sequence from clone RP11-10N16 on chr... 38 8.0
231emb|AL590403.13| Human DNA sequence from clone RP13-459B11 on ch... 38 8.0
232emb|AL590103.12| Human DNA sequence from clone RP11-132G19 on ch... 38 8.0
233emb|AL590036.11| Human DNA sequence from clone RP11-379D21 on ch... 38 8.0
234emb|AL590667.7| Human DNA sequence from clone RP11-441L11 on chr... 38 8.0
235emb|AL590363.6| Human DNA sequence from clone RP11-392A23 on chr... 38 8.0
236emb|AL590681.5| Human DNA sequence from clone RP11-163N15 on chr... 38 8.0
237emb|AL513165.12| Human DNA sequence from clone RP11-613M10 on ch... 38 8.0
238emb|AL445228.13| Human DNA sequence from clone RP11-382D12 on ch... 38 8.0
239ref|XM_501225.1| Yarrowia lipolytica CLIB122, YALI0B22528g predi... 38 8.0
240emb|AL390057.12| Human DNA sequence from clone RP11-26I18 on chr... 38 8.0
241emb|AL357514.19| Human DNA sequence from clone RP1-105O18 on chr... 38 8.0
242emb|AL356793.19| Human DNA sequence from clone RP4-732G19 on chr... 38 8.0
243emb|AL358937.16| Human DNA sequence from clone RP11-60I3 on chro... 38 8.0
244emb|AL357833.16| Human DNA sequence from clone RP11-482E14 on ch... 38 8.0
245emb|AL359186.15| Human DNA sequence from clone RP11-239B6 on chr... 38 8.0
246emb|AL357042.11| Human DNA sequence from clone RP11-85O2 on chro... 38 8.0
247gb|AC025853.17| Homo sapiens chromosome 8, clone RP11-353K12, co... 38 8.0
248emb|AL355812.23| Human DNA sequence from clone RP11-810O3 on chr... 38 8.0
249emb|AL356140.16| Human DNA sequence from clone RP11-268H18 on ch... 38 8.0
250emb|AL356104.6| Human DNA sequence from clone RP11-356J7 on chro... 38 8.0
251emb|AL353742.23| Human DNA sequence from clone RP11-505C13 on ch... 38 8.0
252emb|AL353726.22| Human DNA sequence from clone RP11-345K9 on chr... 38 8.0
253emb|AL354872.9| Human DNA sequence from clone RP11-42O15 on chro... 38 8.0
254emb|AL353072.8| Human DNA sequence from clone RP11-489C13 on chr... 38 8.0
255gb|AC115802.10| Mus musculus, clone RP23-408J7, complete sequence 38 8.0
256emb|AL161613.23| Human DNA sequence from clone RP11-22J15 on chr... 38 8.0
257emb|AL161636.21| Human DNA sequence from clone RP1-140J1 on chro... 38 8.0
258emb|AL162371.13| Human DNA sequence from clone RP11-16M10 on chr... 38 8.0
259emb|AL138891.15| Human DNA sequence from clone RP11-253L3 on chr... 38 8.0
260emb|AL139382.12| Human DNA sequence from clone RP11-86N24 on chr... 38 8.0
261emb|AL157718.10| Human DNA sequence from clone RP11-23O13 on chr... 38 8.0
262emb|AL157387.9| Human DNA sequence from clone RP11-20F24 on chro... 38 8.0
263emb|AL139821.9| Human DNA sequence from clone RP11-80K21 on chro... 38 8.0
264emb|AL157882.5| Human DNA sequence from clone RP11-202I11 on chr... 38 8.0
265emb|AL136126.34| Human DNA sequence from clone RP1-89D4 on chrom... 38 8.0
266emb|AL136305.14| Human DNA sequence from clone RP1-259A10 on chr... 38 8.0
267emb|AL137245.11| Human DNA sequence from clone RP11-196I2 on chr... 38 8.0
268gb|AC026366.20| Homo sapiens 12 BAC RP11-139O18 (Roswell Park Ca... 38 8.0
269emb|AL109966.36|HSJ599G15 Human DNA sequence from clone RP4-599G... 38 8.0
270emb|AL109843.25|HSDJ763G1 Human DNA sequence from clone RP4-763G... 38 8.0
271emb|AL109917.22|HSDJ140A9 Human DNA sequence from clone RP1-140A... 38 8.0
272gb|AC136475.7| Homo sapiens chromosome 11, clone RP11-326C3, com... 38 8.0
273emb|AL096710.8|HSDJ61B2 Human DNA sequence from clone RP1-61B2 o... 38 8.0
274emb|AL035604.16|HS38C16 Human DNA sequence from clone RP1-38C16 ... 38 8.0
275gb|AC158931.4| Mus musculus chromosome 1, clone RP23-3H19, compl... 38 8.0
276gb|AC024073.7| Homo sapiens chromosome 10 clone RP11-394D15, com... 38 8.0
277emb|X80818.1|HSMGLUR4 H.sapiens mRNA for metabotropic glutamate ... 38 8.0
278gb|AF394740.1| Equinus papillomavirus, complete genome 38 8.0
279gb|AC107892.9| Homo sapiens chromosome 18, clone RP11-100K18, co... 38 8.0
280gb|AC011848.11| Homo sapiens chromosome 17, clone RP11-354C22, c... 38 8.0
281gb|AC091158.11| Mus musculus Strain C57BL6/J chromosome 6 BAC, R... 38 8.0
282gb|BC062102.1| Mus musculus SWI/SNF related, matrix associated, ... 38 8.0
283gb|BC040363.1| Mus musculus SWI/SNF related, matrix associated, ... 38 8.0
284gb|AC027820.12| Homo sapiens chromosome 17, clone RP11-198F11, c... 38 8.0
285gb|AC157362.7| Mus musculus chromosome 1, clone RP23-382H8, comp... 38 8.0
286emb|BX294028.1|NC103E1 Neurospora crassa DNA linkage group V Cos... 38 8.0
287emb|AL691413.5| Mouse DNA sequence from clone RP23-309E11 on chr... 38 8.0
288gb|BC061509.1| Mus musculus nuclear factor of activated T-cells,... 38 8.0
289emb|AL603662.11| Mouse DNA sequence from clone RP23-396M19 on ch... 38 8.0
290gb|AC138230.5| Homo sapiens chromosome 11, clone RP13-317D12, co... 38 8.0
291gb|AC007995.23| Mus musculus, clone RP23-266E9, complete sequence 38 8.0
292gb|BC095680.1| Danio rerio zgc:112167, mRNA (cDNA clone MGC:1121... 38 8.0
293emb|AL663042.5| Mouse DNA sequence from clone RP23-400P12 on chr... 38 8.0
294emb|AL954243.1| Pan troglodytes chromosome 22 clone PTB-111H18 m... 38 8.0
295emb|BX571885.7| Mouse DNA sequence from clone RP23-17O21 on chro... 38 8.0
296gb|AC094105.3| Homo sapiens chromosome 5 clone RP11-468D11, comp... 38 8.0
297emb|CR352330.14| Mouse DNA sequence from clone RP23-374F1 on chr... 38 8.0
298emb|AJ721111.1| Gallus gallus partial mRNA for hypothetical prot... 38 8.0
299gb|AC023296.6| Homo sapiens chromosome 8, clone RP11-564K14, com... 38 8.0
300emb|AL670769.3| Mouse DNA sequence from clone RP23-375J5 on chro... 38 8.0
301gb|AC093252.3| Homo sapiens chromosome 5 clone RP11-15B5, comple... 38 8.0
302gb|AC134399.12| Mus musculus chromosome 5, clone RP24-282I19, co... 38 8.0
303gb|AC021763.10| Homo sapiens chromosome 18, clone RP11-56O21, co... 38 8.0
304gb|AC102677.9| Mus musculus chromosome 5, clone RP24-67M11, comp... 38 8.0
305gb|AC090638.11| Homo sapiens chromosome 18, clone RP11-429H5, co... 38 8.0
306gb|AC079174.20| Homo sapiens 12 BAC RP11-651L5 (Roswell Park Can... 38 8.0
307gb|AC118647.4| Homo sapiens chromosome 18, clone RP11-474O19, co... 38 8.0
308emb|CR377210.7| Zebrafish DNA sequence from clone CH211-195C22 i... 38 8.0
309gb|AC092124.2| Homo sapiens chromosome 16 clone RP11-1079H2, com... 38 8.0
310gb|AC104452.2| Homo sapiens chromosome 3 clone RP11-949J7, compl... 38 8.0
311gb|AC112481.2| Homo sapiens 12 BAC RP11-20L19 (Roswell Park Canc... 38 8.0
312gb|AC026130.15| Homo sapiens chromosome 17, clone RP11-801J18, c... 38 8.0
313gb|AC008622.6| Homo sapiens chromosome 19 clone CTB-147N14, comp... 38 8.0
314dbj|BS000583.2| Pan troglodytes chromosome Y clone:PTB-614F22, c... 38 8.0
315dbj|BS000619.1| Pan troglodytes chromosome Y clone:PTB-493L21, c... 38 8.0
316dbj|BS000603.1| Pan troglodytes chromosome Y clone:PTB-616H14, c... 38 8.0
317dbj|BS000591.1| Pan troglodytes chromosome Y clone:PTB-113D22, c... 38 8.0
318gb|AC025518.8| Homo sapiens chromosome 17, clone RP11-713H12, co... 38 8.0
319gb|AC087378.6| Homo sapiens chromosome 11, clone RP11-375L11, co... 38 8.0
320gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 8.0
321gb|AC073544.4| Homo sapiens chromosome 19 clone RP11-359H18, com... 38 8.0
322gb|AC008998.5| Homo sapiens chromosome 19 clone LLNLR-262C5, com... 38 8.0
323dbj|AK126746.1| Homo sapiens cDNA FLJ44792 fis, clone BRACE30393... 38 8.0
324dbj|AK131536.1| Homo sapiens cDNA FLJ16766 fis, clone BRAWH30131... 38 8.0
325dbj|AK127852.1| Homo sapiens cDNA FLJ45955 fis, clone PLACE7010567 38 8.0
326dbj|AK125601.1| Homo sapiens cDNA FLJ43613 fis, clone SPLEN20156... 38 8.0
327dbj|AK122982.1| Homo sapiens cDNA FLJ16736 fis, clone BRACE20064... 38 8.0
328dbj|AK122836.1| Homo sapiens cDNA FLJ16445 fis, clone BRAMY30089... 38 8.0
329dbj|AK122792.1| Homo sapiens cDNA FLJ16356 fis, clone THYMU20038... 38 8.0
330dbj|AK095120.1| Homo sapiens cDNA FLJ37801 fis, clone BRSSN2000312 38 8.0
331dbj|AK094753.1| Homo sapiens cDNA FLJ37434 fis, clone BRAWH2002635 38 8.0
332dbj|AK092905.1| Homo sapiens cDNA FLJ35586 fis, clone SPLEN2007326 38 8.0
333emb|CR609673.1| full-length cDNA clone CS0DM013YM01 of Fetal liv... 38 8.0
334dbj|AK090768.1| Homo sapiens cDNA FLJ33449 fis, clone BRAMY2000021 38 8.0
335gb|AC010617.8| Homo sapiens chromosome 19 clone CTD-2607J13, com... 38 8.0
336gb|AC105923.6| Homo sapiens BAC clone RP11-641A24 from 4, comple... 38 8.0
337gb|AC009785.8| Homo sapiens chromosome 7 clone RP11-198E23, comp... 38 8.0
338gb|AC008427.9| Homo sapiens chromosome 5 clone CTC-307M15, compl... 38 8.0
339gb|AC073596.40| Homo sapiens 12 BAC RP11-385C6 (Roswell Park Can... 38 8.0
340gb|AC112222.2| Homo sapiens chromosome 3 clone RP11-114A11, comp... 38 8.0
341gb|AC006254.10| Homo sapiens 3p21.1-9 PAC RPCI5-966M1 (Roswell P... 38 8.0
342gb|AC103826.2| Homo sapiens chromosome 8, clone CTD-2054L19, com... 38 8.0
343gb|AC093013.14| Homo sapiens 12 BAC RP11-158O15 (Roswell Park Ca... 38 8.0
344gb|AC104947.3| Homo sapiens chromosome 11, clone RP11-1029L14, c... 38 8.0
345gb|AC105227.6| Homo sapiens chromosome 18, clone RP11-1030E3, co... 38 8.0
346gb|AC103976.6| Homo sapiens chromosome 15, clone RP11-121E15, co... 38 8.0
347gb|AC098649.2| Homo sapiens chromosome 3 clone RP11-272D20, comp... 38 8.0
348ref|NM_167623.1| Drosophila melanogaster UDP-N-acetyl--D-galacto... 38 8.0
349gb|AC027671.9| Homo sapiens chromosome 10 clone RP11-183F21, com... 38 8.0
350gb|AC110809.3| Homo sapiens BAC clone RP11-754E11 from 4, comple... 38 8.0
351ref|NM_133073.2| Drosophila melanogaster UDP-N-acetyl--D-galacto... 38 8.0
352gb|AC015910.10| Homo sapiens chromosome 17, clone RP11-690G19, c... 38 8.0
353gb|AC011406.5| Homo sapiens chromosome 5 clone CTB-46E9, complet... 38 8.0
354gb|AC104041.5| Homo sapiens chromosome 15, clone CTD-2034I4, com... 38 8.0
355gb|AC116349.2| Homo sapiens chromosome 5 clone RP11-30F18, compl... 38 8.0
356gb|AC098479.2| Homo sapiens chromosome 3 clone RP11-80H18, compl... 38 8.0
357gb|AF480838.1| Mus musculus NFATc1 (Nfatc1) gene, promoter regio... 38 8.0
358gb|AC027359.7| Homo sapiens chromosome 18, clone RP11-13L18, com... 38 8.0
359gb|AC097537.2| Homo sapiens BAC clone RP11-806K15 from 4, comple... 38 8.0
360gb|AC093909.2| Homo sapiens BAC clone RP11-756P10 from 4, comple... 38 8.0
361gb|AC096766.3| Homo sapiens BAC clone RP11-678H22 from 4, comple... 38 8.0
362gb|AC010310.5| Homo sapiens chromosome 5 clone CTB-55B8, complet... 38 8.0
363gb|AC018356.26| Homo sapiens 3 BAC RP11-258G22 (Roswell Park Can... 38 8.0
364gb|AC026005.7| Homo sapiens chromosome 8, clone RP11-470I23, com... 38 8.0
365gb|AC010240.7| Homo sapiens chromosome 5 clone CTC-350I8, comple... 38 8.0
366gb|AC099499.2| Homo sapiens chromosome 5 clone RP11-192H6, compl... 38 8.0
367dbj|AK144965.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 38 8.0
368gb|AC020703.7| Homo sapiens BAC clone RP11-259G7 from 4, complet... 38 8.0
369gb|AC015967.8| Homo sapiens chromosome 18, clone RP11-294N21, co... 38 8.0
370gb|AC021133.5| Homo sapiens chromosome 6 clone RP11-392A23, comp... 38 8.0
371gb|AC087367.3| Homo sapiens chromosome 8, clone RP11-680O8, comp... 38 8.0
372gb|AC091893.3| Homo sapiens chromosome 5 clone RP11-12P19, compl... 38 8.0
373dbj|AK147567.1| Mus musculus cDNA, RIKEN full-length enriched li... 38 8.0
374gb|AC068513.8| Homo sapiens chromosome 18, clone RP11-659L20, co... 38 8.0
375gb|AC092810.2| Homo sapiens chromosome 1 clone RP11-385M4, compl... 38 8.0
376gb|AC023943.6| Homo sapiens chromosome , clone RP11-1G18, comple... 38 8.0
377gb|AY061339.1| Drosophila melanogaster LD27021 full length cDNA 38 8.0
378gb|AC022429.7| Homo sapiens chromosome 10 clone CTD-2374D18, com... 38 8.0
379ref|XM_689057.1| PREDICTED: Danio rerio similar to Tripartite mo... 38 8.0
380gb|AY058660.1| Drosophila melanogaster LD36616 full length cDNA 38 8.0
381gb|AC016604.6| Homo sapiens chromosome 5 clone CTD-2150I21, comp... 38 8.0
382gb|AC161936.2| Pan troglodytes BAC clone CH251-175C18 from chrom... 38 8.0
383gb|AC018574.6| Homo sapiens chromosome , clone RP11-4G2, complet... 38 8.0
384gb|AC008821.6| Homo sapiens chromosome 5 clone CTD-2129G21, comp... 38 8.0
385gb|AC068875.5| Homo sapiens chromosome 15, clone RP11-720L8, com... 38 8.0
386gb|AC134051.3| Homo sapiens chromosome 3 clone RP11-705F24, comp... 38 8.0
387ref|NM_005964.1| Homo sapiens myosin, heavy polypeptide 10, non-... 38 8.0
388gb|AC109193.16| Mus musculus chromosome 5, clone RP24-352I22, co... 38 8.0
389gb|AC159023.4| Pan troglodytes BAC clone CH251-506L16 from chrom... 38 8.0
390gb|AC161265.2| Mus musculus BAC clone RP23-271F18 from chromosom... 38 8.0
391gb|AC154568.2| Mus musculus BAC clone RP23-246L11 from chromosom... 38 8.0
392emb|BX890600.8| Zebrafish DNA sequence from clone DKEY-72L21, co... 38 8.0
393gb|AC079308.15| Homo sapiens 3 BAC RP11-57P12 (Roswell Park Canc... 38 8.0
394dbj|AK019969.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 38 8.0
395dbj|AK029236.1| Mus musculus 0 day neonate head cDNA, RIKEN full... 38 8.0
396dbj|AK039620.1| Mus musculus adult male spinal cord cDNA, RIKEN ... 38 8.0
397gb|AC021088.5| Homo sapiens chromosome 5 clone CTD-2144A5, compl... 38 8.0
398gb|BC109753.1| Bos taurus cDNA clone MGC:133727 IMAGE:8068799, c... 38 8.0
399gb|AC013759.6|AC013759 Homo sapiens chromosome 18, clone RP11-2E... 38 8.0
400gb|AC159986.4| Pan troglodytes BAC clone CH251-6M11 from chromos... 38 8.0
401gb|AC005744.2| Homo sapiens chromosome 22 clone dj10i10 map 22q1... 38 8.0
402gb|AC011666.28| Human Chromosome 1q21 BAC 236c22, complete sequence 38 8.0
403gb|AC011472.7|AC011472 Homo sapiens chromosome 19 clone CTC-510F... 38 8.0
404dbj|AK048610.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 38 8.0
405gb|AC018710.4|AC018710 Homo sapiens BAC clone RP11-296L20 from 4... 38 8.0
406gb|AF119917.1|AF119917 Homo sapiens PRO3098 mRNA, complete cds 38 8.0
407gb|AC100787.17| Homo sapiens chromosome 17, clone CTD-2589J4, co... 38 8.0
408dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
409dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
410dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
411gb|AC008511.6|AC008511 Homo sapiens chromosome 5 clone CTC-454D3... 38 8.0
412gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, r... 38 8.0
413gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, re... 38 8.0
414gb|AC007925.5|AC007925 Drosophila melanogaster, chromosome 2R, r... 38 8.0
415gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, r... 38 8.0
416gb|AC135586.8| Homo sapiens 12 BAC RP13-672B3 (Roswell Park Canc... 38 8.0
417dbj|AB210026.1| Homo sapiens mRNA for MYH10 variant protein, par... 38 8.0
418gb|AC079835.5| Homo sapiens BAC clone RP11-15O17 from 4, complet... 38 8.0
419gb|AC097464.3| Homo sapiens BAC clone RP11-21M10 from 4, complet... 38 8.0
420gb|AC097470.3| Homo sapiens BAC clone RP11-65E19 from 4, complet... 38 8.0
421gb|AC110766.5| Homo sapiens BAC clone RP11-93M12 from 4, complet... 38 8.0
422gb|AC097378.2| Homo sapiens BAC clone RP11-123G5 from 4, complet... 38 8.0
423gb|AC007341.10| Homo sapiens chromosome 16 clone RP11-381L15, co... 38 8.0
424gb|AC104689.4| Homo sapiens BAC clone RP11-158O16 from 4, comple... 38 8.0
425gb|AC163699.4| Gallus gallus BAC clone CH261-138A17 from chromos... 38 8.0
426gb|AC113052.10| Mus musculus chromosome 5, clone RP23-250D22, co... 38 8.0
427gb|AC069205.6| Homo sapiens BAC clone RP11-735P12 from 2, comple... 38 8.0
428gb|AC096589.1| Homo sapiens BAC clone RP11-744G10 from 2, comple... 38 8.0
429gb|AC084371.5| Homo sapiens BAC clone CTD-3220I23 from 2, comple... 38 8.0
430gb|AC156831.2| Mus musculus BAC clone RP24-276N6 from chromosome... 38 8.0
431gb|AC109333.28| Homo sapiens chromosome 17, clone RP11-115H24, c... 38 8.0
432gb|AC084795.5| Homo sapiens chromosome 16 clone CTD-2007P3, comp... 38 8.0
433dbj|AP001724.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 38 8.0
434gb|AC105068.19| Mus musculus chromosome 5, clone RP23-445H19, co... 38 8.0
435gb|AC013418.32| Homo sapiens 12 BAC RP11-181C3 (Roswell Park Can... 38 8.0
436gb|AC064859.6| Homo sapiens BAC clone RP11-329A6 from 2, complet... 38 8.0
437gb|AC079256.5| Homo sapiens BAC clone RP11-325I24 from 2, comple... 38 8.0
438gb|AC007909.8| Homo sapiens chromosome 16 clone RP11-515G11, com... 38 8.0
439gb|AC016747.7| Homo sapiens BAC clone RP11-493E12 from 2, comple... 38 8.0
440gb|AC079921.5| Homo sapiens BAC clone RP11-360F5 from 4, complet... 38 8.0
441gb|AF490843.1| Homo sapiens clone PAC 70L19, HOXC gene cluster 38 8.0
442ref|NM_017467.2| Mus musculus zinc finger protein 316 (Zfp316), ... 38 8.0
443gb|AC067956.3| Homo sapiens BAC clone RP11-140F14 from 2, comple... 38 8.0
444gb|AC006385.3|AC006385 Homo sapiens BAC clone RP11-559J5 from 2,... 38 8.0
445gb|AC012502.3|AC012502 Homo sapiens BAC clone RP11-461H6 from Y,... 38 8.0
446gb|AC011302.3|AC011302 Homo sapiens BAC clone RP11-333E9 from Y,... 38 8.0
447gb|AC012531.11|AC012531 Homo sapiens, clone RP11-83K1, complete ... 38 8.0
448gb|AC073573.27| Homo sapiens 12 BAC RP11-1136G11 (Roswell Park C... 38 8.0
449gb|AC011603.37| Homo sapiens 12 BAC RP11-386G11 (Roswell Park Ca... 38 8.0
450gb|AC022096.7| Homo sapiens chromosome 5 clone CTB-43D14, comple... 38 8.0
451gb|AC131011.5| Homo sapiens X BAC RP13-314C10 (Roswell Park Canc... 38 8.0
452gb|AC068675.17| Homo sapiens chromosome 17, clone RP11-392O1, co... 38 8.0
453gb|AC012305.7| Homo sapiens BAC clone RP11-84G18 from 2, complet... 38 8.0
454gb|AC122129.9| Homo sapiens chromosome 17, clone RP1-253P7, comp... 38 8.0
455gb|AC011444.5|AC011444 Homo sapiens chromosome 19 clone CTC-232P... 38 8.0
456gb|AC011815.7|AC011815 Homo sapiens chromosome , clone RP11-158H... 38 8.0
457gb|AC090617.16| Homo sapiens chromosome 17, clone RP11-667K14, c... 38 8.0
458dbj|AP002902.2| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
459dbj|AP002835.1| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
460gb|AC116015.16| Homo sapiens chromosome 11, clone RP11-356D19, c... 38 8.0
461gb|AC093525.3| Homo sapiens chromosome 16 clone RP11-20I23, comp... 38 8.0
462gb|AC135507.2| Homo sapiens chromosome 3 clone RP11-802O23, comp... 38 8.0
463gb|AC084064.6| Homo sapiens chromosome 16 clone RP11-467I17, com... 38 8.0
464gb|AC159743.4| Pan troglodytes BAC clone CH251-267D14 from chrom... 38 8.0
465gb|AC062015.7| Homo sapiens BAC clone CTD-2031E17 from 2, comple... 38 8.0
466gb|AC005703.2|AC005703 Homo sapiens chromosome 17, clone hRPK.84... 38 8.0
467dbj|AP004363.3| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
468dbj|AP003335.4| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
469gb|AC010358.5|AC010358 Homo sapiens chromosome 5 clone CTD-2031C... 38 8.0
470emb|BX679670.2| Zebrafish DNA sequence from clone CH211-286D16 i... 38 8.0
471dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 38 8.0
472dbj|AP005425.3| Oryza sativa (japonica cultivar-group) genomic D... 38 8.0
473dbj|BS000020.1| Pan troglodytes chromosome 22 clone:PTB-084P08, ... 38 8.0
474dbj|BS000019.1| Pan troglodytes chromosome 22 clone:PTB-023I17, ... 38 8.0
475dbj|AB111958.1| Laticauda semifasciata pla2 gene for phospholipa... 38 8.0
476emb|BX005304.8| Mouse DNA sequence from clone RP23-328P5 on chro... 38 8.0
477emb|BX648450.1|HSM808598 Homo sapiens mRNA; cDNA DKFZp686C0363 (... 38 8.0
478emb|AL672215.11| Mouse DNA sequence from clone RP23-162B19 on ch... 38 8.0
479emb|AL929026.10| Mouse DNA sequence from clone RP23-332K7 on chr... 38 8.0
480emb|X89722.1|BRNAKATPB B.rerio mRNA for Na, K-ATPase subunit 38 8.0
481gb|AC007262.4|AC007262 Homo sapiens chromosome 14 clone containi... 38 8.0
482dbj|AK026977.1| Homo sapiens cDNA: FLJ23324 fis, clone HEP12482,... 38 8.0
483gb|AF305057.1| Homo sapiens RTS (RTS) gene, complete cds, altern... 38 8.0
484dbj|AK108491.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 8.0
485emb|AJ338498.1|HSA338498 Homo sapiens genomic sequence surroundi... 38 8.0
486emb|AJ323276.1|HSA323276 Homo sapiens genomic sequence surroundi... 38 8.0
487gb|AC004997.2|AC004997 Homo sapiens PAC clone RP1-130H16 from 22... 38 8.0
488emb|AL049667.1|HS434O143 Human gene from PAC 434O14, chromosome 1 38 8.0
489emb|Z84477.1|HS265J14 Human DNA sequence from clone RP1-265J14 o... 38 8.0
490ref|NM_208253.1| Eremothecium gossypii ABL047Wp (ABL047W), mRNA 38 8.0
491emb|AL163209.2|HS21C009 Homo sapiens chromosome 21 segment HS21C009 38 8.0
492emb|AL445883.3|CNS07EEQ Human chromosome 14 DNA sequence BAC R-9... 38 8.0
493dbj|AK067914.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 8.0
494emb|AL445363.7|CNS07ECY Human chromosome 14 DNA sequence BAC R-6... 38 8.0
495gb|BC057078.1| Mus musculus zinc finger protein 316, mRNA (cDNA ... 38 8.0
496emb|BX601646.5| Zebrafish DNA sequence from clone CH211-204J16 i... 38 8.0
497emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-1... 38 8.0
498gb|U92457.1|HSU92457 Human metabotropic glutamate receptor 4 mRN... 38 8.0
499emb|CT033781.12| Mouse DNA sequence from clone RP24-85H21 on chr... 38 8.0
500emb|CR377211.7| Zebrafish DNA sequence from clone DKEYP-13A3 in ... 38 8.0

>ref|XM_464478.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 988

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_507457.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1078

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_507456.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1121

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_507455.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1112

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 48  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 107

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 108 tt-cagtctccaggtcttcttcctccaggaag 138



to top

>ref|XM_507454.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1121

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 57  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 116

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 117 tt-cagtctccaggtcttcttcctccaggaag 147



to top

>ref|XM_507453.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1127

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 63  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 123 tt-cagtctccaggtcttcttcctccaggaag 153



to top

>ref|XM_507452.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1127

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 63  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 123 tt-cagtctccaggtcttcttcctccaggaag 153



to top

>ref|XM_507451.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_507450.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_507449.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_507448.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_464480.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1017

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 80  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 139

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 140 tt-cagtctccaggtcttcttcctccaggaag 170



to top

>ref|XM_507447.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1145

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 81  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 141 tt-cagtctccaggtcttcttcctccaggaag 171



to top

>ref|XM_507446.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1145

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 81  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 141 tt-cagtctccaggtcttcttcctccaggaag 171



to top

>ref|XM_507445.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1148

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 84  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 144 tt-cagtctccaggtcttcttcctccaggaag 174



to top

>ref|XM_507444.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1148

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 84  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 144 tt-cagtctccaggtcttcttcctccaggaag 174



to top

>ref|XM_507443.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1151

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 87  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 146

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 147 tt-cagtctccaggtcttcttcctccaggaag 177



to top

>ref|XM_507442.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1168

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 104 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 163

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 164 tt-cagtctccaggtcttcttcctccaggaag 194



to top

>ref|XM_507441.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1198

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 134 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 193

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 194 tt-cagtctccaggtcttcttcctccaggaag 224



to top

>ref|XM_506748.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1524_D08.28-2
           mRNA
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 64  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 123

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 124 tt-cagtctccaggtcttcttcctccaggaag 154



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Minus

                                                                           
Query: 74      aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
               |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 5470357 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 5470298

                                               
Query: 134     ttcccttctccaggtcgtcttcctcccggaag 165
               || |  |||||||||| ||||||||| |||||
Sbjct: 5470297 tt-cagtctccaggtcttcttcctccaggaag 5470267



to top

>dbj|AP004191.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1524_D08
          Length = 143046

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Minus

                                                                          
Query: 74     aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
              |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 123938 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 123879

                                              
Query: 134    ttcccttctccaggtcgtcttcctcccggaag 165
              || |  |||||||||| ||||||||| |||||
Sbjct: 123878 tt-cagtctccaggtcttcttcctccaggaag 123848



to top

>dbj|AP004812.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0026H03
          Length = 151827

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Minus

                                                                         
Query: 74    aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
             |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 15092 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 15033

                                             
Query: 134   ttcccttctccaggtcgtcttcctcccggaag 165
             || |  |||||||||| ||||||||| |||||
Sbjct: 15032 tt-cagtctccaggtcttcttcctccaggaag 15002



to top

>dbj|AK109398.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-A11, full
           insert sequence
          Length = 1128

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 64  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 123

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 124 tt-cagtctccaggtcttcttcctccaggaag 154



to top

>dbj|AK119554.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-208-E06, full
           insert sequence
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>dbj|AK104557.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-G04, full
           insert sequence
          Length = 1112

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 48  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 107

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 108 tt-cagtctccaggtcttcttcctccaggaag 138



to top

>dbj|AK104535.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-304-E04, full
           insert sequence
          Length = 1148

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 84  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 144 tt-cagtctccaggtcttcttcctccaggaag 174



to top

>dbj|AK104522.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-303-E10, full
           insert sequence
          Length = 1078

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>dbj|AK104734.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-C11, full
           insert sequence
          Length = 1121

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 57  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 116

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 117 tt-cagtctccaggtcttcttcctccaggaag 147



to top

>dbj|AK104646.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-H01, full
           insert sequence
          Length = 1127

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 63  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 123 tt-cagtctccaggtcttcttcctccaggaag 153



to top

>dbj|AK104636.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-D09, full
           insert sequence
          Length = 1126

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 63  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 122

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 123 tt-cagtctccaggtcttcttcctccaggaag 153



to top

>dbj|AK104469.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-D06, full
           insert sequence
          Length = 1145

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 81  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 141 tt-cagtctccaggtcttcttcctccaggaag 171



to top

>dbj|AK104458.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-B05, full
           insert sequence
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>dbj|AK104446.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-211-B11, full
           insert sequence
          Length = 1148

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 84  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 143

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 144 tt-cagtctccaggtcttcttcctccaggaag 174



to top

>dbj|AK104392.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-H10, full
           insert sequence
          Length = 1151

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 87  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 146

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 147 tt-cagtctccaggtcttcttcctccaggaag 177



to top

>dbj|AK104385.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-E04, full
           insert sequence
          Length = 1121

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>dbj|AK104348.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-F11, full
           insert sequence
          Length = 1145

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 81  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 140

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 141 tt-cagtctccaggtcttcttcctccaggaag 171



to top

>dbj|AK104215.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-H02, full
           insert sequence
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>dbj|AK104096.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-B04, full
           insert sequence
          Length = 1129

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>dbj|AK068102.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013130I24, full
           insert sequence
          Length = 1017

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 80  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 139

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 140 tt-cagtctccaggtcttcttcctccaggaag 170



to top

>dbj|AK060970.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D07, full
           insert sequence
          Length = 1168

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 104 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 163

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 164 tt-cagtctccaggtcttcttcctccaggaag 194



to top

>dbj|AK060143.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-310-A02, full
           insert sequence
          Length = 988

 Score = 87.7 bits (44), Expect = 1e-14
 Identities = 81/92 (88%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 65  aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 124

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| ||||||||| |||||
Sbjct: 125 tt-cagtctccaggtcttcttcctccaggaag 155



to top

>ref|XM_464479.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 675

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 77/88 (87%), Gaps = 1/88 (1%)
 Strand = Plus / Plus

                                                                       
Query: 78  atggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtcttcc 137
           |||||||| |||| ||||||||||||||||||||||||||| |||||  |||| |||| |
Sbjct: 1   atggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatctt-c 59

                                       
Query: 138 cttctccaggtcgtcttcctcccggaag 165
             |||||||||| ||||||||| |||||
Sbjct: 60  agtctccaggtcttcttcctccaggaag 87



to top

>dbj|AK106085.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-207-B02, full
           insert sequence
          Length = 1198

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 80/92 (86%), Gaps = 1/92 (1%)
 Strand = Plus / Plus

                                                                       
Query: 74  aacaatggcggcccagggtcttctctctgggaggcagctgctgggtaggcctctgcagtc 133
           |||||||||||| |||| ||||||||||||||||||||||||||| |||||  |||| ||
Sbjct: 134 aacaatggcggctcaggctcttctctctgggaggcagctgctggggaggccattgcaatc 193

                                           
Query: 134 ttcccttctccaggtcgtcttcctcccggaag 165
           || |  |||||||||| |||||| || |||||
Sbjct: 194 tt-cagtctccaggtcttcttcccccaggaag 224



to top

>ref|NM_137518.2| Drosophila melanogaster CG15073-RA (CG15073), mRNA
          Length = 2046

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 44  ctcggagcagcaggaggaggagc 66
           |||||||||||||||||||||||
Sbjct: 387 ctcggagcagcaggaggaggagc 409



to top

>gb|AY071304.1| Drosophila melanogaster RE33093 full length cDNA
          Length = 2066

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 44  ctcggagcagcaggaggaggagc 66
           |||||||||||||||||||||||
Sbjct: 387 ctcggagcagcaggaggaggagc 409



to top

>gb|AC099028.1| Drosophila melanogaster, chromosome 2R, region 55F-56X, BAC clone
             BACR08F09, complete sequence
          Length = 192358

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 44    ctcggagcagcaggaggaggagc 66
             |||||||||||||||||||||||
Sbjct: 80628 ctcggagcagcaggaggaggagc 80650



to top

>gb|AE003798.3| Drosophila melanogaster chromosome 2R, section 52 of 73 of the complete
             sequence
          Length = 242365

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 44    ctcggagcagcaggaggaggagc 66
             |||||||||||||||||||||||
Sbjct: 77092 ctcggagcagcaggaggaggagc 77114



to top

>gb|AC004657.1|AC004657 Drosophila melanogaster DNA sequence (P1s DS08204 (D183) and DS09119
             (D236)), complete sequence
          Length = 76618

 Score = 46.1 bits (23), Expect = 0.033
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 44    ctcggagcagcaggaggaggagc 66
             |||||||||||||||||||||||
Sbjct: 26148 ctcggagcagcaggaggaggagc 26170



to top

>emb|AL645969.20| Mouse DNA sequence from clone RP23-101H2 on chromosome 11 Contains a
             novel gene, complete sequence
          Length = 154687

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 42    ctctcggagcagcaggaggagg 63
             ||||||||||||||||||||||
Sbjct: 50301 ctctcggagcagcaggaggagg 50322



to top

>emb|AL713880.1|CNS07YOW Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 366M1 of library Caltech CITB-BAC from chromosome 11
             of Mus musculus (mouse)
          Length = 111702

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 42    ctctcggagcagcaggaggagg 63
             ||||||||||||||||||||||
Sbjct: 86798 ctctcggagcagcaggaggagg 86819



to top

>emb|AL713838.1|CNS07YOS Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
              clone 278H24 of library Caltech CITB-BAC from chromosome 11
              of Mus musculus (mouse)
          Length = 150493

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 42     ctctcggagcagcaggaggagg 63
              ||||||||||||||||||||||
Sbjct: 135695 ctctcggagcagcaggaggagg 135674



to top

>gb|AC146163.3| Pan troglodytes BAC clone RP43-24D16 from 7, complete sequence
          Length = 162475

 Score = 42.1 bits (21), Expect = 0.51
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 53    gcaggaggaggagcttgcagg 73
             |||||||||||||||||||||
Sbjct: 31669 gcaggaggaggagcttgcagg 31689



to top

>emb|CR704545.2|CNS0G6KT Tetraodon nigroviridis full-length cDNA
          Length = 694

 Score = 42.1 bits (21), Expect = 0.51
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 47  ggagcagcaggaggaggagct 67
           |||||||||||||||||||||
Sbjct: 216 ggagcagcaggaggaggagct 236



to top

>gb|AC004745.2| Homo sapiens BAC clone CTA-281B9 from 7, complete sequence
          Length = 97137

 Score = 42.1 bits (21), Expect = 0.51
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 53    gcaggaggaggagcttgcagg 73
             |||||||||||||||||||||
Sbjct: 42910 gcaggaggaggagcttgcagg 42930



to top

>gb|AY104614.1| Zea mays PCO084486 mRNA sequence
          Length = 1214

 Score = 42.1 bits (21), Expect = 0.51
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 78  atggcggcccagggtcttctctctgggaggcagctgctggg 118
           ||||||||||||| ||| ||||| ||  |||||||||||||
Sbjct: 178 atggcggcccaggctctcctctccggccggcagctgctggg 218



to top

>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 182992 ggagcagcaggaggaggagc 182973



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 184187 ggagcagcaggaggaggag 184169



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 181842 ggagcagcaggaggaggag 181824



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 181016 ggagcagcaggaggaggag 180998



to top

>gb|AC164620.5| Mus musculus BAC clone RP23-64H20 from chromosome 18, complete sequence
          Length = 182838

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 56283 ggagcagcaggaggaggagc 56302



to top

>gb|AC141887.5| Mus musculus BAC clone RP23-478L20 from chromosome 7, complete sequence
          Length = 163916

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 51980 ggagcagcaggaggaggagc 51999



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 52511 ggagcagcaggaggaggag 52529



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 52067 ggagcagcaggaggaggag 52085



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 51412 ggagcagcaggaggaggag 51430



to top

>gb|AC154521.2| Mus musculus BAC clone RP23-473O6 from chromosome 13, complete sequence
          Length = 211603

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 121869 ggagcagcaggaggaggagc 121888



to top

>gb|AC154844.2| Mus musculus BAC clone RP23-46K13 from chromosome 16, complete sequence
          Length = 196946

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 96258 ggagcagcaggaggaggagc 96277



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 96933 ggagcagcaggaggaggag 96951



to top

>gb|AC154623.2| Mus musculus BAC clone RP23-327K7 from chromosome 13, complete sequence
          Length = 190884

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 105603 ggagcagcaggaggaggagc 105622



to top

>gb|AC127171.54| Mus musculus strain C57BL/6J clone rp23-202i7 map 10, complete sequence
          Length = 194193

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     tttcatctcagtctctacca 20
             ||||||||||||||||||||
Sbjct: 32609 tttcatctcagtctctacca 32628



to top

>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 159680 ggagcagcaggaggaggagc 159661



to top

>ref|XM_369854.1| Magnaporthe grisea 70-15 hypothetical protein (MG06369.4) partial
            mRNA
          Length = 1671

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 136  cccttctccaggtcgtcttcctcc 159
            ||||||||||||||||| ||||||
Sbjct: 1451 cccttctccaggtcgtcatcctcc 1428



to top

>gb|AC123837.5| Mus musculus BAC clone RP23-385F8 from chromosome 7, complete sequence
          Length = 208880

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 186570 ggagcagcaggaggaggagc 186551



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 186348 ggagcagcaggaggaggagc 186329



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 186294 ggagcagcaggaggaggagc 186275



to top

>ref|XM_322263.1| Neurospora crassa OR74A hypothetical protein (NCU00178.1) partial
           mRNA
          Length = 1206

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 447 ggagcagcaggaggaggagc 466



to top

>ref|XM_951308.1| Neurospora crassa OR74A hypothetical protein (NCU00178.1) partial
           mRNA
          Length = 1206

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 447 ggagcagcaggaggaggagc 466



to top

>gb|AC125275.8| Mus musculus chromosome 7, clone RP24-165E9, complete sequence
          Length = 218429

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 30112 ggagcagcaggaggaggagc 30131



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 30127 ggagcagcaggaggaggag 30145



to top

>gb|AC131690.3| Mus musculus BAC clone RP23-386P10 from chromosome 10, complete sequence
          Length = 208306

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 115829 ggagcagcaggaggaggagc 115810



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      ggagcagcaggaggaggagc 66
               ||||||||||||||||||||
Sbjct: 2643738 ggagcagcaggaggaggagc 2643719



to top

>gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, complete sequence
          Length = 222820

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 167018 ggagcagcaggaggaggagc 166999



to top

>ref|XM_545636.2| PREDICTED: Canis familiaris similar to membrane-associated ring
           finger (C3HC4) 4 (LOC488515), mRNA
          Length = 1572

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctcggagcagcaggaggagg 63
           ||||||||||||||||||||
Sbjct: 141 ctcggagcagcaggaggagg 160



to top

>gb|BC042932.1| Xenopus laevis hypothetical protein LOC398528, mRNA (cDNA clone
           IMAGE:5570299), partial cds
          Length = 1310

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 51  cagcaggaggaggagcttgc 70
           ||||||||||||||||||||
Sbjct: 660 cagcaggaggaggagcttgc 679



to top

>gb|AC122851.4| Mus musculus BAC clone RP23-171C17 from chromosome 3, complete sequence
          Length = 203490

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 172207 ggagcagcaggaggaggagc 172188



to top

>gb|AC122232.3| Mus musculus BAC clone RP23-136G1 from chromosome 7, complete sequence
          Length = 182272

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 46407 ggagcagcaggaggaggagc 46388



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 46311 ggagcagcaggaggaggagc 46292



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 46257 ggagcagcaggaggaggagc 46238



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 46203 ggagcagcaggaggaggagc 46184



to top

>gb|AC084389.1| Mus musculus BAC clone RP23-247A1 from 1, complete sequence
          Length = 206497

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 76765 ggagcagcaggaggaggagc 76746



to top

>emb|CR716490.2|CNS0GFSJ Tetraodon nigroviridis full-length cDNA
          Length = 473

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 372 ggagcagcaggaggaggagc 391



to top

>emb|CR710272.2|CNS0GAZW Tetraodon nigroviridis full-length cDNA
          Length = 550

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 449 ggagcagcaggaggaggagc 468



to top

>emb|CR687164.2|CNS0FT60 Tetraodon nigroviridis full-length cDNA
          Length = 554

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 444 ggagcagcaggaggaggagc 463



to top

>emb|CR684139.2|CNS0FQTZ Tetraodon nigroviridis full-length cDNA
          Length = 546

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 436 ggagcagcaggaggaggagc 455



to top

>emb|CR662227.2|CNS0F9Y1 Tetraodon nigroviridis full-length cDNA
          Length = 559

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 449 ggagcagcaggaggaggagc 468



to top

>emb|CR657246.2|CNS0F63O Tetraodon nigroviridis full-length cDNA
          Length = 559

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 449 ggagcagcaggaggaggagc 468



to top

>gb|AC101879.8| Mus musculus chromosome 7, clone RP23-378H21, complete sequence
          Length = 174481

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 104727 ggagcagcaggaggaggagc 104708



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 104712 ggagcagcaggaggaggag 104694



to top

>emb|CR650451.2|CNS0F0UX Tetraodon nigroviridis full-length cDNA
          Length = 542

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 432 ggagcagcaggaggaggagc 451



to top

>gb|AC159149.10| Mus musculus 10 BAC RP23-56F17 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 219585

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 83033 ggagcagcaggaggaggagc 83014



to top

>gb|AC161456.3| Mus musculus BAC clone RP23-190H11 from chromosome 6, complete sequence
          Length = 208350

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 163539 ggagcagcaggaggaggagc 163558



to top

>emb|AL157398.6| Human DNA sequence from clone RP11-56H7 on chromosome 10 Contains the
            NEBL gene for the nebulette protein (actin-binding Z-disc
            protein), a pseudogene similar to part of MTCO3
            (COIII)(cytochrome c oxidase III) and a pseudogene
            similar to part of MTND1 (NADH dehydrogenase 1), complete
            sequence
          Length = 172616

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    cagtctctaccacacacacc 28
            ||||||||||||||||||||
Sbjct: 5517 cagtctctaccacacacacc 5536



to top

>emb|AL035694.8|HS33L1 Human DNA sequence from clone RP1-33L1 on chromosome 6q14.1-15 Contains
             the TBX18 gene for T-box 18 and 2 CpG islands, complete
             sequence
          Length = 100209

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 44    ctcggagcagcaggaggagg 63
             ||||||||||||||||||||
Sbjct: 42053 ctcggagcagcaggaggagg 42034



to top

>emb|AL022398.1|HS434O14 Human DNA sequence from clone RP3-434O14 on chromosome 1q32.3-41
             Contains the 3' end of the HSD11B1 gene for hydroxysteroid
             (11-beta) dehydrogenase 1, a adenosine A2b receptor
             (ADORA2B) pseudogene, the T3JAM gene for TRAF3-interacting
             Jun N-terminal kinase (JNK)-activating modulator, a novel
             gene (FLJ25078), the IRF6 gene for interferon regulatory
             factor 6, a novel gene, a novel gene (MGC29875) and the 5'
             end of a novel gene, complete sequence
          Length = 135928

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 98    ctctgggaggcagctgctgg 117
             ||||||||||||||||||||
Sbjct: 60543 ctctgggaggcagctgctgg 60524



to top

>gb|AC160391.2| Mus musculus BAC clone RP24-235G7 from chromosome 12, complete sequence
          Length = 186582

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 136607 ggagcagcaggaggaggagc 136626



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 136637 ggagcagcaggaggaggag 136655



to top

>emb|AL596444.10| Mouse DNA sequence from clone RP23-354D12 on chromosome 11 Contains the
             gene for reversion induced LIM protein (Ril), the Slc22a4
             and Slc22a9 genes for solute carrier family 22 (organic
             cation transporter), members 4 and 9, a Sin3-associated
             polypeptide 18 (Sap18) pseudogene, a pseudogene similar to
             part of solute carrier family 22 (organic cation
             transporter), member 4 Slc22a4 and two CpG islands,
             complete sequence
          Length = 171301

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 80004 ggagcagcaggaggaggagc 79985



to top

>dbj|AB251575.1| Oryzias latipes gene for mesp, complete cds
          Length = 153079

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    cggagcagcaggaggaggag 65
             ||||||||||||||||||||
Sbjct: 70788 cggagcagcaggaggaggag 70807



to top

>gb|AC015743.9| Homo sapiens chromosome 8, clone RP11-1G11, complete sequence
          Length = 193989

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    caggaggaggagcttgcagg 73
             ||||||||||||||||||||
Sbjct: 32170 caggaggaggagcttgcagg 32189



to top

>gb|AC116427.1| Homo sapiens chromosome 5 clone CTD-2316N20, complete sequence
          Length = 103938

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 93353 ggagcagcaggaggaggagc 93334



to top

>gb|AC093835.3| Homo sapiens BAC clone RP11-425A23 from 4, complete sequence
          Length = 197225

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    gcaggaggaggagcttgcag 72
             ||||||||||||||||||||
Sbjct: 96526 gcaggaggaggagcttgcag 96507



to top

>gb|AC140322.4| Mus musculus BAC clone RP23-413F14 from chromosome 14, complete sequence
          Length = 205679

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    tctgcagtcttcccttctcc 144
              ||||||||||||||||||||
Sbjct: 186751 tctgcagtcttcccttctcc 186770



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 26356 ggagcagcaggaggaggagc 26375



to top

>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone
             BACR27L16, complete sequence
          Length = 182623

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 20634 ggagcagcaggaggaggagc 20615



to top

>gb|AC102038.9| Mus musculus chromosome 19, clone RP23-248G20, complete sequence
          Length = 159945

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 95    tctctctgggaggcagctgctggg 118
             ||||||||| ||||||||||||||
Sbjct: 56942 tctctctggaaggcagctgctggg 56919



to top

>gb|AC160402.8| Mus musculus 10 BAC RP23-115L17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 224566

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 97    tctctgggaggcagctgctg 116
             ||||||||||||||||||||
Sbjct: 69258 tctctgggaggcagctgctg 69277



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 46       cggagcagcaggaggaggag 65
                ||||||||||||||||||||
Sbjct: 21270961 cggagcagcaggaggaggag 21270980



to top

>gb|AC139493.3| Homo sapiens chromosome 5 clone RP11-844P9, complete sequence
          Length = 173607

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 37108 ggagcagcaggaggaggagc 37127



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 47      ggagcagcaggaggaggagc 66
               ||||||||||||||||||||
Sbjct: 2643848 ggagcagcaggaggaggagc 2643829



to top

>emb|AL928891.20| Mouse DNA sequence from clone RP23-17O9 on chromosome 2, complete
            sequence
          Length = 163057

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 47   ggagcagcaggaggaggagc 66
            ||||||||||||||||||||
Sbjct: 1816 ggagcagcaggaggaggagc 1835



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 47   ggagcagcaggaggaggagc 66
            ||||||||||||||||||||
Sbjct: 1696 ggagcagcaggaggaggagc 1715



to top

>emb|AL929550.7| Mouse DNA sequence from clone RP23-77A2 on chromosome 2, complete
             sequence
          Length = 80734

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 80550 ggagcagcaggaggaggagc 80569



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 80430 ggagcagcaggaggaggagc 80449



to top

>gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone rp23-362c8, complete
              sequence
          Length = 238658

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 160090 ggagcagcaggaggaggagc 160071



to top

>gb|AC122714.2| Homo sapiens chromosome 5 clone RP11-451H23, complete sequence
          Length = 190024

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 171978 ggagcagcaggaggaggagc 171959



to top

>gb|AC135608.7| Mus musculus strain C57BL/6J clone rp23-408d14, complete sequence
          Length = 213801

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     tctctgggaggcagctgctg 116
              ||||||||||||||||||||
Sbjct: 135891 tctctgggaggcagctgctg 135910



to top

>gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H24, complete sequence
          Length = 104325

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 31887 ggagcagcaggaggaggagc 31868



to top

>gb|AC153997.3| Mus musculus 6 BAC RP24-571G22 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 150676

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    agcagcaggaggaggagctt 68
             ||||||||||||||||||||
Sbjct: 97751 agcagcaggaggaggagctt 97770



to top

>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete
             sequence
          Length = 346474

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 64880 ggagcagcaggaggaggagc 64861



to top

>gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 159189

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 14351 ggagcagcaggaggaggagc 14370



to top

>gb|AC102602.9| Mus musculus chromosome 9, clone RP23-381L11, complete sequence
          Length = 253504

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 201737 ggagcagcaggaggaggagc 201756



 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 201674 ggagcagcaggaggaggagc 201693



to top

>emb|CT030238.7| Mouse DNA sequence from clone RP23-428E20 on chromosome 14, complete
              sequence
          Length = 194408

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 110563 ggagcagcaggaggaggagc 110582



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 46       cggagcagcaggaggaggag 65
                ||||||||||||||||||||
Sbjct: 21197170 cggagcagcaggaggaggag 21197189



to top

>emb|AL844161.18| Mouse DNA sequence from clone RP23-343K11 on chromosome 4, complete
              sequence
          Length = 224031

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    cagctgctgggtaggcctct 127
              ||||||||||||||||||||
Sbjct: 174258 cagctgctgggtaggcctct 174239



to top

>emb|AL713932.4|CNS07YPD Oryza sativa chromosome 12, . BAC OSJNBb0094E08 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 137571

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 46    cggagcagcaggaggaggag 65
             ||||||||||||||||||||
Sbjct: 19239 cggagcagcaggaggaggag 19220



to top

>emb|AL713937.3|CNS07YPI Oryza sativa chromosome 12, . BAC OJ1103_B10 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 95132

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 46    cggagcagcaggaggaggag 65
             ||||||||||||||||||||
Sbjct: 90317 cggagcagcaggaggaggag 90298



to top

>gb|AC135118.3| Mus musculus BAC clone RP24-450N10 from 3, complete sequence
          Length = 188353

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 164002 ggagcagcaggaggaggagc 164021



to top

>gb|AC129222.4| Mus musculus BAC clone RP24-532L14 from 14, complete sequence
          Length = 181469

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    tctgcagtcttcccttctcc 144
              ||||||||||||||||||||
Sbjct: 152067 tctgcagtcttcccttctcc 152048



to top

>gb|AC159106.2| Mus musculus chromosome 14 clone RP23-244I11, complete sequence
          Length = 168884

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    ggagcagcaggaggaggagc 66
             ||||||||||||||||||||
Sbjct: 77402 ggagcagcaggaggaggagc 77383



to top

>gb|AC121990.3| Mus musculus BAC clone RP24-298L8 from chromosome 6, complete sequence
          Length = 173629

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ggagcagcaggaggaggagc 66
              ||||||||||||||||||||
Sbjct: 142522 ggagcagcaggaggaggagc 142503



to top

>emb|AL626773.18| Mouse DNA sequence from clone RP23-273M9 on chromosome 4, complete
              sequence
          Length = 193852

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      tttcatctcagtctctacca 20
              ||||||||||||||||||||
Sbjct: 141601 tttcatctcagtctctacca 141620



to top

>emb|Y14822.1|MMY14822 Mus musculus mRNA containing B1 element, clone 20.1
          Length = 631

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 47  ggagcagcaggaggaggagc 66
           ||||||||||||||||||||
Sbjct: 515 ggagcagcaggaggaggagc 496



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 476 ggagcagcaggaggaggag 458



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 452 ggagcagcaggaggaggag 434



to top

>dbj|AP002892.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-45F15, complete
             sequences
          Length = 35001

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   aggcctctgcagtcttccct 139
             ||||||||||||||||||||
Sbjct: 10048 aggcctctgcagtcttccct 10067



to top

>gb|AC102398.12| Mus musculus chromosome 8, clone RP24-213P1, complete sequence
          Length = 172457

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 13264 ggagcagcaggaggaggag 13282



to top

>gb|AC102739.7| Mus musculus chromosome 5, clone RP24-309H3, complete sequence
          Length = 191542

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 105432 ggagcagcaggaggaggag 105450



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 105366 ggagcagcaggaggaggag 105384



to top

>gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1362_G11,
             complete sequence
          Length = 115808

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 42598 ggagcagcaggaggaggag 42616



to top

>ref|XM_511852.1| PREDICTED: Pan troglodytes similar to nonmuscle myosin heavy chain
            (LOC455090), mRNA
          Length = 6095

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 3536 ggagcagcaggaggaggag 3554



to top

>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence
          Length = 177167

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 134710 ggagcagcaggaggaggag 134728



to top

>gb|BC106248.1| Xenopus laevis hypothetical protein LOC446941, mRNA (cDNA clone
           IMAGE:7765276), partial cds
          Length = 955

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 53  gcaggaggaggagcttgcaggaa 75
           ||||||||||||||||| |||||
Sbjct: 565 gcaggaggaggagcttggaggaa 587



to top

>ref|NM_192045.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1038

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 675 ggagcagcaggaggaggag 693



to top

>ref|NM_131221.1| Danio rerio ATPase, Na+/K+ transporting, beta 3a polypeptide
            (atp1b3a), mRNA
          Length = 1286

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 51   cagcaggaggaggagcttg 69
            |||||||||||||||||||
Sbjct: 1217 cagcaggaggaggagcttg 1199



to top

>ref|NM_000841.1| Homo sapiens glutamate receptor, metabotropic 4 (GRM4), mRNA
          Length = 3884

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 48   gagcagcaggaggaggagc 66
            |||||||||||||||||||
Sbjct: 2925 gagcagcaggaggaggagc 2943



to top

>gb|AC122159.30| Mus musculus strain 129/Sv clone ct7-575j15 map 10, complete sequence
          Length = 183491

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 85893 ggagcagcaggaggaggag 85911



to top

>gb|AC137842.8| Mus musculus chromosome 15, clone RP23-91M6, complete sequence
          Length = 230609

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 192222 ggagcagcaggaggaggag 192240



to top

>gb|AC099743.3| Papio anubis clone RP41-450I16, complete sequence
          Length = 115022

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 53743 caggaggaggagcttgcag 53761



to top

>gb|BT016123.1| Drosophila melanogaster LD01328 full insert cDNA
          Length = 2532

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 2209 ggagcagcaggaggaggag 2227



to top

>gb|AF498323.1| Equus caballus papillomavirus type 1, complete genome
          Length = 7610

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 46   cggagcagcaggaggagga 64
            |||||||||||||||||||
Sbjct: 3123 cggagcagcaggaggagga 3141



to top

>ref|NM_001020781.1| Danio rerio zgc:112167 (zgc:112167), mRNA
          Length = 2922

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1652 ggagcagcaggaggaggag 1634



to top

>ref|NG_002433.1| Homo sapiens major histocompatibility complex, class II, DR53 haplotype
             (DR53) on chromosome 6
          Length = 150447

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 36330 caggaggaggagcttgcag 36348



to top

>gb|AC139231.11| Mus musculus chromosome 1, clone RP24-87I22, complete sequence
          Length = 191438

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 39767 ggagcagcaggaggaggag 39785



to top

>gb|AC164649.4| Mus musculus BAC clone RP23-437D10 from chromosome 5, complete sequence
          Length = 215766

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 49419 ggagcagcaggaggaggag 49401



to top

>gb|AC159247.2| Mus musculus BAC clone RP24-249C9 from chromosome 6, complete sequence
          Length = 190474

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 81919 ggagcagcaggaggaggag 81937



to top

>gb|BC081203.1| Xenopus laevis hypothetical protein LOC446941, mRNA (cDNA clone
           IMAGE:6946945), partial cds
          Length = 964

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 53  gcaggaggaggagcttgcaggaa 75
           ||||||||||||||||| |||||
Sbjct: 564 gcaggaggaggagcttggaggaa 586



to top

>gb|AC007581.6| Drosophila melanogaster clone BACR03I24, complete sequence
          Length = 163517

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 150184 ggagcagcaggaggaggag 150166



to top

>gb|AC099037.2| Drosophila melanogaster clone BACR27P17, complete sequence
          Length = 193320

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 135775 ggagcagcaggaggaggag 135793



to top

>gb|AC091454.2| Mus musculus chromosome X, clones RP21-438P10, RP21-382F2, RP21-118B24,
              Map qA7.1, complete sequences
          Length = 393632

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 268488 ggagcagcaggaggaggag 268470



to top

>ref|NM_175260.1| Mus musculus myosin, heavy polypeptide 10, non-muscle (Myh10), mRNA
          Length = 7666

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4294 ggagcagcaggaggaggag 4312



to top

>gb|AC141565.3| Mus musculus BAC clone RP23-160M21 from chromosome 14, complete
             sequence
          Length = 210128

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 62613 ggagcagcaggaggaggag 62595



to top

>ref|NM_198429.1| Mus musculus nuclear factor of activated T-cells, cytoplasmic,
           calcineurin-dependent 1 (Nfatc1), transcript variant 2,
           mRNA
          Length = 4626

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 48  gagcagcaggaggaggagc 66
           |||||||||||||||||||
Sbjct: 268 gagcagcaggaggaggagc 250



to top

>ref|XM_952298.1| Neurospora crassa OR74A hypothetical protein (NCU07166.1) partial
           mRNA
          Length = 1347

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 918 ggagcagcaggaggaggag 936



to top

>ref|XM_327451.1| Neurospora crassa OR74A hypothetical protein (NCU07166.1) partial
           mRNA
          Length = 1347

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 918 ggagcagcaggaggaggag 936



to top

>gb|AC007387.4| Homo sapiens BAC clone RP11-372J12 from 2, complete sequence
          Length = 165704

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 145917 caggaggaggagcttgcag 145935



to top

>gb|AC161283.2| Pan troglodytes BAC clone CH251-354N8 from chromosome 7, complete
             sequence
          Length = 160292

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 65    gcttgcaggaacaatggcg 83
             |||||||||||||||||||
Sbjct: 32314 gcttgcaggaacaatggcg 32332



to top

>gb|AC147390.4| Pan troglodytes BAC clone RP43-51G14 from 7, complete sequence
          Length = 168525

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 140722 caggaggaggagcttgcag 140740



to top

>gb|AC146249.2| Pan troglodytes BAC clone CH251-140O11 from Y, complete sequence
          Length = 173078

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 85224 caggaggaggagcttgcag 85206



to top

>ref|XM_657915.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5403.2), mRNA
          Length = 4500

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 52   agcaggaggaggagcttgc 70
            |||||||||||||||||||
Sbjct: 2105 agcaggaggaggagcttgc 2123



to top

>gb|AC140042.19| Mus musculus chromosome 5, clone RP23-437D10, complete sequence
          Length = 215786

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 166349 ggagcagcaggaggaggag 166367



to top

>gb|AC109151.9| Mus musculus chromosome 1, clone RP24-530O9, complete sequence
          Length = 130025

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 49    agcagcaggaggaggagct 67
             |||||||||||||||||||
Sbjct: 92830 agcagcaggaggaggagct 92848



to top

>gb|AC163995.4| Mus musculus chromosome 5, clone RP24-242C19, complete sequence
          Length = 177877

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 128   gcagtcttcccttctccag 146
             |||||||||||||||||||
Sbjct: 44381 gcagtcttcccttctccag 44399



to top

>gb|BC065944.1| Danio rerio ATPase, Na+/K+ transporting, beta 3a polypeptide, mRNA
            (cDNA clone MGC:76862 IMAGE:6963397), complete cds
          Length = 2025

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 51   cagcaggaggaggagcttg 69
            |||||||||||||||||||
Sbjct: 1086 cagcaggaggaggagcttg 1068



to top

>ref|XM_974458.1| PREDICTED: Mus musculus hypothetical protein LOC674093 (LOC674093),
           mRNA
          Length = 1035

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 504 ggagcagcaggaggaggag 522



to top

>gb|AC185244.2| Pan troglodytes BAC clone CH251-245L20 from chromosome 1, complete
             sequence
          Length = 140818

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 79726 caggaggaggagcttgcag 79708



to top

>gb|AY528411.1| Homo sapiens G protein coupled receptor 158 (GPR158) mRNA, complete
           cds
          Length = 4012

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 92  tcttctctctgggaggcag 110
           |||||||||||||||||||
Sbjct: 42  tcttctctctgggaggcag 60



to top

>gb|AC117630.11| Mus musculus chromosome 9, clone RP23-181A16, complete sequence
          Length = 245165

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 163604 ggagcagcaggaggaggag 163586



to top

>gb|AC132106.4| Mus musculus BAC clone RP24-240D2 from chromosome 17, complete sequence
          Length = 169722

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 89086 ggagcagcaggaggaggag 89104



to top

>gb|BC059426.1| Danio rerio ATPase, Na+/K+ transporting, beta 3a polypeptide, mRNA
            (cDNA clone MGC:73044 IMAGE:4790814), complete cds
          Length = 2194

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 51   cagcaggaggaggagcttg 69
            |||||||||||||||||||
Sbjct: 1270 cagcaggaggaggagcttg 1252



to top

>gb|AC002457.2| Homo sapiens BAC clone CTB-60P12 from 7, complete sequence
          Length = 177380

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 114853 caggaggaggagcttgcag 114835



to top

>ref|XM_986250.1| PREDICTED: Mus musculus hypothetical protein LOC666821 (LOC666821),
           mRNA
          Length = 447

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 357 ggagcagcaggaggaggag 375



to top

>gb|AC127547.2| Mus musculus BAC clone RP24-498C13 from chromosome 8, complete sequence
          Length = 151070

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     ctcagtctctaccacacac 25
             |||||||||||||||||||
Sbjct: 25994 ctcagtctctaccacacac 26012



to top

>gb|AC146257.3| Pan troglodytes BAC clone CH251-113A6 from Y, complete sequence
          Length = 174522

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 106389 caggaggaggagcttgcag 106407



to top

>gb|AC146054.3| Pan troglodytes BAC clone RP43-78A13 from 7, complete sequence
          Length = 155731

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 114990 caggaggaggagcttgcag 115008



to top

>ref|XM_853292.1| PREDICTED: Canis familiaris similar to Nucleolar GTP-binding protein
            2 (Autoantigen NGP-1), transcript variant 5 (LOC475329),
            mRNA
          Length = 2835

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1786 ggagcagcaggaggaggag 1804



to top

>ref|XM_853256.1| PREDICTED: Canis familiaris similar to Nucleolar GTP-binding protein
            2 (Autoantigen NGP-1), transcript variant 4 (LOC475329),
            mRNA
          Length = 2750

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1701 ggagcagcaggaggaggag 1719



to top

>ref|XM_853214.1| PREDICTED: Canis familiaris similar to Nucleolar GTP-binding protein
            2 (Autoantigen NGP-1), transcript variant 3 (LOC475329),
            mRNA
          Length = 2682

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1633 ggagcagcaggaggaggag 1651



to top

>ref|XM_532556.2| PREDICTED: Canis familiaris similar to Nucleolar GTP-binding protein
            2 (Autoantigen NGP-1), transcript variant 1 (LOC475329),
            mRNA
          Length = 2841

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1792 ggagcagcaggaggaggag 1810



to top

>gb|AC123818.4| Mus musculus BAC clone RP24-266A12 from chromosome 18, complete sequence
          Length = 169506

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 48     gagcagcaggaggaggagc 66
              |||||||||||||||||||
Sbjct: 130816 gagcagcaggaggaggagc 130834



to top

>gb|AC122509.2| Mus musculus BAC clone RP24-443G20 from chromosome 16, complete sequence
          Length = 178757

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 47     ggagcagcaggaggaggag 65
              |||||||||||||||||||
Sbjct: 161615 ggagcagcaggaggaggag 161597



to top

>ref|XM_799011.1| Trypanosoma cruzi strain CL Brener SUMO1/Ulp2
           (Tc00.1047053503407.20) partial mRNA
          Length = 2226

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 87  ggagcagcaggaggaggag 105



to top

>gb|AC106820.4| Homo sapiens chromosome 16 clone RP11-715J22, complete sequence
          Length = 176552

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 40722 caggaggaggagcttgcag 40704



to top

>gb|AC127304.4| Mus musculus BAC clone RP23-285C13 from chromosome 3, complete sequence
          Length = 151365

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 45744 ggagcagcaggaggaggag 45762



to top

>gb|AC090691.16| Homo sapiens chromosome 8, clone RP11-338B22, complete sequence
          Length = 180766

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 104795 caggaggaggagcttgcag 104777



to top

>gb|AC131151.2| Homo sapiens 3 BAC RP11-219E24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109988

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 74868 caggaggaggagcttgcag 74886



to top

>ref|XM_810772.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053508389.50) partial mRNA
          Length = 942

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 449 ggagcagcaggaggaggag 431



to top

>gb|AC124798.5| Homo sapiens chromosome 11, clone RP1-239B22, complete sequence
          Length = 141199

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 100345 caggaggaggagcttgcag 100327



to top

>gb|AF493067.2| Drosophila melanogaster UDP-N-acetylgalactosamine: polypeptide
            N-acetylgalactosaminyltransferase 2 (CG6394) mRNA,
            complete cds
          Length = 2199

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1876 ggagcagcaggaggaggag 1894



to top

>gb|AC121890.3| Mus musculus BAC clone RP24-146K18 from chromosome 16, complete
             sequence
          Length = 136955

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 52662 ggagcagcaggaggaggag 52644



to top

>gb|AC129603.3| Mus musculus BAC clone RP23-63E1 from 18, complete sequence
          Length = 175249

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 128   gcagtcttcccttctccag 146
             |||||||||||||||||||
Sbjct: 73363 gcagtcttcccttctccag 73345



to top

>emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A2 on chromosome 1q42.11-42.3
             Contains the 5' end of the NUP133 gene, a novel gene, the
             ABCB10 gene for ATP-binding cassette, sub-family B
             (MDR/TAP), member 10, a high-mobility group nucleosomal
             binding domain 2 (HMGN2) pseudogene, the TAF5L gene for
             TAF5-like RNA polymerase II, p300/CBP-associated factor
             (PCAF)-associated factor, 65kDa, the 5' end of a novel
             gene (KIAA0133) and three CpG islands, complete sequence
          Length = 147913

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 39771 caggaggaggagcttgcag 39789



to top

>ref|NM_020752.2| Homo sapiens G protein-coupled receptor 158 (GPR158), mRNA
          Length = 6663

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 92  tcttctctctgggaggcag 110
           |||||||||||||||||||
Sbjct: 42  tcttctctctgggaggcag 60



to top

>ref|XM_547642.2| PREDICTED: Canis familiaris similar to Transcription factor GATA-6
           (GATA binding factor-6) (LOC490520), mRNA
          Length = 1882

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 47  ggagcagcaggaggaggag 65
           |||||||||||||||||||
Sbjct: 408 ggagcagcaggaggaggag 390



to top

>gb|AC123686.11| Mus musculus chromosome 5, clone RP23-301L9, complete sequence
          Length = 212246

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 72660 ggagcagcaggaggaggag 72678



to top

>gb|AC101875.7| Mus musculus chromosome 12, clone RP23-367G12, complete sequence
          Length = 184813

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 50055 ggagcagcaggaggaggag 50073



to top

>gb|AC113123.8| Mus musculus chromosome 8, clone RP23-349O15, complete sequence
          Length = 213829

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 7    ctcagtctctaccacacac 25
            |||||||||||||||||||
Sbjct: 4929 ctcagtctctaccacacac 4911



to top

>ref|XM_855761.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 8 (LOC479497), mRNA
          Length = 6311

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4128 ggagcagcaggaggaggag 4146



to top

>ref|XM_855732.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 7 (LOC479497), mRNA
          Length = 6338

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4155 ggagcagcaggaggaggag 4173



to top

>ref|XM_855701.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 6 (LOC479497), mRNA
          Length = 6248

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4065 ggagcagcaggaggaggag 4083



to top

>ref|XM_855666.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 5 (LOC479497), mRNA
          Length = 6278

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4095 ggagcagcaggaggaggag 4113



to top

>ref|XM_855631.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 4 (LOC479497), mRNA
          Length = 6260

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4077 ggagcagcaggaggaggag 4095



to top

>ref|XM_855599.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 3 (LOC479497), mRNA
          Length = 6251

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4068 ggagcagcaggaggaggag 4086



to top

>ref|XM_845005.1| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 2 (LOC479497), mRNA
          Length = 6323

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4140 ggagcagcaggaggaggag 4158



to top

>ref|XM_536636.2| PREDICTED: Canis familiaris similar to myosin, heavy polypeptide 10,
            non-muscle, transcript variant 1 (LOC479497), mRNA
          Length = 6665

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 4065 ggagcagcaggaggaggag 4083



to top

>gb|AC095067.4| Homo sapiens BAC clone RP11-655F21 from 7, complete sequence
          Length = 88281

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 79196 caggaggaggagcttgcag 79178



to top

>gb|AC005998.3| Homo sapiens PAC clone RP4-622E21 from 7, complete sequence
          Length = 96556

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 60333 caggaggaggagcttgcag 60351



to top

>gb|AC004936.2| Homo sapiens PAC clone RP5-959C21 from 7, complete sequence
          Length = 139949

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 100839 caggaggaggagcttgcag 100857



to top

>gb|AC006008.2| Homo sapiens PAC clone RP5-820A21 from 7, complete sequence
          Length = 57554

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 17228 caggaggaggagcttgcag 17210



to top

>gb|AC018557.9| Homo sapiens chromosome 16 clone RP11-63M22, complete sequence
          Length = 180709

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 141650 caggaggaggagcttgcag 141668



to top

>gb|AC115735.8| Mus musculus chromosome 15, clone RP23-470I4, complete sequence
          Length = 177117

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1604 ggagcagcaggaggaggag 1622



to top

>gb|AC162940.4| Mus musculus BAC clone RP23-95D3 from chromosome 13, complete sequence
          Length = 218228

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 28323 ggagcagcaggaggaggag 28341



to top

>emb|AL163285.2|HS21C085 Homo sapiens chromosome 21 segment HS21C085
          Length = 340000

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 30003 caggaggaggagcttgcag 30021



to top

>gb|BC098465.1| Mus musculus myosin, heavy polypeptide 10, non-muscle, mRNA (cDNA
            clone IMAGE:30100060), partial cds
          Length = 4973

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 47   ggagcagcaggaggaggag 65
            |||||||||||||||||||
Sbjct: 1593 ggagcagcaggaggaggag 1611



to top

>emb|Z98052.1|HS505B13 Human DNA sequence from clone RP3-505B13 on chromosome 1p36.2-36.3
            Contains part of the CAMTA1 gene for calmodulin binding
            transcription activator 1, complete sequence
          Length = 112467

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 54   caggaggaggagcttgcag 72
            |||||||||||||||||||
Sbjct: 1915 caggaggaggagcttgcag 1897



to top

>emb|Z73416.2|HSN114B2 Human DNA sequence from clone LL22NC03-114B2 on chromosome 22 Contains
             GSSs, complete sequence
          Length = 40524

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 34414 caggaggaggagcttgcag 34396



to top

>emb|Z81363.2|HS179D3 Human DNA sequence from clone RP1-179D3 on chromosome X Contains the 5'
             end of the ELF4 gene for E74-like factor 4 (ets domain
             transcription factor) (MEF, ELFR) and 2 CpG islands,
             complete sequence
          Length = 49217

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 47    ggagcagcaggaggaggag 65
             |||||||||||||||||||
Sbjct: 46317 ggagcagcaggaggaggag 46335



to top

>emb|Z97988.1|HS491M17 Human DNA sequence from clone RP3-491M17 on chromosome 1p36.2-36.3,
            complete sequence
          Length = 86535

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 54   caggaggaggagcttgcag 72
            |||||||||||||||||||
Sbjct: 3426 caggaggaggagcttgcag 3444



to top

>emb|Z93928.1|HS127B14 Human DNA sequence from clone RP1-127B14 on chromosome Xq22, complete
              sequence
          Length = 126263

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 115141 caggaggaggagcttgcag 115159



to top

>emb|BX571807.5| Human DNA sequence from clone DASS-218M11 on chromosome 6, complete
             sequence
          Length = 68685

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 24830 caggaggaggagcttgcag 24848



to top

>emb|AL807752.10| Human DNA sequence from clone RP11-229P13 on chromosome 9 Contains a
              ribosomal protein L30 (RPL30) pseudogene, the gene for the
              possible ortholog of mouse f-box and WD-40 domain protein 5
              (FBXW5), the C8G gene for complement 8 (gamma polypeptide),
              a novel gene for the possible ortholog to RIKEN mouse CDNA
              9230102M18 (9230192M18Rik), five novel genes,  the PTGDS
              gene for prostaglandin D2 synthase 21kDa (brain), the CLIC3
              gene for chloride intracellular channel 3, the ABCA2 gene
              for ATP-binding cassette (sub-family A (ABC1), member 2),
              the FUT7 gene for fucosyltransferase 7 (alpha (1,3)
              fucosyltransferase), the NPDC1 gene for neural
              proliferation, differentiation and control 1,  the ENTPD2
              gene for ectonucleoside triphosphate diphosphohydrolase 2,
              a novel gene for the possible ortholog of RIKEN mouse cDNA
              2010317E24 (2010317E25Rik), a novel gene (LOC91373), the 5'
              end of the MAN1B1 gene for mannosidase (alpha, class 1B,
              member 1), five novel genes and seventeen CpG islands,
              complete sequence
          Length = 158699

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 129863 caggaggaggagcttgcag 129881



to top

>emb|AL360267.10| Human DNA sequence from clone RP11-342C20 on chromosome 13 Contains a
             RNA-binding protein LIN-28 pseudogene, a novel gene and
             the 3' end of a novel gene, complete sequence
          Length = 157381

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 50192 caggaggaggagcttgcag 50174



to top

>emb|AL731568.7| Human DNA sequence from clone RP11-367B6 on chromosome 10 Contains the
             5' end of the gene for CDA017 protein, a novel gene and a
             CpG island, complete sequence
          Length = 137034

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 97067 caggaggaggagcttgcag 97085



to top

>emb|AL627395.14| Human DNA sequence from clone RP11-575E4 on chromosome 10 Contains
            the 5' end of the CASP7 gene for caspase 7
            apoptosis-related cysteine protease and a CpG island,
            complete sequence
          Length = 29734

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 54   caggaggaggagcttgcag 72
            |||||||||||||||||||
Sbjct: 5841 caggaggaggagcttgcag 5823



to top

>emb|AL607082.9| Human DNA sequence from clone RP11-166O7 on chromosome 10, complete
             sequence
          Length = 75633

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 51540 caggaggaggagcttgcag 51558



to top

>emb|AL592307.36| Human DNA sequence from clone RP11-458D21 on chromosome 1 Contains the
             gene for a novel protein similar to Notch homolog 2
             (Drosophila) NOTCH2, a novel gene and a CpG island,
             complete sequence
          Length = 204307

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 50036 caggaggaggagcttgcag 50054



to top

>emb|AL596222.13| Human DNA sequence from clone RP11-114O18 on chromosome 1 Contains
            the 5' end of the NOTCH2 gene for Notch homolog 2
            (Drosophila) and a CpG island, complete sequence
          Length = 107056

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 54   caggaggaggagcttgcag 72
            |||||||||||||||||||
Sbjct: 5464 caggaggaggagcttgcag 5446



to top

>emb|AL596225.11| Human DNA sequence from clone RP11-30D7 on chromosome 1 Contains part of
              the gene for a novel protein (FLJ31862, FLJ22091, FLJ10597)
              and two CpG islands, complete sequence
          Length = 148750

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 105353 caggaggaggagcttgcag 105371



to top

>emb|AL589987.25| Human DNA sequence from clone RP11-364B14 on chromosome X Contains a
             novel gene, a heterogeneous nuclear ribonucleoprotein A3
             (HNRPA3) pseudogene, a novel pseudogene and a CpG island,
             complete sequence
          Length = 143770

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 15757 caggaggaggagcttgcag 15739



to top

>emb|AL589822.18| Human DNA sequence from clone RP11-109G10 on chromosome 10 Contains the
             gene for a novel protein similar to ARF GTPase-activating
             protein (MRIP2), a ribosomal protein L35a (RPL35A)
             pseudogene and a CpG island, complete sequence
          Length = 86155

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 24290 caggaggaggagcttgcag 24308



to top

>emb|AL590683.16| Human DNA sequence from clone RP11-10N16 on chromosome 1 Contains the
             5' end of the IL22RA1 gene for interleukin 22 receptor
             alpha 1, the IL28RA gene for interleukin 28 receptor alpha
             (interferon, lambda receptor), a novel gene and the 3' end
             of a novel gene, complete sequence
          Length = 164684

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 55442 caggaggaggagcttgcag 55460



to top

>emb|AL590403.13| Human DNA sequence from clone RP13-459B11 on chromosome 6 Contains
            the GRM4 gene for glutamate receptor (metabotropic 4) and
            a CpG island, complete sequence
          Length = 118771

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 48   gagcagcaggaggaggagc 66
            |||||||||||||||||||
Sbjct: 6915 gagcagcaggaggaggagc 6897



to top

>emb|AL590103.12| Human DNA sequence from clone RP11-132G19 on chromosome 1 Contains a
              novel gene, the 3' end of the HSPG2 gene for  heparan
              sulfate proteoglycan 2 (perlecan), the 5' end of the  USP31
              gene for ubiquitin specific protease 31 and a CpG island,
              complete sequence
          Length = 175162

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 96     ctctctgggaggcagctgctggg 118
              ||||||||||||||||| |||||
Sbjct: 172353 ctctctgggaggcagctcctggg 172331



to top

>emb|AL590036.11| Human DNA sequence from clone RP11-379D21 on chromosome 10 Contains an
             ADP-ribosylation factor-like 5 (ARL5) pseudogene, a
             ribosomal protein L7 (RPL7) pseudogene and part of the
             HPSE2 gene for heparanase 2, complete sequence
          Length = 197103

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 75782 caggaggaggagcttgcag 75800



to top

>emb|AL590667.7| Human DNA sequence from clone RP11-441L11 on chromosome 1 Contains a
              novel transcript and the 5' end of the BCL9 gene for B-cell
              CLL/lymphoma 9 protein, complete sequence
          Length = 175494

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 148840 caggaggaggagcttgcag 148858



to top

>emb|AL590363.6| Human DNA sequence from clone RP11-392A23 on chromosome 6 Contains the
             GSTA1 gene for glutathione S-transferase A1, the gene for
             a novel glutathione S-transferase A (GSTA) family member
             and three glutathione S-transferase A (GSTA) family
             pseudogenes, complete sequence
          Length = 95843

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 76545 caggaggaggagcttgcag 76527



to top

>emb|AL590681.5| Human DNA sequence from clone RP11-163N15 on chromosome 13 Contains a
             ubiquitin-conjugating enzyme pseudogene, complete sequence
          Length = 58800

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 20984 caggaggaggagcttgcag 21002



to top

>emb|AL513165.12| Human DNA sequence from clone RP11-613M10 on chromosome 9 Contains part
              of a novel gene, the FBXO10 gene (FBX10) for F-box only
              protein 10, two novel genes, a RAB1B (member RAS oncogene
              family) pseudogene the 5' end of a novel gene (KIAA0967)
              and three CpG islands, complete sequence
          Length = 194976

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 143105 caggaggaggagcttgcag 143123



to top

>emb|AL445228.13| Human DNA sequence from clone RP11-382D12 on chromosome 1 Contains a
             novel gene, the 5' end of the C1orf21 gene for chromosome
             1 open reading frame 21 and a CpG island, complete
             sequence
          Length = 116252

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 40847 caggaggaggagcttgcag 40865



to top

>ref|XM_501225.1| Yarrowia lipolytica CLIB122, YALI0B22528g predicted mRNA
          Length = 2604

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 141 ctccaggtcgtcttcctcc 159
           |||||||||||||||||||
Sbjct: 481 ctccaggtcgtcttcctcc 463



to top

>emb|AL390057.12| Human DNA sequence from clone RP11-26I18 on chromosome 6, complete
             sequence
          Length = 100578

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 33402 caggaggaggagcttgcag 33384



to top

>emb|AL357514.19| Human DNA sequence from clone RP1-105O18 on chromosome 6 Contains a
             novel gene and a CpG island, complete sequence
          Length = 140630

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 80673 caggaggaggagcttgcag 80655



to top

>emb|AL356793.19| Human DNA sequence from clone RP4-732G19 on chromosome 1p31.3-32.3
             Contains the 3' end of the CYP4B1 gene for cytochrome P450
             family 4 subfamily B polypeptide 1 and the 3' end of a
             cytochrome P450 4Z1 (CYP4Z1) pseudogene, complete sequence
          Length = 83072

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 49419 caggaggaggagcttgcag 49437



to top

>emb|AL358937.16| Human DNA sequence from clone RP11-60I3 on chromosome 9 Contains the 3'
             end of the NR4A3 gene for nuclear receptor subfamily 4
             group A member 3, the STX17 gene for syntaxin 17, the 3'
             end of the TXNDC4 gene for thioredoxin domain containing 4
             (endoplasmic reticulum) (ERP44, ERp44,KIAA0573) and a CpG
             island, complete sequence
          Length = 146889

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 97132 caggaggaggagcttgcag 97150



 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 92239 caggaggaggagcttgcag 92221



to top

>emb|AL357833.16| Human DNA sequence from clone RP11-482E14 on chromosome 10 Contains two
             novel genes and a CpG island, complete sequence
          Length = 178563

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 53596 caggaggaggagcttgcag 53578



to top

>emb|AL359186.15| Human DNA sequence from clone RP11-239B6 on chromosome 1 Contains the
             3' end of the EIF2C4 gene for eukaryotic translation
             initiation factor 2C, 4, complete sequence
          Length = 49613

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 46310 caggaggaggagcttgcag 46292



to top

>emb|AL357042.11| Human DNA sequence from clone RP11-85O2 on chromosome 10, complete
             sequence
          Length = 115348

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 82464 caggaggaggagcttgcag 82446



to top

>gb|AC025853.17| Homo sapiens chromosome 8, clone RP11-353K12, complete sequence
          Length = 173681

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 109783 caggaggaggagcttgcag 109801



to top

>emb|AL355812.23| Human DNA sequence from clone RP11-810O3 on chromosome Xq22.3-24
             Contains the 3' end of the HTR2C gene for
             5-hydroxytryptamine (serotonin) receptor 2C, complete
             sequence
          Length = 147288

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 89834 caggaggaggagcttgcag 89816



to top

>emb|AL356140.16| Human DNA sequence from clone RP11-268H18 on chromosome 10, complete
              sequence
          Length = 139968

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 54     caggaggaggagcttgcag 72
              |||||||||||||||||||
Sbjct: 117594 caggaggaggagcttgcag 117576



to top

>emb|AL356104.6| Human DNA sequence from clone RP11-356J7 on chromosome 1 Contains the
             3' end of the ARHGEF11 gene for Rho guanine nucleotide
             exchange factor (GEF) 11, a novel gene (FLJ32884), the 3'
             end of the gene for a novel protein similar to mouse Jedi
             soluble isoform 736 and three CpG islands, complete
             sequence
          Length = 96693

 Score = 38.2 bits (19), Expect = 8.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    caggaggaggagcttgcag 72
             |||||||||||||||||||
Sbjct: 10127 caggaggaggagcttgcag 10145


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,726,168
Number of Sequences: 3902068
Number of extensions: 2726168
Number of successful extensions: 282821
Number of sequences better than 10.0: 573
Number of HSP's better than 10.0 without gapping: 575
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 277057
Number of HSP's gapped (non-prelim): 5556
length of query: 165
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 143
effective length of database: 17,147,199,772
effective search space: 2452049567396
effective search space used: 2452049567396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top