Clone Name	baet65d10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p...	498	e-138
2	emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein	258	1e-65
3	gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds	242	7e-61
4	gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g...	230	3e-57
5	emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat...	208	1e-50
6	ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic...	186	4e-44
7	gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol...	186	4e-44
8	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	186	4e-44
9	dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D...	186	4e-44
10	dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon...	186	4e-44
11	dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon...	186	4e-44
12	dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon...	186	4e-44
13	dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon...	186	4e-44
14	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	178	9e-42
15	dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D...	178	9e-42
16	dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D...	178	9e-42
17	dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	9e-42
18	dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	9e-42
19	dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	9e-42
20	dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon...	178	9e-42
21	gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei...	178	9e-42
22	dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN...	178	9e-42
23	ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic...	176	4e-41
24	dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D...	176	4e-41
25	dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon...	176	4e-41
26	dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon...	176	4e-41
27	dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon...	170	2e-39
28	emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo...	168	9e-39
29	emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding...	165	1e-37
30	emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ...	159	8e-36
31	gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding p...	155	1e-34
32	emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro...	155	1e-34
33	emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl...	151	2e-33
34	gb|AY109324.1| Zea mays CL187_1 mRNA sequence	151	2e-33
35	emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro...	149	8e-33
36	emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin...	147	3e-32
37	emb|AJ843976.1| Plantago major partial mRNA for light harvesting...	145	1e-31
38	dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi...	145	1e-31
39	dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro...	145	1e-31
40	dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ...	145	1e-31
41	dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 g...	143	5e-31
42	emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p...	139	8e-30
43	emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/...	139	8e-30
44	gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding p...	139	8e-30
45	dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv...	139	8e-30
46	gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	135	1e-28
47	gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b...	133	5e-28
48	gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ...	131	2e-27
49	emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr...	131	2e-27
50	gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding p...	131	2e-27
51	gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding p...	131	2e-27
52	gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	127	3e-26
53	gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	127	3e-26
54	gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B...	127	3e-26
55	gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L...	127	3e-26
56	gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein prec...	127	3e-26
57	gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/...	127	3e-26
58	gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding p...	127	3e-26
59	emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p...	125	1e-25
60	gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi...	125	1e-25
61	gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab...	125	1e-25
62	emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi...	123	5e-25
63	gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding p...	123	5e-25
64	gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding p...	123	5e-25
65	emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-t...	123	5e-25
66	gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab...	123	5e-25
67	gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll...	121	2e-24
68	gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyl...	119	7e-24
69	emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/...	119	7e-24
70	dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone...	119	7e-24
71	gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding...	117	3e-23
72	gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein...	117	3e-23
73	emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind...	115	1e-22
74	emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/...	115	1e-22
75	gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ...	115	1e-22
76	dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harv...	115	1e-22
77	dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p...	115	1e-22
78	gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b...	113	4e-22
79	gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (ca...	111	2e-21
80	emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Co...	111	2e-21
81	emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p...	111	2e-21
82	emb|X16535.1|GMCAB4 G.max DNA for Cab4	111	2e-21
83	gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll...	111	2e-21
84	gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-bin...	111	2e-21
85	ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin...	109	7e-21
86	gb|AF339687.1| Arabidopsis thaliana putative photosystem II type...	109	7e-21
87	gb|AF326864.1| Arabidopsis thaliana putative photosystem II type...	109	7e-21
88	gb|AY120776.1| Arabidopsis thaliana putative photosystem II type...	109	7e-21
89	gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma...	109	7e-21
90	gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma...	109	7e-21
91	gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430...	109	7e-21
92	gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s...	109	7e-21
93	emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ...	109	7e-21
94	emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/...	109	7e-21
95	emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin...	109	7e-21
96	gb|BT002103.1| Arabidopsis thaliana putative photosystem II type...	109	7e-21
97	ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2...	107	3e-20
98	ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2...	107	3e-20
99	ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin...	107	3e-20
100	ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ...	107	3e-20
101	gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence	107	3e-20
102	gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence	107	3e-20
103	gb|AY142513.1| Arabidopsis thaliana putative photosystem II type...	107	3e-20
104	gb|AY045806.1| Arabidopsis thaliana putative photosystem II type...	107	3e-20
105	gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro...	107	3e-20
106	gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	107	3e-20
107	gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	107	3e-20
108	gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro...	107	3e-20
109	gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ...	107	3e-20
110	gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ...	107	3e-20
111	gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ...	107	3e-20
112	gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein...	107	3e-20
113	gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co...	107	3e-20
114	gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ...	107	3e-20
115	emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co...	107	3e-20
116	emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co...	107	3e-20
117	emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMW...	107	3e-20
118	emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c...	107	3e-20
119	gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-...	107	3e-20
120	gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene...	107	3e-20
121	emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab bindin...	105	1e-19
122	emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll...	105	1e-19
123	dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue...	103	4e-19
124	gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I ...	103	4e-19
125	gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste...	103	4e-19
126	gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ...	101	2e-18
127	gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a...	101	2e-18
128	emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-bind...	101	2e-18
129	emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin...	101	2e-18
130	gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ...	101	2e-18
131	emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co...	100	7e-18
132	emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co...	100	7e-18
133	emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding pr...	100	7e-18
134	emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b bindin...	100	7e-18
135	emb|X16536.1|GMCAB5 G.max DNA for Cab5	100	7e-18
136	gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll...	100	7e-18
137	emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll ...	100	7e-18
138	gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene ...	100	7e-18
139	dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harv...	100	7e-18
140	emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 ...	98	3e-17
141	dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chloro...	98	3e-17
142	emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co...	96	1e-16
143	gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b...	96	1e-16
144	emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA	96	1e-16
145	gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting...	94	4e-16
146	dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl...	94	4e-16
147	emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ...	92	2e-15
148	emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co...	92	2e-15
149	gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi...	92	2e-15
150	emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b...	92	2e-15
151	gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/...	90	6e-15
152	emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi...	90	6e-15
153	ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND...	88	3e-14
154	gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin...	88	3e-14
155	gb|AY050935.1| Arabidopsis thaliana putative photosystem II type...	88	3e-14
156	gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	88	3e-14
157	gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m...	88	3e-14
158	gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com...	88	3e-14
159	emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co...	88	3e-14
160	emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Co...	88	3e-14
161	gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P...	88	3e-14
162	gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N...	88	3e-14
163	gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/...	88	3e-14
164	emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/...	88	3e-14
165	dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone...	86	1e-13
166	gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence	84	4e-13
167	emb|X61915.1|PTCABP P.thunbergii cab gene	84	4e-13
168	emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy...	84	4e-13
169	emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting...	84	4e-13
170	gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophy...	84	4e-13
171	gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p...	84	4e-13
172	gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-...	84	4e-13
173	gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei...	82	2e-12
174	gb|AY617096.1| Picea sitchensis chloroplast light harvesting chl...	82	2e-12
175	gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl...	82	2e-12
176	gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl...	82	2e-12
177	gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor...	82	2e-12
178	gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro...	82	2e-12
179	gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo...	82	2e-12
180	gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor...	82	2e-12
181	gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L...	82	2e-12
182	emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig...	82	2e-12
183	emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh...	82	2e-12
184	gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence	80	6e-12
185	gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor...	78	2e-11
186	gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p...	78	2e-11
187	gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro...	78	2e-11
188	gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein...	78	2e-11
189	gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein...	76	1e-10
190	emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll...	74	4e-10
191	gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop...	74	4e-10
192	gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor...	74	4e-10
193	emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA	74	4e-10
194	emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II c...	74	4e-10
195	emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ...	74	4e-10
196	emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind...	74	4e-10
197	emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro...	74	4e-10
198	gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA	74	4e-10
199	ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND...	72	2e-09
200	gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	72	2e-09
201	gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	72	2e-09
202	emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy...	72	2e-09
203	dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b...	72	2e-09
204	gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple...	70	6e-09
205	emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calret...	70	6e-09
206	gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ...	70	6e-09
207	gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlor...	70	6e-09
208	gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid...	70	6e-09
209	dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest...	70	6e-09
210	gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin...	68	2e-08
211	emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi...	68	2e-08
212	emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin...	68	2e-08
213	emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h...	68	2e-08
214	dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	2e-08
215	gb|M64619.1|PEACAB66 Pea cab gene, complete cds	68	2e-08
216	gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major li...	68	2e-08
217	gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b bi...	66	9e-08
218	ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ...	66	9e-08
219	gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom...	66	9e-08
220	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	66	9e-08
221	gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)...	66	9e-08
222	gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro...	66	9e-08
223	gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve...	66	9e-08
224	gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro...	66	9e-08
225	gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo...	66	9e-08
226	gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch...	66	9e-08
227	gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor...	66	9e-08
228	gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl...	66	9e-08
229	gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	66	9e-08
230	gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot...	66	9e-08
231	gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	66	9e-08
232	gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	66	9e-08
233	gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com...	66	9e-08
234	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	66	9e-08
235	emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co...	66	9e-08
236	emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Co...	66	9e-08
237	gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s...	66	9e-08
238	emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyl...	66	9e-08
239	emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy...	66	9e-08
240	gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot...	66	9e-08
241	gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chl...	66	9e-08
242	dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting c...	66	9e-08
243	gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting ...	64	4e-07
244	gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin...	64	4e-07
245	dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light...	62	1e-06
246	emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl...	62	1e-06
247	emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chl...	62	1e-06
248	emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chloro...	62	1e-06
249	gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot...	62	1e-06
250	gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b bi...	60	6e-06
251	ref|NM_124807.2| Arabidopsis thaliana LHCB3 (LIGHT-HARVESTING CH...	60	6e-06
252	ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA	60	6e-06
253	ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
254	ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
255	ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
256	ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
257	ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
258	ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
259	ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group...	60	6e-06
260	gb|AF361858.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl...	60	6e-06
261	gb|AY057735.1| Arabidopsis thaliana AT5g54270/MDK4_9 mRNA, compl...	60	6e-06
262	gb|AF372917.1|AF372917 Arabidopsis thaliana AT5g54270/MDK4_9 mRN...	60	6e-06
263	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
264	emb|BX830083.1|CNS0A1XR Arabidopsis thaliana Full-length cDNA Co...	60	6e-06
265	emb|BX831139.1|CNS09ZGL Arabidopsis thaliana Full-length cDNA Co...	60	6e-06
266	gb|AF134126.1| Arabidopsis thaliana chromosome V Lhcb3 protein (...	60	6e-06
267	dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
268	dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
269	dbj|AB115771.1| Physcomitrella patens subsp. patens PpLhcb1 gene...	60	6e-06
270	dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
271	dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
272	emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB p...	60	6e-06
273	emb|X57082.1|PSCABII P.sativum Cab II gene for chlorophyll a/b-b...	60	6e-06
274	dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
275	dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
276	dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
277	dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
278	dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
279	dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
280	dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
281	gb|AF143691.1|AF143691 Arabidopsis thaliana type III chlorophyll...	60	6e-06
282	gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding prot...	60	6e-06
283	emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20...	60	6e-06
284	dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv...	60	6e-06
285	ref|NM_124808.3| Arabidopsis thaliana ATM2 (ARABIDOPSIS THALIANA...	58	2e-05
286	gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein...	58	2e-05
287	gb|AF526508.1| Vicia faba A-B binding protein (CHLOR1) mRNA, par...	58	2e-05
288	gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest...	58	2e-05
289	gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor...	58	2e-05
290	dbj|AB010695.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	58	2e-05
291	dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon...	58	2e-05
292	dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN...	58	2e-05
293	gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi...	56	9e-05
294	gb|AY267623.1| Bigelowiella natans chlorophyll a/b-binding prote...	54	4e-04
295	gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
296	gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
297	gb|AF268319.1|AF268319 Chlorarachnion CCMP621 light-harvesting c...	54	4e-04
298	gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ...	54	4e-04
299	emb|X17697.1|MDCHBP Apple light-harvesting chlorophyll a/b bindi...	54	4e-04
300	dbj|AU066540.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	54	4e-04
301	gb|AY845255.1| Pisum sativum light-harvesting chlorophyll-a/b bi...	52	0.001
302	dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene...	52	0.001
303	gb|AF133340.1|AF133340 Phalaenopsis sp. 'KCbutterfly' putative c...	52	0.001
304	dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro...	52	0.001
305	gb|BT013404.1| Lycopersicon esculentum clone 135718R, mRNA sequence	50	0.006
306	emb|X61610.1|BNLHCB3C B.napus gene for LHCII Type III chlorophyl...	50	0.006
307	emb|X60275.1|LELHBC1G L.esculentum lhbC1 gene for LHCII type III	50	0.006
308	emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll...	50	0.006
309	gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c...	50	0.006
310	gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro...	48	0.022
311	gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch...	48	0.022
312	dbj|AB050123.1| Amaranthus tricolor cab1a mRNA for type I chloro...	48	0.022
313	ref|XM_483142.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.086
314	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	46	0.086
315	dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D...	46	0.086
316	emb|X61609.1|BNLHCB3B B.napus gene for LHC II Type III chlorophy...	46	0.086
317	dbj|AP005148.3| Oryza sativa (japonica cultivar-group) genomic D...	46	0.086
318	gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end	46	0.086
319	dbj|AB050126.1| Amaranthus tricolor cab3 mRNA for type III chlor...	46	0.086
320	gb|DQ226734.1| Boechera divaricarpa isolate SLW-A-E08 mRNA sequence	44	0.34
321	emb|BX817733.1|CNS0AE6W Arabidopsis thaliana Full-length cDNA Co...	44	0.34
322	dbj|D78207.1|PHNCABBP Japanese morning glory mRNA for chlorophyl...	44	0.34
323	gb|AC147802.2| Oryza sativa chromosome 3 BAC OSJNBb0013C14 genom...	42	1.4
324	emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro...	42	1.4
325	emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin...	42	1.4
326	gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge...	42	1.4
327	gb|L07120.1|COTIIABINB Gossypium hirsutum chloroplast photosyste...	42	1.4
328	ref|XM_653097.1| Aspergillus nidulans FGSC A4 hypothetical prote...	40	5.3
329	gb|AC123924.4| Mus musculus BAC clone RP24-292A3 from chromosome...	40	5.3
330	gb|AC107030.3| Homo sapiens 3 BAC RP11-603J22 (Roswell Park Canc...	40	5.3
331	gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ...	40	5.3
332	gb|AC161372.2| Mus musculus BAC clone RP23-326G14 from chromosom...	40	5.3
333	gb|AY554168.1| Nicotiana tabacum chloroplast chlorophyll a-b bin...	40	5.3
334	gb|AY105650.1| Zea mays PCO135935 mRNA sequence	40	5.3
335	gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein...	40	5.3
336	gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein...	40	5.3
337	dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest...	40	5.3

---

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score =  498 bits (251), Expect = e-138
 Identities = 320/342 (93%), Gaps = 1/342 (0%)
 Strand = Plus / Plus

                                                                       
Query: 59  agctttccaatggcggcagccaccatgtccatctcctcctcgacctttgccggca-gacg 117
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||
Sbjct: 1   agctttccaatggcggcagccaccatgtccctctcctcctcgacctttgccggcaaggcg 60

                                                                       
Query: 118 gtgaagaacgtaccatcttcggctctctttggcgaggcccgagtcaccatgcgcaagatc 177
           |||||||| |||||||||| ||||||||| ||||||||||| |||||||||||||||| |
Sbjct: 61  gtgaagaatgtaccatctttggctctcttgggcgaggcccgcgtcaccatgcgcaagacc 120

                                                                       
Query: 178 gcagcaaaggcaaagcaagtttcctccggcagcccatggtacggtgccgaccgtgtgctc 237
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 121 gcagcaaaggcaaagcaggtttcctccggcagcccatggtacggtgctgaccgtgtgctc 180

                                                                       
Query: 238 tacctcggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgac 297
           |||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||
Sbjct: 181 tacctcggcccactctccggtgagcctccgagctacctgaccggtgagttccctggcgac 240

                                                                       
Query: 298 tatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggag 357
           ||||||||||||||||| |||||||| |||||||| ||||||||  ||||||||||||||
Sbjct: 241 tatgggtgggacactgctggactttcggctgacccggagaccttctccaagaaccgggag 300

                                                     
Query: 358 ctggaggtgatccattgccgatgggccatgctcggngcactt 399
           |||||||||||||| || || ||||||||||| || ||||||
Sbjct: 301 ctggaggtgatccactgtcgctgggccatgcttggggcactt 342

---

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score =  258 bits (130), Expect = 1e-65
 Identities = 292/345 (84%), Gaps = 1/345 (0%)
 Strand = Plus / Plus

                                                                       
Query: 55  ccttagctttccaatggcggcagccaccatgtccatctcctcctcgacctttgccggca- 113
           |||||||  ||||||||||||  ||||||||| | ||||||| ||||| || ||||| | 
Sbjct: 6   ccttagcactccaatggcggccaccaccatgtacctctcctcatcgacattcgccggaaa 65

                                                                       
Query: 114 gacggtgaagaacgtaccatcttcggctctctttggcgaggcccgagtcaccatgcgcaa 173
           | |||||||||| || ||||  ||||||||||| || ||||| || ||||||||||||||
Sbjct: 66  ggcggtgaagaatgtcccattatcggctctcttcggtgaggctcgcgtcaccatgcgcaa 125

                                                                       
Query: 174 gatcgcagcaaaggcaaagcaagtttcctccggcagcccatggtacggtgccgaccgtgt 233
           || ||| || || || ||||||||||||||| |||||||||||||||| || || |||||
Sbjct: 126 gaccgcggcgaaagctaagcaagtttcctccagcagcccatggtacggagctgatcgtgt 185

                                                                       
Query: 234 gctctacctcggcccactctccggtgagcccccgagctacctcaccggtgagttccctgg 293
           |||||||||||||||||||||  | |||||||| ||||||||||||||||| ||||| ||
Sbjct: 186 gctctacctcggcccactctctcgcgagcccccaagctacctcaccggtgatttccccgg 245

                                                                       
Query: 294 cgactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccg 353
            ||||| ||||||||||| || ||||| || |||||||| ||||||||  | ||||||||
Sbjct: 246 tgactacgggtgggacacggctggactctctgctgaccccgagaccttctcgaagaaccg 305

                                                        
Query: 354 ggagctggaggtgatccattgccgatgggccatgctcggngcact 398
            ||| |||||||||| || ||||| ||||| ||||| || |||||
Sbjct: 306 cgagttggaggtgatacactgccgctgggctatgcttggtgcact 350

---

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score =  242 bits (122), Expect = 7e-61
 Identities = 221/254 (87%)
 Strand = Plus / Plus

                                                                       
Query: 136 tcggctctctttggcgaggcccgagtcaccatgcgcaagatcgcagcaaaggcaaagcaa 195
           ||||| ||||| || ||||| || |||||||||||||||| ||| || ||||| ||||  
Sbjct: 133 tcggcgctcttcggggaggcgcgcgtcaccatgcgcaagaccgcggccaaggccaagccg 192

                                                                       
Query: 196 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 255
           || || ||||||||||| ||||||||  ||||||| ||||||||||||||||| ||||||
Sbjct: 193 gtgtcgtccggcagcccgtggtacgggtccgaccgcgtgctctacctcggcccgctctcc 252

                                                                       
Query: 256 ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
           || || |||||||||||||||||||| |||||||| |||||||| ||||||||||| || 
Sbjct: 253 ggcgaccccccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcg 312

                                                                       
Query: 316 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 375
           || || || || ||||| |||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 313 gggctgtcggccgaccccgagaccttcgccaagaaccgggagctggaggtgatccactgc 372

                         
Query: 376 cgatgggccatgct 389
           || |||||||||||
Sbjct: 373 cggtgggccatgct 386

---

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score =  230 bits (116), Expect = 3e-57
 Identities = 276/328 (84%), Gaps = 1/328 (0%)
 Strand = Plus / Plus

                                                                       
Query: 66  caatggcggcagccaccatgtccatctcctcctcgacctttgccggca-gacggtgaaga 124
           ||||||||||  ||||||||||  | ||||| ||| |||| ||||||| | | || ||||
Sbjct: 199 caatggcggccaccaccatgtctctttcctcttcgtccttcgccggcaaggccgtcaaga 258

                                                                       
Query: 125 acgtaccatcttcggctctctttggcgaggcccgagtcaccatgcgcaagatcgcagcaa 184
           || | || || ||||||||| |||| || || || || | |||||||||||  || || |
Sbjct: 259 acttgccctcgtcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcga 318

                                                                       
Query: 185 aggcaaagcaagtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcg 244
           |||| || |||||||| ||  ||||||| ||||||||  | |||||||||||||||||||
Sbjct: 319 aggccaaacaagtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcg 378

                                                                       
Query: 245 gcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggt 304
           |||| || ||||| |||||||| |||||| | || ||||||||||| || ||||||||||
Sbjct: 379 gcccgctttccggcgagccccccagctacttgactggtgagttccccggtgactatgggt 438

                                                                       
Query: 305 gggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggagg 364
           ||||||| ||||| || || ||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 439 gggacaccgccgggctctcggctgaccctgagaccttcgccaagaaccgggagctcgagg 498

                                       
Query: 365 tgatccattgccgatgggccatgctcgg 392
           ||||||| ||||||||||||||||||||
Sbjct: 499 tgatccactgccgatgggccatgctcgg 526

---

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score =  208 bits (105), Expect = 1e-50
 Identities = 219/257 (85%)
 Strand = Plus / Plus

                                                                       
Query: 136 tcggctctctttggcgaggcccgagtcaccatgcgcaagatcgcagcaaaggcaaagcaa 195
           ||||||||| |||| || || || || | |||||||||||  || || ||||| || |||
Sbjct: 65  tcggctctcattggtgacgcacgtgtgaacatgcgcaagactgcggcgaaggccaaacaa 124

                                                                       
Query: 196 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 255
           ||||| ||  ||||||| ||||||||  | ||||||||||||||||||||| | || |||
Sbjct: 125 gtttcgtcgagcagcccgtggtacggctctgaccgtgtgctctacctcggctcgctttcc 184

                                                                       
Query: 256 ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
           || || ||||| |||||| | || ||||||||||| || ||||||||||||||||| |||
Sbjct: 185 ggcgaaccccccagctacttgactggtgagttccccggtgactatgggtgggacaccgcc 244

                                                                       
Query: 316 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 375
           || || || ||||||||||||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 245 gggctctcggctgaccctgagaccttcgccaagaaccgggagctcgaggtgatccactgc 304

                            
Query: 376 cgatgggccatgctcgg 392
           |||||||||||||||||
Sbjct: 305 cgatgggccatgctcgg 321

---

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 139 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 198

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 199 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 258

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 259 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 318

             
Query: 388 ct 389
           ||
Sbjct: 319 ct 320

---

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                         
Query: 208   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
             ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 14535 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 14476

                                                                         
Query: 268   agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
               |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 14475 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 14416

                                                                         
Query: 328   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
             ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 14415 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 14356

               
Query: 388   ct 389
             ||
Sbjct: 14355 ct 14354

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                            
Query: 208      agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
                ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 30024476 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 30024535

                                                                            
Query: 268      agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
                  |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 30024536 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 30024595

                                                                            
Query: 328      gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
                ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 30024596 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 30024655

                  
Query: 388      ct 389
                ||
Sbjct: 30024656 ct 30024657



 Score =  176 bits (89), Expect = 4e-41
 Identities = 161/185 (87%)
 Strand = Plus / Plus

                                                                            
Query: 208      agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
                ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 23603670 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 23603729

                                                                            
Query: 268      agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
                |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 23603730 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 23603789

                                                                            
Query: 328      gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
                ||||| ||||| || ||||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 23603790 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 23603849

                     
Query: 388      ctcgg 392
                |||||
Sbjct: 23603850 ctcgg 23603854



 Score = 46.1 bits (23), Expect = 0.086
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                           
Query: 203      ccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
                |||||| ||| ||||||||  ||||||| ||  |||||||| |||| ||||||||||||
Sbjct: 37443423 ccggcaacccgtggtacggccccgaccgcgtcatctacctccgcccgctctccggtgag 37443365

---

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                         
Query: 208   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
             ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 20466 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 20525

                                                                         
Query: 268   agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
               |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 20526 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 20585

                                                                         
Query: 328   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
             ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 20586 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 20645

               
Query: 388   ct 389
             ||
Sbjct: 20646 ct 20647

---

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

             
Query: 388 ct 389
           ||
Sbjct: 400 ct 401

---

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 220 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 279

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 280 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 339

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 340 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 399

             
Query: 388 ct 389
           ||
Sbjct: 400 ct 401

---

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

             
Query: 388 ct 389
           ||
Sbjct: 402 ct 403

---

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score =  186 bits (94), Expect = 4e-44
 Identities = 160/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 222 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 281

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||| |||||||| |||||||| || |||||||| ||||| || || || 
Sbjct: 282 tcctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctgtcggcc 341

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 342 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 401

             
Query: 388 ct 389
           ||
Sbjct: 402 ct 403

---

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                            
Query: 208      agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
                ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 10793123 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 10793182

                                                                            
Query: 268      agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
                |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 10793183 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 10793242

                                                                            
Query: 328      gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
                ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 10793243 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 10793302

                  
Query: 388      ct 389
                ||
Sbjct: 10793303 ct 10793304

---

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                         
Query: 208   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
             ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 16846 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 16905

                                                                         
Query: 268   agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 16906 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 16965

                                                                         
Query: 328   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
             ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 16966 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 17025

               
Query: 388   ct 389
             ||
Sbjct: 17026 ct 17027

---

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                          
Query: 208    agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
              ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 129741 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 129800

                                                                          
Query: 268    agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
              |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 129801 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 129860

                                                                          
Query: 328    gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
              ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 129861 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 129920

                
Query: 388    ct 389
              ||
Sbjct: 129921 ct 129922

---

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 191 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 250

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 251 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 310

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 311 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 370

             
Query: 388 ct 389
           ||
Sbjct: 371 ct 372

---

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

             
Query: 388 ct 389
           ||
Sbjct: 376 ct 377

---

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 258 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 377

             
Query: 388 ct 389
           ||
Sbjct: 378 ct 379

---

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

             
Query: 388 ct 389
           ||
Sbjct: 376 ct 377

---

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 181 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 240

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||||||| |||||| | |||||||| || |||||||| ||||| || || || 
Sbjct: 241 tcctacctcaccggcgagttctccggcgactacggctgggacaccgccgggctgtcggcc 300

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 301 gacccggagacgttcgccaagaaccgggagctggaggtgatccactgccggtgggccatg 360

             
Query: 388 ct 389
           ||
Sbjct: 361 ct 362

---

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score =  178 bits (90), Expect = 9e-42
 Identities = 159/182 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 177 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 236

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 237 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 296

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||| ||||||| | ||||||||| |||
Sbjct: 297 gacccggagacgttcgccaagaaccgggagctggagctgatccactcccgatgggcgatg 356

             
Query: 388 ct 389
           ||
Sbjct: 357 ct 358

---

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score =  176 bits (89), Expect = 4e-41
 Identities = 161/185 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 127 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 186

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 187 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 246

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 247 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 306

                
Query: 388 ctcgg 392
           |||||
Sbjct: 307 ctcgg 311

---

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score =  176 bits (89), Expect = 4e-41
 Identities = 161/185 (87%)
 Strand = Plus / Plus

                                                                         
Query: 208   agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
             ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 66369 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 66428

                                                                         
Query: 268   agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 66429 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 66488

                                                                         
Query: 328   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
             ||||| ||||| || ||||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 66489 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 66548

                  
Query: 388   ctcgg 392
             |||||
Sbjct: 66549 ctcgg 66553

---

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score =  176 bits (89), Expect = 4e-41
 Identities = 161/185 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 198 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 257

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 258 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 317

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 318 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 377

                
Query: 388 ctcgg 392
           |||||
Sbjct: 378 ctcgg 382

---

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score =  176 bits (89), Expect = 4e-41
 Identities = 161/185 (87%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||
Sbjct: 197 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggcgagccgccg 256

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 257 agctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctccgcc 316

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || ||||||||||||||||||||||||||||| | | | ||||| |||
Sbjct: 317 gacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcgatg 376

                
Query: 388 ctcgg 392
           |||||
Sbjct: 377 ctcgg 381

---

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score =  170 bits (86), Expect = 2e-39
 Identities = 158/182 (86%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||| |||||||| |||||||| || |||||||||||||| |||||||| ||||| |||
Sbjct: 196 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctccggcgagccgccg 255

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||||||||| |||||||| |||||||| ||||||||||| || || || || || 
Sbjct: 256 agctacctcaccggcgagttcccgggcgactacgggtgggacaccgcggggctctccgcc 315

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| |||||  | ||||||||||||||||||||||||||||| | ||| ||||| |||
Sbjct: 316 gacccggagacgctcgccaagaaccgggagctggaggtgatccactcccggtgggcgatg 375

             
Query: 388 ct 389
           ||
Sbjct: 376 ct 377

---

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score =  168 bits (85), Expect = 9e-39
 Identities = 163/189 (86%)
 Strand = Plus / Plus

                                                                       
Query: 201 ctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtga 260
           |||||||||||| ||||||||  ||||||| ||||||||||| |||||||| ||||| ||
Sbjct: 144 ctccggcagcccgtggtacggccccgaccgcgtgctctacctgggcccactgtccggcga 203

                                                                       
Query: 261 gcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggact 320
           ||||||||||||||| || || |||||||| |||||||| || |||||||| || || ||
Sbjct: 204 gcccccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggct 263

                                                                       
Query: 321 ttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatg 380
            || || ||||| ||||| || ||||||||||||||||||||||| ||||| | ||| ||
Sbjct: 264 gtcggcggacccggagacgttcgccaagaaccgggagctggaggtcatccactcccgctg 323

                    
Query: 381 ggccatgct 389
           |||||||||
Sbjct: 324 ggccatgct 332

---

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  165 bits (83), Expect = 1e-37
 Identities = 164/191 (85%)
 Strand = Plus / Plus

                                                                        
Query: 202  tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
            ||||||||||| ||||||||  ||||||| ||    |||||||||||  ||||||| |||
Sbjct: 1015 tccggcagcccctggtacggccccgaccgcgtcaagtacctcggccccttctccggcgag 1074

                                                                        
Query: 262  cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            |||||||||||||||||||| |||||||| |||||||| || |||||||| ||||| || 
Sbjct: 1075 cccccgagctacctcaccggcgagttccccggcgactacggctgggacaccgccgggctg 1134

                                                                        
Query: 322  tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
            || || ||||| ||||| || ||||||||||| ||||||||||||||||| | ||| |||
Sbjct: 1135 tccgccgaccccgagacattcgccaagaaccgcgagctggaggtgatccactcccgctgg 1194

                       
Query: 382  gccatgctcgg 392
            |||||||||||
Sbjct: 1195 gccatgctcgg 1205

---

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score =  159 bits (80), Expect = 8e-36
 Identities = 161/188 (85%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||| ||||| ||||||||  ||||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 197 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 256

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 257 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 316

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || ||||| ||||| || ||||||||||||||||||||||||||||| ||||| |||
Sbjct: 317 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactgccgctgg 376

                   
Query: 382 gccatgct 389
           ||||||||
Sbjct: 377 gccatgct 384

---

>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA,
           complete cds
          Length = 927

 Score =  155 bits (78), Expect = 1e-34
 Identities = 147/170 (86%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  | ||||||||    ||| | |||||| |||||||||||
Sbjct: 142 tccggcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgag 201

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           ||||| |||||| | |||||||| ||||| || |||||||| ||||||||||||||||| 
Sbjct: 202 cccccaagctacttgaccggtgaattccccggtgactatggctgggacactgccggactc 261

                                                             
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           ||||||||||| || ||||||||||||||||| ||||| || ||||||||
Sbjct: 262 tcagctgacccagaaacctttgccaagaaccgtgagctcgaagtgatcca 311

---

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1442

 Score =  155 bits (78), Expect = 1e-34
 Identities = 161/188 (85%), Gaps = 3/188 (1%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt---gagccc 264
           ||||| |||||||| |||||||| ||||||||||||||||| ||||||||    ||||| 
Sbjct: 624 agcccgtggtacggcgccgaccgcgtgctctacctcggcccgctctccggccgcgagccg 683

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 684 ccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 743

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           || ||||| ||||| || ||||||||||||||||||||||||||||| | | | ||||| 
Sbjct: 744 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactccaggtgggcg 803

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 804 atgctcgg 811

---

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Plus

                                                                        
Query: 202  tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
            ||||| ||||| ||||||||  ||||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 262  cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 322  tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
            || || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                    
Query: 382  gccatgct 389
            ||||||||
Sbjct: 1325 gccatgct 1332

---

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score =  151 bits (76), Expect = 2e-33
 Identities = 160/188 (85%)
 Strand = Plus / Plus

                                                                        
Query: 202  tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
            ||||| ||||| ||||||||  ||||||| ||||| ||||| |||||||| ||||| |||
Sbjct: 1145 tccgggagcccgtggtacggccccgaccgcgtgctgtacctgggcccactgtccggcgag 1204

                                                                        
Query: 262  cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            || ||||||||||| || || |||||||| |||||||| || |||||||| || || || 
Sbjct: 1205 ccgccgagctacctgacgggcgagttcccgggcgactacggctgggacaccgcggggctg 1264

                                                                        
Query: 322  tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
            || || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| |||
Sbjct: 1265 tcggcggacccggagacgttcgccaagaaccgggagctggaggtgatccactcccgctgg 1324

                    
Query: 382  gccatgct 389
            ||||||||
Sbjct: 1325 gccatgct 1332

---

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score =  149 bits (75), Expect = 8e-33
 Identities = 158/185 (85%), Gaps = 3/185 (1%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt---gagccc 264
           ||||| |||||||| |||||||| || |||||||||||||| ||||| ||    ||||| 
Sbjct: 585 agcccgtggtacggcgccgaccgcgtcctctacctcggcccgctctcgggccgcgagccg 644

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||||||||| |||||||| |||||||| ||||||||||| || || || || 
Sbjct: 645 ccgagctacctcaccggcgagttccccggcgactacgggtgggacaccgcggggctctcc 704

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           || ||||| ||||| || ||||||||||||||||||||||||||||| | ||| ||||| 
Sbjct: 705 gccgacccggagacgttcgccaagaaccgggagctggaggtgatccactcccggtgggcg 764

                
Query: 385 atgct 389
           |||||
Sbjct: 765 atgct 769

---

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score =  147 bits (74), Expect = 3e-32
 Identities = 158/186 (84%)
 Strand = Plus / Plus

                                                                        
Query: 201  ctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtga 260
            |||||||||||| ||||||||||||||||| || || ||||| ||||| || |||||   
Sbjct: 2055 ctccggcagcccctggtacggtgccgaccgcgtcctgtacctgggcccgctgtccggctc 2114

                                                                        
Query: 261  gcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggact 320
             || ||||||||||| ||||| |||||||| |||||||| ||||||||||| |  || ||
Sbjct: 2115 acctccgagctacctgaccggcgagttccccggcgactacgggtgggacaccgaggggct 2174

                                                                        
Query: 321  ttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatg 380
             || || ||||| |||||||| ||||||||||| ||||||||||||||||| ||||| ||
Sbjct: 2175 gtcggcggacccggagaccttcgccaagaaccgcgagctggaggtgatccactgccgctg 2234

                  
Query: 381  ggccat 386
            ||||||
Sbjct: 2235 ggccat 2240

---

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score =  145 bits (73), Expect = 1e-31
 Identities = 129/148 (87%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||||||| ||||||||||| | |||||||||||||| || ||||| || |||||||
Sbjct: 74  tctccggtgagtccccgagctacttgaccggtgagttccccggtgactacggctgggaca 133

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           |||| ||||| ||||||||||| |||||||| ||||||||||| ||||| ||||||||||
Sbjct: 134 ctgctggactctcagctgacccagagaccttcgccaagaaccgtgagcttgaggtgatcc 193

                                       
Query: 371 attgccgatgggccatgctcggngcact 398
           | |   ||||||||||||| || |||||
Sbjct: 194 actcaagatgggccatgcttggagcact 221

---

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score =  145 bits (73), Expect = 1e-31
 Identities = 114/128 (89%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||||| |||||||| |||||||||||||||||||| |||||||||||||||
Sbjct: 224 tacctgaccggtgaattccctggagactatgggtgggacactgctggactttcagctgac 283

                                                                       
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 390
           || ||||| |||||||||||||| ||||| || ||||||||  || ||||||||||||| 
Sbjct: 284 ccagagacatttgccaagaaccgtgagctcgaagtgatccacagcagatgggccatgctt 343

                   
Query: 391 ggngcact 398
           || |||||
Sbjct: 344 ggtgcact 351

---

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
           protein, complete cds
          Length = 1500

 Score =  145 bits (73), Expect = 1e-31
 Identities = 148/173 (85%)
 Strand = Plus / Plus

                                                                       
Query: 215 ggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccgagctacc 274
           ||||||||||||||||  | |||||||| |||||| |||| |||   |||||   |||||
Sbjct: 667 ggtacggtgccgaccgccttctctacctgggcccattctctggttctcccccatcctacc 726

                                                                       
Query: 275 tcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctg 334
           |||| |||||||||||||| ||||||||||||||||| || || || || || ||||| |
Sbjct: 727 tcactggtgagttccctggtgactatgggtgggacacagctggtctgtccgcagacccag 786

                                                                
Query: 335 agacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||||| ||||||||| ||||||||||||||||||||| | |||||||||||
Sbjct: 787 agaccttcgccaagaacagggagctggaggtgatccattccagatgggccatg 839

---

>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score =  145 bits (73), Expect = 1e-31
 Identities = 157/185 (84%)
 Strand = Plus / Minus

                                                                        
Query: 205  ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccc 264
            |||||||||||||||||| ||||||||||    ||| | |||||| |||| |||||| | 
Sbjct: 2532 ggcagcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggtgagtct 2473

                                                                        
Query: 265  ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
            || |||||| | || |||||||| || || |||||||| ||||||||||| |||||||||
Sbjct: 2472 ccaagctacttgactggtgagtttccaggtgactatggatgggacactgctggactttca 2413

                                                                        
Query: 325  gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
            ||||| || || || |||||||||||||| ||| ||||||||||||| ||| ||||||||
Sbjct: 2412 gctgatccagaaacttttgccaagaaccgtgagttggaggtgatccactgcagatgggcc 2353

                 
Query: 385  atgct 389
            |||||
Sbjct: 2352 atgct 2348



 Score =  115 bits (58), Expect = 1e-22
 Identities = 124/146 (84%)
 Strand = Plus / Plus

                                                                        
Query: 244  ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
            |||||| |||| |||||| | || |||||| | || ||||| |||||||| ||||| |||
Sbjct: 4540 ggcccattctctggtgagtctccaagctacttgactggtgaattccctggtgactacggg 4599

                                                                        
Query: 304  tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
            ||||||||||| |||||||||||||| || || || ||||| |||||||| ||| |||||
Sbjct: 4600 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 4659

                                      
Query: 364  gtgatccattgccgatgggccatgct 389
            |||||||| ||| ||||||| |||||
Sbjct: 4660 gtgatccactgcagatgggcaatgct 4685

---

>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light
            harvesting chlorophyll a/b-binding protein, complete cds
          Length = 7965

 Score =  143 bits (72), Expect = 5e-31
 Identities = 156/184 (84%)
 Strand = Plus / Plus

                                                                        
Query: 206  gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
            ||||||||||||||||| | ||||||||    ||| | |||||| ||||||||||| |||
Sbjct: 4471 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattctccggtgagtccc 4530

                                                                        
Query: 266  cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
            | |||||| | |||||||| || || || |||||||||||||| ||||| ||||||||||
Sbjct: 4531 caagctacttgaccggtgaatttcccggtgactatgggtgggatactgctggactttcag 4590

                                                                        
Query: 326  ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 385
            | || || || ||||||||||||||||| ||||| ||||||||||| ||| ||||||| |
Sbjct: 4591 cagatccagaaacctttgccaagaaccgtgagctcgaggtgatccactgcagatgggcta 4650

                
Query: 386  tgct 389
            ||||
Sbjct: 4651 tgct 4654



 Score =  119 bits (60), Expect = 7e-24
 Identities = 153/184 (83%)
 Strand = Plus / Plus

                                                                        
Query: 206  gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
            ||||||||||||||||  | ||||||||    ||| | |||||| ||||||||||| |||
Sbjct: 7011 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgaggccc 7070

                                                                        
Query: 266  cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
            | |||||| | |||||||| ||||| || || || |||||||| ||||| ||||||||||
Sbjct: 7071 caagctacttgaccggtgaattcccaggtgattacgggtgggatactgctggactttcag 7130

                                                                        
Query: 326  ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 385
            | || || || ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 7131 cggatccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 7190

                
Query: 386  tgct 389
            ||||
Sbjct: 7191 tgct 7194



 Score =  103 bits (52), Expect = 4e-19
 Identities = 151/184 (82%)
 Strand = Plus / Plus

                                                                        
Query: 206  gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
            ||||||||||||||||| | ||||||||    ||| | |||||| | || |||||| | |
Sbjct: 2018 gcagcccatggtacggtccagaccgtgttaagtacttgggcccattttctggtgagtctc 2077

                                                                        
Query: 266  cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
            | |||||  | || ||||| |||||||| |||||||||||||| ||||| ||||||||||
Sbjct: 2078 caagctatttgactggtgaattccctggtgactatgggtgggatactgctggactttcag 2137

                                                                        
Query: 326  ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 385
            | ||||| || || |||||||||||||| || || |||||||| || ||| ||||||| |
Sbjct: 2138 ccgacccagaaacttttgccaagaaccgtgaactcgaggtgattcactgcagatgggcta 2197

                
Query: 386  tgct 389
            ||||
Sbjct: 2198 tgct 2201

---

>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score =  139 bits (70), Expect = 8e-30
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||||||| | ||||||||    ||| | |||||| ||||||||||  |||| 
Sbjct: 375 agcccatggtacggtcctgaccgtgtcaagtacttgggcccattctccggtgaagcccca 434

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||| | ||||||||||||||||| |||||||| |||||||| || | ||||||||||
Sbjct: 435 agctacttgaccggtgagttccctggtgactatggttgggacaccgctgaactttcagct 494

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           || || || || || ||||||||||| ||| ||||||||||||| ||| |||||||||||
Sbjct: 495 gatcccgaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 554

             
Query: 388 ct 389
           ||
Sbjct: 555 ct 556

---

>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score =  139 bits (70), Expect = 8e-30
 Identities = 154/182 (84%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| |||| 
Sbjct: 208 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtcccca 267

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||| | || |||||||||||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 268 agctacttgactggtgagttccctggtgactacgggtgggacactgctggactttcagct 327

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           || || || || ||||||||||| || ||| ||||||||||||| ||| |||||||||||
Sbjct: 328 gatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcagatgggccatg 387

             
Query: 388 ct 389
           ||
Sbjct: 388 ct 389

---

>gb|U21115.1|STU21115 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-6) gene,
           nuclear gene encoding chloroplast protein, partial cds
          Length = 405

 Score =  139 bits (70), Expect = 8e-30
 Identities = 127/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | |||||||| |||||||| ||||| || 
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggc 234

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| ||||| ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 235 tgggatactgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||||||| ||||||| |||||
Sbjct: 295 gtgatccattgcagatgggctatgct 320

---

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score =  139 bits (70), Expect = 8e-30
 Identities = 127/146 (86%)
 Strand = Plus / Plus

                                                                        
Query: 244  ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
            |||||| |||| |||||| |||| |||||| | || |||||||||||||| || ||||| 
Sbjct: 1631 ggcccattctctggtgagtccccaagctacttgacgggtgagttccctggtgattatgga 1690

                                                                        
Query: 304  tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
            ||||||||||| |||||||||||||| || || || ||||| |||||||| ||| |||||
Sbjct: 1691 tgggacactgctggactttcagctgatccagaaacttttgctaagaaccgtgagttggag 1750

                                      
Query: 364  gtgatccattgccgatgggccatgct 389
            |||||||||||| |||||||||||||
Sbjct: 1751 gtgatccattgcagatgggccatgct 1776

---

>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score =  135 bits (68), Expect = 1e-28
 Identities = 158/188 (84%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||| ||||||||  | ||||||||    |||||||||||  |||||||||||
Sbjct: 94  tccggcagcccctggtacggcccggaccgtgtcaagtacctcggcccgttctccggtgag 153

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            | ||    |||||||||||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 154 gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 213

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || ||||| ||||| |||||||||||||||||||| ||||||||||| ||||| |||
Sbjct: 214 tccgcggaccccgagacatttgccaagaaccgggagctcgaggtgatccactgccggtgg 273

                   
Query: 382 gccatgct 389
           || |||||
Sbjct: 274 gcaatgct 281

---

>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score =  133 bits (67), Expect = 5e-28
 Identities = 163/195 (83%)
 Strand = Plus / Plus

                                                                       
Query: 195 agtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctc 254
           |||||| ||||||||||| ||||| ||| | ||||||||    ||| | |||||| ||||
Sbjct: 96  agtttcttccggcagcccgtggtatggtcctgaccgtgtcaagtacttgggcccattctc 155

                                                                       
Query: 255 cggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgc 314
            |||||||| ||   |||||| ||||| ||||||||||| ||||| || |||||||||||
Sbjct: 156 tggtgagccaccatcctaccttaccggagagttccctggtgactacggttgggacactgc 215

                                                                       
Query: 315 cggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattg 374
            |||||||||||||| || |||||||| ||||||||||| ||| |||| |||||||| | 
Sbjct: 216 tggactttcagctgatcccgagaccttcgccaagaaccgtgagttggaagtgatccactc 275

                          
Query: 375 ccgatgggccatgct 389
           | |||||||||||||
Sbjct: 276 cagatgggccatgct 290

---

>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score =  131 bits (66), Expect = 2e-27
 Identities = 162/194 (83%)
 Strand = Plus / Plus

                                                                       
Query: 196 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 255
           |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 115 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 174

                                                                       
Query: 256 ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
           |||||||||||    ||||| || ||||| |||||||| |||||||| ||||||||||| 
Sbjct: 175 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 234

                                                                       
Query: 316 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 375
           || |||||||||||||| || ||||||||||||||||| ||||| || |||||||| | |
Sbjct: 235 gggctttcagctgacccagaaacctttgccaagaaccgtgagcttgaagtgatccactcc 294

                         
Query: 376 cgatgggccatgct 389
            |||||||||||||
Sbjct: 295 agatgggccatgct 308

---

>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score =  131 bits (66), Expect = 2e-27
 Identities = 117/134 (87%)
 Strand = Plus / Plus

                                                                       
Query: 256 ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
           |||||| |||| |||||| | || |||||||| ||||| |||||||||||||| ||||| 
Sbjct: 420 ggtgaggccccaagctacttgactggtgagtttcctggtgactatgggtgggatactgct 479

                                                                       
Query: 316 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 375
           ||||||||||| ||||| || || || ||||||||||||||| ||||||||||||| |||
Sbjct: 480 ggactttcagcagacccagaaactttcgccaagaaccgggagttggaggtgatccactgc 539

                         
Query: 376 cgatgggccatgct 389
            |||||||||||||
Sbjct: 540 agatgggccatgct 553

---

>gb|U21114.1|STU21114 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-5) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | |||||||| |||||||| ||||| |||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggcaatgct 320

---

>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  131 bits (66), Expect = 2e-27
 Identities = 126/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | |||||||| |||||||| ||||| |||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 234

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggcaatgct 320

---

>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score =  127 bits (64), Expect = 3e-26
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||| ||||||||  | ||||||||    |||||||||||  ||||||| |||
Sbjct: 190 tccggcagcccgtggtacggcccggaccgtgtcaagtacctcggcccgttctccggcgag 249

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            ||||    ||||||||||| || ||||| |||||||| ||||||||||| ||||| || 
Sbjct: 250 gccccatcatacctcaccggcgaattccccggcgactacgggtgggacaccgccgggctc 309

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || ||||| ||||||||  |||||||||||||||| ||||||||||| ||||| |||
Sbjct: 310 tccgccgaccccgagaccttctccaagaaccgggagctcgaggtgatccactgccggtgg 369

                   
Query: 382 gccatgct 389
           ||||||||
Sbjct: 370 gccatgct 377

---

>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score =  127 bits (64), Expect = 3e-26
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||| ||||||||  |||| |||||    |||||||||||  |||||||||||
Sbjct: 174 tccggcagcccgtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgag 233

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            | ||    |||||||||||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 234 gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 293

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           ||||| ||||| ||||| || ||||||||||||||||| ||||||||||| ||| | |||
Sbjct: 294 tcagcggaccccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgg 353

                   
Query: 382 gccatgct 389
           || |||||
Sbjct: 354 gcaatgct 361

---

>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score =  127 bits (64), Expect = 3e-26
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||| ||||||||  |||| |||||    |||||||||||  |||||||||||
Sbjct: 9   tccggcagcccgtggtacggccccgaacgtgtcaagtacctcggcccgttctccggtgag 68

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
            | ||    |||||||||||||||||||| |||||||| || |||||||| ||||| || 
Sbjct: 69  gcaccatcatacctcaccggtgagttccccggcgactacggctgggacaccgccgggctc 128

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           ||||| ||||| ||||| || ||||||||||||||||| ||||||||||| ||| | |||
Sbjct: 129 tcagcggaccccgagacattcgccaagaaccgggagctcgaggtgatccactgcaggtgg 188

                   
Query: 382 gccatgct 389
           || |||||
Sbjct: 189 gcaatgct 196

---

>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score =  127 bits (64), Expect = 3e-26
 Identities = 121/140 (86%)
 Strand = Plus / Plus

                                                                       
Query: 253 tccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacact 312
           ||||| ||||||||||||||||||||||| |||||||| || ||||| || |||||||| 
Sbjct: 1   tccggagagcccccgagctacctcaccggagagttccccggagactacggatgggacacc 60

                                                                       
Query: 313 gccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccat 372
           ||||| || || |||||||| |||||||| |||| |||||| ||||| || || ||||| 
Sbjct: 61  gccggtctctccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatccac 120

                               
Query: 373 tgccgatgggccatgctcgg 392
           ||| ||||||||||||||||
Sbjct: 121 tgcagatgggccatgctcgg 140

---

>gb|AY198376.1| Citrus limon chlorophyll a/b-binding protein precursor, gene,
           partial cds; nuclear gene for chloroplast product
          Length = 647

 Score =  127 bits (64), Expect = 3e-26
 Identities = 124/144 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| || |||||||| |||||| | ||||||||||||||||||||||| || 
Sbjct: 172 ggcccattctctggcgagcccccaagctacttgaccggtgagttccctggcgactacggt 231

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           |||||||| ||||| |||||||||||||| || |||||||||||||| || || || || 
Sbjct: 232 tgggacacagccgggctttcagctgacccagaaacctttgccaagaatcgtgaactcgaa 291

                                   
Query: 364 gtgatccattgccgatgggccatg 387
           || ||||| ||| |||||||||||
Sbjct: 292 gtcatccactgcagatgggccatg 315

---

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score =  127 bits (64), Expect = 3e-26
 Identities = 166/200 (83%)
 Strand = Plus / Plus

                                                                       
Query: 190 aagcaagtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggccca 249
           ||||| ||||||||||| ||||||||||||||  | ||||||||    ||| | ||||||
Sbjct: 173 aagcaggtttcctccggaagcccatggtacggcccagaccgtgtcaagtacttgggccca 232

                                                                       
Query: 250 ctctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggac 309
            ||||||| |||||||||  |||||||||||| |||||||| || ||||| || ||||||
Sbjct: 233 ttctccggcgagcccccgtcctacctcaccggcgagttcccaggtgactacggttgggac 292

                                                                       
Query: 310 actgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatc 369
           ||||| || ||||| |||||||| |||||||| |||| |||||| ||| |||| || |||
Sbjct: 293 actgctgggctttccgctgacccagagaccttcgccaggaaccgtgagttggaagtcatc 352

                               
Query: 370 cattgccgatgggccatgct 389
           || | | | |||||||||||
Sbjct: 353 cactccaggtgggccatgct 372

---

>gb|U21113.1|STU21113 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-4) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  127 bits (64), Expect = 3e-26
 Identities = 154/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 206 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
           ||||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| |||
Sbjct: 137 gcagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggtgagtccc 196

                                                                       
Query: 266 cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
           | || ||| | |||||||| |||||||| |||||||| ||||| ||||| ||||||||||
Sbjct: 197 caagttacttgaccggtgaattccctggtgactatggctgggatactgctggactttcag 256

                                                                       
Query: 326 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 385
           | |||||||| ||||||||||||||||| || || ||||||||||| ||| | ||||| |
Sbjct: 257 cagaccctgaaacctttgccaagaaccgtgaactagaggtgatccactgcaggtgggcta 316

               
Query: 386 tgct 389
           ||||
Sbjct: 317 tgct 320

---

>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score =  125 bits (63), Expect = 1e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           |||| |||||| |||| |||||| | || |||||||||||||| || |||||||||||||
Sbjct: 418 tctctggtgaggccccaagctacttgactggtgagttccctggtgattatgggtgggaca 477

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           |||| |||||||||||||| || || || || |||||||| || ||| ||||||||||||
Sbjct: 478 ctgctggactttcagctgatccagaaactttcgccaagaatcgtgagttggaggtgatcc 537

                              
Query: 371 attgccgatgggccatgct 389
           | ||| |||||||||||||
Sbjct: 538 actgcagatgggccatgct 556

---

>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score =  125 bits (63), Expect = 1e-25
 Identities = 159/191 (83%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           ||||| || ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||
Sbjct: 171 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggcccattctctggt 230

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||  |||| |||||| | || |||||||| ||||| ||||| || ||||||||||| |||
Sbjct: 231 gaagccccaagctacttgactggtgagtttcctggtgactacggatgggacactgctgga 290

                                                                       
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 378
           ||||||||||||||||| || || || |||||||| ||||| ||||||||||| ||| ||
Sbjct: 291 ctttcagctgaccctgaaacattcgctaagaaccgtgagcttgaggtgatccactgcaga 350

                      
Query: 379 tgggccatgct 389
           |||||||||||
Sbjct: 351 tgggccatgct 361

---

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score =  125 bits (63), Expect = 1e-25
 Identities = 120/139 (86%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           |||| |||||| | || |||||| | || |||||||||||||| |||||||| ||||| |
Sbjct: 624 tctctggtgagtctccaagctacttgactggtgagttccctggtgactatggatgggata 683

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           |||| |||||||||||||| ||||| || |||||||||||||| ||| ||||||||||||
Sbjct: 684 ctgctggactttcagctgatcctgaaacttttgccaagaaccgtgagttggaggtgatcc 743

                              
Query: 371 attgccgatgggccatgct 389
           | ||  |||||||||||||
Sbjct: 744 actgtagatgggccatgct 762

---

>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score =  123 bits (62), Expect = 5e-25
 Identities = 98/110 (89%)
 Strand = Plus / Plus

                                                                        
Query: 280  ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 339
            |||||||||||||| ||||| || ||||||||||| ||||| ||||||||||||||||| 
Sbjct: 2322 ggtgagttccctggtgactacggatgggacactgctggactctcagctgaccctgagaca 2381

                                                              
Query: 340  tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
            ||||| | ||||| |||||| |||||||||||||| || |||||||||||
Sbjct: 2382 tttgctaggaacctggagcttgaggtgatccattgtcgttgggccatgct 2431

---

>gb|U21112.1|STU21112 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-3 gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  123 bits (62), Expect = 5e-25
 Identities = 125/146 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | || ||||| |||||||| ||||| |||
Sbjct: 175 ggcccattctctggtgagtccccaagctacttgactggtgaattccctggtgactacggg 234

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 294

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggctatgct 320

---

>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 798

 Score =  123 bits (62), Expect = 5e-25
 Identities = 125/146 (85%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| || ||| | || ||||| |||||||| |||||||| 
Sbjct: 175 ggcccattctctggtgagtccccaagttacttgactggtgaattccctggtgactatgga 234

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||||||||||||||||||||| || || |||
Sbjct: 235 tgggataccgctggactttcagcagaccctgagacctttgccaagaaccgtgaacttgag 294

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 295 gtgatccactgcagatgggctatgct 320

---

>emb|AJ318069.1|STU318069 Solanum tuberosum mRNA for ferredoxin-thioredoxin-reductase
           catalytic subunit B (ftrbpot gene)
          Length = 701

 Score =  123 bits (62), Expect = 5e-25
 Identities = 119/138 (86%)
 Strand = Plus / Minus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | |||||||| |||||||| ||||| |||
Sbjct: 618 ggcccattctctggtgagtccccaagctacttgaccggtgaattccctggtgactacggg 559

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||| ||||||||||||||||| || || |||
Sbjct: 558 tgggataccgctggactttcagcagaccctgaaacctttgccaagaaccgtgaactcgag 499

                             
Query: 364 gtgatccattgccgatgg 381
           |||||||| ||| |||||
Sbjct: 498 gtgatccactgcagatgg 481

---

>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score =  123 bits (62), Expect = 5e-25
 Identities = 152/182 (83%)
 Strand = Plus / Plus

                                                                        
Query: 208  agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
            ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 1120 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 1179

                                                                        
Query: 268  agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
            |||||| | || |||||||| ||||| || || |||||||||||||||||||||||||||
Sbjct: 1180 agctacttgactggtgagtttcctggtgattacgggtgggacactgccggactttcagct 1239

                                                                        
Query: 328  gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
            || || || || || ||||||||||| ||| ||||||||||||| ||| |||||||||||
Sbjct: 1240 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 1299

              
Query: 388  ct 389
            ||
Sbjct: 1300 ct 1301

---

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score =  121 bits (61), Expect = 2e-24
 Identities = 148/177 (83%)
 Strand = Plus / Plus

                                                                       
Query: 207 cagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccccc 266
           |||||||||||||||| ||||||||||    ||| | |||||| |||| || ||| | ||
Sbjct: 168 cagcccatggtacggtcccgaccgtgtcaagtacttgggcccattctctggcgagtcacc 227

                                                                       
Query: 267 gagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagc 326
              ||||||||| ||||| |||||||| ||||| |||||||||||||| ||||| || ||
Sbjct: 228 atcctacctcactggtgaattccctggtgactacgggtgggacactgctggactctctgc 287

                                                                    
Query: 327 tgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggc 383
           |||||| ||||||||||| |||||||| || || ||||||||||| ||| |||||||
Sbjct: 288 tgacccagagacctttgctaagaaccgcgaacttgaggtgatccactgcagatgggc 344

---

>gb|DQ471302.1| Carya cathayensis putative chloroplast chlorophyll a/b-binding
           protein (ABC) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 993

 Score =  119 bits (60), Expect = 7e-24
 Identities = 105/120 (87%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           ||||||||| || || || |||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 207 ctacctcacaggagaatttcctggcgactatggttgggacactgccggactctcagctga 266

                                                                       
Query: 330 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           ||| ||||| || || |||||||| ||||| || ||||||||||  ||||||||||||||
Sbjct: 267 cccggagacattcgctaagaaccgtgagctcgaagtgatccattcacgatgggccatgct 326

---

>emb|X52743.1|NTCAB21 Tabacco Cab21 mRNA for major chlorophyll a/b binding protein
          Length = 953

 Score =  119 bits (60), Expect = 7e-24
 Identities = 153/184 (83%)
 Strand = Plus / Plus

                                                                       
Query: 206 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
           ||||||||||||||||  | ||||||||    ||| | || ||| ||||||||||| |||
Sbjct: 199 gcagcccatggtacggcccagaccgtgttaagtacttgggtccattctccggtgagtccc 258

                                                                       
Query: 266 cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
           | |||||| | |||||||| ||||| || || || |||||||| ||||| ||||||||||
Sbjct: 259 caagctacttgaccggtgaattccccggtgattacgggtgggatactgctggactttcag 318

                                                                       
Query: 326 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 385
           | ||||| || ||||||||||||||||| || || ||||||||||| ||| ||||||| |
Sbjct: 319 cagacccagaaacctttgccaagaaccgtgaactcgaggtgatccactgcagatgggcta 378

               
Query: 386 tgct 389
           ||||
Sbjct: 379 tgct 382

---

>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007,
             complete sequence
          Length = 92741

 Score =  119 bits (60), Expect = 7e-24
 Identities = 111/128 (86%)
 Strand = Plus / Minus

                                                                         
Query: 244   ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
             |||||| |||||||||||||||||  |||| | |||||||||||||| || ||||| || 
Sbjct: 66182 ggcccattctccggtgagcccccgtcctacttgaccggtgagttccccggtgactacggc 66123

                                                                         
Query: 304   tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
             ||||||||||| || ||||| |||||||| ||||| || ||||||||||| ||||| |||
Sbjct: 66122 tgggacactgctgggctttctgctgaccccgagacattcgccaagaaccgtgagcttgag 66063

                     
Query: 364   gtgatcca 371
             ||||||||
Sbjct: 66062 gtgatcca 66055

---

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score =  117 bits (59), Expect = 3e-23
 Identities = 119/139 (85%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| |||||||| ||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 224 tctccggagagcccccaagctacctcacaggagagttccccggtgactacggatgggaca 283

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | ||||| ||||| |||||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 284 ccgccggtctttccgctgaccccgagaccttcgccaggaaccgtgagctagaagttatcc 343

                              
Query: 371 attgccgatgggccatgct 389
           | ||| |||||||||||||
Sbjct: 344 actgcagatgggccatgct 362

---

>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score =  117 bits (59), Expect = 3e-23
 Identities = 104/119 (87%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           |||||||||||||||||||| || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 261 tacctcaccggtgagttcccaggtgactatggttgggacactgctggactctcagctgac 320

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| || || |  ||||| || || ||||||||||||||||| |||||||||||
Sbjct: 321 ccagagacattcgctagaaaccgtgaacttgaggtgatccattgccgttgggccatgct 379

---

>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score =  115 bits (58), Expect = 1e-22
 Identities = 97/110 (88%)
 Strand = Plus / Plus

                                                                        
Query: 280  ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 339
            ||||||||||| || || || |||||||||||||| ||||||||||||||||| ||||| 
Sbjct: 945  ggtgagttcccaggtgattacgggtgggacactgctggactttcagctgacccagagaca 1004

                                                              
Query: 340  tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
            || || | |||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1005 ttcgctaggaaccgtgagcttgaggtgatccattgccgttgggccatgct 1054

---

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score =  115 bits (58), Expect = 1e-22
 Identities = 151/182 (82%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||| ||| | ||||||||    ||| | |||||| |||| |||||| | || 
Sbjct: 200 agcccatggtatggtcctgaccgtgtcaagtacttgggcccattctctggtgagtctcca 259

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||| | || |||||||| ||||| || || |||||||||||||| ||||||||||||
Sbjct: 260 agctacttgactggtgagtttcctggtgattacgggtgggacactgctggactttcagct 319

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           || || || || || ||||||||||| ||| ||||||||||||| ||| |||||||||||
Sbjct: 320 gatccagaaacattcgccaagaaccgtgagttggaggtgatccactgcagatgggccatg 379

             
Query: 388 ct 389
           ||
Sbjct: 380 ct 381

---

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score =  115 bits (58), Expect = 1e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           |||||||||||||| ||||||||  ||||||| ||    ||||| |||||  ||||||| 
Sbjct: 527 tcctccggcagcccctggtacgggcccgaccgcgtcaagtacctaggcccgttctccggc 586

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||| | |||  |||||| ||||| |||||| | |||||||| || |||||||| ||||| 
Sbjct: 587 gaggcgccgtcctacctgaccggcgagttcgccggcgactacggctgggacaccgccggg 646

                                                                       
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 378
           || || || ||||| |||||||| |||||||||||||||||||||||||||||    || 
Sbjct: 647 ctctcggccgaccccgagaccttcgccaagaaccgggagctggaggtgatccacgcgcgg 706

                         
Query: 379 tgggccatgctcgg 392
           ||||||||||||||
Sbjct: 707 tgggccatgctcgg 720

---

>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll
           a/b-binding protein, complete cds
          Length = 3659

 Score =  115 bits (58), Expect = 1e-22
 Identities = 124/146 (84%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| ||||||||||| | || |||||| | ||| |||| |||||||| || ||||||
Sbjct: 311 ggcccattctccggtgagtctccaagctacttgaccagtgaattccctggtgattatggg 370

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| ||||| ||||||||||| || || || ||||||||||||||||| || || |||
Sbjct: 371 tgggatactgctggactttcagcagatccagaaacctttgccaagaaccgtgaactcgag 430

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 431 gtgatccactgcagatgggctatgct 456

---

>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score =  115 bits (58), Expect = 1e-22
 Identities = 160/194 (82%)
 Strand = Plus / Plus

                                                                       
Query: 196 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 255
           |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 171 gtttcctctggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctct 230

                                                                       
Query: 256 ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
           |||||||||||    ||||| || ||||| |||||||| |||||||| ||||||||||| 
Sbjct: 231 ggtgagcccccatcttaccttactggtgaattccctggtgactatggctgggacactgct 290

                                                                       
Query: 316 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 375
           || || ||||||||||| || |||||||| |||||||| ||||| || |||||||| | |
Sbjct: 291 gggctatcagctgacccagaaacctttgctaagaaccgtgagcttgaagtgatccactcc 350

                         
Query: 376 cgatgggccatgct 389
            |||||||||||||
Sbjct: 351 agatgggccatgct 364

---

>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 748

 Score =  113 bits (57), Expect = 4e-22
 Identities = 123/145 (84%)
 Strand = Plus / Plus

                                                                       
Query: 245 gcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggt 304
           ||||| |||| |||||||| ||   |||||| ||||| ||||||||||| ||||| || |
Sbjct: 1   gcccattctctggtgagccaccatcctaccttaccggagagttccctggtgactacggtt 60

                                                                       
Query: 305 gggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggagg 364
           |||||||||| |||||||||||||| || |||||||| ||||||||||| ||| |||| |
Sbjct: 61  gggacactgctggactttcagctgatcccgagaccttcgccaagaaccgagagttggaag 120

                                    
Query: 365 tgatccattgccgatgggccatgct 389
           ||||||| | |  ||||||||||||
Sbjct: 121 tgatccactccacatgggccatgct 145

---

>gb|AF295639.1| Beta vulgaris chlorophyll a/b binding protein (cab) gene, partial
           cds, nuclear gene for chloroplast product
          Length = 507

 Score =  111 bits (56), Expect = 2e-21
 Identities = 77/84 (91%)
 Strand = Plus / Plus

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||||||||| ||||| ||||||||||| || ||||||||||||||||| ||||| |||
Sbjct: 12  tgggacactgctggactctcagctgacccagaaacctttgccaagaaccgtgagcttgag 71

                                   
Query: 364 gtgatccattgccgatgggccatg 387
           |||||||||||| |||||||||||
Sbjct: 72  gtgatccattgcagatgggccatg 95

---

>emb|BX814757.1|CNS0AEAM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB92ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 409

 Score =  111 bits (56), Expect = 2e-21
 Identities = 155/188 (82%)
 Strand = Plus / Minus

                                                                       
Query: 205 ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccc 264
           |||||||||||||||||  | ||||| |||   ||| | || ||| ||||||| ||||||
Sbjct: 285 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 226

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| |||||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 225 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 166

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           || ||||| |||||||| |||| |||||| ||||| || || |||||  || ||||||||
Sbjct: 165 gccgacccagagaccttcgccaggaaccgtgagctagaagttatccacagcagatgggcc 106

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 105 atgctcgg 98

---

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score =  111 bits (56), Expect = 2e-21
 Identities = 152/184 (82%)
 Strand = Plus / Plus

                                                                       
Query: 206 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
           ||||||||||||| ||| | ||||||||    ||| | || ||| |||| |||||| | |
Sbjct: 373 gcagcccatggtatggtcctgaccgtgtcaagtacttgggaccattctctggtgaggcac 432

                                                                       
Query: 266 cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
           | |||||| | || |||||||||||| | |||||||| ||||| ||||| |||||||| |
Sbjct: 433 caagctacttgactggtgagttccctagtgactatggatgggatactgctggactttcgg 492

                                                                       
Query: 326 ctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcca 385
           |||| ||||| || |||||||||||||| ||||||||||| ||||| ||  |||||||||
Sbjct: 493 ctgatcctgaaacttttgccaagaaccgtgagctggaggtcatccactgtagatgggcca 552

               
Query: 386 tgct 389
           ||||
Sbjct: 553 tgct 556

---

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score =  111 bits (56), Expect = 2e-21
 Identities = 122/144 (84%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||||||||   ||||||||| ||||| ||||| || |||||||| 
Sbjct: 502 ggcccattctctggtgagcccccatcctacctcactggtgaattcccaggtgactatggt 561

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||||||||| || ||||| |||||||| |||||||||||||| ||||| || ||||| 
Sbjct: 562 tgggacactgctgggctttctgctgacccagagacctttgccaaaaaccgtgaactggaa 621

                                   
Query: 364 gtgatccattgccgatgggccatg 387
           || ||||| | | |||||||||||
Sbjct: 622 gtcatccactccagatgggccatg 645

---

>gb|AF003129.1|AF003129 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB3) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1011

 Score =  111 bits (56), Expect = 2e-21
 Identities = 137/164 (83%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||||||  | ||||||||    ||||| |||||| ||||||||||| | || 
Sbjct: 201 agcccatggtacggcccagaccgtgtcaagtacctaggcccattctccggtgaggcacca 260

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
              |||||||| ||||| |||||||| |||||||| ||||||||||| || || ||||||
Sbjct: 261 tcttacctcactggtgaattccctggtgactatggttgggacactgctgggctctcagct 320

                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           ||||| ||||| ||||| |||||||| ||||| |||||||||||
Sbjct: 321 gaccccgagacttttgctaagaaccgtgagcttgaggtgatcca 364

---

>gb|M21396.1|SOYCBPA Soybean light-harvesting chlorophyll a/b-binding protein (LHCPII)
           mRNA, 3' end
          Length = 911

 Score =  111 bits (56), Expect = 2e-21
 Identities = 149/180 (82%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||||||  | ||||||||    ||| | |||||| |||| ||||||||||| 
Sbjct: 81  agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccccca 140

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             ||||||||| ||||| ||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 141 tcctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 200

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| |||||||||||||||||||| || || || || ||||| | | |||||||||||
Sbjct: 201 gacccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatg 260

---

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 375 gccatgctcgg 385

---

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 313 gccatgctcgg 323

---

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 375 gccatgctcgg 385

---

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 375 gccatgctcgg 385

---

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                         
Query: 202   tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
             ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 95437 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 95496

                                                                         
Query: 262   cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
             || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 95497 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 95556

                                                                         
Query: 322   tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
             || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 95557 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 95616

                        
Query: 382   gccatgctcgg 392
             |||||||||||
Sbjct: 95617 gccatgctcgg 95627



 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Minus

                                                                         
Query: 251   tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
             ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 93822 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 93763

                                                                         
Query: 311   ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
             | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 93762 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 93703

                                   
Query: 371   attgccgatgggccatgctcgg 392
             |  || ||||||||||||||||
Sbjct: 93702 acagcagatgggccatgctcgg 93681

---

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Minus

                                                                         
Query: 202   tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
             ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 78765 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 78706

                                                                         
Query: 262   cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
             || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 78705 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 78646

                                                                         
Query: 322   tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
             || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 78645 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 78586

                        
Query: 382   gccatgctcgg 392
             |||||||||||
Sbjct: 78585 gccatgctcgg 78575



 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                         
Query: 251   tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
             ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 80380 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 80439

                                                                         
Query: 311   ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
             | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 80440 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 80499

                                   
Query: 371   attgccgatgggccatgctcgg 392
             |  || ||||||||||||||||
Sbjct: 80500 acagcagatgggccatgctcgg 80521

---

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 375 gccatgctcgg 385

---

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 195 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 254

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 255 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 314

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 315 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 374

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 375 gccatgctcgg 385

---

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
           binding protein
          Length = 1301

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 433 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 492

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 493 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 552

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 553 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 612

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 613 gccatgctcgg 623

---

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           ||||| |||||||||||||| ||| | ||||||||    ||| | || ||| |||| |||
Sbjct: 203 tcctctggcagcccatggtatggtcctgaccgtgtcaagtacttggggccattctctggt 262

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||| | || || ||| | || ||||| |||||||| |||||||| ||||||||||| |||
Sbjct: 263 gagtctccaagttacttgacgggtgaattccctggtgactatggatgggacactgctgga 322

                                                                       
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 378
           ||||||||||| || || || ||||||||||| || ||| ||||||||||||| ||| ||
Sbjct: 323 ctttcagctgatccagaaacttttgccaagaatcgtgagttggaggtgatccactgcaga 382

                      
Query: 379 tgggccatgct 389
           ||||| |||||
Sbjct: 383 tgggctatgct 393

---

>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score =  109 bits (55), Expect = 7e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 283 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 342
           ||||||||||| |||||||| ||||| ||||| ||||| ||||| |||||||| || |||
Sbjct: 562 gagttccctggtgactatggatgggatactgctggactctcagccgaccctgaaacattt 621

                                                          
Query: 343 gccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           |||| |||||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 622 gccaggaaccgtgagcttgaggtgatccattgccgttgggcaatgct 668

---

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score =  109 bits (55), Expect = 7e-21
 Identities = 157/191 (82%)
 Strand = Plus / Plus

                                                                       
Query: 202 tccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
           ||||||||||||||||||||  ||||||| ||    ||| | || ||| |||||||||||
Sbjct: 133 tccggcagcccatggtacggatccgaccgagtcaagtacttgggtccattctccggtgag 192

                                                                       
Query: 262 cccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactt 321
           || |||||||||||||| || |||||||| || || || ||||||||||||||||| || 
Sbjct: 193 cctccgagctacctcactggagagttccccggtgattacgggtgggacactgccggtcta 252

                                                                       
Query: 322 tcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgg 381
           || || || || |||||||| || | |||||| ||||| || || |||||  || |||||
Sbjct: 253 tccgccgatcccgagaccttcgctaggaaccgtgagctagaagttatccacagcagatgg 312

                      
Query: 382 gccatgctcgg 392
           |||||||||||
Sbjct: 313 gccatgctcgg 323

---

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Minus

                                                                        
Query: 251  tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
            ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 3065 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3006

                                                                        
Query: 311  ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
            | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 3005 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 2946

                                  
Query: 371  attgccgatgggccatgctcgg 392
            |  || ||||||||||||||||
Sbjct: 2945 acagcagatgggccatgctcgg 2924

---

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Minus

                                                                        
Query: 251  tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
            ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 3104 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 3045

                                                                        
Query: 311  ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
            | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 3044 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 2985

                                  
Query: 371  attgccgatgggccatgctcgg 392
            |  || ||||||||||||||||
Sbjct: 2984 acagcagatgggccatgctcgg 2963

---

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 354 acagcagatgggccatgctcgg 375

---

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 354 acagcagatgggccatgctcgg 375

---

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||| ||||||||||| ||||| |||||||| || |||||||| |||||||
Sbjct: 13  tctccggcgagccaccgagctaccttaccggagagttccccggtgactatggatgggaca 72

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | ||||| || || ||||| || |||||||| |||| |||||| ||||| || || ||||
Sbjct: 73  ccgccggtctatccgctgatccagagaccttcgccaggaaccgtgagctagaagttatcc 132

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 133 acagcagatgggccatgctcgg 154

---

>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence
          Length = 958

 Score =  107 bits (54), Expect = 3e-20
 Identities = 123/146 (84%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | |||||||| || ||||| || || |||
Sbjct: 219 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 278

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||| || |||||||||||||| || || |||
Sbjct: 279 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgag 338

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 339 gtgatccactgcagatgggctatgct 364

---

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcgg 320

---

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 234 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 293

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 294 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 353

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 354 acagcagatgggccatgctcgg 375

---

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcgg 320

---

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcgg 320

---

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 179 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 238

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 239 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 298

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 299 acagcagatgggccatgctcgg 320

---

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcgg 371

---

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcgg 371

---

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcgg 371

---

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcgg 371

---

>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene,
           complete cds; nuclear gene for chloroplast product
          Length = 1322

 Score =  107 bits (54), Expect = 3e-20
 Identities = 110/129 (85%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| ||||| || ||||| || ||||| || ||||||||||| ||||| |||||||||
Sbjct: 517 tacctgaccggagaattccccggtgactacggatgggacactgctggactatcagctgac 576

                                                                       
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 390
           || || ||||| |||| ||||||||||||||||||||| ||  || ||||||||||||| 
Sbjct: 577 ccggaaaccttcgccaggaaccgggagctggaggtgattcacagcagatgggccatgctt 636

                    
Query: 391 ggngcactt 399
           || ||||||
Sbjct: 637 ggtgcactt 645

---

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcgg 371

---

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 230 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 289

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 290 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 349

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 350 acagcagatgggccatgctcgg 371

---

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 211 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 270

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 271 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 330

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 331 acagcagatgggccatgctcgg 352

---

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 214 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 273

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 274 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 333

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 334 acagcagatgggccatgctcgg 355

---

>emb|AJ234427.1|HVU234427 Hordeum vulgare partial mRNA; clone cMWG0701.uni
          Length = 312

 Score =  107 bits (54), Expect = 3e-20
 Identities = 81/90 (90%)
 Strand = Plus / Plus

                                                                       
Query: 200 cctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtg 259
           ||||| ||||||| ||||||||  ||||||| ||||||||||||||||| |||||||| |
Sbjct: 172 cctccagcagcccgtggtacggccccgaccgcgtgctctacctcggcccgctctccggcg 231

                                         
Query: 260 agcccccgagctacctcaccggtgagttcc 289
           |||||||||||||||||| ||| |||||||
Sbjct: 232 agcccccgagctacctcagcggcgagttcc 261

---

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
           protein
          Length = 1405

 Score =  107 bits (54), Expect = 3e-20
 Identities = 120/142 (84%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 479 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 538

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 539 ccgctggtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 598

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 599 acagcagatgggccatgctcgg 620

---

>gb|M17559.1|TOMCAB5A Tomato Cab-5 gene encoding chlorophyll a/b-binding protein, 3' end
          Length = 810

 Score =  107 bits (54), Expect = 3e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                       
Query: 280 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 339
           |||||||| || || |||||||| ||||||||||||||||| ||||||||||||||||| 
Sbjct: 129 ggtgagtttccaggtgactatggatgggacactgccggactctcagctgaccctgagaca 188

                                                             
Query: 340 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           ||||| | |||||| ||||| |||||||| ||||| || ||||| |||||
Sbjct: 189 tttgcaaggaaccgtgagcttgaggtgatacattgtcgttgggctatgct 238

---

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score =  107 bits (54), Expect = 3e-20
 Identities = 96/110 (87%)
 Strand = Plus / Plus

                                                                        
Query: 283  gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 342
            |||||||| |||||||| ||||||||||| ||||| || || || ||||| |||||||| 
Sbjct: 950  gagttccccggcgactacgggtgggacacggccggcctctccgccgacccggagaccttc 1009

                                                              
Query: 343  gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcgg 392
            ||||||||||| ||||||||||| |||||  |||| ||||||||||||||
Sbjct: 1010 gccaagaaccgcgagctggaggtcatccacagccggtgggccatgctcgg 1059

---

>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein
          Length = 1746

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||||| |||||||| ||||| |||||||| ||||| ||| | |||||||||
Sbjct: 745 tacctgaccggtgaattccctggggactacgggtgggatactgctggattatcagctgac 804

                                                    
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatcca 371
           || ||||| |||||||||||||| ||||| |||||||||||
Sbjct: 805 ccagagacatttgccaagaaccgtgagcttgaggtgatcca 845

---

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score =  105 bits (53), Expect = 1e-19
 Identities = 125/149 (83%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| || |||||||||  |||||| |||||||||||||| |||||||| || 
Sbjct: 419 ggcccattctctggcgagcccccgtcctacctaaccggtgagttcccaggcgactacggc 478

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||||||||| || ||||| || ||||| || ||||| ||||||||||| || || || 
Sbjct: 479 tgggacactgctgggctttccgcagacccagaaaccttcgccaagaaccgtgaactcgaa 538

                                        
Query: 364 gtgatccattgccgatgggccatgctcgg 392
           |||||||| | | | ||||||||||||||
Sbjct: 539 gtgatccactccaggtgggccatgctcgg 567

---

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score =  103 bits (52), Expect = 4e-19
 Identities = 142/172 (82%)
 Strand = Plus / Plus

                                                                       
Query: 200 cctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtg 259
           ||||||||||||| ||||||||  ||||| | ||    |||||||||||  ||||||| |
Sbjct: 42  cctccggcagcccctggtacggccccgacagagtcaagtacctcggccccttctccggcg 101

                                                                       
Query: 260 agcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggac 319
           || ||||    ||||||||||| |||||| | |||||||| || |||||||| ||||| |
Sbjct: 102 aggccccctcatacctcaccggcgagttcgccggcgactacggctgggacaccgccgggc 161

                                                               
Query: 320 tttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           | || || ||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 162 tctccgccgaccccgagaccttcgccaagaaccgcgagctggaggtgatcca 213

---

>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding
            protein (lhcb1*7) gene, complete cds
          Length = 1882

 Score =  103 bits (52), Expect = 4e-19
 Identities = 157/192 (81%)
 Strand = Plus / Plus

                                                                        
Query: 196  gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 255
            |||||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| 
Sbjct: 881  gtttcctcaggaagcccatggtacggcccagaccgtgtcaagtacttgggcccattctca 940

                                                                        
Query: 256  ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
            |||||||||||   ||| ||||| ||||| ||||| || |||||||| ||||||||||| 
Sbjct: 941  ggtgagcccccctcctatctcactggtgaattcccaggtgactatggttgggacactgct 1000

                                                                        
Query: 316  ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgc 375
            || ||||| |||||||| ||||| |||||||| ||||| || ||||| || ||||| | |
Sbjct: 1001 gggctttctgctgacccagagacttttgccaaaaaccgtgaactggaagtcatccactcc 1060

                        
Query: 376  cgatgggccatg 387
             |||||||||||
Sbjct: 1061 agatgggccatg 1072

---

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score =  103 bits (52), Expect = 4e-19
 Identities = 148/180 (82%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||||||| | ||||| ||  | ||| | || ||||| ||||||||||| || 
Sbjct: 333 agcccatggtacggtcctgaccgagttttgtacttgggtccactttccggtgagccacca 392

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
              ||| | ||||||||||||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 393 tcttacttgaccggtgagttccctggtgactatggttgggacactgctggactctcagct 452

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           || || ||||||||||| | |||||| ||||| || || || || ||| |||||||||||
Sbjct: 453 gatcccgagacctttgctaggaaccgtgagctcgaagtcattcactgcagatgggccatg 512

---

>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA,
           partial cds
          Length = 446

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 295 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 354
           |||||||| ||||||||||| ||| | || || ||||||||||| ||||| |||||||| 
Sbjct: 312 gactatggctgggacactgctggattatccgcagaccctgagacatttgctaagaaccgt 371

                                              
Query: 355 gagctggaggtgatccattgccgatgggccatgct 389
           |||||||||||||||||  ||||||||||||||||
Sbjct: 372 gagctggaggtgatccacagccgatgggccatgct 406

---

>gb|AF279248.1|AF279248 Vigna radiata LHCII type II chlorophyll a/b-binding protein
           (CipLhcb2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1033

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||||| |||||||| ||||| || |||||||| || ||| | |||||||||
Sbjct: 258 tacctgaccggtgaattccctggtgactacggatgggacacagctggattatcagctgac 317

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           ||||| |||||||||| |||||| ||| |||||||||| ||  || |||||||||||||
Sbjct: 318 cctgaaacctttgccaggaaccgtgagttggaggtgattcacagcagatgggccatgct 376

---

>emb|Z13987.1|STCABPSII S.tuberosum gene for chlorophyll a/b-binding protein PS II type I
          Length = 2432

 Score =  101 bits (51), Expect = 2e-18
 Identities = 120/143 (83%)
 Strand = Plus / Plus

                                                                        
Query: 244  ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
            |||||| |||| |||||  |||| |||||| | || ||||||   ||||| ||||| || 
Sbjct: 1081 ggcccattctctggtgaagccccaagctacttgactggtgagaaacctggtgactacgga 1140

                                                                        
Query: 304  tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
            ||||||||||| |||||||||||||| || || || |||||||||||||| ||| |||||
Sbjct: 1141 tgggacactgctggactttcagctgatccagaaacttttgccaagaaccgtgagttggag 1200

                                   
Query: 364  gtgatccattgccgatgggccat 386
            |||||||||||  ||||||||||
Sbjct: 1201 gtgatccattgtagatgggccat 1223

---

>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| || |||||||| || || |||||||| ||||||||||| || ||||| ||||||
Sbjct: 241 taccttactggtgagtttccaggtgactatggctgggacactgctgggctttcggctgac 300

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           |||||||| |||||||||||||| || || || |||||||| | | |||||||||||||
Sbjct: 301 cctgagacttttgccaagaaccgtgaacttgaagtgatccactccagatgggccatgct 359

---

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score =  101 bits (51), Expect = 2e-18
 Identities = 156/191 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           ||||| || ||||||||||| ||| | ||||||||    ||| | || ||| |||| || 
Sbjct: 338 tcctctggtagcccatggtatggtcctgaccgtgttaagtacttgggtccattctctggg 397

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||| |||| |||||| | ||||||||||| ||||| || || || ||||||||||| |||
Sbjct: 398 gagtccccaagctacttgaccggtgagtttcctggtgattacggatgggacactgctgga 457

                                                                       
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 378
           ||||||||||||||||| || || || |||||||| ||| ||||||| || |||||  ||
Sbjct: 458 ctttcagctgaccctgaaacattcgctaagaaccgtgagttggaggttattcattgtaga 517

                      
Query: 379 tgggccatgct 389
           |||||||||||
Sbjct: 518 tgggccatgct 528

---

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 119/142 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 221 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 280

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| || ||||| |||| |||||| ||||| || || ||||
Sbjct: 281 ccgctggtctatccgccgacccagaaaccttcgccaggaaccgtgagctagaagttatcc 340

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 341 acagcagatgggccatgctcgg 362

---

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 705 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 646

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || || ||||| |||||||| |||| | |||| ||||| || || ||||
Sbjct: 645 ccgctggtctatccgccgacccagagaccttcgccagggaccgtgagctagaagttatcc 586

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || ||||||||||||||||
Sbjct: 585 acagcagatgggccatgctcgg 564

---

>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13
          Length = 1019

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 122/146 (83%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | || |||||||||||||| |||||||| 
Sbjct: 299 ggcccattctctggtgaggccccaagctacttgactggtgagttccctggtgactatgga 358

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| ||||| ||||||||||| ||||| |  || || |||||||||||| | ||||||
Sbjct: 359 tgggatactgctggactttcagccgacccagcaactttcgccaagaaccggaaactggag 418

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           || ||||| ||  ||||| |||||||
Sbjct: 419 gtaatccactgtagatggaccatgct 444

---

>emb|X58229.1|NTCAB7 Tobacco CAB7 gene for chlorophyll a/b binding protein
          Length = 1656

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 280 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 339
           |||||||||||||| || ||||||||||||||||| |||||||||||||| || || || 
Sbjct: 718 ggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaaact 777

                                                             
Query: 340 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           ||||| |||||||| ||||| |||||||| || ||  ||||||| |||||
Sbjct: 778 tttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgct 827

---

>emb|X16536.1|GMCAB5 G.max DNA for Cab5
          Length = 1467

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 148/180 (82%), Gaps = 3/180 (1%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||||||  | ||||||||    ||| | |||||| |||| |||||||||   
Sbjct: 466 agcccatggtacggcccagaccgtgtcaagtacttgggcccattctctggtgagccc--- 522

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           | ||||||||| ||||| ||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 523 atctacctcactggtgaattcccaggtgactatggttgggacactgctgggctttctgct 582

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| |||||||||||||||||||| || || || || ||||| | | |||||||||||
Sbjct: 583 gacccagagacctttgccaagaaccgtgaacttgaagtcatccactccagatgggccatg 642

---

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 98/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||| |||||||| || || || ||||| || ||||||||||| || ||||| |||||
Sbjct: 219 ctaccttaccggtgaatttcccggtgactacggctgggacactgctgggctttcggctga 278

                                                                 
Query: 330 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggc 383
           ||||||||| ||| | |||||||| ||||| |||||||| ||||||||||||||
Sbjct: 279 ccctgagacttttactaagaaccgtgagctcgaggtgattcattgccgatgggc 332

---

>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein
          Length = 980

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 128/154 (83%)
 Strand = Plus / Plus

                                                                       
Query: 206 gcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccc 265
           ||||||||||||||||  | ||||||||    ||| | |||||| |||||||||||  ||
Sbjct: 192 gcagcccatggtacggcccagaccgtgttaagtacttgggcccattctccggtgagagcc 251

                                                                       
Query: 266 cgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcag 325
           |    ||||||||||||||||||||||| ||||| || ||||||||||| || |||||||
Sbjct: 252 catcatacctcaccggtgagttccctggtgactacggttgggacactgctgggctttcag 311

                                             
Query: 326 ctgaccctgagacctttgccaagaaccgggagct 359
           ||||||| || ||||| || |||||||| |||||
Sbjct: 312 ctgacccagaaaccttcgctaagaaccgtgagct 345

---

>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds
          Length = 1253

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 122/146 (83%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||| |||||| |||| |||||| | |||||||| || ||||| || || |||
Sbjct: 365 ggcccattctctggtgagtccccaagctacttgaccggtgaatttcctggtgattacggg 424

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||| || || ||||||||||| |||||||| || |||||||||||||| || || || 
Sbjct: 425 tgggataccgctggactttcagcagaccctgaaacttttgccaagaaccgtgaacttgaa 484

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           |||||||| ||| ||||||| |||||
Sbjct: 485 gtgatccactgcagatgggctatgct 510

---

>dbj|AB012640.1| Nicotiana sylvestris Lhcb1*8 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3102

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                        
Query: 280  ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 339
            |||||||||||||| || ||||||||||||||||| |||||||||||||| || || || 
Sbjct: 2121 ggtgagttccctggtgattatgggtgggacactgctggactttcagctgatccagaaact 2180

                                                              
Query: 340  tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
            ||||| |||||||| ||||| |||||||| || ||  ||||||| |||||
Sbjct: 2181 tttgctaagaaccgtgagctagaggtgattcactgtagatgggctatgct 2230

---

>emb|AJ303352.1|HVU303352 Hordeum vulgare cv. Igri partial cab11 gene for chlorophyll
           a/b-binding protein
          Length = 741

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 64/69 (92%)
 Strand = Plus / Plus

                                                                       
Query: 2   aaatcatctccacactcactcatctccttgagaacccatacaatagacccttcccttagc 61
           |||||||||||||||||||||||||||||||||||||||| |  |||| |||| ||||||
Sbjct: 673 aaatcatctccacactcactcatctccttgagaacccatatagcagacacttcgcttagc 732

                    
Query: 62  tttccaatg 70
           |||||||||
Sbjct: 733 tttccaatg 741

---

>dbj|AB050125.1| Amaranthus tricolor cab1b mRNA for type I chlorophyll a/b-binding
           protein b, partial cds
          Length = 461

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 82/93 (88%)
 Strand = Plus / Plus

                                                                       
Query: 295 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 354
           ||||| |||||||||||||| || |||||||||||||| || |||||||| |||||||| 
Sbjct: 1   gactacgggtgggacactgctgggctttcagctgacccggaaacctttgctaagaaccgt 60

                                            
Query: 355 gagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || |||||||||||||||
Sbjct: 61  gagcttgaggtcattcactgccgatgggccatg 93

---

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 153/188 (81%)
 Strand = Plus / Plus

                                                                       
Query: 205 ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagccc 264
           |||||||||||||||||  | ||||| |||   ||| | || ||| ||||||| ||||||
Sbjct: 168 ggcagcccatggtacggatctgaccgagtgaagtacttgggtccattctccggcgagccc 227

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| |||||||||||||| || ||||| || |||||||| || || || || 
Sbjct: 228 ccgagctaccttaccggtgagttccccggtgactacggatgggacaccgctggtctatcc 287

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           || ||||| || ||||| |||| |||||| ||||  || || |||||  || ||||||||
Sbjct: 288 gccgacccagaaaccttcgccaggaaccgtgagcgagaagttatccacagcagatgggcc 347

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 348 atgctcgg 355

---

>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 280 ggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacc 339
           ||||| |||||||| ||||| || ||||||||||| ||||| || || ||||||||||| 
Sbjct: 211 ggtgaattccctggtgactacggatgggacactgctggactatccgcagaccctgagaca 270

                                                                      
Query: 340 tttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctcggngcact 398
           ||||| || ||| | ||||| |||||||||||  |||||||||||||||| || |||||
Sbjct: 271 tttgcgaaaaacggtgagcttgaggtgatccacagccgatgggccatgcttggtgcact 329

---

>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA
          Length = 1152

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 286 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 345
           |||||||| |||||||| ||||||||||| ||||||||||| ||||| || |||||||||
Sbjct: 383 ttccctggtgactatggttgggacactgctggactttcagcagacccagaaacctttgcc 442

                                                       
Query: 346 aagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           |  ||||| ||||| |||||||||||  || | |||||||||||
Sbjct: 443 agaaaccgtgagcttgaggtgatccacagcaggtgggccatgct 486

---

>gb|L36064.1|PRULHP Prunus persica (clone pAB19) light harvesting chlorophyll a/b
           binding protein (Lhcb-Pp1) gene, complete cds
          Length = 1912

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           |||||||| || || |||||||| || || || ||||||||||| || || |||||||||
Sbjct: 543 tacctcactggagaattccctggtgattacggttgggacactgctgggctctcagctgac 602

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || |||||||||||||||||||| ||||| || || |||||||   |||||||||||||
Sbjct: 603 ccagagacctttgccaagaaccgtgagcttgaagttatccattcaagatgggccatgct 661

---

>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||||| ||||| || ||||| || |||||||| ||||||||||| ||||| 
Sbjct: 249 tacctgaccggtgaattcccaggtgactacggctgggacaccgccggactttctgctgat 308

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| ||| |||||||||| ||||| ||||| ||||| ||| ||||||| |||||
Sbjct: 309 ccagagacattttccaagaaccgtgagcttgaggtcatccactgcagatgggcaatgct 367

---

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 118/142 (83%)
 Strand = Plus / Plus

                                                                        
Query: 251  tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
            ||||||| |||||||| |||||||| || || |||||||| || |||||||| |||||||
Sbjct: 1757 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1816

                                                                        
Query: 311  ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
            | || || || ||||||||||| ||||| || || |  ||||| ||||| || || ||||
Sbjct: 1817 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1876

                                  
Query: 371  attgccgatgggccatgctcgg 392
            | ||| ||||||||||||||||
Sbjct: 1877 actgcagatgggccatgctcgg 1898

---

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 118/142 (83%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||||||||||||||| |||||||||||||| || ||||| || |||||||
Sbjct: 209 tctccggcgagcccccgagctaccttaccggtgagttccccggtgactacggatgggaca 268

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | ||  | || || || ||||| |||||||| |||| |||||| ||||| || || ||||
Sbjct: 269 ccgcttgtctatccgccgacccagagaccttcgccaggaaccgtgagctagaagttatcc 328

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || || |||||||||||||
Sbjct: 329 acagcagaagggccatgctcgg 350

---

>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 97/114 (85%)
 Strand = Plus / Plus

                                                                       
Query: 274 ctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccct 333
           |||||||| || || || |||||||| ||||||||||| ||||| || || || ||||||
Sbjct: 282 ctcaccggcgaatttcccggcgactacgggtgggacaccgccgggctctctgccgaccct 341

                                                                 
Query: 334 gagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           |||||||| ||||| ||| | |||||||||||||||||  || |||||||||||
Sbjct: 342 gagaccttcgccaaaaacagagagctggaggtgatccacagcagatgggccatg 395

---

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 118/142 (83%)
 Strand = Plus / Plus

                                                                        
Query: 251  tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
            ||||||| |||||||| |||||||| || || |||||||| || |||||||| |||||||
Sbjct: 1758 tctccggcgagcccccaagctaccttactggagagttccccggagactatggatgggaca 1817

                                                                        
Query: 311  ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
            | || || || ||||||||||| ||||| || || |  ||||| ||||| || || ||||
Sbjct: 1818 ccgctggtctatcagctgaccccgagactttcgctagaaaccgtgagctagaagttatcc 1877

                                  
Query: 371  attgccgatgggccatgctcgg 392
            | ||| ||||||||||||||||
Sbjct: 1878 actgcagatgggccatgctcgg 1899

---

>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 941

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| ||||||||||| ||||    |||||||| ||||| ||||| || |||||||| 
Sbjct: 227 ggcccattctccggtgaggccccatcttacctcactggtgaattcccaggtgactatggt 286

                                                    
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgc 344
           |||||||||||||| ||||| |||||||||||||| |||||
Sbjct: 287 tgggacactgccgggctttctgctgaccctgagacttttgc 327

---

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 78/89 (87%)
 Strand = Plus / Plus

                                                                       
Query: 283 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 342
           ||||||||||| ||||| || ||||||||||| ||||| ||||| |||||||| ||||| 
Sbjct: 289 gagttccctggtgactacggttgggacactgctggactatcagcagaccctgaaaccttc 348

                                        
Query: 343 gccaagaaccgggagctggaggtgatcca 371
           || |||||||| ||||| |||||||||||
Sbjct: 349 gctaagaaccgtgagctcgaggtgatcca 377

---

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 385 atgctcgg 392

---

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 258

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 259 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 318

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 319 atgctcgg 326

---

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 385 atgctcgg 392

---

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 385 atgctcgg 392

---

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 385 atgctcgg 392

---

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 265 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 324

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 325 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 384

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 385 atgctcgg 392

---

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 234 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 293

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 294 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 353

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 354 atgctcgg 361

---

>emb|BX817619.1|CNS0AAVV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL33ZA06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 994

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 249 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 308

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 309 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 368

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 369 atgctcgg 376

---

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 145 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 204

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 205 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 264

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 265 atgctcgg 272

---

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                         
Query: 265   ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
             ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 16716 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 16657

                                                                         
Query: 325   gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
             |||||||| ||||| || || | |||||| || || || || |||||  || | ||||||
Sbjct: 16656 gctgaccccgagacattcgcaaggaaccgtgaactagaagttatccacagcaggtgggcc 16597

                     
Query: 385   atgctcgg 392
             ||||||||
Sbjct: 16596 atgctcgg 16589



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                         
Query: 265   ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
             ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 21937 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 21996

                                                                         
Query: 325   gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
             ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 21997 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 22056

                     
Query: 385   atgctcgg 392
             ||||||||
Sbjct: 22057 atgctcgg 22064



 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                         
Query: 268   agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
             |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 19294 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 19353

                                                                         
Query: 328   gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
             ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 19354 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 19413

                  
Query: 388   ctcgg 392
             |||||
Sbjct: 19414 ctcgg 19418

---

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 143/176 (81%)
 Strand = Plus / Plus

                                                                       
Query: 196 gtttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctcc 255
           |||||||| || ||||||||||||||  | |||||||||   ||||| |||||| |||| 
Sbjct: 180 gtttcctctggaagcccatggtacggcccagaccgtgtgaagtacctgggcccattctcg 239

                                                                       
Query: 256 ggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgcc 315
           |||||| | ||    ||||| || || || ||||| || |||||||||||||||||||||
Sbjct: 240 ggtgaggctccttcttacctgacgggggaattcccaggtgactatgggtgggacactgcc 299

                                                                   
Query: 316 ggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           || ||||| |||||||| ||||| |||||   |||||| || ||||| ||||||||
Sbjct: 300 gggctttcggctgacccggagacatttgctcggaaccgtgaactggaagtgatcca 355

---

>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein
          Length = 983

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 134/164 (81%)
 Strand = Plus / Plus

                                                                       
Query: 208 agcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccg 267
           ||||||||||||||| | |||||||||   ||| | || ||| |||| ||||||||||||
Sbjct: 156 agcccatggtacggtccagaccgtgtgaagtacttagggccattctctggtgagcccccg 215

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
              ||| | || || |||||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 216 tcgtacttgactggagagttcccaggtgactatggttgggacactgctgggctttctgct 275

                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           ||||| ||||| ||||| || ||||| || |||||||| |||||
Sbjct: 276 gacccagagacatttgcgaaaaaccgtgaactggaggtaatcca 319

---

>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a,
             complete sequence
          Length = 48924

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 100/119 (84%)
 Strand = Plus / Plus

                                                                         
Query: 271   tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
             ||||| || ||||| |||||||| ||||| || |||||||| || ||| | |||||||||
Sbjct: 40107 tacctgactggtgaattccctggtgactacggatgggacacagctggattatcagctgac 40166

                                                                        
Query: 331   cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
             || || ||||| ||||||||||| ||||| |||||||| ||  || |||||||||||||
Sbjct: 40167 cccgaaaccttcgccaagaaccgtgagctcgaggtgattcacagcagatgggccatgct 40225

---

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 117/142 (82%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           ||||||| ||||| |||||||||||||| || |||||||| || ||||| || |||||||
Sbjct: 13  tctccggcgagccaccgagctacctcacaggagagttccccggagactacggatgggaca 72

                                                                       
Query: 311 ctgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatcc 370
           | || || || || |||||||| ||||| ||||| | |||||| ||||| || || ||||
Sbjct: 73  cagctggcctatccgctgaccccgagacatttgcaaggaaccgtgagctagaagttatcc 132

                                 
Query: 371 attgccgatgggccatgctcgg 392
           |  || | ||||||||||||||
Sbjct: 133 acagcaggtgggccatgctcgg 154

---

>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 96/114 (84%)
 Strand = Plus / Plus

                                                                        
Query: 274  ctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccct 333
            |||||||| || || || |||||||| ||||||||||||||||| || || || || || 
Sbjct: 2476 ctcaccggagaatttcccggcgactacgggtgggacactgccggcctctcggcggatcca 2535

                                                                  
Query: 334  gagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
            |||||||| || || ||| | ||||||||||||||||| ||| |||||||||||
Sbjct: 2536 gagaccttcgcaaaaaacagagagctggaggtgatccactgcagatgggccatg 2589

---

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| ||||||||||||
Sbjct: 416 ccgagctaccttaccggagagttccccggagactacggatgggacaccgccggactttca 475

                         
Query: 325 gctgaccctgagac 338
           |||||||| |||||
Sbjct: 476 gctgaccccgagac 489

---

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||| ||||| |||||||| || ||||| ||||||||||| ||||| ||    || ||
Sbjct: 378 ctacctgaccggcgagttccccggagactacgggtgggacacggccgggctcagcgccga 437

                                                     
Query: 330 ccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           ||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 438 ccccgagaccttcgccaagaaccgcgagctggaggtgatcca 479

---

>gb|AF162200.1|AF162200 Lactuca sativa light-harvesting chlorophyll a/b binding protein
           mRNA, complete sequence; nuclear gene for chloroplast
           product
          Length = 643

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| ||||||| |||||| || ||||| || ||||||||||| || || || ||||| 
Sbjct: 33  tacctgaccggtgggttccccggtgactacggttgggacactgctgggctctctgctgat 92

                                                                       
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 390
           ||||| || || ||||||||||| ||||| ||||| |||||  || ||||||||||||||
Sbjct: 93  cctgaaacattcgccaagaaccgtgagcttgaggtcatccacagcagatgggccatgctc 152

             
Query: 391 gg 392
           ||
Sbjct: 153 gg 154

---

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| ||||| |||||||| |||||||| || ||||||||||| || || || || |||
Sbjct: 253 tacctgaccggagagttccccggcgactacggatgggacactgctgggctgtcggcggac 312

                                                                       
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 390
           || ||||| || |||| |||||| ||||||||||||||||| |   | ||||||||||||
Sbjct: 313 ccagagactttcgccaggaaccgtgagctggaggtgatccactcgaggtgggccatgctc 372

             
Query: 391 gg 392
           ||
Sbjct: 373 gg 374

---

>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein,
           complete cds
          Length = 895

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 75/86 (87%)
 Strand = Plus / Plus

                                                                       
Query: 304 tgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggag 363
           ||||||||||| ||||| ||||||||||| ||||| ||||| |  ||||| ||||| |||
Sbjct: 293 tgggacactgctggactctcagctgaccccgagacatttgctagaaaccgtgagcttgag 352

                                     
Query: 364 gtgatccattgccgatgggccatgct 389
           ||||| |||||||| |||||||||||
Sbjct: 353 gtgattcattgccgttgggccatgct 378

---

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 131/161 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| |||
Sbjct: 185 tcctctggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 244

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           |||||||||   ||| | || || |||||||| || ||||| || ||||||||||| |||
Sbjct: 245 gagcccccgtcttacttgactggagagttcccaggtgactacggttgggacactgctgga 304

                                                    
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagct 359
           ||||| |||||||| ||||| || ||||||||||| |||||
Sbjct: 305 ctttctgctgacccagagacattcgccaagaaccgtgagct 345

---

>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 763

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || |||||||||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 340

---

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| |||||||||||||| || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 340

---

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 274 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 333

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 334 acttttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 386

---

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 262 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 321

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || |||||||||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 322 acgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 374

---

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 259 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 318

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || |||||||||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 319 acgtttgccaagaacagagagctggaagtgatccacagccggtgggcaatgct 371

---

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 157 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 216

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||||
Sbjct: 217 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggcc 276

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 277 atgctcgg 284

---

>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 217 accggtgagttcccgggtgactacgggtgggacacwgcggggctttcggcggatccggag 276

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 277 acttttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 329

---

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 126/155 (81%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||| |||
Sbjct: 184 tcctcaggaagcccatggtacggcccagaccgtgttaagtacttaggcccattctctggt 243

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           |||||||||   ||| | || || |||||||| || ||||| || ||||||||||| |||
Sbjct: 244 gagcccccgtcttacttgactggagagttcccaggtgactacggatgggacactgctgga 303

                                              
Query: 319 ctttcagctgaccctgagacctttgccaagaaccg 353
           ||||| |||||||| ||||| || |||||||||||
Sbjct: 304 ctttctgctgacccagagacattcgccaagaaccg 338

---

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           |||||||| |||||||| || || || || || ||||||||||| || ||||| ||||| 
Sbjct: 228 tacctcactggtgagtttccaggtgattacggttgggacactgctggcctttctgctgat 287

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| || ||||||||||| ||||| |||||||| ||  || |||||||||||||
Sbjct: 288 cccgagacattcgccaagaaccgtgagcttgaggtgattcacagcagatgggccatgct 346

---

>gb|M16887.1|SIPCAB White campion chlorophyll a/b-binding protein precursor (CAB) mRNA,
           partial cds
          Length = 642

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| || ||||| ||||| || || || || ||||||||||| ||||| |||||||||
Sbjct: 226 taccttacaggtgaattccccggtgattacggttgggacactgctggactctcagctgac 285

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || || || || || |||||||| ||||| ||||||||||| ||| ||||||| |||||
Sbjct: 286 ccagaaacattcgctaagaaccgtgagctagaggtgatccactgcagatgggcaatgct 344

---

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 155/194 (79%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           |||||||| ||||||||||||||  | ||||| ||    ||| | |||||| |||| || 
Sbjct: 155 tcctccggaagcccatggtacggcccagaccgcgtcaagtacttgggcccattctctggc 214

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           |||||||||  ||||||||| || |||||||| || ||||| || ||||||||||| || 
Sbjct: 215 gagcccccgtcctacctcactggcgagttcccaggtgactacggctgggacactgctggg 274

                                                                       
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccga 378
           ||||| || ||||| || ||||| ||||  ||||  ||||| || |||||||| | | | 
Sbjct: 275 ctttcggccgacccagaaaccttcgccagaaaccctgagctcgaagtgatccactccagg 334

                         
Query: 379 tgggccatgctcgg 392
           ||||||||||||||
Sbjct: 335 tgggccatgctcgg 348

---

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 298 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 357

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 358 acttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 410

---

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| |||||||||||||| || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacactgcggggctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | ||  |||| |||||||| ||||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagaattggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 340

---

>emb|X74731.1|AHLHCB A.hypochondriacus Lhcb1*Ah1 mRNA
          Length = 699

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                       
Query: 307 gacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctggaggtg 366
           |||||||| ||||| |||||||||||||| || ||||| |||||||| ||| |||| |||
Sbjct: 1   gacactgctggactgtcagctgaccctgaaacttttgctaagaaccgtgagttggaagtg 60

                            
Query: 367 atccattgccgatgggc 383
           ||||| ||| |||||||
Sbjct: 61  atccactgcagatgggc 77

---

>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding
            protein
          Length = 2236

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 130/161 (80%)
 Strand = Plus / Plus

                                                                        
Query: 199  tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
            ||||| || ||||||||||||||  | ||||||||    ||| | |||||| ||||||||
Sbjct: 1449 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 1508

                                                                        
Query: 259  gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
            ||| | |||  |||| | || || |||||||| || ||||| || |||||||||||||||
Sbjct: 1509 gagtctccgtcctacttgactggagagttccccggtgactacggttgggacactgccgga 1568

                                                     
Query: 319  ctttcagctgaccctgagacctttgccaagaaccgggagct 359
            || || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 1569 ctctctgctgacccagagacattctccaagaaccgtgagct 1609

---

>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 79/93 (84%)
 Strand = Plus / Plus

                                                                       
Query: 295 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 354
           ||||| ||||||||||| ||||| || || || ||||| |||||||| ||||| ||  | 
Sbjct: 18  gactacgggtgggacaccgccgggctctcggccgaccccgagaccttcgccaaaaataga 77

                                            
Query: 355 gagctggaggtgatccattgccgatgggccatg 387
           ||||||||||||||||| ||| |||||||||||
Sbjct: 78  gagctggaggtgatccactgcagatgggccatg 110

---

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                        
Query: 277  accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
            |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 1376 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 1435

                                                                 
Query: 337  acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
            || ||||| |||||| | |||||||| ||||||||  |||| ||||| |||||
Sbjct: 1436 acttttgcgaagaacagagagctggaagtgatccacagccggtgggcaatgct 1488

---

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 283 accggtgagttccccggtgactacgggtgggacacggcggggctttcggcagatccagag 342

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           |  ||||| |||||| | |||||||| |||||||| ||||| ||||| |||||
Sbjct: 343 aattttgcgaagaacagagagctggaagtgatccactgccggtgggcaatgct 395

---

>gb|DQ275468.1| Arachis hypogaea clone PNDI 2 unknown mRNA
          Length = 454

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 77/89 (86%), Gaps = 1/89 (1%)
 Strand = Plus / Plus

                                                                       
Query: 244 ggcccactctccggtgagcccccgagctacctcaccggtgagttccctggcgactatggg 303
           |||||| |||||||||||||||||  ||||||||| ||||||||||| || |||||  | 
Sbjct: 265 ggcccattctccggtgagcccccgtcctacctcactggtgagttcccaggtgacta-cgc 323

                                        
Query: 304 tgggacactgccggactttcagctgaccc 332
           ||||||||||| || ||||| ||||||||
Sbjct: 324 tgggacactgctgggctttccgctgaccc 352

---

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 371

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 372 atgctcgg 379

---

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 199 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 258

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 259 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 318

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 319 atgctcgg 326

---

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 252 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 311

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 312 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 371

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 372 atgctcgg 379

---

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Plus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || |||||||| || |||||||||
Sbjct: 405 ccgagctaccttaccggagagttccccggagactacggatgggacaccgctggactttca 464

                                                                       
Query: 325 gctgaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggcc 384
           ||||| || ||||| || || | |||||| ||||| || || |||||  || | ||||| 
Sbjct: 465 gctgatcccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggct 524

                   
Query: 385 atgctcgg 392
           ||||||||
Sbjct: 525 atgctcgg 532

---

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||||| |||||||||| |||| || || || ||||||||||| ||||| ||| | ||
Sbjct: 249 ctacctcaacggtgagttcgctggtgattacggctgggacactgctggactctcatccga 308

                                                                       
Query: 330 ccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           ||| |||||||| |||   ||||| ||||| |||||||||||    ||||||||||||||
Sbjct: 309 ccccgagaccttcgcccgcaaccgcgagctcgaggtgatccacgctcgatgggccatgct 368



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 147 tggcgaggcccgagtcaccatgcgcaaga 175
           |||||| ||||| ||||||||||||||||
Sbjct: 132 tggcgaagcccgcgtcaccatgcgcaaga 160

---

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 186 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 245

                                  
Query: 319 ctttcagctgaccctgagacctt 341
           || || |||||||| ||||||||
Sbjct: 246 ctgtccgctgacccggagacctt 268

---

>emb|AJ000765.1|CRAJ765 Chlamydomonas reinhardtii mRNA for calreticulin
          Length = 2336

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 236 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggc 177

                                  
Query: 319 ctttcagctgaccctgagacctt 341
           || || |||||||| ||||||||
Sbjct: 176 ctgtccgctgacccggagacctt 154

---

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 184 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 243

                                  
Query: 319 ctttcagctgaccctgagacctt 341
           || || |||||||| ||||||||
Sbjct: 244 ctgtccgctgacccggagacctt 266

---

>gb|AF195221.1|AF195221 Pyrus pyrifolia strain Whangkeumbae chlorophyll a/b-binding protein
           (ChBP) mRNA, complete cds
          Length = 411

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| ||||| | ||||||||| ||||| || ||||||||||| || || ||||| |||
Sbjct: 33  tacctaaccggagggttccctggtgactacggatgggacactgctgggctatcagcagac 92

                                  
Query: 331 cctgagacctttgccaagaaccg 353
           || || |||||||||||||||||
Sbjct: 93  cccgaaacctttgccaagaaccg 115

---

>gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid protein (polypeptide
           15) mRNA, clone pAB96
          Length = 822

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           ||||| |||||||| || ||||| || ||||||||||| |||||||| || || || |||
Sbjct: 98  accggagagttcccaggtgactacggttgggacactgctggactttctgccgatccagag 157

                                  
Query: 337 acctttgccaagaaccgggagct 359
           || |||||||||||||| |||||
Sbjct: 158 acatttgccaagaaccgtgagct 180

---

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||||||||||||||||| || || |||||||| || ||||| || |||||||| ||||| 
Sbjct: 170 gagcccccgagctacctgactggcgagttccccggtgactacggctgggacaccgccggt 229

                                  
Query: 319 ctttcagctgaccctgagacctt 341
           || || |||||||| ||||||||
Sbjct: 230 ctgtccgctgacccggagacctt 252

---

>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 732

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 105/129 (81%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| || ||||| ||||| || || ||||| ||||||||||| ||  | || || || 
Sbjct: 136 taccttactggtgaattccccggtgattatggatgggacactgctggtttatctgcagat 195

                                                                       
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgctc 390
           ||||| || |||||||||||||| ||||| || |||||||| ||| ||||||| ||||| 
Sbjct: 196 cctgaaacatttgccaagaaccgtgagcttgaagtgatccactgcagatgggctatgctt 255

                    
Query: 391 ggngcactt 399
           || ||||||
Sbjct: 256 ggtgcactt 264

---

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||| ||||| |||||||| || ||||| || ||||||||||| || || || |||||
Sbjct: 203 ctacctgaccggcgagttccccggtgactacggctgggacactgctggtctgtccgctga 262

                                                     
Query: 330 ccctgagacctttgccaagaaccgggagctggaggtgatcca 371
           ||| ||||||||    ||| |||| |||||||||||||||||
Sbjct: 263 ccccgagaccttcaagaagtaccgtgagctggaggtgatcca 304

---

>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 94/114 (82%)
 Strand = Plus / Plus

                                                                       
Query: 274 ctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccct 333
           |||||||| || || || |||||||| ||||||||||||||||   | || || || || 
Sbjct: 257 ctcaccggagaatttcccggcgactacgggtgggacactgccgccgtctcggcggatcca 316

                                                                 
Query: 334 gagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           |||||||| || || ||| | ||||||||||||||||| ||| |||||||||||
Sbjct: 317 gagaccttcgcaaaaaacagagagctggaggtgatccactgcagatgggccatg 370

---

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                       
Query: 226 gaccgtgtgctctacctcggcccactctccggtgagcccccgagctacctcaccggtgag 285
           ||||||||||| ||  | || ||| ||||||| ||||| |||   ||||| |||||||| 
Sbjct: 197 gaccgtgtgctgtatttgggtccattctccggggagccaccgtcgtacctaaccggtgaa 256

                                                                       
Query: 286 ttccctggcgactatgggtgggacactgccggactttcagctgaccctgagacctttgcc 345
           ||||| || ||||| ||||||||||| || || || || || || || ||||| || || 
Sbjct: 257 ttcccgggtgactacgggtgggacacggcggggctgtcggcagatccggagacgttcgcg 316

                                                     
Query: 346 aagaaccgggagctggaggtgatccattgccgatgggccatg 387
           |||||| | |||||||| ||||||||  ||||||||||||||
Sbjct: 317 aagaacagagagctggaagtgatccacggccgatgggccatg 358

---

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                       
Query: 283 gagttccctggcgactatgggtgggacactgccggactttcagctgaccctgagaccttt 342
           |||||||| |||||||||||||||||||| || || || || || ||||| ||| | || 
Sbjct: 274 gagttcccgggcgactatgggtgggacacggcggggctctccgcggacccggaggcgttc 333

                                                             
Query: 343 gccaagaaccgggagctggaggtgatccattgccgatgggccatgctcgg 392
           || | |||| ||| |||||||||||||||  |||| ||||| ||||||||
Sbjct: 334 gcgaggaacagggcgctggaggtgatccacggccggtgggcgatgctcgg 383

---

>gb|M64619.1|PEACAB66 Pea cab gene, complete cds
          Length = 1666

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                        
Query: 198  ttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccgg 257
            |||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||||||
Sbjct: 850  ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 909

                                                                        
Query: 258  tgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgg 317
            |||| | ||   |||| | || || |||||||| || ||||| || ||||||||||||||
Sbjct: 910  tgagtctccatcctacttgacaggagagttccccggtgactacggttgggacactgccgg 969

                                                      
Query: 318  actttcagctgaccctgagacctttgccaagaaccgggagct 359
            ||| || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 970  actctctgctgacccagagacattctccaagaaccgtgagct 1011

---

>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll
            a/b-binding protein (polypeptide 15) complex precursor,
            complete coding sequence
          Length = 1993

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 130/162 (80%)
 Strand = Plus / Plus

                                                                        
Query: 198  ttcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccgg 257
            |||||| || ||||||||||||||  | ||||||||    ||| | |||||| |||||||
Sbjct: 1151 ttcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccgg 1210

                                                                        
Query: 258  tgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgg 317
            |||| | ||   |||| | || || |||||||| || ||||| || ||||||||||||||
Sbjct: 1211 tgagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgg 1270

                                                      
Query: 318  actttcagctgaccctgagacctttgccaagaaccgggagct 359
            ||| || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 1271 actctctgctgacccagagacattctccaagaaccgtgagct 1312

---

>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb1 mRNA, complete cds
          Length = 801

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 129/161 (80%)
 Strand = Plus / Plus

                                                                       
Query: 199 tcctccggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggt 258
           ||||| || ||||||||||||||  | ||||||||    ||| | |||||| ||||||||
Sbjct: 133 tcctctggaagcccatggtacggaccagaccgtgttaagtacttaggcccattctccggt 192

                                                                       
Query: 259 gagcccccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccgga 318
           ||| | ||   |||| | || || |||||||| || ||||| || |||||||||||||||
Sbjct: 193 gagtctccatcctacttgactggagagttccccggtgactacggttgggacactgccgga 252

                                                    
Query: 319 ctttcagctgaccctgagacctttgccaagaaccgggagct 359
           || || |||||||| ||||| ||  |||||||||| |||||
Sbjct: 253 ctctctgctgacccagagacattctccaagaaccgtgagct 293

---

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                
Query: 388 ctcgg 392
           |||||
Sbjct: 389 ctcgg 393

---

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                         
Query: 271   tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
             ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 79568 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 79509

                                                      
Query: 331   cctgagacctttgccaagaaccgggagctggaggtgatcca 371
             || ||||| || || | |||| |||||||||||||||||||
Sbjct: 79508 ccggagacgttcgcgaggaacagggagctggaggtgatcca 79468

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                            
Query: 271      tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
                ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 21808248 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21808307

                                                         
Query: 331      cctgagacctttgccaagaaccgggagctggaggtgatcca 371
                || ||||| || || | |||| |||||||||||||||||||
Sbjct: 21808308 ccggagacgttcgcgaggaacagggagctggaggtgatcca 21808348



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 205      ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
                |||| ||||||||||||  ||||||| ||  |||||||| |||| ||||| ||||||
Sbjct: 18189193 ggcaacccatggtacggccccgaccgcgtcatctacctccgcccgctctctggtgag 18189137

---

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                
Query: 388 ctcgg 392
           |||||
Sbjct: 375 ctcgg 379

---

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 255 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 314

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 315 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 374

                
Query: 388 ctcgg 392
           |||||
Sbjct: 375 ctcgg 379

---

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| |||||||| || || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggatacggcgggcctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| |||||||| ||||| ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccactgccggtgggcaatgct 340

---

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

---

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

---

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

---

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcagatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

---

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Plus

                                                                       
Query: 277 accggtgagttccctggcgactatgggtgggacactgccggactttcagctgaccctgag 336
           |||||||||||||| || ||||| ||||||||||| || || ||||| || || || |||
Sbjct: 228 accggtgagttcccgggtgactacgggtgggacacggcggggctttcggcggatccggag 287

                                                                
Query: 337 acctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| |||||| | || ||||| ||||||||  |||| ||||| |||||
Sbjct: 288 acatttgcgaagaacagagaactggaagtgatccacagccggtgggcaatgct 340

---

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                
Query: 388 ctcgg 392
           |||||
Sbjct: 322 ctcgg 326

---

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                
Query: 388 ctcgg 392
           |||||
Sbjct: 374 ctcgg 378

---

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 202 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 261

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 262 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 321

                
Query: 388 ctcgg 392
           |||||
Sbjct: 322 ctcgg 326

---

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 248 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 307

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 308 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 367

                
Query: 388 ctcgg 392
           |||||
Sbjct: 368 ctcgg 372

---

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 254 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 313

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 314 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 373

                
Query: 388 ctcgg 392
           |||||
Sbjct: 374 ctcgg 378

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                            
Query: 271      tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
                ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 21801277 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 21801336

                                                         
Query: 331      cctgagacctttgccaagaaccgggagctggaggtgatcca 371
                || ||||| || || | |||| |||||||||||||||||||
Sbjct: 21801337 ccggagacgttcgcgaggaacagggagctggaggtgatcca 21801377



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                         
Query: 205      ggcagcccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgag 261
                |||| ||||||||||||  ||||||| ||  |||||||| |||| ||||| ||||||
Sbjct: 18182734 ggcaacccatggtacggccccgaccgcgtcatctacctccgcccgctctctggtgag 18182678

---

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 240 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 299

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 300 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 359

                
Query: 388 ctcgg 392
           |||||
Sbjct: 360 ctcgg 364

---

>emb|BX841915.1|CNS09Y31 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL40ZF08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 907

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 265 ccgagctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttca 324
           ||||||||||| ||||| |||||||| || ||||| || ||||||||||| | |||||||
Sbjct: 677 ccgagctaccttaccggagagttccccggagactacggatgggacactgctgtactttca 618

                
Query: 325 gctga 329
           |||||
Sbjct: 617 gctga 613

---

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 269 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 328

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 329 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 388

                
Query: 388 ctcgg 392
           |||||
Sbjct: 389 ctcgg 393

---

>emb|X61608.1|BNLHCB3A B.napus gene for LHCII Type III chlorophyll a/b-binding protein,
            partial
          Length = 2036

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                        
Query: 271  tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
            ||||||||||| ||||| || ||||||||||| |||||||| |||||  | || || |||
Sbjct: 1568 tacctcaccggagagtttcccggcgactatggttgggacaccgccggtttatccgcagac 1627

                                 
Query: 331  cctgagacctttgccaagaac 351
            |||||  ||||||||||||||
Sbjct: 1628 cctgaagcctttgccaagaac 1648

---

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 102/125 (81%)
 Strand = Plus / Plus

                                                                       
Query: 268 agctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagct 327
           |||||||| ||||| ||||||||||| ||||| || |||||||| || || || || |||
Sbjct: 347 agctaccttaccggagagttccctggagactacggatgggacacagctggtctatccgct 406

                                                                       
Query: 328 gaccctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatg 387
           ||||| ||||| || || | |||||| ||||| || || |||||  || | |||||||||
Sbjct: 407 gaccccgagacattcgcaaggaaccgtgagctagaagttatccacagcaggtgggccatg 466

                
Query: 388 ctcgg 392
           |||||
Sbjct: 467 ctcgg 471

---

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| ||||| |||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 236 tacctgaccggagagttcccgggagactacgggtgggacacggcggggctatcggccgac 295

                                                    
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatcca 371
           || ||||| || || | |||| |||||||||||||||||||
Sbjct: 296 ccggagacgttcgcgaggaacagggagctggaggtgatcca 336

---

>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb2) mRNA, partial cds
          Length = 873

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 78/93 (83%)
 Strand = Plus / Plus

                                                                       
Query: 295 gactatgggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgg 354
           ||||| ||||||||||| ||||| || || || || || |||||||| ||||| ||| | 
Sbjct: 169 gactacgggtgggacacagccgggctctctgccgatcccgagaccttcgccaaaaacaga 228

                                            
Query: 355 gagctggaggtgatccattgccgatgggccatg 387
           ||||||||||||||||| | | |||||||||||
Sbjct: 229 gagctggaggtgatccactccagatgggccatg 261

---

>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll
           a/b-binding protein of photosystem II, complete cds
          Length = 935

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 95/113 (84%), Gaps = 2/113 (1%)
 Strand = Plus / Plus

                                                                       
Query: 251 tctccggtgagcccccgagctacctcaccggtgagttccctggcgactatgggtgggaca 310
           |||| |||||||||||   |||||| |||||||| ||||| || ||||| ||||||||||
Sbjct: 196 tctctggtgagcccccatcctacctgaccggtgaattccc-ggtgactacgggtgggaca 254

                                                                
Query: 311 ctgccggactttcagct-gaccctgagacctttgccaagaaccgggagctgga 362
           | ||||| || |||||  ||||| ||||| |||||||||||| | ||||||||
Sbjct: 255 ccgccggtctgtcagccagacccagagacttttgccaagaacagagagctgga 307

---

>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m9 (Lhcbm9) mRNA, complete cds
          Length = 1221

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||| || || |||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 196 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 255

                       
Query: 330 ccctgagacctt 341
           ||| ||||||||
Sbjct: 256 cccggagacctt 267

---

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 62/72 (86%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||| || || |||||||| |||||||| || |||||||||||||| || || |||||
Sbjct: 201 ctacctgactggcgagttccccggcgactacggctgggacactgccggtctgtcggctga 260

                       
Query: 330 ccctgagacctt 341
           ||| ||||||||
Sbjct: 261 cccggagacctt 272

---

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||||| ||||| || ||||| ||||||||||| || || ||||| || || 
Sbjct: 303 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctttcggcggat 362

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| || || |||||| | |||||||| |||||||| | ||| ||||| |||||
Sbjct: 363 ccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgct 421

---

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| ||||| |||||||| |||||||| |||||||| || |||||  | || || |||
Sbjct: 232 tacctgaccggcgagttccccggcgactacgggtgggagaccgccggcgtctcggccgac 291

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| || ||    ||||||||||||||||||||||| | ||| ||||| |||||
Sbjct: 292 ccggagacattcgcgcgcaaccgggagctggaggtgatccactcccggtgggcgatgct 350

---

>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding
           protein of photosystem II
          Length = 772

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                       
Query: 301 gggtgggacactgccggactttcagctgaccctgagacctttgccaagaaccgggagctg 360
           ||||||||||| |||||||| || || ||||| |||||||| ||||| ||  | ||||||
Sbjct: 141 gggtgggacaccgccggactctcggccgacccagagaccttcgccaaaaatagagagctg 200

                      
Query: 361 gaggtgatcca 371
           |||||||||||
Sbjct: 201 gaggtgatcca 211

---

>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein
          Length = 1083

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 142/179 (79%)
 Strand = Plus / Plus

                                                                       
Query: 211 ccatggtacggtgccgaccgtgtgctctacctcggcccactctccggtgagcccccgagc 270
           |||||||||||  | ||||||||||| ||  | || ||| ||||||| ||||| |||   
Sbjct: 236 ccatggtacggaccggaccgtgtgctgtatttgggtccattctccggcgagccgccgtca 295

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||||| ||||| || ||||| ||||||||||| || || || || || || 
Sbjct: 296 tacctgaccggtgaattccccggtgactacgggtgggacacggcggggctgtcggcggat 355

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| || || |||||| | |||||||| |||||||| | ||| ||||| |||||
Sbjct: 356 ccggagacgttcgcgaagaacagagagctggaagtgatccactcccggtgggcgatgct 414

---

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 97/119 (81%)
 Strand = Plus / Plus

                                                                       
Query: 271 tacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctgac 330
           ||||| |||||  ||||||| || ||||| ||||||||||| || || || || || |||
Sbjct: 243 tacctgaccggaaagttcccgggagactacgggtgggacacggcggggctatcggccgac 302

                                                                      
Query: 331 cctgagacctttgccaagaaccgggagctggaggtgatccattgccgatgggccatgct 389
           || ||||| || || | |||| ||||||||||||||||||| | ||| ||||| |||||
Sbjct: 303 ccggagacgttcgcgaggaacagggagctggaggtgatccactcccggtgggcaatgct 361

---

>gb|AY845254.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein
           Lhcb2 mRNA, complete cds
          Length = 798

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                       
Query: 270 ctacctcaccggtgagttccctggcgactatgggtgggacactgccggactttcagctga 329
           |||||| || ||||| || ||||| |||||||| |||||||| || ||| | ||||||||
Sbjct: 201 ctacctgactggtgaatttcctggtgactatggatgggacacagctggattatcagctga 260

                                         
Query: 330 ccctgagacctttgccaagaaccgggagct 359
           |||||| || ||||| | |||||| |||||
Sbjct: 261 ccctgaaacatttgcaaggaaccgtgagct 290


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,780,629
Number of Sequences: 3902068
Number of extensions: 2780629
Number of successful extensions: 52430
Number of sequences better than 10.0: 337
Number of HSP's better than 10.0 without gapping: 339
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 51619
Number of HSP's gapped (non-prelim): 717
length of query: 399
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 377
effective length of database: 17,147,199,772
effective search space: 6464494314044
effective search space used: 6464494314044
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---