>gb|M95500.1|WHTWIR1APR Wheat WIR1A gene, complete cds
          Length = 842

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 94  ggtgctcctccagatcgctctcttcgtc 121
           ||||||||| ||||||||||||||||||
Sbjct: 200 ggtgctcctgcagatcgctctcttcgtc 227

>gb|AC155651.4| Mus musculus 6 BAC RP24-111E13 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 175599

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 358   gcatggctctgtcttgttcgca 379
             ||||||||||||||||||||||
Sbjct: 50266 gcatggctctgtcttgttcgca 50287

>gb|AC158664.5| Mus musculus 6 BAC RP23-24F17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 232894

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 358    gcatggctctgtcttgttcgca 379
              ||||||||||||||||||||||
Sbjct: 216757 gcatggctctgtcttgttcgca 216736

>gb|AC025035.15| Homo sapiens 12 BAC RP11-121E16 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 165440

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 28     agtaacaaaccacagcccaaa 48
              |||||||||||||||||||||
Sbjct: 136779 agtaacaaaccacagcccaaa 136759

>gb|AY664414.1| Zea mays cultivar B73 locus 9008, complete sequence
          Length = 339089

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 301   gcgcccgcagaccccgcctcc 321
             |||||||||||||||||||||
Sbjct: 89455 gcgcccgcagaccccgcctcc 89435

>ref|XM_547974.2| PREDICTED: Canis familiaris similar to CG32732-PA (LOC490852), mRNA
          Length = 2695

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 168  caggactcggtggtggtgctctgg 191
            ||||||| ||||||||||||||||
Sbjct: 2164 caggactgggtggtggtgctctgg 2187

>emb|BX572600.1| Rhodopseudomonas palustris CGA009 complete genome; segment 8/16
          Length = 349640

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 167    ccaggactcggtggtggtgc 186
              ||||||||||||||||||||
Sbjct: 236077 ccaggactcggtggtggtgc 236096

>emb|AJ431203.1|NTO431203 Nicotiana tomentosiformis endogenous pararetrovirus partial
           proviral ORF3 & ORF4 pseudogenes
          Length = 1928

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 393 tcaggatcttatactgaacc 412
           ||||||||||||||||||||
Sbjct: 601 tcaggatcttatactgaacc 620


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,589,319
Number of Sequences: 3902068
Number of extensions: 2589319
Number of successful extensions: 51467
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51456
Number of HSP's gapped (non-prelim): 11
length of query: 451
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 429
effective length of database: 17,147,199,772
effective search space: 7356148702188
effective search space used: 7356148702188
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)